WO2023109538A1

WO2023109538A1 - Adaptor used for characterizing polynucleotide and use thereof

Info

Publication number: WO2023109538A1
Application number: PCT/CN2022/136442
Authority: WO
Inventors: 刘先宇; 常馨
Original assignee: 成都齐碳科技有限公司
Priority date: 2021-12-15
Filing date: 2022-12-05
Publication date: 2023-06-22
Also published as: CN114262735A

Abstract

Provided are an adaptor used for characterizing a polynucleotide and a use thereof. The adaptor contains {L-S}_n or {S-L}_n in the 5' to 3' end direction. The L double strand contains polynucleotide strand L' connected to S and complementary strand L" of L', and L' comprises a first segment far away from blocking strand S and a second segment close to blocking strand S. The first segment contains a modified portion. The second segment contains a motor protein binding active region. The active region is closed by complementary strand L". The complementary strand L" contains a polymer that can compete with a motor protein so as to bind to strand L'.

Description

Adapters for characterizing polynucleotides and uses thereof

Cross References to Related Applications

This application claims the priority of Chinese patent application 202111534007.8 entitled "Adapters used in characterizing polynucleotides and their uses" filed on December 15, 2021, the entire contents of which are incorporated herein by reference middle.

technical field

The application belongs to the field of gene sequencing, and relates to an adapter used in characterizing polynucleotides, and also relates to a method for characterizing polynucleotides using the adapter.

Background technique

Nanopore sequencing technology has the characteristics of long read length, direct reading of modification information and parallel analysis of real-time data production. Nucleic acid-related variations such as shearing and RNA editing) and modification information (including but not limited to methylation, acetylation, etc.) have obvious advantages over next-generation sequencing or other sequencing platforms. The platform supports parallel data production and analysis to realize real-time mutation/modification detection and diagnosis, and the portable design makes it have a wide range of application prospects.

After applying a voltage to both sides of the nanopore, when the analyte (such as polynucleotide, polypeptide) passes through the nanopore, the current will drop, and the degree of current blockage caused by the analyte with different structures is different. When the analyte temporarily stays in the barrel of the nanopore for a period of time, the current changes. Nanopores detect nucleotides that give current changes of known character and duration.

In nanopore sequencing, when no potential is applied, the blocking strand of the polynucleotide is often capable of stalling the helicase, preventing further movement of the helicase across the blocking strand along the target polynucleotide. However, when the helicase-polynucleotide complex is in contact with the transmembrane pore and a potential is applied, one or more stalled helicases can be moved across the blocking strand on the polynucleotide and along the polynucleotide to be tested. The sequence is moved to achieve the purpose of sequencing. Therefore, adapters containing enzyme-binding regions and blocking strands are required for nanopore sequencing.

In nanopore sequencing, nucleic acid adapters such as Y-shaped adapters or hairpin-like adapters (patent CN202111018113.0) are usually used, wherein motor proteins such as helicase are bound to the binding region of the adapters. Adapters in the related art have a phenomenon of adenosine triphosphate (ATP) depletion in practical applications, that is, adapters that have not been sequenced through the holes will also consume a large amount of ATP. Since the reduction of ATP concentration in the sequencing environment will lead to a decrease in sequencing speed, the sequencing time is too short, which in turn affects the output of sequencing data. Therefore, there is currently a need for sequencing methods that can reduce ATP consumption.

Contents of the invention

In view of the technical deficiencies in the related art, the purpose of the present application is to provide a new adapter, and the present application also provides a preparation method of the adapter and its use for nanopore sequencing. Using the adapter of the present application greatly reduces the ATP waste in nanopore sequencing.

The application provides the following examples:

In one aspect, the present application provides an adapter for characterizing a target polynucleotide, the adapter comprising {LS} _n or {SL} _n in the direction of the 5' to 3' end,

Wherein, L is a modified double-stranded polynucleotide, S is a blocking strand, and n is a positive integer;

And, the L double strand comprises a polynucleotide strand L' connected to S and a complementary strand L" of said L',

The L' includes a first segment away from the blocking chain S and a second segment close to the blocking chain S, the first segment includes a modified part, and the second segment includes a motor protein binding active region , the active region is blocked by the complementary chain L";

The complementary chain L" comprises a polymer capable of competing with said motor protein for binding to the L' chain.

The adapter according to the present application, wherein the adapter comprises {D ₁ -LS} _n or {SLD ₁ } _n in the direction from 5' to 3' end, D ₁ is the first double-stranded polynucleotide,

And/or, the adapter comprises {LSD ₂ } _n or {D ₂ -SL} _n in the direction from the 5' to the 3' end, and D ₂ is the second double-stranded polynucleotide;

Optionally, the n is an integer of 1-20, for example, n may be 1, 2, 3, 4, 5, 6, 7, 8 or more.

According to the adapter described in the present application, wherein, the modified part of the chain L' makes the binding ability of the first segment to motor protein weaker than that of the second segment, or makes the first segment not binds to motor proteins;

Optionally, the modification part in the chain L' is ribonucleotide (RNA) and/or nucleic acid analogue;

The ribonucleotides include 2'-modified ribonucleotides, optionally 2'alkoxy-modified ribonucleotides, and more optionally 2'methoxy-modified ribonucleotides;

The nucleic acid analogs include any one or any combination of two or more of peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), and bridge nucleic acid (BNA). Optionally, the unmodified part of the chain L' is a deoxyribonucleotide;

Optionally, the number of modified polynucleotides is 1-20, more preferably 1-15, 1-10 or 2-6, further optionally 3, 4, 5.

Wherein, modification is provided at one end (first section) of the polynucleotide chain L' away from the blocking chain S, and the binding ability of the modified end (first section) to the motor protein is weaker, so that in the preparation process of the adapter In , the motor protein is more likely to be combined into the end (the second segment) of the polynucleotide chain L' close to the blocking chain S, which is more conducive to the subsequent expulsion of the motor protein. Those skilled in the art can understand that the modified part can be an optional modification, as long as the modification can weaken the binding of the modified part to the motor protein. The length of the modification part can be determined according to the length of the polynucleotide chain L'. Without being limited to any particular theory, after ensuring that one end (the second segment) of the polynucleotide chain L' near the blocking chain S has a sufficient number of polynucleotides bound to the motor protein, the remaining parts can be selectively modified , without affecting the technical effect of the present application.

