WO2023112048A1 - Crispr-dcas13 system, composition, and method to induce translational readthrough across stop codons - Google Patents

Crispr-dcas13 system, composition, and method to induce translational readthrough across stop codons Download PDF

Info

Publication number
WO2023112048A1
WO2023112048A1 PCT/IN2022/051066 IN2022051066W WO2023112048A1 WO 2023112048 A1 WO2023112048 A1 WO 2023112048A1 IN 2022051066 W IN2022051066 W IN 2022051066W WO 2023112048 A1 WO2023112048 A1 WO 2023112048A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
promoter
stop codon
protein
polynucleotide
Prior art date
Application number
PCT/IN2022/051066
Other languages
French (fr)
Inventor
Sandeep Muthanegere ESWARAPPA
Lekha E Manjunath
Original Assignee
Indian Institute Of Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Indian Institute Of Science filed Critical Indian Institute Of Science
Publication of WO2023112048A1 publication Critical patent/WO2023112048A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795—Porphyrin- or corrin-ring-containing peptides
    • C07K14/805—Haemoglobins; Myoglobins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present disclosure broadly relates to the field of molecular biology and particularly refers to the recombinant expression vector, compositions and method for inducing translational readthrough across stop codon (canonical stop codon or pre-mature stop codon).
  • transcript-specific induction of SCR has therapeutic benefits in treating genetic diseases caused by nonsense mutations.
  • diseases arising from nonsense mutations include P-thalassemia, Duchenne muscular dystrophy, cystic fibrosis, Hemophilia A and B.
  • the conventional strategies to promote translational readthrough includes the use of antibiotics such as, aminoglycosides and macrolides and molecules such as, PTC 124 (Ataluren), 2,6-diaminopurine, and clitocine have been used to promote readthrough.
  • antibiotics such as, aminoglycosides and macrolides and molecules such as, PTC 124 (Ataluren), 2,6-diaminopurine, and clitocine have been used to promote readthrough.
  • PTC 124 Totaluren
  • 2,6-diaminopurine 2,6-diaminopurine
  • clitocine clitocine
  • a guide polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 30.
  • Figure 2(A) depicts the sequence of the proximal 3'UTR of VEGFA. The region targeted by the guide RNA is shown in blue. The canonical stop codon (TGA) is shown in red.
  • Figure 2(B) depicts the results of western blot showing the effect of CRISPR-dCasl3a system on SCR of VEGFA. HEK293 cells were transfected with indicated constructs and the levels of VEGF-Ax (SCR product) in the conditioned medium were analysed by Western blot. RT-PCR result shows the expression of VEGFA mRNA (bottom panels).
  • Figure 3(A) depicts the sequence of the proximal coding sequence of HBB.
  • the region targeted by the guide RNA is shown in blue.
  • the start codon (ATG) is shown in green and the premature stop codon (TAG) is shown in red.
  • Figure 3(B) depicts HEK293 cells that were transfected with indicated constructs. The full-length GFP-tagged P -globin was detected by Western blot. HBB-GFP mRNA level detected by RT-PCR is also shown. Results are representatives of three independent experiments.
  • Figure 3(C) depicts a schematic representation showing the induction of SCR across the thalassemia-causing premature stop codon of HBB by CRISPR- dCasl3a system to generate full-length P-globin protein, in accordance with an embodiment of the present disclosure.
  • Figure 4(A) depicts the RT-PCR analysis showing the expression of Casl3a- HA and dCasl3a in transfected cells.
  • Figure 4(B) depicts western blot showing the expression of HA-tagged Casl3a in transfected cells, in accordance with an embodiment of the present disclosure.
  • Figure 8 depicts the vector map of pC015-dLwCasl3a-NF, in accordance with an embodiment of the present disclosure.
  • Figure 9 depicts the vector map of pC016-LwCasl3a guide expression backbone (with U6 promoter), in accordance with an embodiment of the present disclosure.
  • SEQ ID NO: 5 depicts the nucleotide sequence encoding dCasl3a protein
  • SEQ ID NO: 7 depicts the nucleotide sequence of DNA encoding MTCH2 mRNA
  • SEQ ID NO: 8 depicts the nucleotide sequence of DNA encoding VEGFA mRNA
  • SEQ ID NO: 9 depicts the nucleotide sequence of DNA encoding HBB mRNA
  • SEQ ID NO: 10 depicts the nucleotide sequence of DNA encoding guide
  • SEQ ID NO: 11 depicts the nucleotide sequence of DNA encoding guide
  • SEQ ID NO: 13 depicts the nucleotide sequence of DNA encoding guide
  • SEQ ID NO: 15 depicts the nucleotide sequence of DNA encoding guide RNA targeting MTCH2 mRNA
  • SEQ ID NO: 16 depicts the nucleotide sequence of DNA encoding guide
  • SEQ ID NO: 17 depicts the nucleotide sequence of DNA encoding guide
  • SEQ ID NO: 21 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
  • SEQ ID NO: 22 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
  • SEQ ID NO: 25 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
  • SEQ ID NO: 32 depicts the amino acid sequence of Ago lx protein
  • SEQ ID NO: 33 depicts the amino acid sequence of a single readthrough MTCH2x protein
  • SEQ ID NO: 35 depicts the amino acid sequence of VEGF-Ax protein
  • SEQ ID NO: 36 depicts the amino acid sequence of P -globin protein
  • SEQ ID NO: 38 depicts the nucleotide sequence of single guide RNA targeting A GO1 mRNA
  • SEQ ID NO: 39 depicts the nucleotide sequence of single guide RNA targeting A GO1 mRNA
  • SEQ ID NO: 44 depicts the nucleotide sequence of ACTB (P-Actin) primer
  • SEQ ID NO: 46 depicts the nucleotide sequence of GFP primer
  • guide polynucleotide relates to a polynucleotide sequence encoding the guide RNA, wherein the guide RNA forms a complex with a dCasl3 protein and recruits the dCasl3 protein proximally downstream of the stop codon (canonical or premature stop codon) of the target sequence.
  • the guide polynucleotide is a DNA encoding guide RNA wherein the polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides.
  • a recombinant expression vector as described herein wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter.
  • the promoter is U6 promoter.
  • the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3b protein having a nucleotide sequence as set forth in SEQ ID NO: 31, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3b complex comprising the dCasl3b protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dC
  • a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein comprising: (a) obtaining a human cell comprising a AGO1 target polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, complementary to a region downstream of canonical stop codon of the AGO1 target polynucleotide sequence as set forth in SEQ NO: 6, operably linked to a promoter; and
  • VEGF-A Vascular endothelial growth factor
  • a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Mitochondrial carrier homolog 2 protein- (MTCH2) comprising: (a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ NO: 7, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19, complementary to a region downstream of canonical stop codon of MTCH2 target polynucleotide sequence as set forth in SEQ ID NO: 7, operably linked to a promoter; and (
  • a method of inducing translational readthrough as described herein wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3 protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, , EF- laand CAG promoter, and wherein the dCasl3 protein is either a dCasl3a protein encoded by a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 5, or dCasl3b protein encoded by a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 31.
  • compositions as described herein wherein the composition is delivered by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers, to a subject for treating a disease.
  • AAV Adeno associated virus
  • compositions as described herein wherein the composition is delivered by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers, to a subject for treating a disease, wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis.
  • AAV Adeno associated virus
  • a method of treating a disease in a subject in a need thereof as described herein wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis.
  • a method of treating a disease in a subject in a need thereof as described herein wherein administering is done by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers.
  • AAV Adeno associated virus
  • composition as described herein for inducing translational readthrough across canonical stop codon or the pre-mature stop codon of the target sequence.
  • a guide polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
  • the guide RNA is capable of hybridizing to the target sequence in transcript- selective and selective manner.
  • the guide RNA is capable of hybridizing to the target sequence in transcript- selective and selective manner, and wherein the guide RNA is encoded by the guide polynucleotide.
  • HEK293 cells (source: ATCC) were cultured using Dulbecco’s Modified Eagle’s Medium (DMEM, HiMedia), which was supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% antibiotics (10000 U/ml penicillin, 10000 pg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
  • DMEM Dulbecco’s Modified Eagle’s Medium
  • FBS fetal bovine serum
  • antibiotics 10000 U/ml penicillin, 10000 pg/ml streptomycin, Lonza
  • the reporter (Luciferase/GFP) constructs in pcDNA3.1B vector background) used for stop codon readthrough (SCR) assays for target mRNA: AGO1, VEGFA, MTCH2 and HBB (as disclosed in Eswarappa et al., 2014, Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax. Cell, 757(7):1605-18; Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in P-Globin-Encoding mRNA. Biochemistry, 59(1), 80-84; Singh et al., 2019 Let-7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor .
  • pC014-LwCasl3a-msfGFP plasmid expressing active Casl3a (as shown in Figure 10)
  • pC015-dLwCasl3a-NF (as shown in Figure 8)
  • pC016-LwCasl3a guide expression backbone (with U6 promoter) (as shown in Figure 9)
  • Feng Zhang Additionalgene plasmid # 91902, # 91905 and # 91906
  • Abudayyeh O., Gootenberg, J., Essletzbichler, P. et al. RNA targeting with CRISPR- Casl3.
  • the non-targeting guide RNA used for the comparative purpose has a sequence as set forth in SEQ ID NO: 37
  • the recombinant expression vector (CRISPR-dCasl3 system) of the present disclosure includes both the Casl3 or dCasl3 protein present in one expression vector along with the guide RNA cloned in pC016, another expression vector.
  • the expression of both the Cas protein and the CRISPR guide RNA comprises the recombinant expression vector or CRISPR-Casl3 system.
  • sgRNAs (sequences given below) were cloned in pSpCas9 (BB)-2A-Puro plasmid.
  • HEK293 cells were transfected with the following plasmids (two per gene) using Lipofectamine 2000 (Thermo Fisher Scientific): (a) pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with AGO1 sgRNA 1 (SEQ ID NO: 38) and pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with AGO1 sgRNA 2 (SEQ ID NO: 39); or (b) pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with VEGFA sgRNA 1 (SEQ ID NO: 40) and pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with VEGFA sgRNA 2 (SEQ ID NO: 41).
  • transfected cells were selected using 2 pg/ml of puromycin (Sigma) for 5 days. The surviving cells were reseeded in a 96-well plate at a density of single cell per well. These clones were expanded and screened for the required genetic deletion by PCR (polymerase chain reaction). The deletion was confirmed by sequencing of the PCR product and by Western blot.
  • the sgRNA sequences (5' to 3') are provided below:
  • VEGFA ACAAGCCGAGGCGGTGAGCC (SEQ ID NO: 40) and GGAAAGACTGATACAGAACG (SEQ ID NO: 41)
  • HEK293 cells were seeded in 24-well plates at 70%-80% confluency. 200ng/well of firefly luciferase-encoding reporter plasmids as disclosed in Eswarappa et al., 2014, Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax. Cell, 757(7): 1605-18; Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in P-Globin- Encoding mRNA. Biochemistry, 59(1), 80-84; Singh et al., 2019 Let-7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor .
  • Firefly and Renilla luciferase activities were measured using Dual-Luciferase Reporter Assay System (Promega) using GloMax Explorer (Promega) 24 hours post-transfection in case of samples involving VEGFA, MTCH2 and HBB, and 48 hours post-transfection in case of AGO1.
  • Anti- Agol antibody Novus Biologicals, NB 100-2817
  • Anti-GFP antibody BioLegend, 902602
  • Anti- VEGFA antibody Thermo Fisher Scientific, JH121
  • anti-GAPDH antibody Sigma, G9295
  • anti-HA antibody Sigma, 11867423001
  • anti- Actin antibody Sigma, A3854
  • horseradish-peroxidase-conjugated secondary antibodies were used as per the manufacturer’s instructions.
  • HEK293 cells were seeded in 6-well plates at 70%-80% confluency.
  • 2 pg/well of LwCasl3a-NF or 3 pg/well of dLwCasl3a-NF along with 2 pg/well of guide RNA (gene- specific or non-targeting) were transfected using Lipofectamine 2000.
  • 500 ng/well of the GFP-encoding construct HBB wl6 *-GFP
  • Cell pellets were lysed in cell lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton-X with protease inhibitor cocktail (Promega)) and subjected to Western blotting. Protein Assay Dye Reagent (Bio-Rad Laboratories) was used to determine the protein concentration. 50-100 pg of the cell lysate was subjected to denaturing SDS-PAGE in an 8% or 10% or 12.5% or 15% Tris-glycine gel. After the transfer of proteins onto a PVDF membrane (Merck), blocking was carried out (5% skimmed milk in PBS).
  • RNA isolation was carried out using RNAiso Plus (TaKaRa).
  • cDNA synthesis was carried out with 1 pg of RNA using oligo(dT) primers or gene-specific reverse primer and RevertAid Reverse Transcriptase (Thermo Fisher Scientific). Semi-quantitative analysis of the mRNA levels was carried out using gene-specific primers.
  • FLuc CAACTGCATAAGGCTATGAAGAGA (SEQ ID NO: 42); ATTTGTATTCAGCCCATATCGTTT (SEQ ID NO: 43)
  • ACTB (p-Actin): AGAGCTACGAGCTGCCTGAC (SEQ ID NO: 44); AGCACTGTGTTGGCGTACAG (SEQ ID NO: 45)
  • GFP- ATGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 46); CTTGTACAGCTCGTCCATGCCGAG (SEQ ID NO: 47)
  • AGO1 GGGAGCCACATATCGGGGCAG (SEQ ID NO: 48); CTACCCCACCTCCCTCCTCCTTG (SEQ ID NO: 49)
  • 18s rRNA GGCCCTGTAATTGGAATGAGTC (SEQ ID NO: 50); CCAAGATCCAACTACGAGCTT (SEQ ID NO: 51) [00193] VEGFA: CTTGCCTTGCTGCTCTACC (SEQ ID NO: 52);