According to the adapter described in the present application, wherein, the end of the complementary strand L" close to the blocking strand S includes a part with stronger binding force to the polynucleotide strand L' or the second segment; optionally, This part contains PNA or LNA.

The main function of the complementary chain L" is to repel the motor protein by complementing the polynucleotide chain L'. Those skilled in the art can understand that it is not limited to any specific theory, as long as the complementary chain L" has more Strong binding force. In the preparation of the adapter, the motor protein can be expelled to the blocking strand by complementing the polynucleotide strand L'.

According to the adapter described in the present application, wherein, the end of the complementary chain L" away from the blocking chain S comprises a first part of click chemistry, an optional click reaction group;

And/or, the D ₁ double strand comprises a polynucleotide chain D ₁ ′ connected to L’ and its complementary chain D ₁ ″, and one end of the complementary chain D ₁ ″ near the blocking chain S comprises the first click chemistry Two-part, optional click reactive group;

And/or, the D ₂ double strand comprises a polynucleotide strand D ₂ ′ connected to the blocking strand S and its complementary strand D ₂ ″, and the complementary strand D ₂ ″ includes a part that does not hybridize with the adapter ; Optionally, the part that does not hybridize with the adapter is located at one end of the complementary strand D ₂ ″ adjacent to the blocking strand S.

This moiety can be made more firmly bound by the introduction of click chemistry groups.

The adapter according to the present application, wherein the blocking chain has a structure different from that of the polynucleotide and is used to block motor proteins;

Optionally, the blocker chain comprises one or more nitroindole, one or more inosine, one or more acridine, one or more 2-aminopurine, one or more 2-6- Diaminopurine, one or more 5-bromo-deoxyuridines, one or more inverted thymidines (inverted dTs), one or more inverted dideoxythymidines (ddTs), one or more dideoxy Cytidines (ddCs), one or more 5-methylcytidylic acid, one or more 5-hydroxymethylcytidine, one or more 2'alkoxy-modified ribonucleotides (optionally 2' methoxy-modified ribonucleotides), one or more isodeoxycytidines (iso-dCs), one or more isodeoxyguanosines (iso-dGs), one or more C3 groups, one or more One or more photocleavable (PC) groups, one or more hexanediols, one or more iSp9 groups, one or more iSp18 groups, polymers, or one or more thiol linkages.

In an optional embodiment, the number of 2' alkoxy-modified ribonucleotides is 1-10, optionally 2-6; optionally,

The 2'alkoxy-modified ribonucleotides are uniformly distributed in the blocking chain.

According to the adapter described in the present application, one end of the L' far away from the S comprises a leader strand sequence;

The end of S away from L' is used to connect the target polynucleotide;

The polynucleotide chain L' connected to S contains a motor protein binding active region at one end close to the blocking chain S, and the active region is blocked by the complementary chain L";

The motor protein is a protein capable of binding to a polynucleotide and controlling its movement through a pore; optionally, the motor protein is selected from one of polymerase, exonuclease, helicase and topoisomerase one or more, more optionally, the helicase is selected from one of Hel308 helicase, RecD helicase, Tral helicase, TrwC helicase, XPD helicase and DDA helicase or more.

In another aspect, the present application provides a complex comprising the adapter described in the present application, and the motor protein and/or the target polynucleotide, wherein the motor protein is located at the blocking chain .

In another aspect, the application provides a method for preparing the complex, comprising:

S1: binding the Y1 chain containing L'-S to the motor protein, and the binding region is located in the L' chain;

S2: adding the PNA-R chain comprising the complementary chain L" to obtain the complex, wherein the motor protein is driven to the blocking chain by the PNA-R chain;

Optionally, the method includes

S101: Binding the annealed product of the Y1 chain comprising D ₁ '-L'-SD ₂ ', the Y2 chain comprising D ₁ ” and the YB chain comprising D ₂ ” to the motor protein, the binding region is located at the L of the annealed product 'chain at;

S102: Adding the PNA-R chain containing the complementary chain L" to obtain the complex, wherein the motor protein is driven to the blocking chain by the PNA-R chain.

The present application also provides a method for characterizing a target polynucleotide, the method using the adapter or the complex;

Optionally, the method includes:

(a) moving the polynucleotide of interest across the transmembrane pore,

wherein said target polynucleotide is linked to said adapter or said complex; and

(b) taking one or more electrical and/or optical measurements as the polynucleotide moves relative to the pore, wherein the measurements represent one or more characteristics of the polynucleotide and are determined by This characterizes the polynucleotide of interest.

In another aspect, the present application also provides a kit for characterizing polynucleotides,

The composition of the kit is any one of the following 1)-4):

1) comprising the independently packaged adapter, optionally also comprising the independently packaged motor protein;

2) comprising said complex;

3) comprising the compound obtained by the preparation method;

4) Contains the following components individually packaged:

As described in the adapter, the polynucleotide chain L' for linking with S, the blocking chain S, and the complementary chain L" of the nucleotide chain L', optionally, also include an independent The packaged motor protein. Block chains In nanopore sequencing, there is a relatively serious phenomenon of ATP emptying in existing sequencing adapters, that is, adapters that have not been sequenced through holes will also consume a large amount of ATP. In sequencing fires, the ATP concentration The reduction will lead to a decrease in sequencing speed, and the sequencing time is too short, which will affect the output value of sequencing data. The applicant of this application tries to provide a method that does not require the consumption of ATP to drive the motor protein loaded on the adapter To the blocking chain, thereby avoiding the empty consumption of ATP.The technical concept of the present application is described as follows in conjunction with Fig. 1, and Fig. 1 is the schematic diagram of the principle of using the Y-type adapter of the present application to expel the helicase to the blocking chain; wherein, Y -Top-1 chain (Y1 chain) contains D ₁ '-L'-SD ₂ ', Y-Top-2 chain (Y2 chain) contains D ₁ ", YB chain contains D ₂ "; first, Y1 chain, Y2 chain and YB strand anneal, then add helicase, the helicase binds to the L' strand, and the Y-Top-2 strand contains a chemical click group; add the PNA-R strand, the PNA-R chain can better combine with the L' in the Y-Top-1 chain (Y1 chain), and the chemical click reaction between the PNA-R chain and the Y-Top-2 chain further stabilizes the combination, thereby binding to the The helicase at the L' strand is expelled to the S region along the direction from the 5' to the 3' end. This expulsion is driven by the binding force between the double strands and does not need to consume any ATP, thereby reducing the actual sequencing process. consumption of ATP;

Wherein, in Fig. 1, the star signal of the Y-Top-2 chain is a click reaction group, which is modified by dibenzocyclooctyne (DBCO, Dibenzocyclooctyne) in a specific embodiment; the PNA-R chain The triangle signal in is the click reaction group, which is N3 in the specific example.

Compared with related technologies, the technical solution of the present application has the following advantages:

The present application provides a novel adapter, which can greatly avoid ATP waste in nanopore sequencing and significantly improve sequencing efficiency.

Description of drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the accompanying drawings that need to be used in the embodiments of the present application. Obviously, the accompanying drawings described below are only some embodiments of the present application. Those of ordinary skill in the art can also obtain other drawings based on these drawings without making creative efforts.

Figure 1 is a schematic diagram of the principle of using the Y-type adapter of the present application to expel the helicase to the blocking chain; wherein, the Y-Top-1 chain (Y1 chain) contains D ₁ '-L'-SD ₂ ', Y- Top-2 chain (Y2 chain) contains D ₁ ″, and YB chain contains D ₂ ″; first, Y1 chain, Y2 chain, and YB chain are annealed, and then a helicase is added, which binds to the L' chain , and the Y-Top-2 chain contains a chemical click group; adding the PNA-R chain, the PNA-R chain can better combine with the L' in the Y-Top-1 chain (Y1 chain), and The chemical click reaction between the PNA-R strand and the Y-Top-2 strand further stabilizes the binding, thereby expelling the helicase bound at the L' strand to the S region along the 5' to 3' end direction, which The expulsion is driven by the binding force between the double strands and does not need to consume any ATP, thus reducing the consumption of ATP in the actual sequencing process;

Wherein, in Fig. 1, the star-shaped signal of the Y-Top-2 chain is a click reaction group, which is DBCO modification in a specific embodiment; the triangle signal in the PNA-R chain is a click reaction group, In a specific embodiment, it is N3.

Fig. 2 is a quality inspection diagram of the adapter adapter complex before and after loading the fourth-strand PNA according to Example 1 of the present application.

Fig. 3 is a graph of ATP/NADH consumption measured after driving enzymes to blocker chains of different structures and sequences according to Example 2 of the present application.

Fig. 4 shows the reduction rate of different adapters in actual sequencing according to Example 3 of the present application.

Detailed ways

Features and exemplary embodiments of various aspects of the present application will be described in detail below. In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the application. It will be apparent, however, to one skilled in the art that the present application may be practiced without some of these specific details. The following description of the embodiments is only to provide a better understanding of the present application by showing examples of the present application.

Furthermore, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "polynucleotide" includes two or more polynucleotides, reference to "anchor" includes two or more anchors, reference to "helicase" includes two or more Helicase, reference to "transmembrane pore" includes two or more pores, etc.

Adapter

The present application provides an adapter for characterizing polynucleotides, which comprises {LS} _n or {SL} _n in the direction of the 5' to 3' end, wherein L is a modified double-stranded polynucleotide , S is a blocking chain, and n is an integer; and, the L double-strand includes a polynucleotide chain L' connected to S and a complementary chain L "of the L', and the L' includes a chain far away from the blocking chain S The first segment of the first segment, and the second segment near the blocking chain S, the first segment includes a modified part, the second segment includes a motor protein binding active region, and the active region is blocked by the complementary chain L "Closed; complementary strand L" comprises a polymer capable of competing with the motor protein for binding to the L' strand.

According to the adapter described in the present application, wherein the adapter comprises {D ₁ -LS} _n or {SLD ₁ } _n , D ₁ is the first double-stranded polynucleotide; and/or, the adapter is in The direction from the 5' to the 3' end includes {LSD ₂ } _n or {D ₂ -SL} _n , D ₂ is the second double-stranded polynucleotide; optionally, the n is an integer of 1-20, for example, n can be 1, 2, 3, 4, 5, 6, 7, 8, or more.

According to the adapter described in the present application, wherein, the modified part of the chain L' makes the binding ability of the first segment to motor protein weaker than that of the second segment, or makes the first segment not binds to motor proteins; and/or

The modification part in the chain L' is ribonucleotide and/or nucleic acid analog.

Optionally, the ribonucleotides include 2'-modified ribonucleotides, optionally 2'alkoxy-modified ribonucleotides, more optionally 2'methoxy-modified ribonucleotides or preferably, the nucleic acid analogue includes any one or any combination of two or more of peptide nucleic acid, glycerol nucleic acid, threose nucleic acid, locked nucleic acid, and bridge nucleic acid; and/or the motor in the chain L' The protein binding active region is deoxyribonucleotides; and/or the number of ribonucleotides and/or nucleic acid analogs is 1-20, 1-15 or 1-10; optional 2-6, for example 2, 3, 4, 5 or 6.

Among them, the modification is provided at the end of the polynucleotide chain L' away from the blocking chain S, and the binding ability of the modified end to the motor protein is weaker, making it easier for the motor protein to bind to the polynucleotide chain during the preparation of the adapter L' is close to the end of the blocking chain S, which is more conducive to the subsequent expulsion of the motor protein. Those skilled in the art can understand that the modified part can be an optional modification, as long as the modification can weaken the binding of the modified part to the motor protein. The length of the modification part can be determined according to the length of the polynucleotide chain L'. Without being limited to any particular theory, after ensuring that one end of the polynucleotide chain L' near the blocking chain S has a sufficient number of polynucleotides bound to the motor protein, the remaining parts can be selectively modified without affecting the present application. technical effect.