  • target AGO1 mRNA encodes Argonaute 1 (Agol) protein.
  • Agol is important for microRN A -mediated repression of gene expression.
  • AGO1 undergo SCR across its canonical stop codon resulting in a longer isoform called Agolx.
  • Ago lx cannot repress the expression of target transcripts and serves as an inhibitor of the microRNA pathway when its expression is increased (Singh et al., 2019 Let- 7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 3S(16), 1-20).
  • Agolx inhibits dsRNA-induced interferon signaling and promotes cell proliferation (Ghosh et al., 2020 Prevention of dsRNA-induced interferon signaling by AGO lx is linked to breast cancer cell proliferation. EMBO J. 39, el03922.
  • AGO1 guide RNA was designed (SEQ ID NO: 1), which guides Casl3a or dCasl3a to the region downstream of the canonical stop codon of AGO1 mRNA (NM_001317122.2; SEQ ID NO: 6).
  • the canonical stop codon (TGA) and the region targeted by the AGO1 guide RNA are indicated in red and blue color, respectively, in Figure 1A.
  • the recombinant expression vector (hereinafter referred to as CRISPR-Casl3a system) comprising: (a) the guide polynucleotide complementary to a region downstream of AGO1 mRNA target sequence (SEQ ID NO: 6), operably linked to U6 promoter, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 1; and (b) a polynucleotide encoding dCasl3a protein encoded by a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to at least one promoter selected from CMV promoter, SV40 promoter, and chicken P-actin promoter, was obtained following the method as described in Example 1.2
  • the recombinant expression vector expressing dCasl3a and the guide RNA were transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produce guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA.
  • Figure 4 depicts the expression of Cas proteins (dCasl3a/Casl3a in transfected cells). The expression of dCasl3a/Casl3a in transfected cells was confirmed by RT-PCR (as shown in Figure 4 A) and/or Western blot (as shown in Figure 4B).
  • Figure IB depicts the result of western blot showing the effect of recombinant expression vector (CRISPR-dCasl3a system) on stop codon readthrough (SCR) of AGO1 in HEK293 cells.
  • HEK293 cells transfected with the recombinant expression vector comprising AGG7-3'UTR-targeting guide RNA (SEQ ID NO: 1) and dCasl3a showed about 3-fold increase in the expression of a readthrough protein, Ago lx protein (SEQ ID NO: 32), as compared to cells those transfected with a non-targeting guide RNA (SEQ ID NO: 37), wherein the nontargeting guide RNA does not target any transcript in mammalian cells.
  • Figure ID shows that there was a reduction in the expression levels of Ago lx protein in cells transfected with AGO1 -3 'UTR-targeting guide RNA along with Casl3a, which is catalytically active.
  • a part of the AGO1 coding sequence and the proximal part of its 3'UTR (shown in Figure 1A) were cloned upstream of and in-frame with the firefly luciferase (FLuc) coding sequence.
  • This luciferase construct was transfected in HEK293 cells along with the recombinant expression vector of the present disclosure expressing dCasl3a protein and the guide RNA (SEQ ID NO: 1).
  • the luminescence was further enhanced in cells expressing both dCasl3a and AGO1 -3 'UTR-targeting guide RNA (SEQ ID NO: 1) as compared to those cells expressing the non-targeting guide RNA (SEQ ID NO: 37) (as shown in 3 rd and 4 th bar of Figure IF). Since luminescence is an indicator of SCR, the luminescencebased readthrough assay shows that dCasl3a along with A GCU-3 UTR-targeting guide RNA enhances the SCR across the canonical stop codon of AGO1.
  • the present example also discloses the use of guide RNA (SEQ ID NO: 1) to recruit Casl3b or dPguCasl3b protein to the region downstream of the canonical stop codon of AGO1 mRNA (a region indicated with blue color in Figure 1A).
  • SEQ ID NO: 1 guide RNA
  • a recombinant expression vector comprising: (a) the guide polynucleotide complementary to a region downstream of AGO1 mRNA target sequence (SEQ ID NO: 6), operably linked to U6 promoter, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 1; and (b) a polynucleotide encoding dPguCasl3b protein encoded by a nucleotide sequence as set forth in SEQ ID NO: 31, operably linked to EF-la, was obtained.
  • the recombinant expression vector expressing dPguCasl3b protein and the guide RNA were transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produces guide RNA/ dCasl3b complex comprising the dCasl3b protein complexed with the guide RNA.
  • Figure 6 shows the effect of recombinant expression vector expressing dPguCasl3b protein and the AGCU-3'UTR-targeting guide RNA on the expression levels of Ago lx protein. It can be deduced that there was a significant increase in the expression levels of Ago lx protein in HEK293 cells transfected with a combination of dPguCasl3b and A GO1- 3 'UTR- targeting guide RNA as compared to cells transfected with the non-targeting guide RNA (SEQ ID NO: 37).
  • the recombinant expression vector comprising AGOl-3'UTR-targeting guide RNA, along with dCasl3a or the recombinant expression vector comprising AGO 1-3 'UTR- targeting guide RNA along with dPguCasl3b increases the translational readthrough across the canonical stop codon of AGO1 mRNA, without affecting the target mRNA level or its canonical translation.
  • the dCasl3a or dPguCasl3b -mediated augmentation of translational readthrough in AGO1 can be used to achieve enhancement of global translation. This strategy can also be used to inhibit dsRNA-mediated apoptosis.
  • MTCH2 recombinant expression vector (CRISPR- dCasl3a system) in enhancement of readthrough across canonical stop codon
  • MTCH2-3 UTR targeting guide RNA SEQ ID NO: 2 was designed to recruit dCasl3a proximally downstream to the canonical stop codon of MTCH2 mRNA (NM_014342.3; SEQ ID NO: 7).
  • the recombinant expression vector expressing dCasl3a and the MTCH2-3'UTR targeting guide RNA was transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA.
  • HEK293 cells transfected with the recombinant expression vector comprising MTCH2-3'UTR targeting guide RNA and dCasl3a showed an enhancement in the expression of the readthrough protein of MTCH2, as compared to cells transfected with the non-targeting guide RNA (SEQ ID NO: 37).
  • MTCH2 mRNA can undergo single- and double- translational readthrough.
  • MTCH2x protein SEQ ID NO: 33
  • MTCH2xx protein SEQ ID NO: 34
  • Enhancement of translational readthrough across the canonical stop codon of VEGFA using CRISPR-dCasl3a system demonstrates the effect of the recombinant expression vector to induce the translational readthrough across the canonical stop codon of VEGFA mRNA, which encodes a secretory pro -angiogenic protein VEGF-A.
  • SCR of VEGFA results in a longer isoform termed VEGF-Ax (SEQ ID NO: 35) with a unique C- terminus, which prevents its binding to Neuropilin 1, an important co-receptor in VEGF-A signalling.
  • VEGF-Ax shows anti-angiogenic or weakly pro- angiogenic properties.
  • VEGFA guide RNA having the nucleotide sequence as set forth in SEQ ID NO: 3, was designed to recruit Casl3a or dCasl3a to the region downstream of the canonical stop codon of VEGFA mRNA (NM_001171623.2; SEQ ID NO: 8) ( Figure 2A).
  • Figure 2B shows the effect of the recombinant expression vector comprising VEGFA-3 'UTR-targeting guide RNA and dCasl3a on the SCR of VEGFA.
  • the VEGFA-3 'UTR-targeting guide RNA was expressed in HEK293 cells along with dCasl3a, and the expression levels of VEGF-Ax was detected in the conditioned medium using western blot. It can be inferred from Figure 2B that the level of secreted endogenous VEGF-Ax was increased in cells transfected with VEGFA-3 'UTR-targeting guide RNA, as compared to cells expressing nontargeting guide RNA. However, there was no change in the level of VEGFA mRNA under same conditions ( Figure 2B). These results show that dCasl3a, guided by the specific guide RNA, enhances VEGF-Ax expression, like in the case of AGO1.
  • VEGFA-3 'UTR-targeting guide RNA caused knockdown of VEGF-Ax when expressed along with Casl3a (catalytically active form) in these cells confirming the ability of this guide RNA to target VEGFA mRNA ( Figure 2C).
  • VEGF-Ax knockout cells were generated by targeting the proximal 3'UTR of VEGFA mRNA ( Figure 2A), the region responsible for SCR.
  • Figure 2D The VEGF-Ax knockout cells showed complete absence of VEGF-Ax confirming that the presence of 20 kDa band observed in Western blots is the product of SCR in VEGFA ( Figure 2D).
  • the recombinant expression vector comprising VEGFA-3 TR-targeting guide RNA and dCasl3a enhances the SCR across the canonical stop codon of VEGFA in a transcript- specific manner, without affecting the canonical translation of VEGFA mRNA or its cellular levels.
  • VEGF-Ax is anti-angiogenic or weakly angiogenic protein, as compared to the canonical isoform VEGF-A, the SCR of VEGFA mRNA result in a net anti-angiogenic effect. Therefore, enhancement of SCR in VEGFA by the recombinant expression vector of the present disclosure can be used to treat diseases with excessive and abnormal angiogenesis such as cancer and retinopathies.
  • Nonsense mutations resulting in premature stop codons in HBB gene cause a condition called P -thalassemia, which is characterized by reduced haemoglobin level.
  • guide RNA having a nucleotide sequence as set forth in SEQ ID NO: 4 was designed to target HBB gene having a non-sense mutation at various codon positions that leading to HBB mRNA with pre-mature codons.
  • the HBB mRNA has a nucleotide sequence as set forth in SEQ ID NO: 9 (having accession number- NM_000518.5).
  • the recombinant expression vector or CRISPR-Casl3a system was constructed by following the procedure as described in Example 1.2.
  • the recombinant expression vector (CRISPR-dCasl3a system) comprising HBB- targeting guide RNA and dCasl3a, was transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA.
  • HBB' 16 th codon
  • the coding sequence of green fluorescent protein (GFP) was cloned in-frame with and downstream of HBB w16 * (as shown in Figure 3B), such that SCR across the premature stop codon result in full-length P- globin protein tagged to GFP.
  • This HBB construct along with the recombinant expression vector expressing dCasl3a and the guide RNA were transfected in HEK293 cells, and the expression levels of P-globin protein were evaluated.
  • Figure 3B shows: (i) the expression levels of the full-length GFP-tagged P- globin detected by Western blot, and (ii) HBB-GFP mRNA level detected by RT- PCR. It can be observed from Figure 3B that while the P-globin protein was not detected in cells expressing non-targeting guide RNA, however, a full length P- globin protein (GFP-tagged) was detected in cells expressing //£>£> -targeting guide RNA (SEQ ID NO: 4). It was also observed from Figure 3B that there was no change in the HBB-GFP RNA levels in these conditions.
  • dCasl3a can be used to induce SCR across the thalassemia-causing premature stop codon in HBB mRNA.
  • the recombinant expression vector comprising /7BB- targeting guide RNA (SEQ ID NO: 4) and dCasl3a induce SCR across the thalassemia-causing premature stop codon in HBB mRNA.
  • dCasl3a-mediated induction of SCR can potentially provide therapeutic benefit in human genetic diseases caused by nonsense mutations.
  • the HRB-targeting guide RNA (SEQ ID NO: 4) recruits dCasl3a protein by hybridizing proximally downstream to the pre-mature stop codon in HBB gene, thus helps in enhancing the SCR without affecting the HBB mRNA level or its canonical translation.
  • the recombinant expression vector as described herein can be personalized to a patient depending on the location of the nonsense mutation, for treating diseases caused by non-sense mutations.
  • the present disclosure discloses that the combination of guide polynucleotide as described herein along with the dCasl3 protein in the recombinant expression vector is crucial for inducing translational readthrough across the canonical stop codon or a pre-mature stop codon of the target mRNA sequence.
  • dCasl3 protein (dCasl3a protein or dCasl3b protein) was recruited proximally downstream of the canonical stop codon or pre-mature stop codon of the target sequence to enhance (or induce) SCR across the pre-mature stop codons ( Figure 3C) and canonical stop codons ( Figure 7).
  • the enhancement of SCR was achieved in a transcript- selective and stop codon-specific manner without altering the transcript (mRNA) level or its translation.
  • the present disclosure discloses a CRISPR-Casl3 system for inducing the translational readthrough across the canonical or pre-mature stop codon of the target mRNA sequence.
  • the CRISPR-Casl3 system or the recombinant expression vector comprises: (a) a guide polynucleotide complementary to a region to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24- 30 nucleotides, and wherein the guide polynucleotide is complementary to a region to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b)
  • the dCasl3 protein are targeted to the downstream region of stop codons of the target sequence using specific guide RNAs selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
  • specific guide RNAs selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID
  • the present disclosure also discloses a method for inducing translational readthrough across canonical stop codons of AGO1, MTCH2 and VEG FA mRNa, and pre-mature stop codon of HBB mRNA, using the recombinant expression vector expressing both the guide RNA as described herein and dCasl3 protein (dCasl3a or dCasl3b protein).
  • the enhancement of the translational readthrough across the canonical stop codons or pre-mature stop codon of the target mRNA is achieved in a transcript- selective and stop codon- specific manner without altering the transcript (mRNA) level or its translation.
  • This specificity provides a key advantage over the existing SCR-inducing strategies/molecules, which are largely nonselective.
  • CRISPR-dCasl3a mediated induction or CRISPR-dCasl3b mediated induction of stop codon readthrough can be applied for the treatment of different diseases such as, P- thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis.
  • enhancement of readthrough in VEG FA can be useful in the treating conditions arising from excessive and abnormal angiogenesis, such as cancer and retinopathies.