According to the adapter described in the present application, wherein, the end of the complementary chain L" close to the blocking chain S contains a part with stronger binding force with the polynucleotide chain L'; optionally, this part contains PNA or LNA.

According to the adapter described in the present application, wherein, the end of the complementary chain L" far away from the blocking chain S comprises a first part of click chemistry, optionally a click reaction group;

The adapter according to the present application, wherein the blocking chain has a structure different from that of the polynucleotide.

Complex

The present application provides a complex, which comprises the adapter described in the present application and a motor protein, wherein the motor protein is located at the blocking chain;

Optionally, the motor protein is a protein capable of binding to a polynucleotide and controlling its movement through the pore; optionally an enzyme. For example, the enzyme is selected from one or more of polymerase, exonuclease, helicase and topoisomerase. For example, the helicase is selected from one or more of Hel308 helicase, RecD helicase, Tral helicase, TrwC helicase, XPD helicase and DDA helicase.

The application provides the preparation method of the complex, including:

Optionally, the method includes

polynucleotide

Polynucleotides such as nucleic acids are macromolecules containing two or more nucleotides. A polynucleotide or nucleic acid may comprise any combination of nucleotides. Nucleotides can be naturally occurring or synthetic. One or more nucleotides in a polynucleotide may be oxidized or methylated. One or more nucleotides in a polynucleotide may be damaged. For example, a polynucleotide may comprise pyrimidine dimers. Such dimers are often associated with UV-induced damage and are the leading cause of skin melanoma. One or more nucleotides in a polynucleotide may be modified, for example, with a label or tag. Suitable markers are described below.

The nucleotides in a polynucleotide are typically ribonucleotides or deoxyribonucleotides. The polynucleotide may comprise the following nucleosides: adenosine, uridine, guanosine and cytidine. The nucleotides may be deoxyribonucleotides. The polynucleotide may optionally include the following nucleosides: deoxyadenosine (dA), deoxyuridine (dU) and/or thymidine (dT), deoxyguanosine (dG) and deoxycytidine (dC).

Nucleotides usually contain monophosphates, diphosphates or triphosphates. Phosphate can be attached on the 5" or 3" side of the nucleotide.

Suitable nucleotides include, but are not limited to, adenosine monophosphate (AMP), guanosine monophosphate (GMP), thymidine monophosphate (TMP), uridine monophosphate (UMP), cytidine monophosphate (CMP), Cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dGMP), deoxythymidine monophosphate (dTMP), deoxyuridine monophosphate (dUMP ) and deoxycytidine monophosphate (dCMP). The nucleotides may optionally be selected from AMP, TMP, GMP, CMP, UMP, dAMP, dTMP, dGMP, dCMP and dUMP. The nucleotides are most preferably selected from dAMP, dTMP, dGMP, dCMP and dUMP. The polynucleotide may optionally comprise the following nucleotides: dAMP, dUMP and/or dTMP and dCMP.

The nucleotides in the polynucleotide may be linked to each other in any manner. Nucleotides are usually linked by their sugar and phosphate groups, as in nucleic acids. The nucleotides may be linked via their nucleobases, as in pyrimidine dimers.

The polynucleotide may be a nucleic acid. The polynucleotide can be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), or other nucleic acid with nucleotide side chain of synthetic polymers. The PNA backbone consists of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. The GNA backbone consists of repeating ethylene glycol units linked by phosphodiester bonds. The TNA backbone consists of repeating threose sugars linked together by phosphodiester bonds. The LNA is formed from nucleotides with an additional bridge linking the 2'' oxygen to the 4" carbon in the ribose sugar as discussed above.

The polynucleotide is most preferably ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).

The polynucleotide can be of any length. For example, a polynucleotide can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotides in length. The polynucleotide may be 1000 or more nucleotides, 5000 or more nucleotides in length or 100000 or more nucleotides in length.

The helicase may move along all or only part of the target polynucleotide in the methods of the present application. All or part of the target polynucleotide can be characterized using the methods of the present application.

A polynucleotide of interest can be single-stranded. At least a portion of the polynucleotide of interest is optionally double-stranded. Helicases typically bind to single-stranded polynucleotides. If at least a portion of the target polynucleotide is double-stranded, the target polynucleotide optionally includes single-stranded regions or non-hybridizing regions. The one or more helicases are capable of binding to the single-stranded region or to one strand of the non-hybridizing region. The target polynucleotide optionally includes one or more single-stranded regions or one or more non-hybridizing regions.

sample

The polynucleotide of interest is present in any suitable sample. The application is generally performed on samples known to contain or suspected to contain the polynucleotide of interest. Alternatively, the present application can be performed on a sample to identify one or more target polynucleotides that are known or expected to be present in the sample.

The sample can be a biological sample. The present application may be practiced in vitro on samples obtained or extracted from any organism or microorganism. The organisms or microorganisms are generally archaean, prokaryotic or eukaryotic, and generally belong to one of the following five kingdoms: Plantae, Animalia, Fungi, Prokaryotes and Protists. The application is performed in vitro on samples obtained or extracted from any virus. The sample is optionally a liquid sample. Samples typically include bodily fluids of a patient. The sample may be urine, lymph, saliva, mucus or amniotic fluid, but may alternatively be blood, plasma or serum. Typically, the sample is of human origin, but may alternatively be from other mammals, such as from a commercially bred animal such as a horse, cow, sheep or pig, or may be a pet such as a cat or dog. Alternatively, samples of plant origin are usually obtained from commercial crops such as cereals, legumes, fruits or vegetables such as wheat, quinoa, barley, oats, canola, corn, soybeans, rice, bananas, apples, tomatoes, potatoes, grapes, Tobacco, beans, lentils, sugar cane, cocoa, cotton.

The sample can be a non-biological sample. Non-biological samples can be selected as liquid samples. Examples of non-biological samples include surgical fluids, water such as drinking water, sea water or river water, and reagents for laboratory testing.

Samples are often processed prior to testing, such as by centrifugation or filtration through membranes to remove unwanted molecules or cells, such as red blood cells. Testing can be performed immediately after obtaining said sample. Typically the samples may also be stored prior to analysis, optionally below -70°C.

blocking chain

The one or more blocker strands are included in the target polynucleotide. The one or more blocking strands are optionally part of the target polynucleotide, eg it/they interrupt the polynucleotide sequence. The one or more blocker strands are optionally not part of one or more block molecules such as speed bumps for hybridization to the polynucleotide of interest.

Have any number of blocker strands in the target polynucleotide, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more blocks chain. Optionally there are 2, 4 or 6 blocker strands in the polynucleotide of interest. There may be blocker strands in different regions of the polynucleotide of interest, for example a blocker strand in the leader sequence and a blocker strand in the hairpin loop.

The one or more blocking strands each provide an energy barrier that the one or more helicases cannot overcome even in active mode. The one or more blocking strands can be achieved by reducing the pull of the helicase (e.g., by removing bases of nucleotides in the target polynucleotide) or physically blocking the movement of the one or more helicases (eg, using bulky chemical groups) to stall one or more helicases.

The one or more blocking strands may comprise any molecule or combination of any molecules that stall one or more helicases. The one or more blocker strands may comprise any molecule or combination of any molecules that prevent movement of the one or more helicases along the target polynucleotide. It directly determines whether, in the absence of a transmembrane pore and an applied potential, one or more helicases lodges at one or more blocking strands. For example, this can be tested as shown in the Examples, eg the ability of the helicase to pass through the blocking strand and displace the complementary strand of DNA can be measured by PAGE.

The one or more blocking chains typically comprise linear molecules such as polymers. The one or more blocking strands typically have a different structure than the target polynucleotide. For example, if the target polynucleotide is DNA, the one or more blocking strands are typically not deoxyribonucleic acid. In particular, if the polynucleotide of interest is deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), the one or more blocking strands optionally include peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid ( TNA), locked nucleic acid (LNA) or synthetic polymers with nucleotide side chains.

One or more blocker strands optionally include one or more nitroindole, for example one or more 5-nitroindole, one or more inosine, one or more acridine, one or more 2 - aminopurines, one or more 2-6-diaminopurines, one or more 5-bromo-deoxyuridines, one or more reverse thymidines (reverse dTs), one or more reverse deoxythymidines glycosides (ddTs), one or more dideoxycytidines (ddCs), one or more 5-methylcytidines, one or more 5-hydroxymethylcytidines, one or more 2' alkoxy modifications Ribonucleotides (optionally 2'methoxy-modified ribonucleotides), one or more isodeoxycytidines (iso-dCs), one or more isodeoxyguanosines (iso-dGs), one or Multiple iSpC3 groups (i.e., nucleotides lacking sugar and base), one or more photocleavage (PC) groups, one or more hexanediol groups, one or more blocker chain 9 (iSp9 ) group, one or more chain-blocking 18 (iSp18) groups, a polymer or one or more thiol linkages. The one or more blocking chains may comprise any combination of these groups. Many of these groups are commercially available from (Integrated DNA).

The one or more blocking chains may contain any number of these groups. For example, for 2-aminopurine, 2-6-diaminopurine, 5-bromodeoxyuridine, reverse dTs, ddTs, ddCs, 5-methylcytidine, 5-hydroxymethylcytidine, 2'alkoxy base-modified ribonucleotides (optionally 2'methoxy-modified ribonucleotides), iso-dCs, iso-dGs, iSpC3 groups, PC groups, hexanediol groups and thiol linkages, one or more Each blocking chain may optionally comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more. One or more blocker strands optionally comprise 2, 3, 4, 5, 6, 7, 8 or more iSp9 groups. One or more blocker strands optionally comprise 2, 3, 4, 5 or 6 or more iSpl8 groups. Optional chain-blocking groups are 4 iSp18 groups.

The polymer can be optionally a polypeptide or polyethylene glycol (PEG). The polypeptide optionally comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more amino acids. The PEG optionally comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more monomeric units.

One or more blocking strands optionally include one or more abasic nucleotides (i.e., nucleotides lacking nucleobases), e.g., 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12 or more abasic nucleotides. A nucleobase can be replaced by -H(idSp) or -OH in an abasic nucleotide. An abasic blocker strand can be inserted into a polynucleotide of interest by removing a nucleobase from one or more adjacent nucleotides.

The one or more blocking strands optionally contain one or more chemical groups that physically cause the one or more helicases to stall. The one or more chemical groups may be one or more pendant chemical groups. The one or more chemical groups may be linked to one or more nucleobases in the target polynucleotide. The one or more chemical groups may be attached to the backbone of the polynucleotide of interest. There may be any number, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more of these chemical groups. Suitable groups include, but are not limited to, fluorophores, streptavidin and/or biotin, cholesterol, methylene blue, dinitrophenols (DNPs), digoxigenin and/or anti-digoxigenin and diphenyl Cyclooctyne group.

Different blocking strands in the target polynucleotide may contain different arresting molecules. For example, one blocker strand can include a linear molecule as discussed above, and the other blocker strand can include one or more chemical groups that physically cause one or more helicases to stall. A blocking strand may comprise any linear molecule as discussed above and one or more chemical groups that physically cause one or more helicases to stall, such as one or more abasic groups and fluorophores.

A suitable blocker chain can be designed according to the type of target polynucleotide and carried out under the method conditions of the present application. Most helicases bind and move along DNA, so can be stalled by anything that is not DNA. Suitable molecules are described above.

In a specific embodiment, the number of 2'methoxy-modified ribonucleotides is 1-10, more optionally 2-6; and/or the 2'methoxy-modified ribose Nucleotides are evenly distributed over the blocking strand.