Abstract

The present disclosure discloses a recombinant expression vector comprising a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO: 5, or SEQ ID NO: 31, operably linked to a promoter. A method and a composition for inducing the translational readthrough is also disclosed.

Description

CRISPR-DCAS13 SYSTEM, COMPOSITION, AND METHOD TO INDUCE TRANSLATIONAL READTHROUGH ACROSS STOP CODONS
FIELD OF INVENTION
[001] The present disclosure broadly relates to the field of molecular biology and particularly refers to the recombinant expression vector, compositions and method for inducing translational readthrough across stop codon (canonical stop codon or pre-mature stop codon).
BACKGROUND OF INVENTION
[002] Stop codon read-through (SCR), also known as translational read-through, is the process in which ribosomes continue to translate beyond the canonical stop codon, up to a downstream, in-frame stop codon, resulting in a polypeptide with a C-terminal extension. Translational readthrough can result in a protein isoform with difference in function, localization or stability in comparison with the canonical isoform (Eswarappa et al., 2014, Programmed translational readthrough generates antiangiogenic VEGF-Ax. Cell 157, 1605-1618. 10.1016/j.cell.2014.04.033; Manjunath et al., 2020 Stop codon read-through of mammalian MTCH2 leading to an unstable isoform regulates mitochondrial membrane potential. J. Biol. Chem. 295, 17009-17026; Schueren et al., 2014 Functional Translational Readthrough: A Systems Biology Perspective. PLoS Genet. 12, el006196.
10.1371/journal.pgen.1006196). Accordingly, enhancement of target- specific readthrough and transcript-specific readthrough can have different potential applications. For instance, the transcript-specific induction of SCR has therapeutic benefits in treating genetic diseases caused by nonsense mutations. Examples of diseases arising from nonsense mutations include P-thalassemia, Duchenne muscular dystrophy, cystic fibrosis, Hemophilia A and B.
[003] The conventional strategies to promote translational readthrough includes the use of antibiotics such as, aminoglycosides and macrolides and molecules such as, PTC 124 (Ataluren), 2,6-diaminopurine, and clitocine have been used to promote readthrough. [004] For instance, W02005073375A1 discloses the method for screening or selecting cells expressing a desired level of a polypeptide, and wherein the method relies on the property of aminoglycoside antibiotics to promote translational readthrough.
[005] US20020086427A1 discloses an inducible eukaryotic expression system in which the expression of a desired gene can be activated or deactivated at the level of gene translation via an inducible signal. This is accomplished by introducing a mutation into the coding sequence of the gene of interest that causes a decrease or alteration of translation, e.g. a stop codon, and by contacting the eukaryotic cell containing the mutated gene of interest with an agent that suppresses the effect of the mutation, e.g. an aminoglycoside.
[006] However, the current strategies used for promoting translational readthrough can potentially target any stop codon and hence lack specificity. Additionally, toxicity related issues are also reported with the use of the conventional strategies as mentioned above.
[007] Hence, there is a dire need in the art to provide strategies which can target specific mRNA, and can be used to enhance the efficiency of readthrough or to induce readthrough across canonical stop codons or premature stop codons.
SUMMARY OF THE INVENTION
[008] In an aspect of the present disclosure, there is provided a recombinant expression vector comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24- 30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO:5, or SEQ ID NO: 31, operably linked to a promoter. [009] In another aspect of the present disclosure, there is provided a bacterial host cell comprising the recombinant expression vector as described herein.
[0010] In another aspect of the present disclosure, there is provided a method to induce translational readthrough across a canonical stop codon or a pre-mature stop codon of a target sequence, said method comprising: (a) obtaining a human cell comprising a polynucleotide having a canonical stop codon or a pre-mature stop codon of a target sequence, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, and SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO:
9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO: 5, and SEQ ID NO: 31, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3 complex comprising the dCasl3 protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3 protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence; and (d) analysing the expression levels of target proteins in the transfected cells, wherein an increase in the levels of the target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence.
[0011] In another aspect of the present disclosure, there is provided a method of inducing translational readthrough across pre-mature stop codon of a target haemoglobin subunit beta (HBB) gene, said method comprising: (a) obtaining a human cell having a pre-mature stop codon in HBB gene, wherein the HBB gene has a nucleotide sequence as set forth in SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30, complementary to a region downstream of a pre-mature stop codon in HBB gene having a nucleotide sequence as set forth in SEQ NO: 9, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the pre-mature stop codon in HBB gene having a nucleotide sequence as set forth in SEQ NO: 9; and (d) analysing the expression levels of a P-globin protein in the transfected cells, wherein an increase in the expression levels of P-globin protein in the transfected cell indicates an increased translational readthrough across the pre-mature stop codon of the HBB gene to produce the P-globin protein.
[0012] In another aspect of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein, said method comprising: (a) obtaining a human cell comprising a AGO1 target polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, complementary to a region downstream of canonical stop codon of the AGO1 target polynucleotide sequence as set forth in SEQ NO: 6, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 6; and (d) analysing the expression levels of a target protein Ago lx in the transfected cells, wherein an increase in the expression levels of the Ago lx protein in the transfected cells indicates an increased translational readthrough across a canonical stop codon of the polynucleotide encoding Argonaute 1 (Agol) protein.
[0013] In another aspect of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a polynucleotide encoding Vascular endothelial growth factor (VEGF-A), said method comprising:
(a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ ID NO: 8, wherein the polynucleotide has a canonical stop codon;
(b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, complementary to a region downstream of canonical stop codon of the VEGF-A target polynucleotide sequence as set forth in SEQ ID NO: 8, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter, (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 8; and (d) analysing the expression levels of a target protein VEGF-Ax in the transfected cells, wherein an increase in the expression levels of the VEGF-Ax protein in the transfected cells indicates an increased translational readthrough across a canonical stop codon of a polynucleotide encoding VEGF-A protein.
[0014] In another aspect of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Mitochondrial carrier homolog 2 protein- (MTCH2), said method comprising: (a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ NO: 7, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19, complementary to a region downstream of canonical stop codon of MTCH2 target polynucleotide sequence as set forth in SEQ ID NO: 7, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ NO: 7; and (d) analysing the expression levels of readthrough proteins of MTCH2 in the transfected cells, wherein an increase in the expression levels of the readthrough proteins of MTCH2 in the transfected cells indicates an increased translational readthrough across a canonical stop codon of the target polynucleotide encoding MTCH2 protein.
[0015] In another aspect of the present disclosure, there is provided a composition comprising the recombinant expression vector as described herein.
[0016] In another aspect of the present disclosure, there is provided a method of treating a disease in a subject in a need thereof, said method comprising administering to a subject a therapeutic amount of the composition as described herein. [0017] In another aspect of the present disclosure, there is provided a use of the recombinant expression vector as described herein for inducing translational readthrough across canonical stop codon or the pre-mature stop codon of the target sequence.
[0018] In another aspect of the present disclosure, there is provided a guide polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 30.
[0019] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[0020] The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.
[0021] Figure 1(A) shows the sequence of the proximal 3'UTR of AGO1. The canonical stop codon (TGA) and the gRNA targeting region are in red and blue, respectively. Figure 1(B) depicts the results of western blot showing the effect of recombinant expression vector (herein referred to as CRISPR-dCasl3a system) on stop codon readthrough (SCR) of AGO1 in HEK293 cells. The expression of Agolx (SCR product) and Agol (total) was analysed by Western blot. RT-PCR result shows the expression of AGO1 mRNA (bottom panels). Figure 1(C) depicts the western blot showing the requirement of both dCasl3a and the AGO1-3 UTR-targeting guide RNA for the increased expression of Agolx. Figure 1(D) depicts the western blot showing reduced expression of Agolx in cells expressing Casl3a and AGO1-3 'UTR-targeting guide RNA, Figure 1(E) depicts western blot showing reduced expression of Agolx in cells transfected with Cas9 and AGO1 -3 'UTR-targeting sgRNAs. Figure 1(F) illustrates the results of luminescence-based SCR assay, wherein the indicated constructs were transfected in HEK293 cells and firefly luciferase (FLuc) activity was measured 48 h after transfection. FLuc activity relative to the activity of the cotransfected renilla luciferase is shown, Figure 1(G) shows the effect of CRISPR- dCasl3a system on normal translation and mRNA level. AG(?7-3'UTR-FLuc construct without any stop codon in between was transfected in cells along with plasmids expressing dCasl3a and indicated guide RNA. Relative luciferase activity was measured as described above. RT-PCR results show the expression of FLuc mRNA. Numbers below the blot (in Figures 1(B) to 1(E), represent mean densitometry values with standard error (N = 3). Graphs in Figure 1(F) and 1(G) are representatives of three independent experiments. Bars indicate mean ± standard error. Two-sided Student’s t-test was used to calculate the P value, in accordance with an embodiment of the present disclosure.
[0022] Figure 2(A) depicts the sequence of the proximal 3'UTR of VEGFA. The region targeted by the guide RNA is shown in blue. The canonical stop codon (TGA) is shown in red. Figure 2(B) depicts the results of western blot showing the effect of CRISPR-dCasl3a system on SCR of VEGFA. HEK293 cells were transfected with indicated constructs and the levels of VEGF-Ax (SCR product) in the conditioned medium were analysed by Western blot. RT-PCR result shows the expression of VEGFA mRNA (bottom panels). Figure 2(C) depicts the results of western blot showing the level of VEGF-Ax in the conditioned medium of HEK293 cells expressing Casl3a and VEGFA-3 TR-targeting guide RNA. Figure 2(D) depicts the results of western blot showing absence of VEGF-Ax in the conditioned medium of VEGF-Ax knockout cells generated using CRISPR-Cas9 system. Ax, VEGF-Ax; ns, non-specific band. Figure 2(E) illustrates the results of luminescence-based SCR assay, wherein the indicated constructs were transfected in HEK293 cells and firefly luciferase (FLuc) activity was measured 24 h after transfection. FLuc activity relative to the activity of the co-transfected renilla luciferase is shown. Bottom panel shows the expression of FLuc mRNA. Figure 2(F) shows the effect of CRISPR-dCasl3a system on canonical translation. VEGFA-3 'UTR-FLuc construct without any stop codon in between was transfected in HEK293 cells along with plasmids expressing dCasl3a and indicated guide RNA. Relative luciferase activity was measured as described above. Numbers below the blot in Figure 2(B) and 2(C) represent mean densitometry values with standard error (N = 3). Graphs in Figures 2(E) and 2(F) are representative of three independent experiments. Bars indicate mean ± standard error (N = 3). Two-sided Student’s t-test was used to calculate the P value, in accordance with an embodiment of the present disclosure.
[0023] Figure 3(A) depicts the sequence of the proximal coding sequence of HBB. The region targeted by the guide RNA is shown in blue. The start codon (ATG) is shown in green and the premature stop codon (TAG) is shown in red. Figure 3(B) depicts HEK293 cells that were transfected with indicated constructs. The full-length GFP-tagged P -globin was detected by Western blot. HBB-GFP mRNA level detected by RT-PCR is also shown. Results are representatives of three independent experiments. Figure 3(C) depicts a schematic representation showing the induction of SCR across the thalassemia-causing premature stop codon of HBB by CRISPR- dCasl3a system to generate full-length P-globin protein, in accordance with an embodiment of the present disclosure.
[0024] Figure 4(A) depicts the RT-PCR analysis showing the expression of Casl3a- HA and dCasl3a in transfected cells. Figure 4(B) depicts western blot showing the expression of HA-tagged Casl3a in transfected cells, in accordance with an embodiment of the present disclosure.
[0025] Figure 5(A) depicts the sequence of the proximal 3'UTR of MTCH2. The canonical stop codon (TGA) and the gRNA targeting region are in red and blue, respectively. Figure 5(B) illustrates the luminescence-based SCR assay. The indicated constructs were transfected in HEK293 cells and firefly luciferase (FLuc) activity was measured 24 h after transfection. FLuc activity relative to the activity of the cotransfected renilla luciferase is shown. Bottom panel shows the expression of FLuc mRNA. Figure 5(C)shows the effect of CRISPR-dCasl3a system on normal translation. A77'C/72-3'UTR-FLuc construct without any stop codon in between was transfected in cells along with plasmids expressing dCasl3a and indicated guide RNA. Relative luciferase activity was measured as described above. Graphs are representatives of three independent experiments. Bars indicate mean ± standard error. Two-sided Student’s t-test was used to calculate the P value, in accordance with an embodiment of the present disclosure.
[0026] Figure 6 depicts the effect of CRISPR-dCasl3b system in inducing translational readthrough across the canonical stop codon of AGO1 mRNA, in accordance with an embodiment of the present disclosure.
[0027] Figure 7 depicts the Schematic representation summarizing the enhancement of SCR across the canonical stop codon of select mRNAs using CRISPR-dCasl3a system, in accordance with an embodiment of the present disclosure.
[0028] Figure 8 depicts the vector map of pC015-dLwCasl3a-NF, in accordance with an embodiment of the present disclosure.
[0029] Figure 9 depicts the vector map of pC016-LwCasl3a guide expression backbone (with U6 promoter), in accordance with an embodiment of the present disclosure.
[0030] Figure 10 depicts the vector map of pC014-LwCasl3a-msfGFP plasmid expressing active Casl3a, in accordance with an embodiment of the present disclosure.
[0031] Figure 11 depicts the vector map of the recombinant expression vector expressing dCasl3b protein, in accordance with an embodiment of the present disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0032] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
[0033] Sequences used in the present disclosure
[0034] SEQ ID NO: 1 depicts the nucleotide sequence of DNA encoding guide RNA targeting A GO1 mRNA
[0035] SEQ ID NO: 2 depicts the nucleotide sequence of DNA encoding guide RNA targeting MTCH2 mRNA