Helicase

Any helicase can be used herein. The helicase may be or be derived from a Hel308 helicase, a RecD helicase, such as a TraI helicase or a TrwC helicase, an XPD helicase or a Dda helicase. The helicase can be the helicase provided in Example 1, or the helicase disclosed in Chinese patent CN201880095718.X, or other helicases.

click chemistry

The polynucleotides of the present application can be linked covalently. For example, free copper click chemistry or copper catalyzed click chemistry can be used. Click chemistry is used in these applications because of its desirable properties and its scope for generating covalent linkages between a variety of building blocks. For example, it is fast, clean and non-toxic, producing only harmless by-products. Click chemistry is a term first introduced by Kolb et al. in 2001 to describe a broader set of robust, selective and modular building blocks that are reliably usable for both small-scale and large-scale applications (Kolb HC Finn, MG, Sharp less KB, click chemistry: diverse chemical function from a few good reactions, Angew. Chem. Int. Ed. 40(2001) 2004-2021). They defined the following set of stringent criteria for click chemistry: "The reaction must be modular, broad in scope, give very high yields, produce only harmless by-products that can be removed by non-chromatographic methods, and be stereogenic. Directional (but not necessarily enantioselective). Required process features include simple reaction conditions (ideally the process should be insensitive to oxygen and water), readily available starting materials and reagents, solvent-free or use, the solvent is mild (e.g. water) or easily removed, and simple product isolation. Purification must be by non-chromatographic methods if necessary, such as crystallization or distillation, and the product must be stable under physiological conditions of".

Suitable examples of click chemistry include but are not limited to the following:

(a) 1,3-Dipolar Cycloaddition of variants of free copper (1,3-Dipolar Cycloaddition),

where azides react with alkynes under stress, for example in cyclooctane rings;

(b) reaction of an oxygen nucleophile on one linker with an epoxy or aziridine reactive moiety on the other linker; and

(c) Staudinger linkage, in which the alkyne moiety can be substituted by an arylphosphine, resulting in specific reaction with azide to give an amide bond.

Optionally the click chemistry reaction is a Cu(I) catalyzed 1,3 dipolar cycloaddition between alkynes and azides. In an alternative embodiment, the first group is an azide group and the second group is an alkyne group. Nucleobases have been synthesized with insertion of azide and alkyne groups in alternative positions (e.g. Kocalka P, El-Sagheer AH, Brown T, Rapid and efficient DNA strand cross-linking by click chemistry, Chembiochem.2008.9(8 ):1280-5). Alkyne groups were commercially available from Berry Associates (Michigan, USA), and azide groups were synthesized by ATDBio or IDT bio.

In a specific embodiment of the present application, optionally reactive groups are azide and hexyl groups, eg azide N3 and DBCO.

method

Optionally, the method includes:

(a) moving the polynucleotide of interest across the transmembrane pore,

The methods of the present application comprise measuring one or more characteristics of said target polynucleotide. The method may comprise measuring 2, 3, 4, 5 or more characteristics of the target polynucleotides. The one or more characteristics may be selected from (i) the length of the target polynucleotide, (ii) the identity of the target polynucleotide, (iii) the sequence of the target polynucleotide, (iv) the the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified. Any combination of (i) to (v) can be measured according to the present application.

For (i), the length of the polynucleotide can be determined, for example, by determining the number of interactions between the target polynucleotide and the pore, and the duration between interactions between the target polynucleotide and the pore.

Regarding (ii), the identity of the polynucleotides can be determined in a number of ways. Polynucleotide identity may be determined in conjunction with or without determination of the sequence of the polynucleotide of interest. The former is straightforward; the polynucleotide is sequenced and thus identified. The latter can be done in several ways. For example, the presence of a particular motif in a polynucleotide can be determined (without determining the rest of the sequence of the polynucleotide). Alternatively, specific electrical and/or optical signals determined in the method can identify a target polynucleotide from a specific source.

For (iii), the sequence of the polynucleotide can be determined as previously described. Suitable sequencing methods, particularly those using electrical measurements, are described in Stoddart D et al., Proc Natl Acad Sci, 12; 106(19):7702-7, Lieberman KR et al, J Am Chem Soc. 2010; 132 (50):17961-72, and in International Application WO 2000/28312.

As for (iv), the secondary structure can be measured in various ways. For example, if the method involves electrical measurements, secondary structure can be measured using a change in residence time or a change in current through the pore. This allows regions of single- and double-stranded polynucleotides to be identified.

For (v), the presence or absence of any modification can be determined. The method optionally includes determining whether said target polynucleotide is modified by methylation, oxidation, damage, with one or more proteins or with one or more markers, tags or blocker strands. Specific modifications will result in specific interactions with the pore, which can be determined using the methods described below. For example, cytosines can be identified from methylated cytosines based on the current flow through the pore during the interaction of the pore with each nucleotide.

The method is usually carried out in the presence of a buffer. In the exemplary devices discussed above, the buffer is present in the aqueous solution in the chamber. Any buffer may be used in the methods of the present application. Typically, the buffer is phosphate buffered saline. Other suitable buffers are HEPES and Tris-HCl buffers. The method is typically carried out at a pH of 4.0 to 12.0, 4.5 to 10.0, 5.0 to 9.0, 5.5 to 8.8, 6.0 to 8.7, 7.0 to 8.8, or 7.5 to 8.5. The pH used is optionally about 7.5.

The method may be performed at 0 to 100°C, 15°C to 95°C, 16°C to 90°C, 17°C to 85°C, 18°C to 80°C, 19°C to 70°C, or 20°C to 60°C. The method is usually carried out at room temperature. The method is optionally performed at a temperature that supports the function of the helicase, eg, about 37°C.

The method may be carried out in the presence of free nucleotides or free nucleotide analogs and/or cofactors which assist in the functioning of the helicase. The method can also be carried out in the absence of free nucleotides or free nucleotide analogues and in the absence of cofactors for the helicase. The free nucleotides may be any one or more of the individual nucleotides as discussed above. Free nucleotides include, but are not limited to, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate GTP, thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate ( UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate ( dAMP), deoxyadenosine diphosphate (DADP), deoxyadenosine triphosphate (dATP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxyuridine diphosphate (dUMP), deoxyuridine diphosphate (dUDP), deoxyuridine triphosphate (dUTP), deoxy Cytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP). The free nucleotide may be selected from AMP, TMP, GMP, CMP, UMP, dAMP, dTMP, dGMP or dCMP. The free nucleotide may be adenosine triphosphate (ATP). A helicase cofactor is a factor that enables a helicase or construct to function. The helicase cofactor can optionally be a divalent metal cation. The divalent metal cation may be Mg ²⁺ , Mn ²⁺ , Ca ²⁺ or Co ²⁺ . The helicase cofactor is most preferably Mg ²⁺ .

It should be noted that: reduced coenzyme I, NADH (Nicotinamide adenine dinucleotide) is a chemical substance, which is the reduced state of nicotinamide adenine dinucleotide.

Reagent test kit

In another aspect, the present application also provides a kit for characterizing polynucleotides, said kit comprising said adapter or said complex.

The kit includes (a) one or more adapters, (b) one or more helicases. The kit may include any of the helicases and wells discussed above.

The kit may also include membrane components, such as phospholipids, such as lipid bilayers, required for the formation of amphiphilic layers.

The kits of the present application may additionally comprise one or more other reagents or instruments that enable the performance of any of the above-mentioned embodiments. Such reagents or devices include one or more of the following: a suitable buffer (aqueous solution), means for obtaining a sample from a subject (such as a container or device containing a needle), amplification and/or Or a means for expressing polynucleotides, a membrane as defined above or a pressure clamp or patch clamp device. The reagents may be present in a dry state in the kit such that a fluid sample resuspends the reagents. The kit may also, optionally, include instructions for how to use the kit in the methods of the present application, or details of which patients the methods may be used for. The kit optionally includes the necessary components to facilitate the movement of the helicase (eg ATP and Mg ²⁺ ).

The following examples illustrate the application.

Example 1: Preparation of a Y adapter-enzyme complex that reduces ATP empty consumption

SEQ ID NO: 1 GCGGAGTCAAACGGTAGAAGTCG;

SEQ ID NO:2 TAACGTATTC;

SEQ ID NO:3 ACTGCTCATTCGGTCCTGCTGACT;

SEQ ID NO:4 CGACTTCTACCGTTTGACTCCGC;

SEQ ID NO:5 GTCAGCAGGACCGAATGA;

SEQ ID NO: 6 GAATACGTTAGCGG, wherein SEQ ID NO: 6 is composed of PNA; PNA represents peptide nucleic acid, a class of DNA analogues that replace sugar and phosphate backbones with polypeptide backbones.

SEQ ID NO:7 GCAGTAGTCCAGCACCGACC;

SEQ ID NO:8

The complex is formed by the hybridization of 4 different strands;

The first strand (Y-Top-1), which in turn contains the leader sequence, i.e. the iSpC3 blocking strand, denoted as 3, is connected to the 5' end of SEQ ID NO: 1, and its 3' end is connected to four i2OMeC and SEQ ID NO:2, the 3' end of SEQ ID NO:2 is connected to the blocking chain (R0-R6 as shown in Table 2) and SEQ ID NO:3, wherein i2OmeC and i2OmeG are 2''-O-methyl RNA, that is, 2'methoxy-modified RNA.

The second strand (Y-Top-2), DBCO is connected to the 5' end of SEQ ID NO:4.

The third strand (Y-Bottom), the 3' end of SEQ ID NO:4 is linked to SEQ ID NO:7.

The fourth strand (PNA-R), [GAATACGTTAGCGG]pna-OO-azide (N3), where O is O-liker (also known as AEEA or eg1), was used to increase the solubility of PNA-R.

Among them, 3333333333333333333333333333 represents C3 spacer modification.

Y-Top-2: DBCO- CGACTTCTACCGTTTGACTCCGC;

Anneal the three synthetic single strands of Y1, Y2, and YB at a ratio of 1:1.1:1.1 (slowly cool down from 95°C to 25°C, and the temperature drop does not exceed 0.1°C/s). The final annealing system includes 160mM HEPES 7.0; 200mM NaCl, the final concentration of Y1 is 4-8μM, and the Y-type adapter is finally formed. Enzyme T4 Dda-M1G/E94C/C109A/C136A/A360C (3μM) (sequence shown in SEQ ID NO: 8) with Y-type adapter (500nM) and 6 times the amount of substance, in buffer (100mM NaAc ( pH 7); 1.5mM TMAD) and incubated at room temperature for 30 minutes. This mixture is referred to as Sample 1.

1 μM of PNA-R chain was added to sample 1 and incubated at room temperature for 30 minutes. Sample 2 is obtained.

TBE (native) PAGE gels were used to examine the mobility of

samples

1 and 2 under the same conditions. After the PNA-R chain is loaded on the adapter, the mobility of sample 2 will decrease, which is slower than that of the control (sample 1) without PNA-R chain. Among them, the comparison results using the blocking chain as R0 are shown in Figure 2 Show.

Sample 2 was used on a DNAPac PA200 column with the following elution buffers (buffer A: 20 mM Na-CHES, 250 mM NaCl, 4% (W/V) glycerol, pH 8.6, buffer B: 20 mM Na-CHES, 1 M NaCl , 4% (W/V) glycerol, pH 8.6) for purification, sample 1 was loaded on the column, and the enzyme not bound to DNA was eluted from the column with buffer A. The enzyme-bound Y-adapter complex was then eluted with 10 column volumes of 0-100% buffer E. Then the main elution peaks were collected and their concentrations were measured for the detection of Example 2.

Embodiment 2: ATPase activity detection

Firstly, the NADH reaction mixture was prepared, and the reaction mixture was mainly prepared according to Table 1 below. After the preparation was completed, the reaction mixture was turned horizontally at room temperature and incubated for 10 minutes.

Table 1 Preparation of NADH reaction mixture

Afterwards, 112.5 μL NADH reaction mixture, 37.5 μL (20 nM) Y adapter-enzyme complex (i.e. any one of sample 1 and sample 2 after purification in Example 1 ) was added in the 96-well plate, and then Put it into an ultraviolet-visible spectrophotometer to measure the absorbance value at 380nm, set the temperature at 34°C; detect 200 cycles, each cycle is 5 minutes. The collected data were drawn into a standard curve and the ATP consumption value was obtained through the slope of the standard curve.