[0036] SEQ ID NO: 3 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0037] SEQ ID NO: 4 depicts the nucleotide sequence of DNA encoding guide RNA targeting HBB mRNA
[0038] SEQ ID NO: 5 depicts the nucleotide sequence encoding dCasl3a protein
[0039] SEQ ID NO: 6 depicts the nucleotide sequence of DNA encoding AGO1 mRNA
[0040] SEQ ID NO: 7 depicts the nucleotide sequence of DNA encoding MTCH2 mRNA
[0041] SEQ ID NO: 8 depicts the nucleotide sequence of DNA encoding VEGFA mRNA
[0042] SEQ ID NO: 9 depicts the nucleotide sequence of DNA encoding HBB mRNA
[0043] SEQ ID NO: 10 depicts the nucleotide sequence of DNA encoding guide
RNA targeting AGO1 mRNA
[0044] SEQ ID NO: 11 depicts the nucleotide sequence of DNA encoding guide
RNA targeting AGO1 mRNA
[0045] SEQ ID NO: 12 depicts the nucleotide sequence of DNA encoding guide
RNA targeting AGO1 mRNA
[0046] SEQ ID NO: 13 depicts the nucleotide sequence of DNA encoding guide
RNA targeting AGO1 mRNA
[0047] SEQ ID NO: 14 depicts the nucleotide sequence of DNA encoding guide
RNA targeting AGO1 mRNA [0048] SEQ ID NO: 15 depicts the nucleotide sequence of DNA encoding guide RNA targeting MTCH2 mRNA
[0049] SEQ ID NO: 16 depicts the nucleotide sequence of DNA encoding guide
RNA targeting MTCH2 mRNA
[0050] SEQ ID NO: 17 depicts the nucleotide sequence of DNA encoding guide
RNA targeting MTCH2 mRNA
[0051] SEQ ID NO: 18 depicts the nucleotide sequence of DNA encoding guide
RNA targeting MTCH2 mRNA
[0052] SEQ ID NO: 19 depicts the nucleotide sequence of DNA encoding guide
RNA targeting MTCH2 mRNA
[0053] SEQ ID NO: 20 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0054] SEQ ID NO: 21 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0055] SEQ ID NO: 22 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0056] SEQ ID NO: 23 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0057] SEQ ID NO: 24 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0058] SEQ ID NO: 25 depicts the nucleotide sequence of DNA encoding guide RNA targeting VEGFA mRNA
[0059] SEQ ID NO: 26 depicts the nucleotide sequence of DNA encoding guide
RNA targeting HBB mRNA
[0060] SEQ ID NO: 27 depicts the nucleotide sequence of DNA encoding guide
RNA targeting HBB mRNA
[0061] SEQ ID NO: 28 depicts the nucleotide sequence of DNA encoding guide
RNA targeting HBB mRNA
[0062] SEQ ID NO: 29 depicts the nucleotide sequence of DNA encoding guide RNA targeting HBB mRNA [0063] SEQ ID NO: 30 depicts the nucleotide sequence of DNA encoding guide RNA targeting HBB mRNA
[0064] SEQ ID NO: 31 depicts the nucleotide sequence encoding dPguCasl3b protein
[0065] SEQ ID NO: 32 depicts the amino acid sequence of Ago lx protein
[0066] SEQ ID NO: 33 depicts the amino acid sequence of a single readthrough MTCH2x protein
[0067] SEQ ID NO: 34 depicts the amino acid sequence of a double readthrough
MTCH2xx protein
[0068] SEQ ID NO: 35 depicts the amino acid sequence of VEGF-Ax protein
[0069] SEQ ID NO: 36 depicts the amino acid sequence of P -globin protein
[0070] SEQ ID NO: 37 depicts the nucleotide sequence of non-targeting guide RNA
[0071] SEQ ID NO: 38 depicts the nucleotide sequence of single guide RNA targeting A GO1 mRNA
[0072] SEQ ID NO: 39 depicts the nucleotide sequence of single guide RNA targeting A GO1 mRNA
[0073] SEQ ID NO: 40 depicts nucleotide sequence of single guide RNA targeting VEGFA mRNA
[0074] SEQ ID NO: 41 depicts the nucleotide sequence of single guide RNA targeting VEGFA mRNA
[0075] SEQ ID NO: 42 depicts the nucleotide sequence of FLuc primer
[0076] SEQ ID NO: 43 depicts the nucleotide sequence of FLuc primer
[0077] SEQ ID NO: 44 depicts the nucleotide sequence of ACTB (P-Actin) primer
[0078] SEQ ID NO: 45 depicts the nucleotide sequence of ACTB (P-Actin) primer
[0079] SEQ ID NO: 46 depicts the nucleotide sequence of GFP primer
[0080] SEQ ID NO: 47 depicts the nucleotide sequence of GFP primer
[0081] SEQ ID NO: 48 depicts the nucleotide sequence of AGO1 primer
[0082] SEQ ID NO: 49 depicts the nucleotide sequence of AGO1 primer
[0083] SEQ ID NO: 50 depicts the nucleotide sequence of 18s rRNA primer
[0084] SEQ ID NO: 51 depicts the nucleotide sequence of 18s rRNA primer
[0085] SEQ ID NO: 52 depicts the nucleotide sequence of VEGFA primer [0086] SEQ ID NO: 53 depicts the nucleotide sequence of VEGFA primer Definitions
[0087] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.
[0088] The articles “a”, “an” and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
[0089] The terms “comprise” and “comprising” are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as “consists of only”.
[0090] Throughout this specification, unless the context requires otherwise the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps. [0091] The term “including” is used to mean “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.
[0092] For the purposes of the present document, the term “recombinant expression vector” used herein refers to vectors is capable of directing the expression of genes to which they are operatively-linked to. In the present disclosure, the recombinant expression vector comprises a guide polynucleotide complementary to a target sequence, and a polynucleotide encoding a dCasl3 protein, in a form suitable for expression of the guide polynucleotide and polynucleotide encoding dCasl3 protein in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcnption/translation system or in a host cell when the vector is introduced into the host cell). The terms “recombinant expression vector” and “CRISPR-Casl3 system” are interchangeably used in the present disclosure.
[0093] In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR- associated (“Cas”) genes, including sequences encoding a Casl3 gene, and guide polynucleotide encoding guide RNA. The CRISPR-dCasl3a system which acts as an RNA-guided, RNA-binding system in the present disclosure is used to target regions proximally downstream of the stop codon and act as transient hindrances, driving readthrough.
[0094] The “Casl3” is type of RNA targeting enzyme, wherein the Casl3 protein can be programmed to bind and cleave the target RNA. The diverse Cas 13 family contains at least four known subtypes, including Casl3a (formerly C2c2), Casl3b, Casl3c, and Casl3d. The term “dCasl3” refers to catalytically inactive Casl3 protein. The present disclosure deploys the dCasl3a protein and dCasl3b protein that forms a complex with the guide polynucleotide, wherein the guide polynucleotide recruits the dCasl3 protein proximally downstream of the canonical or premature stop codons of the target sequence.
[0095] The term “guide polynucleotide” relates to a polynucleotide sequence encoding the guide RNA, wherein the guide RNA forms a complex with a dCasl3 protein and recruits the dCasl3 protein proximally downstream of the stop codon (canonical or premature stop codon) of the target sequence. The guide polynucleotide is a DNA encoding guide RNA wherein the polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides. [0096] As used herein, the term “guide RNA” refers to the specific RNA sequences that recognize and hybridize to the target sequence of interest and directs the dCasl3 protein proximally downstream of the stop codon (canonical or stop codon) of the target sequence, by forming a complex with said dCasl3 protein.
[0097] The terms "target sequence", "target site", "target mRNA", “target mRNA sequence” are used interchangeably herein and refer to a polynucleotide sequence in the genome of a cell in which the phenomenon of stop codon readthrough (SCR) or translational readthrough occurs under specific conditions.
[0098] The term “translational readthrough” refers to a process of continuation of translation beyond a stop codon (canonical or pre-mature stop codon). This phenomenon, which occurs only in certain mRNAs under specific conditions, leads to a longer isoform with properties different from that of the canonical isoform. The terms “translational readthrough” and “stop codon readthrough (SCR) are used interchangeably in the present disclosure.
[0099] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human.
[00100] Ratios, concentrations, amounts, and other numerical data may be presented herein in a range format. It is to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited.
[00101] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.
[00102] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the disclosure, as described herein.
[00103] As discussed in the background section of the present disclosure, the major drawback of the conventional approaches used to enhance readthrough across either the canonical stop codon or disease-causing premature stop codons are as follows: (a) Lack of Specificity: The conventional approaches including antibiotics such as aminoglycosides and macrolides, small molecules like PTC 124 (ataluren) and clitocine, engineered suppressor tRNAs and targeted pseudo uridylation of the stop codon can potentially target any stop codon and hence lack specificity; (b) Undesirable side effects: Since these conventional approaches can target any stop codon, it leads to undesirable effects when used in patients. Hence, these strategies have failed to reach clinical application to treat diseases in patients.
[00104] In order to overcome the aforementioned problems in the art, the present disclosure provides CRISPR-dCasl3 system to induce the translational readthrough across the stop codons (canonical or pre-mature stop codons). CRISPR- dCasl3 system is used to create a transient molecular obstacle for ribosomes near the canonical stop or a pre-mature stop codon, and thereby enhance or induce SCR or translational readthrough. In particular, the present disclosure discloses the recombinant expression vector (CRISPR-dCasl3 system) comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, and (b) a polynucleotide encoding dCasl3a protein having an amino acid sequence as set forth in SEQ ID NO: 5, or dCasl3b protein having an amino acid sequence as set forth in SEQ ID NO: 31. The guide RNA(s) encoded by the guide polynucleotide are designed such that they have contiguous nucleotides complementary to the target sequence (target mRNA sequence) in the range of 24-30 nucleotides. The guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence, such that guide polynucleotide is used for enhancing readthrough across stop codon and inducing readthrough across premature stop codon in transcriptspecific manner. The recombinant expression vector or CRISPR-dCasl3 system is used to enhance the efficiency of natural translational readthrough across canonical stop codons.
[00105] The recombinant expression vector comprising the guide polynucleotide is capable of targeting the following mammalian mRNA: AGO1 (SEQ ID NO: 6), MTCH2 (SEQ ID NO: 7). VEGFA (SEQ ID NO: 8), HBB (SEQ ID NO: 9) mRNA. The guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30. Since the guide polynucleotide targets regions proximally downstream of the stop codon of the target mRNA, therefore, the use of the guide polynucleotide in the recombinant expression vector as described herein, makes it more specific and likely safer as compared to the conventional strategies. The present disclosure also discloses a method of inducing translational readthrough across the canonical stop codon or a pre-mature stop codon, wherein the method involves the step of transfecting a human cell with the recombinant expression vector as described herein, to obtain transfected cells, and wherein the transfected cells produce guide RNA/ dCasl3 complex comprising the dCasl3 protein (dCasl3a or dCasl3b protein) complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3 protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence. The increase in the expression levels of target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or pre-mature stop codon.
[00106] Overall, the CRISPR-dCasl3a or CRISPR-dCasl3b mediated induction of stop codon readthrough can be applied for the treatment of different diseases, including but not limited to P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis. For instance, enhancement of readthrough in VEGFA can be useful to treat conditions arising from excessive and abnormal angiogenesis, such as cancer and retinopathies. In another example, the induction of readthrough across the premature stop codon in HBB mRNA can provide therapeutic benefit to P-thalassemia patients with nonsense mutations. Moreover, in case of mRNA containing disease-causing premature stop codon, the guide RNA used in the recombinant expression vector can be personalized based on the location of the nonsense mutation in the patient. [00107] In an embodiment of the present disclosure, there is provided a recombinant expression vector comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24- 30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO:5, and SEQ ID NO: 31, operably linked to a promoter.
[00108] In another embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the target sequence has a nucleotide sequence as set forth in SEQ ID NO: 6. In yet another embodiment of the present disclosure, the target sequence has a nucleotide sequence as set forth in SEQ ID NO: 7. In one of the embodiment of the present disclosure, the target sequence has a nucleotide sequence as set forth in SEQ ID NO: 8. In an alternate embodiment of the present disclosure, the target sequence has a nucleotide sequence as set forth in SEQ ID NO: 9.
[00109] In an embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-29 nucleotides, or 24-28 nucleotides, or 26-28 nucleotides.
[00110] In an embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the polynucleotide encoding dCasl3a protein has a nucleotide sequence as set forth in SEQ ID NO: 5.
[00111] In an embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the polynucleotide encoding dCasl3b protein has a nucleotide sequence as set forth in SEQ ID NO: 31.
[00112] In an embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30. In another embodiment of the present disclosure, the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.
[00113] In an embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter. In another embodiment of the present disclosure, the promoter is U6 promoter.
[00114] In an embodiment of the present disclosure, there is provided a recombinant expression vector as described herein, wherein the promoter driving the expression of dCasl3 protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, and CAG promoter. In another embodiment of present disclosure, the promoter is chicken P-actin promoter. In yet another embodiment of the present disclosure, the promoter is SV40 promoter. In another embodiment of the present disclosure, the promoter is CMV promoter.
[00115] In an embodiment of the present disclosure, there is provided a recombinant expression vector comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24- 30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30 ; and (b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO:5, and SEQ ID NO: 31, operably linked to a promoter selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, and CAG promoter.
[00116] In an embodiment of the present disclosure, there is provided a recombinant expression vector comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO:5, and SEQ ID NO: 31, operably linked to a promoter selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, and CAG promoter.
[00117] In an embodiment of the present disclosure, there is provided a recombinant expression vector comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b) a polynucleotide encoding dCasl3a protein having a nucleotide sequence as set forth in SEQ ID NO:5, operably linked to a promoter selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, and CAG promoter.
[00118] In an embodiment of the present disclosure, there is provided a recombinant expression vector comprising: (a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b) a polynucleotide encoding dCasl3b protein having a nucleotide sequence as set forth in SEQ ID NO: 31, operably linked to a promoter selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, EF-la, and CAG promoter. In another embodiment of the present disclosure, the promoter is EF-la.
[00119] In an embodiment of the present disclosure, there is provided a bacterial host cell comprising the recombinant expression vector as described herein, wherein the bacterial cell is E. coli. In another embodiment of the present disclosure, the bacterial cell is DH5- Alpha cells.
[00120] In an embodiment of the present disclosure, there is provided a method to induce translational readthrough across a canonical stop codon or a pre-mature stop codon of a target sequence, said method comprising: (a) obtaining a human cell comprising a polynucleotide having a canonical stop codon or a pre-mature stop codon of a target sequence, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, and SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO:
9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO: 5, and SEQ ID NO: 31, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3 complex comprising the dCasl3 protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3 protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence; and (d) analysing the expression levels of target proteins in the transfected cells, wherein an increase in the levels of the target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence.
[00121] In an embodiment of the present disclosure, there is provided a method to induce translational readthrough across a canonical stop codon or a pre-mature stop codon of a target sequence, said method comprising: (a) obtaining a human cell comprising a polynucleotide having a canonical stop codon or a pre-mature stop codon of a target sequence, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO: 5, or SEQ ID NO: 31, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3 complex comprising the dCasl3 protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3 protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence; and (d) analysing the expression levels of target proteins in the transfected cells, wherein an increase in the levels of the target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence.
[00122] In an embodiment of the present disclosure, there is provided a method to induce translational readthrough across a canonical stop codon or a pre-mature stop codon of a target sequence, said method comprising: (a) obtaining a human cell comprising a polynucleotide having a canonical stop codon or a pre-mature stop codon of a target sequence, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3a protein having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence; and (d) analysing the expression levels of target proteins in the transfected cells, wherein an increase in the levels of the target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence.
[00123] In an embodiment of the present disclosure, there is provided a method to induce translational readthrough across a canonical stop codon or a pre-mature stop codon of a target sequence, said method comprising: (a) obtaining a human cell comprising a polynucleotide having a canonical stop codon or a pre-mature stop codon of a target sequence, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, and SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO:
9, and wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3b protein having a nucleotide sequence as set forth in SEQ ID NO: 31, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3b complex comprising the dCasl3b protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3b protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence; and (d) analysing the expression levels of target proteins in the transfected cells, wherein an increase in the levels of the target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence.
[00124] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across pre-mature stop codon of a target haemoglobin subunit beta (HBB) gene, said method comprising: (a) obtaining a human cell having a pre-mature stop codon in HBB gene, wherein the HBB gene has a nucleotide sequence as set forth in SEQ ID NO: 9; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30, complementary to a region downstream of a pre-mature stop codon in HBB gene having a nucleotide sequence as set forth in SEQ NO: 9, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (b) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the pre-mature stop codon in HBB gene having a nucleotide sequence as set forth in SEQ NO: 9; and (d) analysing the expression levels of a P-globin protein in the transfected cells, wherein an increase in the expression levels of P-globin protein in the transfected cell indicates an increased translational readthrough across the pre-mature stop codon of the HBB gene to produce the P-globin protein.
[00125] In another embodiment of the present disclosure, there is provided a method of inducing translational readthrough across pre-mature stop codon of a target haemoglobin subunit beta (HBB) gene as described herein, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 4.
[00126] In another embodiment of the present disclosure, there is provided a method of inducing translational readthrough across pre-mature stop codon of a target haemoglobin subunit beta (HBB) gene as described herein, wherein the P-globin protein has an amino acid sequence as set forth in SEQ ID NO: 36.
[00127] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein, said method comprising: (a) obtaining a human cell comprising a AGO1 target polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, complementary to a region downstream of canonical stop codon of the AGO1 target polynucleotide sequence as set forth in SEQ NO: 6, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 6; and (d) analysing the expression levels of a target protein Ago lx in the transfected cells, wherein an increase in the expression levels of the Ago lx protein in the transfected cells indicates an increased 1 translational readthrough across a canonical stop codon of the polynucleotide encoding Argonaute 1 (Agol) protein.
[00128] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein, said method comprising: (a) obtaining a human cell comprising a AGO1 target polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, complementary to a region downstream of canonical stop codon of the AGO1 target polynucleotide sequence as set forth in SEQ NO: 6, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3b protein, having a nucleotide sequence as set forth in SEQ ID NO: 31, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3b protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3b protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 6; and (d) analysing the expression levels of a target protein Ago lx in the transfected cells, wherein an increase in the expression levels of the Ago lx protein in the transfected cells indicates an increased translational readthrough across a canonical stop codon of the polynucleotide encoding Argonaute 1 (Agol) protein.
[00129] In another embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein as described herein, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 1.
[00130] In another embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein as described herein, wherein the Ago lx protein has an amino acid sequence as set forth in SEQ ID NO: 32.
[00131] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a polynucleotide encoding Vascular endothelial growth factor (VEGF-A), said method comprising:
(a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ ID NO: 8, wherein the polynucleotide has a canonical stop codon;
(b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, complementary to a region downstream of canonical stop codon of the VEGF-A target polynucleotide sequence as set forth in SEQ ID NO: 8, operably linked to a promoter; and (ii) a polynucleotide encoding a dCas 13a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter, (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 8; and (d) analysing the expression levels of a target protein VEGF-Ax in the transfected cells, wherein an increase in the expression levels of the VEGF-Ax protein in the transfected cells indicates an increased translational readthrough across a canonical stop codon of a polynucleotide encoding VEGF-A protein.
[00132] In another embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a polynucleotide encoding Vascular endothelial growth factor (VEGF-A) as described herein, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 3.
[00133] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a polynucleotide encoding Vascular endothelial growth factor (VEGF-A) as described herein, wherein the target protein VEGF-Ax has an amino acid sequence as set forth in SEQ ID NO: 35.
[00134] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Mitochondrial carrier homolog 2 protein- (MTCH2), said method comprising: (a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ NO: 7, wherein the polynucleotide has a canonical stop codon; (b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19, complementary to a region downstream of canonical stop codon of MTCH2 target polynucleotide sequence as set forth in SEQ ID NO: 7, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter; (c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ NO: 7; and (d) analysing the expression levels of readthrough proteins of MTCH2 in the transfected cells, wherein an increase in the expression levels of the readthrough proteins of MTCH2 in the transfected cells indicates an increased translational readthrough across a canonical stop codon of the target polynucleotide encoding MTCH2 protein.
[00135] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Mitochondrial carrier homolog 2 protein- (MTCH2) as described herein, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 2. [00136] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Mitochondrial carrier homolog 2 protein- (MTCH2) as described herein, wherein the readthrough proteins of MTCH2 are MTCH2x protein having an amino acid sequence as set forth in SEQ ID NO: 33, and MTCH2xx protein having an amino acid sequence as set forth in SEQ ID NO: 34.
[00137] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough as described herein, wherein the human cell is selected from the group consisting of HEK293, HeLa, HepG2, MCF7, HPMEC, huh7, U2OS, and K562 cells. In another embodiment of the present disclosure, the human cell is HEK293.
[00138] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough across pre-mature stop codon of a target haemoglobin subunit beta (HBB) gene, wherein the human cell has at least one nonsense mutation at a nucleotide position in SEQ ID NO: 9, and wherein the non-sense mutation at the nucleotide position is selected from the group consisting of positions at 7, 8, 16, 18, 23, 27, 36, 38, 40, 44, 44, 60, 62, 83, 91, 96, 113, 122, 128, 131, 133, 145, andl46. The non-sense mutation leads to the pre-mature stop codon in SEQ ID NO: 9.
[00139] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough as described herein, wherein transfecting the human cell is done by a method selected from the group consisting of lipofection, nucleofection, electroporation, microinjection, and viral delivery systems.
[00140] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough as described herein, wherein transfecting the human cell is done by a method selected from the group consisting of lipofection, nucleofection, electroporation, microinjection, and viral delivery systems, and wherein the human cell is selected from the group consisting of HEK293, HeLa, HepG2, MCF7, HPMEC, huh7, U2OS, and K562 cells.
[00141] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough as described herein, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3a protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, EF-la, and CAG promoter, and wherein the dCasl3a protein is encoded by a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 5.
[00142] In an embodiment of the present disclosure, there is provided a method of inducing translational readthrough as described herein, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3 protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, , EF- laand CAG promoter, and wherein the dCasl3 protein is either a dCasl3a protein encoded by a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 5, or dCasl3b protein encoded by a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 31.
[00143] In an embodiment of the present disclosure, there is provided a composition comprising a recombinant expression vector as described herein.
[00144] In an embodiment of the present disclosure, there is provided a composition comprising a recombinant expression vector as described herein, wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
[00145] In an embodiment of the present disclosure, there is provided a composition comprising a recombinant expression vector as described herein, wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. [00146] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3 protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, EF-la, and CAG promoter.
[00147] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition further comprises excipients.
[00148] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition induces translational readthrough across the canonical stop codon or pre-mature stop codon of the target sequence.
[00149] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition is delivered to a subject for treating a disease.
[00150] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition is delivered by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers, to a subject for treating a disease.
[00151] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition is delivered to a subject for treating a disease, wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis.
[00152] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition is delivered by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers, to a subject for treating a disease, wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis. [00153] In an embodiment of the present disclosure, there is provided a method of treating a disease in a subject in a need thereof, said method comprising administering to a subject a therapeutic amount of the composition as described herein.
[00154] In an embodiment of the present disclosure, there is provided a method of treating a disease in a subject in a need thereof as described herein, wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis.
[00155] In an embodiment of the present disclosure, there is provided a method of treating a disease in a subject in a need thereof as described herein, wherein administering is done by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers.
[00156] In an embodiment of the present disclosure, there is provided a method of treating a disease in a subject in a need thereof as described herein, wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis, and wherein administering is done by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers.
[00157] In an embodiment of the present disclosure, there is provided a use of the recombinant expression vector as described herein for inducing translational readthrough across canonical stop codon or the pre-mature stop codon of the target sequence.
[00158] In an embodiment of the present disclosure, there is provided a use of the composition as described herein for inducing translational readthrough across canonical stop codon or the pre-mature stop codon of the target sequence.
[00159] In an embodiment of the present disclosure, there is provided a guide polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
[00160] In an embodiment of the present disclosure, there is provided a method as described herein, wherein the guide RNA is capable of hybridizing to the target sequence in transcript- selective and selective manner.
[00161] In an embodiment of the present disclosure, there is provided a method as described herein, wherein the guide RNA is capable of hybridizing to the target sequence in transcript- selective and selective manner, and wherein the guide RNA is encoded by the guide polynucleotide.
[00162] Although the subject matter has been described in considerable detail with reference to certain examples and implementations thereof, other implementations are possible.
EXAMPLES
[00163] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may apply.
Example 1
Materials and Methods [00164] 1.1 Cell culture
[00165] HEK293 cells (source: ATCC) were cultured using Dulbecco’s Modified Eagle’s Medium (DMEM, HiMedia), which was supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% antibiotics (10000 U/ml penicillin, 10000 pg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
[00166] 1.2 Construction of recombinant expression vector: CRISPR-Casl3 system
[00167] The reporter (Luciferase/GFP) constructs (in pcDNA3.1B vector background) used for stop codon readthrough (SCR) assays for target mRNA: AGO1, VEGFA, MTCH2 and HBB (as disclosed in Eswarappa et al., 2014, Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax. Cell, 757(7):1605-18; Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in P-Globin-Encoding mRNA. Biochemistry, 59(1), 80-84; Singh et al., 2019 Let-7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 35( 16), 1-20), were incorporated herein by reference in its entirety. pC014-LwCasl3a-msfGFP plasmid expressing active Casl3a (as shown in Figure 10), pC015-dLwCasl3a-NF (as shown in Figure 8) expressing the catalytically inactive mutant of Casl3a (dCasl3a; encoded by a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 5) and pC016-LwCasl3a guide expression backbone (with U6 promoter) (as shown in Figure 9) were a gift from Feng Zhang (Addgene plasmid # 91902, # 91905 and # 91906) (Abudayyeh, O., Gootenberg, J., Essletzbichler, P. et al. RNA targeting with CRISPR- Casl3. Nature 550, 280-284 (2017). https://doi.org/10.1038/nature24049).
[00168] In the present disclosure, the guide polynucleotide encoding guide RNA has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides. The guide RNA is capable of hybridizing to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence. For this purpose, oligos were cloned in the guide expression backbone (pC016-LwCasl3a) to generate the 28-nucleotide guide RNA targeting the desired region. The expression vector pC016-LwCasl3a containing the 28- nucleotide guide RNA is referred to as the recombinant expression vector (CRISPR- Cas 13 system), wherein the guide RNA is under the control of U6 promoter.
[00169] The guide polynucleotide encoding guide RNA sequences are given below in Table 1
[00170] Table 1
Figure imgf000038_0001
[00171] Although the examples in the forthcoming sections demonstrates the use of guide RNA sequences as provided in Table 1 to induce or increase the translational readthrough, however, a person skilled in the art can use the other possible guide
RNA targeting various other mRNA using the method as described herein. The sequences of other possible guide polynucleotides encoding guide RNA are provided in Table 2.
Table 2
Figure imgf000038_0002
Figure imgf000039_0001
[00172] The non-targeting guide RNA used for the comparative purpose has a sequence as set forth in SEQ ID NO: 37
(TAGATTGCTGTTCTACCAAGTAATCCAT). [00173] Similar to the construction of recombinant expression vector containing the guide RNA and a polynucleotide encoding dCasl3a protein as explained above, a recombinant expression vector containing guide RNA and a polynucleotide encoding dCasl3b protein (SEQ ID NO: 31) were also constructed. The vector map of the recombinant expression vector expressing dCasl3b protein is illustrated in Figure 11.
[00174] Thus, the recombinant expression vector (CRISPR-dCasl3 system) of the present disclosure includes both the Casl3 or dCasl3 protein present in one expression vector along with the guide RNA cloned in pC016, another expression vector. The expression of both the Cas protein and the CRISPR guide RNA comprises the recombinant expression vector or CRISPR-Casl3 system.
[00175] 1.3 CRISPR-Cas9 mediated deletion [00176] sgRNAs (sequences given below) were cloned in pSpCas9 (BB)-2A-Puro plasmid. HEK293 cells were transfected with the following plasmids (two per gene) using Lipofectamine 2000 (Thermo Fisher Scientific): (a) pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with AGO1 sgRNA 1 (SEQ ID NO: 38) and pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with AGO1 sgRNA 2 (SEQ ID NO: 39); or (b) pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with VEGFA sgRNA 1 (SEQ ID NO: 40) and pSpCas9(BB)-2A-Puro plasmid expressing pSpCas9 along with VEGFA sgRNA 2 (SEQ ID NO: 41). 24 h posttransfection, transfected cells were selected using 2 pg/ml of puromycin (Sigma) for 5 days. The surviving cells were reseeded in a 96-well plate at a density of single cell per well. These clones were expanded and screened for the required genetic deletion by PCR (polymerase chain reaction). The deletion was confirmed by sequencing of the PCR product and by Western blot. The sgRNA sequences (5' to 3') are provided below:
[00177] (i) AGOF. GCAGAACGCTGTTACCTCAC (SEQ ID NO: 38) and GCTGTGCCACCCAAATCCAG (SEQ ID NO: 39)
[00178] (ii) VEGFA: ACAAGCCGAGGCGGTGAGCC (SEQ ID NO: 40) and GGAAAGACTGATACAGAACG (SEQ ID NO: 41)
[00179] 1.4 Luminescence-based translational readthrough assays
[00180] HEK293 cells were seeded in 24-well plates at 70%-80% confluency. 200ng/well of firefly luciferase-encoding reporter plasmids as disclosed in Eswarappa et al., 2014, Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax. Cell, 757(7): 1605-18; Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in P-Globin- Encoding mRNA. Biochemistry, 59(1), 80-84; Singh et al., 2019 Let-7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 5S(16), 1-20; Manjunath et al.2020, Stop codon read- through of mammalian MTCH2 leading to an unstable isoform regulates mitochondrial membrane potential. Journal of Biological Chemistry, 295(50), 17009 - 17026), 500 ng/well each of LwCasl3a or dLwCasl3a-NF and guide RNA (genespecific or non-targeting) were transfected using Lipofectamine 2000. 10 ng/well of Renilla luciferase was used as transfection control. Firefly and Renilla luciferase activities were measured using Dual-Luciferase Reporter Assay System (Promega) using GloMax Explorer (Promega) 24 hours post-transfection in case of samples involving VEGFA, MTCH2 and HBB, and 48 hours post-transfection in case of AGO1.
[00181] 1.5 Antibodies
[00182] Antibodies specific to the readthrough region of VEGFA (against the peptide AGLEEGASLRVSGTR) and AGO1 (against the peptide RQNAVTSLDRRKLSKP) were generated as described in Eswarappa et al., 2014, Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax. Cell, 757(7):1605-18; Singh et al., 2019 Let-7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 3S(16), 1-20. Anti- Agol antibody (Novus Biologicals, NB 100-2817), Anti-GFP antibody (BioLegend, 902602), anti- VEGFA antibody (Thermo Fisher Scientific, JH121), anti-GAPDH antibody (Sigma, G9295), anti-HA antibody (Sigma, 11867423001), anti- Actin antibody (Sigma, A3854) and horseradish-peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific) were used as per the manufacturer’s instructions.
[00183] 1.6 Western blot-based stop codon readthrough assays
[00184] HEK293 cells were seeded in 6-well plates at 70%-80% confluency. For assays involving the detection of endogenous proteins, 2 pg/well of LwCasl3a-NF or 3 pg/well of dLwCasl3a-NF along with 2 pg/well of guide RNA (gene- specific or non-targeting) were transfected using Lipofectamine 2000. For assays involving exogenous plasmids with a premature stop codon, 500 ng/well of the GFP-encoding construct (HBBwl6*-GFP), (as disclosed in Kar et al., 2020. Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in P-Globin-Encoding mRNA. Biochemistry, 59(1), 80-84), 1 pg/well each of dLwCasl3a-NF and pC016-LwCasl3a , a guide RNA expression vector (for genespecific or non-targeting guide RNA) were transfected using Lipofectamine 2000. 24-hours post-transfection, either the conditioned media (in case of VEGFA) or cell pellets were harvested. Conditioned medium was subjected to Trichloroacetic acid (TCA) precipitation followed by Western blotting. Cell pellets were lysed in cell lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton-X with protease inhibitor cocktail (Promega)) and subjected to Western blotting. Protein Assay Dye Reagent (Bio-Rad Laboratories) was used to determine the protein concentration. 50-100 pg of the cell lysate was subjected to denaturing SDS-PAGE in an 8% or 10% or 12.5% or 15% Tris-glycine gel. After the transfer of proteins onto a PVDF membrane (Merck), blocking was carried out (5% skimmed milk in PBS). Following this, the membrane was probed with the specific primary antibody and then with the respective horseradish peroxidase-conjugated secondary antibody. Clarity ECL reagent (Bio-Rad Laboratories) was used for the development of the blots, and the images were recorded using LAS -4000 imager (Fujifilm) or ChemiDoc Imaging System (Bio-Rad Laboratories). Band intensities were quantified using Image J.
[00185] 1.7 RNA isolation and RT-PCR
[00186] RNA isolation was carried out using RNAiso Plus (TaKaRa). cDNA synthesis was carried out with 1 pg of RNA using oligo(dT) primers or gene-specific reverse primer and RevertAid Reverse Transcriptase (Thermo Fisher Scientific). Semi-quantitative analysis of the mRNA levels was carried out using gene-specific primers.
[00187] Primer sequences used in the present disclosure are as shown below (5' to 3'):
[00188] FLuc. CAACTGCATAAGGCTATGAAGAGA (SEQ ID NO: 42); ATTTGTATTCAGCCCATATCGTTT (SEQ ID NO: 43)
[00189] ACTB (p-Actin): AGAGCTACGAGCTGCCTGAC (SEQ ID NO: 44); AGCACTGTGTTGGCGTACAG (SEQ ID NO: 45)
[00190] GFP-. ATGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 46); CTTGTACAGCTCGTCCATGCCGAG (SEQ ID NO: 47)
[00191] AGO1: GGGAGCCACATATCGGGGCAG (SEQ ID NO: 48); CTACCCCACCTCCCTCCTCCTTG (SEQ ID NO: 49)
[00192] 18s rRNA: GGCCCTGTAATTGGAATGAGTC (SEQ ID NO: 50); CCAAGATCCAACTACGAGCTT (SEQ ID NO: 51) [00193] VEGFA: CTTGCCTTGCTGCTCTACC (SEQ ID NO: 52);
CACACAGGATGGCTTGAAG (SEQ ID NO: 53)
[00194] 1.8 Statistics
[00195] Two-sided Student’s t-test was used to test for the significance of the differences observed between samples in the experiments when samples showed normal distribution. Welch’s correction was applied when samples showed unequal variance.
Example 2
2.1 Enhancement of translational readthrough across the canonical stop codon of AGO1 using CRISPR-dCasl3a system
[00196] To evaluate the effect of the recombinant expression vector (CRISPR- dCas l3a system) of the present disclosure in enhancing the translational readthrough across the canonical stop codon, target AGO1 mRNA was used, which encodes Argonaute 1 (Agol) protein. Agol is important for microRN A -mediated repression of gene expression. AGO1 undergo SCR across its canonical stop codon resulting in a longer isoform called Agolx. Unlike Agol (the canonical isoform), Ago lx cannot repress the expression of target transcripts and serves as an inhibitor of the microRNA pathway when its expression is increased (Singh et al., 2019 Let- 7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 3S(16), 1-20). In cancer cells, Agolx inhibits dsRNA-induced interferon signaling and promotes cell proliferation (Ghosh et al., 2020 Prevention of dsRNA-induced interferon signaling by AGO lx is linked to breast cancer cell proliferation. EMBO J. 39, el03922.
10.15252/embj.2019103922).
[00197] For the purpose of the present disclosure, AGO1 guide RNA was designed (SEQ ID NO: 1), which guides Casl3a or dCasl3a to the region downstream of the canonical stop codon of AGO1 mRNA (NM_001317122.2; SEQ ID NO: 6). The canonical stop codon (TGA) and the region targeted by the AGO1 guide RNA are indicated in red and blue color, respectively, in Figure 1A. The recombinant expression vector (hereinafter referred to as CRISPR-Casl3a system) comprising: (a) the guide polynucleotide complementary to a region downstream of AGO1 mRNA target sequence (SEQ ID NO: 6), operably linked to U6 promoter, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 1; and (b) a polynucleotide encoding dCasl3a protein encoded by a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to at least one promoter selected from CMV promoter, SV40 promoter, and chicken P-actin promoter, was obtained following the method as described in Example 1.2
[00198] The recombinant expression vector expressing dCasl3a and the guide RNA were transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produce guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA.
[00199] RESULTS
[00200] Figure 4 depicts the expression of Cas proteins (dCasl3a/Casl3a in transfected cells). The expression of dCasl3a/Casl3a in transfected cells was confirmed by RT-PCR (as shown in Figure 4 A) and/or Western blot (as shown in Figure 4B).
[00201] Figure IB depicts the result of western blot showing the effect of recombinant expression vector (CRISPR-dCasl3a system) on stop codon readthrough (SCR) of AGO1 in HEK293 cells. HEK293 cells transfected with the recombinant expression vector comprising AGG7-3'UTR-targeting guide RNA (SEQ ID NO: 1) and dCasl3a showed about 3-fold increase in the expression of a readthrough protein, Ago lx protein (SEQ ID NO: 32), as compared to cells those transfected with a non-targeting guide RNA (SEQ ID NO: 37), wherein the nontargeting guide RNA does not target any transcript in mammalian cells. However, there was no change in the total Agol protein and AGO1 mRNA under the same conditions (Figure IB). These results show that the designed AGG7-3'UTR-targeting guide RNA (SEQ ID NO: 1) increases the expression of readthrough protein, Agolx. It is also pertinent to note that the recombinant expression vector did not affect the canonical translation of AGO1 mRNA or its levels. This implies that the increased Agolx expression was because of increased SCR across the canonical stop codon of AGO1 mRNA. The increase in Agolx protein level was achieved only when both dCasl3a and AGO1-3 UTR-targeting guide RNA were expressed in cells. From Figure 1C, it can be deduced that transfecting the cells with just dCasl3a or the specific guide RNA were not enough to enhance the expression levels of Ago lx protein.
[00202] Thus, it can be inferred from Figure IB and Figure 1C that the increased expression of Ago lx protein is the result of the guide RNA-mediated action of dCasl3a.
[00203] Further, Figure ID shows that there was a reduction in the expression levels of Ago lx protein in cells transfected with AGO1 -3 'UTR-targeting guide RNA along with Casl3a, which is catalytically active.
[00204] The results shown in Figure ID along with the results shown in Figure IB and Figure 1C demonstrates that the AGO1 -3 'UTR-targeting guide RNA (SEQ ID NO: 1) recruits Casl3a and dCasl3a to its target mRNA, i.e., AGO1.
[00205] Furthermore, targeting the same AGCU-3UTR region (Figure 1A) on the genomic DNA using CRISPR-Cas9 system knocked down the expression of Ago lx (Figure IE). However, the complete knockout of Ago lx protein could not be achieved possibly because of lethality. This result shows that the band observed in Western blot assay (Figure IB) indeed represents the SCR product of AGO1, i.e., Ago lx.
[00206] To further confirm the effect of dCasl3a on SCR of AGO1, a luminescencebased readthrough assay was employed, and the process is same as described in Eswarappa et al., 2014, Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax. Cell, 57(7): 1605- 18; Singh et al., 2019 Let-7a- regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 3S(16), 1-20). A part of the AGO1 coding sequence and the proximal part of its 3'UTR (shown in Figure 1A) were cloned upstream of and in-frame with the firefly luciferase (FLuc) coding sequence. This luciferase construct was transfected in HEK293 cells along with the recombinant expression vector of the present disclosure expressing dCasl3a protein and the guide RNA (SEQ ID NO: 1). The SCR was observed in AGO1 across its canonical stop codon in the presence of the proximal part of its 3'UTR as indicated by the increased luminescence (1st and 3rd bar in Figure IF) ( Singh et al., 2019 Let-7a-regulated translational readthrough of mammalian AGO 1 generates a micro RNA pathway inhibitor . The EMBO Journal, 3S(16), 1-20). Therefore, this validates the fact that the expression of the luciferase, and therefore, luminescence, was expected only if there was SCR across the canonical stop codon of AGO1.
[00207] The luminescence was further enhanced in cells expressing both dCasl3a and AGO1 -3 'UTR-targeting guide RNA (SEQ ID NO: 1) as compared to those cells expressing the non-targeting guide RNA (SEQ ID NO: 37) (as shown in 3rd and 4th bar of Figure IF). Since luminescence is an indicator of SCR, the luminescencebased readthrough assay shows that dCasl3a along with A GCU-3 UTR-targeting guide RNA enhances the SCR across the canonical stop codon of AGO1.
[00208] It is noteworthy that the combination of AGO1 -3 'UTR-targeting guide RNA and dCasl3a failed to alter the activity of the luciferase construct that lacked the proximal part of AGO1 3 'UTR, which is the target region of the guide RNA (results shown in first two bars in Figure IF). Thus, it can be inferred from Figure IF that the recombinant expression vector comprising the guide RNA and dCasl3a work in a transcript- specific manner to enhance SCR. Furthermore, the combination of guide RNA and dCasl3a did not alter the normal translation as indicated by the luminescence in cells transfected with AGO 1-3 'UTR- luciferase construct without any stop codon between them. Similarly, RT-PCR analysis as shown in Figure 1G revealed that no change in the level of the target RNA, i.e., luciferase RNA was observed. These observations are consistent with the western blot results shown in Figure IB indicating the expressional levels of endogenous AGO1.
2.2. Enhancement of translational readthrough across the canonical stop codon o AGOl using CRISPR-dCasl3b system
[00209] The present example also discloses the use of guide RNA (SEQ ID NO: 1) to recruit Casl3b or dPguCasl3b protein to the region downstream of the canonical stop codon of AGO1 mRNA (a region indicated with blue color in Figure 1A). Similar to the recombinant expression vector as explained previously in Example 2.1, a recombinant expression vector comprising: (a) the guide polynucleotide complementary to a region downstream of AGO1 mRNA target sequence (SEQ ID NO: 6), operably linked to U6 promoter, wherein the guide polynucleotide has a nucleotide sequence as set forth in SEQ ID NO: 1; and (b) a polynucleotide encoding dPguCasl3b protein encoded by a nucleotide sequence as set forth in SEQ ID NO: 31, operably linked to EF-la, was obtained.
[00210] The recombinant expression vector expressing dPguCasl3b protein and the guide RNA were transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produces guide RNA/ dCasl3b complex comprising the dCasl3b protein complexed with the guide RNA.
[00211] RESULTS
[00212] Figure 6 shows the effect of recombinant expression vector expressing dPguCasl3b protein and the AGCU-3'UTR-targeting guide RNA on the expression levels of Ago lx protein. It can be deduced that there was a significant increase in the expression levels of Ago lx protein in HEK293 cells transfected with a combination of dPguCasl3b and A GO1- 3 'UTR- targeting guide RNA as compared to cells transfected with the non-targeting guide RNA (SEQ ID NO: 37).
[00213] Therefore, it can be concluded that the recombinant expression vector comprising AGOl-3'UTR-targeting guide RNA, along with dCasl3a or the recombinant expression vector comprising AGO 1-3 'UTR- targeting guide RNA along with dPguCasl3b increases the translational readthrough across the canonical stop codon of AGO1 mRNA, without affecting the target mRNA level or its canonical translation.
[00214] Since overexpression of Agolx can enhance global translation, the dCasl3a or dPguCasl3b -mediated augmentation of translational readthrough in AGO1 can be used to achieve enhancement of global translation. This strategy can also be used to inhibit dsRNA-mediated apoptosis.
Example 3
Enhancement of translational readthrough across the canonical stop codon of MTCH2 using CRISPR-dCasl3a system
[00215] To further validate the use of recombinant expression vector (CRISPR- dCasl3a system) in enhancement of readthrough across canonical stop codon, MTCH2, another mRNA known to undergo readthrough, was targeted. For this purpose, MTCH2-3 UTR targeting guide RNA (SEQ ID NO: 2) was designed to recruit dCasl3a proximally downstream to the canonical stop codon of MTCH2 mRNA (NM_014342.3; SEQ ID NO: 7). The recombinant expression vector expressing dCasl3a and the MTCH2-3'UTR targeting guide RNA was transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA.
[00216] RESULTS
[00217] HEK293 cells transfected with the recombinant expression vector comprising MTCH2-3'UTR targeting guide RNA and dCasl3a showed an enhancement in the expression of the readthrough protein of MTCH2, as compared to cells transfected with the non-targeting guide RNA (SEQ ID NO: 37). MTCH2 mRNA can undergo single- and double- translational readthrough. Hence two readthrough products were obtained, denoted as MTCH2x protein (SEQ ID NO: 33) for the single readthrough product and MTCH2xx protein (SEQ ID NO: 34) for the double readthrough product.
[00218] Further, to confirm the effect of dCasl3a on SCR of MTCH2, a luminescence-based readthrough assay was performed, in which part of the coding sequence of MTCH2, along with the proximal 3 'UTR was cloned upstream of and in-frame with firefly luciferase. Similar to AGO1 (as demonstrated in Example 2), it was observed that dCasl3a coupled with MTCH2-3'UTR-targeting guide RNA enhanced translational readthrough across the canonical stop codon of MTCH2 in a transcript- selective manner without altering the levels of its mRNA (Figure 5).
[00219] Hence, it can be concluded from Figure 5 that the recombinant expression vector (CRISPR-dCasl3a system) comprising MTCH2-3’UTR targeting guide RNA and dCasl3a is used to enhance the SCR without affecting the MTCH2 mRNA level or its canonical translation.
Example 4
Enhancement of translational readthrough across the canonical stop codon of VEGFA using CRISPR-dCasl3a system [00220] This example demonstrates the effect of the recombinant expression vector to induce the translational readthrough across the canonical stop codon of VEGFA mRNA, which encodes a secretory pro -angiogenic protein VEGF-A. SCR of VEGFA results in a longer isoform termed VEGF-Ax (SEQ ID NO: 35) with a unique C- terminus, which prevents its binding to Neuropilin 1, an important co-receptor in VEGF-A signalling. Hence, VEGF-Ax shows anti-angiogenic or weakly pro- angiogenic properties.
[00221] A VEGFA guide RNA having the nucleotide sequence as set forth in SEQ ID NO: 3, was designed to recruit Casl3a or dCasl3a to the region downstream of the canonical stop codon of VEGFA mRNA (NM_001171623.2; SEQ ID NO: 8) (Figure 2A). Figure 2B shows the effect of the recombinant expression vector comprising VEGFA-3 'UTR-targeting guide RNA and dCasl3a on the SCR of VEGFA. For this purpose, the VEGFA-3 'UTR-targeting guide RNA was expressed in HEK293 cells along with dCasl3a, and the expression levels of VEGF-Ax was detected in the conditioned medium using western blot. It can be inferred from Figure 2B that the level of secreted endogenous VEGF-Ax was increased in cells transfected with VEGFA-3 'UTR-targeting guide RNA, as compared to cells expressing nontargeting guide RNA. However, there was no change in the level of VEGFA mRNA under same conditions (Figure 2B). These results show that dCasl3a, guided by the specific guide RNA, enhances VEGF-Ax expression, like in the case of AGO1. The same VEGFA-3 'UTR-targeting guide RNA caused knockdown of VEGF-Ax when expressed along with Casl3a (catalytically active form) in these cells confirming the ability of this guide RNA to target VEGFA mRNA (Figure 2C). Using the recombinant expression vector or CRISPR-Cas9 system, VEGF-Ax knockout cells were generated by targeting the proximal 3'UTR of VEGFA mRNA (Figure 2A), the region responsible for SCR. These VEGF-Ax knockout cells showed complete absence of VEGF-Ax confirming that the presence of 20 kDa band observed in Western blots is the product of SCR in VEGFA (Figure 2D).
[00222] Further, to confirm the effect of dCasl3a on SCR of VEGFA, luminescencebased readthrough assay was performed similar to AGO1 (as described in Example 2). VEGFA coding sequence and the proximal part of its 3'UTR (Figure 2 A) were cloned upstream of and in-frame with firefly luciferase coding sequence (as shown in Figure 2E). This luciferase construct was expressed in HEK293 cells along with dCasl3a and the VEGFA-3 'UTR-targeting guide RNA. SCR across the stop codon results in luciferase expression which can be quantified as luminescence. Hence, an increased luminescence was observed in cells expressing VEGFA-3 'UTR-targeting guide RNA as compared to the cells expressing non-targeting guide RNA showing enhancement of SCR. However, this increase was not observed in the construct lacking the target region (Figure 2 A) i.e., proximal 3'UTR of VEGFA. Further, there was no change in the luciferase mRNA level in any of these conditions (Figure 2E). Furthermore, the translation of VEGFA-3 'UTR-luciferase construct, not have any stop codon in between, was unaltered by the expression of VEGFA-3 'UTR-targeting guide RNA and dCasl3a (Figure 2F).
[00223] Overall, it can be inferred from Figure 2 that the recombinant expression vector comprising VEGFA-3 TR-targeting guide RNA and dCasl3a enhances the SCR across the canonical stop codon of VEGFA in a transcript- specific manner, without affecting the canonical translation of VEGFA mRNA or its cellular levels.
[00224] Since VEGF-Ax is anti-angiogenic or weakly angiogenic protein, as compared to the canonical isoform VEGF-A, the SCR of VEGFA mRNA result in a net anti-angiogenic effect. Therefore, enhancement of SCR in VEGFA by the recombinant expression vector of the present disclosure can be used to treat diseases with excessive and abnormal angiogenesis such as cancer and retinopathies.
Example 5
Induction of translational readthrough across the B- thalassemia-causing premature stop codon of HBB using CRISPR-dCasl3a system
[00225] Nonsense mutations resulting in premature stop codons in HBB gene (encodes P-globin protein) cause a condition called P -thalassemia, which is characterized by reduced haemoglobin level.
[00226] In the present example, guide RNA having a nucleotide sequence as set forth in SEQ ID NO: 4, was designed to target HBB gene having a non-sense mutation at various codon positions that leading to HBB mRNA with pre-mature codons. The HBB mRNA has a nucleotide sequence as set forth in SEQ ID NO: 9 (having accession number- NM_000518.5).
[00227] The list of disease-causing non-sense mutations in HBB leading to premature stop codons is provided in Table 3. [00228] Table 3
Figure imgf000051_0001
Figure imgf000052_0001
[00229] To provide therapeutic benefit to P -thalassemia patients with non-sense mutations, the recombinant expression vector or CRISPR-Casl3a system was constructed by following the procedure as described in Example 1.2. The recombinant expression vector (CRISPR-dCasl3a system) comprising HBB- targeting guide RNA and dCasl3a, was transfected in HEK293 cells (human cells) to obtain transfected cells, wherein the transfected cells produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA. [00230] In order to test the ability of the recombinant expression vector as described herein, to induce SCR in P -thalassemia context, an HBB construct with a premature stop codon at its 16th codon (HBB'" 1 ) (indicated in Figure 3 A) as described in Kar et al., 2020 Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in beta-Globin-Encoding mRNA. Biochemistry 59, 80-84. 10.1021/acs.biochem.9b00761), was used. This nonsense mutation (wl6*) is frequently found in P -thalassemia patients. The coding sequence of green fluorescent protein (GFP) was cloned in-frame with and downstream of HBBw16* (as shown in Figure 3B), such that SCR across the premature stop codon result in full-length P- globin protein tagged to GFP. This HBB construct along with the recombinant expression vector expressing dCasl3a and the guide RNA were transfected in HEK293 cells, and the expression levels of P-globin protein were evaluated.
[00231] RESULTS
[00232] Figure 3B shows: (i) the expression levels of the full-length GFP-tagged P- globin detected by Western blot, and (ii) HBB-GFP mRNA level detected by RT- PCR. It can be observed from Figure 3B that while the P-globin protein was not detected in cells expressing non-targeting guide RNA, however, a full length P- globin protein (GFP-tagged) was detected in cells expressing //£>£> -targeting guide RNA (SEQ ID NO: 4). It was also observed from Figure 3B that there was no change in the HBB-GFP RNA levels in these conditions.
[00233] Therefore, it can be inferred from Figure 3 that dCasl3a can be used to induce SCR across the thalassemia-causing premature stop codon in HBB mRNA. Hence, the recombinant expression vector comprising /7BB- targeting guide RNA (SEQ ID NO: 4) and dCasl3a induce SCR across the thalassemia-causing premature stop codon in HBB mRNA.
[00234] Thus, it can be concluded that dCasl3a-mediated induction of SCR can potentially provide therapeutic benefit in human genetic diseases caused by nonsense mutations. The HRB-targeting guide RNA (SEQ ID NO: 4) recruits dCasl3a protein by hybridizing proximally downstream to the pre-mature stop codon in HBB gene, thus helps in enhancing the SCR without affecting the HBB mRNA level or its canonical translation. Further, the recombinant expression vector as described herein, can be personalized to a patient depending on the location of the nonsense mutation, for treating diseases caused by non-sense mutations.
[00235] Overall, the present disclosure discloses that the combination of guide polynucleotide as described herein along with the dCasl3 protein in the recombinant expression vector is crucial for inducing translational readthrough across the canonical stop codon or a pre-mature stop codon of the target mRNA sequence. It is well demonstrated in the Examples 2-5 that using the guide RNAs (as provided in Table 1 and Table 2) capable of hybridizing to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence of four different mRNAs - AGO I, MTCH2, VEGFA and HBB, dCasl3 protein (dCasl3a protein or dCasl3b protein) was recruited proximally downstream of the canonical stop codon or pre-mature stop codon of the target sequence to enhance (or induce) SCR across the pre-mature stop codons (Figure 3C) and canonical stop codons (Figure 7). The enhancement of SCR was achieved in a transcript- selective and stop codon-specific manner without altering the transcript (mRNA) level or its translation.
Advantages of the present disclosure [00236] The present disclosure discloses a CRISPR-Casl3 system for inducing the translational readthrough across the canonical or pre-mature stop codon of the target mRNA sequence. The CRISPR-Casl3 system or the recombinant expression vector comprises: (a) a guide polynucleotide complementary to a region to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24- 30 nucleotides, and wherein the guide polynucleotide is complementary to a region to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and (b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO:5, and SEQ ID NO: 31, operably linked to a promoter. The dCasl3 protein (dCasl3a protein or dCasl3b protein) are targeted to the downstream region of stop codons of the target sequence using specific guide RNAs selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30. The present disclosure also discloses a method for inducing translational readthrough across canonical stop codons of AGO1, MTCH2 and VEG FA mRNa, and pre-mature stop codon of HBB mRNA, using the recombinant expression vector expressing both the guide RNA as described herein and dCasl3 protein (dCasl3a or dCasl3b protein).
[00237] With the use of the guide RNAs as described herein, the enhancement of the translational readthrough across the canonical stop codons or pre-mature stop codon of the target mRNA is achieved in a transcript- selective and stop codon- specific manner without altering the transcript (mRNA) level or its translation. This specificity provides a key advantage over the existing SCR-inducing strategies/molecules, which are largely nonselective. Further, CRISPR-dCasl3a mediated induction or CRISPR-dCasl3b mediated induction of stop codon readthrough can be applied for the treatment of different diseases such as, P- thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis. For example, enhancement of readthrough in VEG FA can be useful in the treating conditions arising from excessive and abnormal angiogenesis, such as cancer and retinopathies. Induction of readthrough across the premature stop codon in HBB mRNA can provide therapeutic benefit to P-thalassemia patients with nonsense mutations. It can also be applied to other diseases arising as a result of premature stop codon such as Duchenne muscular dystrophy, cystic fibrosis, Hemophilia A and B. Further, the guide RNA used in the recombinant expression vector can be customized to every patient depending on the location of the premature stop codon in the disease-causing premature stop codon containing mRNA. Thus, induction of stop codon readthrough is a new addition to the CRISPR system’s expanding arsenal of biotechnological applications directed towards therapeutics.

Claims

I/We Claim:
1. A recombinant expression vector comprising:
(a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or a pre-mature stop codon of the target sequence; and
(b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO:5, and SEQ ID NO: 31, operably linked to a promoter.
2. The recombinant expression vector as claimed in claim 1, wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 26-28 nucleotides.
3. The recombinant expression vector as claimed in claim 1 or 2, wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
4. The recombinant expression vector as claimed in claim 1, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter.
5. The recombinant expression vector as claimed in claim 1, wherein the promoter driving the expression of dCasl3 protein is selected from the group
55 consisting of chicken p-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, and CAG promoter.
6. A bacterial host cell comprising the recombinant expression vector as claimed in anyone of the claims 1-5.
7. A method of inducing translational readthrough across a canonical stop codon or a pre-mature stop codon of a target sequence, said method comprising:
(a) obtaining a human cell comprising a polynucleotide having a canonical stop codon or a pre-mature stop codon of a target sequence, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9;
(b) obtaining a recombinant expression vector of claim 1, wherein the recombinant expression vector comprising: (i) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides, and wherein the guide polynucleotide complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or a pre-mature stop codon of the target sequence; and (ii) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO: 5, and SEQ ID NO: 31, operably linked to a promoter;
(c) transfecting the human cell with the recombinant expression vector to obtain a transfected cell, wherein the transfected cell produces guide RNA/ dCasl3 complex comprising the dCasl3 protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target sequence, and wherein the guide RNA recruits the dCasl3
56 protein hybridizing proximally downstream to the canonical stop codon or pre-mature stop codon of the target sequence; and
(d) analysing the expression levels of target proteins in the transfected cells, wherein an increase in the levels of the target proteins in the transfected cells indicates an increased translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence. A method of inducing translational readthrough across pre-mature stop codon of a target haemoglobin subunit beta (HBB) gene, said method comprising:
(a) obtaining a human cell having a pre-mature stop codon in HBB gene, wherein the HBB gene has a nucleotide sequence as set forth in SEQ ID NO: 9;
(b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30, complementary to a region downstream of a pre-mature stop codon in HBB gene having a nucleotide sequence as set forth in SEQ NO: 9, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter;
(c) transfecting the human cell with the recombinant expression vector to obtain a transfected cell, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCas 13a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the target haemoglobin subunit beta (HBB) gene, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the pre-mature stop codon in HBB gene having a nucleotide sequence as set forth in SEQ NO: 9; and
(d) analysing the expression levels of a P-globin protein in the transfected cells, wherein an increase in the expression levels of P-globin protein in the transfected cell indicates an increased translational readthrough
57 across the pre-mature stop codon of the HBB gene to produce the p- globin protein. A method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Argonaute 1 (Agol) protein, said method comprising:
(a) obtaining a human cell comprising a AGO1 target polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the polynucleotide has a canonical stop codon;
(b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, complementary to a region downstream of canonical stop codon of the AGO1 target polynucleotide sequence as set forth in SEQ NO: 6, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter;
(c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCas 13a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the AGO1 target polynucleotide sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 6; and
(d) analysing the expression levels of a target protein Ago lx in the transfected cells, wherein an increase in the expression levels of the Ago lx protein in the transfected cells indicates an increased translational readthrough across a canonical stop codon of the polynucleotide encoding Argonaute 1 (Agol) protein.
58 A method of inducing translational readthrough across canonical stop codon of a polynucleotide encoding Vascular endothelial growth factor (VEGF-A), said method comprising:
(a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ ID NO: 8, wherein the polynucleotide has a canonical stop codon;
(b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, complementary to a region downstream of a canonical stop codon of the VEGF-A target polynucleotide sequence as set forth in SEQ ID NO: 8, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter,
(c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the VEGF-A target polynucleotide sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ ID NO: 8; and
(d) analysing the expression levels of a target protein VEGF-Ax in the transfected cells, wherein an increase in the expression levels of the VEGF-Ax protein in the transfected cells indicates an increased translational readthrough across a canonical stop codon of a polynucleotide encoding VEGF-A protein. A method of inducing translational readthrough across canonical stop codon of a target polynucleotide encoding Mitochondrial carrier homolog 2 protein- (MTCH2), said method comprising: (a) obtaining a human cell comprising a polynucleotide having nucleotide sequence as set forth in SEQ NO: 7, wherein the polynucleotide has a canonical stop codon;
(b) obtaining a recombinant expression vector comprising: (i) a guide polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19, complementary to a region downstream of canonical stop codon of MTCH2 target polynucleotide sequence as set forth in SEQ ID NO: 7, operably linked to a promoter; and (ii) a polynucleotide encoding a dCasl3a protein, having a nucleotide sequence as set forth in SEQ ID NO: 5, operably linked to a promoter;
(c) transfecting the human cell with the recombinant expression vector to obtain transfected cells, wherein the transfected cell produces guide RNA/ dCasl3a complex comprising the dCasl3a protein complexed with the guide RNA, and wherein the guide RNA is capable of hybridizing to the MTCH2 target polynucleotide sequence, and wherein the guide RNA recruits the dCasl3a protein hybridizing proximally downstream to the canonical stop codon of SEQ NO: 7; and
(d) analysing the expression levels of readthrough proteins of MTCH2 in the transfected cells, wherein an increase in the expression levels of the readthrough proteins of MTCH2 in the transfected cells indicates an increased translational readthrough across a canonical stop codon of the target polynucleotide encoding MTCH2 protein. The method as claimed in anyone of the claims 7-11, wherein the human cell is selected from the group consisting of HEK293, HeLa, HepG2, MCF7, HPMEC, huh7, U2OS, and K562 cells. The method as claimed in claim in claim 8, wherein the human cell has at least one non-sense mutation at a nucleotide position in SEQ ID NO: 9, and wherein the non-sense mutation at the nucleotide position is selected from the group consisting of positions at 7, 8, 16, 18, 23, 27, 36, 38, 40, 44, 44, 60, 62, 83, 91, 96, 113, 122, 128, 131, 133, 145, and 146.
14. The method as claimed in claim in claim 7, wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
15. The method as claimed in anyone of the claims 7-11, wherein transfecting the human cell is done by a method selected from the group consisting of lipofection, nucleofection, electroporation, microinjection, and viral delivery systems.
16. The method as claimed in anyone of the claims 7-11, analysing the expression levels of proteins is done by a method selected from the group consisting of western blotting, ELISA, mass spectrometry, luminescencebased reporter assays, and fluorescence-based reporter assays.
17. The method as claimed in claim 7, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3 protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, EF-la, and CAG promoter.
18. The method as claimed in anyone of the claims 8-11, wherein the promoter driving the expression of guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3a protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, EF-la, and CAG promoter.
19. A composition compnsing a recombinant expression vector, said recombinant expression vector comprising:
(a) a guide polynucleotide complementary to a target sequence, operably linked to a promoter, wherein the target sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and wherein the guide polynucleotide has contiguous nucleotides complementary to the target sequence in the range of 24-30 nucleotides, and wherein the guide polynucleotide is complementary to a region within at least 50 nucleotides downstream of a canonical stop codon or pre-mature stop codon of the target sequence; and
(b) a polynucleotide encoding dCasl3 protein having a nucleotide sequence selected from SEQ ID NO: 5, and SEQ ID NO: 31, operably linked to a promoter.
20. The composition as claimed in claim 19, wherein the guide polynucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30.
21. The composition as claimed in claim 19, wherein the promoter driving the expression of the guide polynucleotide is selected from the group consisting of U6 promoter, tRNAVal promoter, and Hl promoter, and wherein the promoter driving the expression of dCasl3 protein is selected from the group consisting of chicken P-actin promoter, SV40 promoter, CMV promoter, Ubc promoter, EF-la, and CAG promoter.
22. The composition as claimed in claim 19, wherein the composition further comprises excipients.
62 The composition as claimed in claim 19, wherein the composition induces translational readthrough across the canonical stop codon or the pre-mature stop codon of the target sequence. The composition as claimed in claim 19, wherein the composition is delivered to a subject for treating a disease. The composition as claimed in claim 24, wherein the composition is delivered by a method selected from the group consisting of Lentivirus, Adeno associated virus (AAV) systems and lipid based nano carriers. The composition as claimed in claim 24, wherein the disease is selected from the group consisting of P-thalassemia, duchenne muscular dystrophy, cystic fibrosis, hemophilia, cancer, retinopathies, usher syndrome, hurler syndrome, spinal muscular atrophy, cystinosis, and infantile neuronal ceroid lipofuscinosis. A guide polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 30. The method as claimed in anyone of the claims 7-11, wherein the guide RNA is capable of hybridizing to the target sequence in transcript-selective and selective manner.
63
PCT/IN2022/051066 2021-12-13 2022-12-12 Crispr-dcas13 system, composition, and method to induce translational readthrough across stop codons WO2023112048A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN202141058043 2021-12-13
IN202141058043 2021-12-13

Publications (1)

Publication Number Publication Date
WO2023112048A1 true WO2023112048A1 (en) 2023-06-22

Family

ID=86773933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IN2022/051066 WO2023112048A1 (en) 2021-12-13 2022-12-12 Crispr-dcas13 system, composition, and method to induce translational readthrough across stop codons

Country Status (1)

Country Link
WO (1) WO2023112048A1 (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015035091A1 (en) * 2013-09-04 2015-03-12 Cold Spring Harbor Laboratory Reducing nonsense-mediated mrna decay
US20180282759A1 (en) * 2017-03-31 2018-10-04 National Tsing Hua University System for over-expressing target protein and method for over-expressing target protein
WO2019060746A1 (en) * 2017-09-21 2019-03-28 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
WO2019191232A2 (en) * 2018-03-27 2019-10-03 University Of Rochester Nucleic acid molecules for pseudouridylation
WO2021011493A1 (en) * 2019-07-12 2021-01-21 Duke University 3' utr crispr-dcas 13 engineering system and methods of using same
WO2021211598A1 (en) * 2020-04-14 2021-10-21 University Of Massachusetts Dcas13-mediated therapeutic rna base editing for in vivo gene therapy

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015035091A1 (en) * 2013-09-04 2015-03-12 Cold Spring Harbor Laboratory Reducing nonsense-mediated mrna decay
US20180282759A1 (en) * 2017-03-31 2018-10-04 National Tsing Hua University System for over-expressing target protein and method for over-expressing target protein
WO2019060746A1 (en) * 2017-09-21 2019-03-28 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
WO2019191232A2 (en) * 2018-03-27 2019-10-03 University Of Rochester Nucleic acid molecules for pseudouridylation
WO2021011493A1 (en) * 2019-07-12 2021-01-21 Duke University 3' utr crispr-dcas 13 engineering system and methods of using same
WO2021211598A1 (en) * 2020-04-14 2021-10-21 University Of Massachusetts Dcas13-mediated therapeutic rna base editing for in vivo gene therapy

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ESWARAPPA SANDEEPA M.; POTDAR ALKA A.; KOCH WILLIAM J.; FAN YI; VASU KOMMIREDDY; LINDNER DANIEL; WILLARD BELINDA; GRAHAM LINDA M.;: "Programmed Translational Readthrough Generates Antiangiogenic VEGF-Ax", CELL, vol. 157, no. 7, 19 June 2014 (2014-06-19), Amsterdam NL , pages 1605 - 1618, XP028874990, ISSN: 0092-8674, DOI: 10.1016/j.cell.2014.04.033 *
KAR DEBALEENA, SELLAMUTHU KARTHI, KUMAR SANGEETHA DEVI, ESWARAPPA SANDEEP M.: "Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in β-Globin-Encoding mRNA", BIOCHEMISTRY, vol. 59, no. 1, 14 January 2020 (2020-01-14), pages 80 - 84, XP093076613, ISSN: 0006-2960, DOI: 10.1021/acs.biochem.9b00761 *
MANJUNATH LEKHA E., SINGH ANUMEHA, SAHOO SARTHAK, MISHRA ASHUTOSH, PADMARAJAN JINSHA, BASAVARAJU CHAITHANYA G., ESWARAPPA SANDEEP : "Stop codon read-through of mammalian MTCH2 leading to an unstable isoform regulates mitochondrial membrane potential", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 295, no. 50, 1 December 2020 (2020-12-01), US , pages 17009 - 17026, XP093076612, ISSN: 0021-9258, DOI: 10.1074/jbc.RA120.014253 *
SINGH ANUMEHA, MANJUNATH LEKHA E, KUNDU PRADIPTA, SAHOO SARTHAK, DAS ARPAN, SUMA HARIKUMAR R, FOX PAUL L, ESWARAPPA SANDEEP M: "Let-7a-regulated translational readthrough of mammalian AGO1 generates a microRNA pathway inhibitor", THE EMBO JOURNAL, vol. 38, no. 16, 15 August 2019 (2019-08-15), Oxford , pages 1 - 20, XP093076610, ISSN: 0261-4189, DOI: 10.15252/embj.2018100727 *

Similar Documents

Publication Publication Date Title
Izquierdo et al. Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition
CN111405912A (en) Polynucleotides, compositions and methods for genome editing
US20080293142A1 (en) Multiple shRNA Expression Vectors and Methods of Construction
EP2982758A1 (en) Genome editing for the treatment of huntington's disease
KR20210102883A (en) Compositions and methods for expressing a transgene from an albumin locus
JP2017506885A (en) High titer production of adeno-associated virus vector
KR20210102882A (en) Nucleic acid constructs and methods of use
WO2012056440A1 (en) COMPOSITIONS AND METHODS FOR ACTIVATING EXPRESSION BY A SPECIFIC ENDOGENOUS miRNA
JP2021522783A (en) Lentivirus-based vectors and related systems and methods for eukaryotic gene editing
JP2022534988A (en) Use of TREM to modulate tRNA pools
CA3129321A1 (en) Modulation of rep protein activity in closed-ended dna (cedna) production
JP2011507554A (en) Methods and compositions for increasing gene expression
EP3302522B1 (en) Means and methods for treating facioscapulohumeral muscular dystrophy (fshd).
US7972816B2 (en) Efficient process for producing dumbbell DNA
JP2023514149A (en) RNA assembly and expression mediated by ribozymes
JP2022534627A (en) Method for treating muscular dystrophy by targeting DMPK gene
US20220154186A1 (en) Novel nucleic acid molecules and their use in therapy
Pinto et al. Evaluation of AAV-mediated delivery of shRNA to target basal-like breast cancer genetic vulnerabilities
WO2012056449A2 (en) Compositions and methods for specific cleavage of exogenous rna in a cell
Economos et al. Antispacer peptide nucleic acids for sequence-specific CRISPR-Cas9 modulation
JP2023522020A (en) CRISPR inhibition for facioscapulohumeral muscular dystrophy
JP2022548399A (en) Compositions and methods for modulating hepatocyte nuclear factor 4-alpha (HNF4α) gene expression
WO2023112048A1 (en) Crispr-dcas13 system, composition, and method to induce translational readthrough across stop codons
WO2023039440A9 (en) Hbb-modulating compositions and methods
WO2019052000A1 (en) Stat3 signal path targeting mirna, preparation method therefor, and application thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22906869

Country of ref document: EP

Kind code of ref document: A1