The results are shown in Figure 3 and Table 2 (complex addition 10h). No addition of PNA-R was used as a control (it used the same blocker chain as R1), and was set as baseline (100%). Percent ATP depletion below 100% indicates potential for reduced ATP depletion compared to control linkers. The blocking chain sequences of all the adapter adapters tested are shown in Table 2 below. After driving the enzyme to blocking chains with different structures and sequences, the ATP/NADH consumption was determined, as shown in Figure 3.

It can be seen from Figure 3 that compared with the control R0, the ATP consumption rate of the adapter R1-R6 was significantly decreased. Compared with R1, the blocking chains of R2-R6 are different, and the ATP consumption is different. Among them, the blocking chain adds a 2'methoxy-modified ribonucleotide such as R2, and the ATP consumption does not change significantly. The blocking chain The addition of four 2′methoxy-modified ribonucleotides such as R3-R6 significantly decreased ATP consumption. In addition, an enzyme (same as Example 1) control (CK) without an adapter is also set in Figure 3, and the enzyme relies on the substrate to consume ATP. Low.

Table 2

Example 3: On-machine test of the Y adapter-enzyme complex that reduces ATP empty consumption

A library of 10kb in length was prepared by end repair, and the Y adapter-enzyme complex (joint is R4) prepared in Example 1 to reduce ATP vacancy was used to connect the library, that is, the target polynucleotide, to build a library. The acid linking position is the right end of the adapter shown in Figure 1. Take no addition of PNA-R chain as a control (denoted as RC).

Sequencing was performed using the nanopore sequencer QNome-9604 of Qitan Technology Co., Ltd., sequencing buffer: final concentration 10mM HEPEs, 100mM MgCl ₂ , 375mM KCl, ATP 100mM, pH 7.1, sequencing temperature: 30-40°C.

Results: As shown in Figure 4, the control RC decreased by about 80 bp/s within 16 hours of sequencing; the rate of linker R4 decreased by about 10 bp/s within 16 hours of sequencing. The sequencing rate is positively correlated with the ATP concentration. If the ATP concentration drops significantly during the sequencing process, the sequencing rate will also decrease.

In addition, the term "and/or" in this article is only an association relationship describing associated objects, which means that there may be three relationships, for example, A and/or B may mean: A exists alone, A and B exist at the same time, There are three cases of B alone. In addition, the character "/" in this article generally indicates that the contextual objects are an "or" relationship.

It should be understood that in this embodiment of the present application, "B corresponding to A" means that B is associated with A, and B can be determined according to A. However, it should also be understood that determining B according to A does not mean determining B only according to A, and B may also be determined according to A and/or other information.

The above is only a specific embodiment of the application, but the scope of protection of the application is not limited thereto. Any person familiar with the technical field can easily think of various equivalents within the scope of the technology disclosed in the application. Modifications or replacements, these modifications or replacements shall be covered within the scope of protection of this application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

an adapter for characterizing a polynucleotide of interest comprising {LS} n or {SL} n in the 5' to 3' direction,

Wherein, L is a modified double-stranded polynucleotide, S is a blocking strand, and n is a positive integer;

And, the L double strand comprises a polynucleotide strand L' connected to S and a complementary strand L" of said L', said L' comprising a first segment away from the blocking strand S and a segment close to the blocking strand S The second section of said first section comprises a modified part, said second section comprises a motor protein binding active region, and the active region is blocked by said complementary chain L";

The complementary chain L" comprises a polymer capable of competing with said motor protein for binding to the L' chain.
The adapter according to claim 1, wherein the adapter comprises {D 1 -LS} n or {SLD 1 } n in the direction from the 5' to the 3' end, and D 1 is the first double-stranded polynucleotide;

And/or, the adapter comprises {LSD 2 } n or {D 2 -SL} n in the direction from the 5' to the 3' end, and D 2 is the second double-stranded polynucleotide;

Optionally, the n is an integer of 1-20.
The adapter according to claim 1 or 2, wherein the modified part of the chain L' makes the binding ability of the first segment to motor protein weaker than that of the second segment, or makes the first segment The segment does not bind to the motor protein; and/or

The modification part in the chain L' is a ribonucleotide and/or a nucleic acid analogue;

Optionally, the ribonucleotides include 2'-modified ribonucleotides, optionally 2'alkoxy-modified ribonucleotides, more optionally 2'methoxy-modified ribonucleotides ;or

Optionally, the nucleic acid analogs include any one or any combination of two or more of peptide nucleic acid, glycerol nucleic acid, threose nucleic acid, locked nucleic acid, and bridge nucleic acid; and/or

The motor protein binding active region in the chain L' is a deoxyribonucleotide; and/or

The number of ribonucleotides and/or nucleic acid analogues is 1-20, 1-15 or 1-10; optionally 2-6.
The adapter according to any one of claims 1 to 3, wherein the end of the complementary strand L" close to the blocking strand S contains a stronger binding force with the polynucleotide strand L' or the second segment part; optionally, the part includes PNA or LNA;

And/or, the end of the complementary chain L" away from the blocking chain S contains the first part of click chemistry, which can be optionally a click reaction group;

And/or, the D 1 double strand comprises a polynucleotide chain D 1 ′ connected to L’ and its complementary chain D 1 ″, and one end of the complementary chain D 1 ″ near the blocking chain S comprises the first click chemistry Two parts, which can be optionally click-reactive groups;

And/or, the D 2 double strand comprises a polynucleotide strand D 2 ′ connected to the blocking strand S and its complementary strand D 2 ″, and the complementary strand D 2 ″ includes a part that does not hybridize with the adapter ; Optionally, the part that does not hybridize with the adapter is located at one end of the complementary strand D 2 ″ adjacent to the blocking strand S.
The adapter according to any one of claims 1 to 4, wherein the blocking strand has a structure different from that of the polynucleotide for blocking a motor protein;

Optionally, the blocker chain comprises one or more nitroindole, one or more inosine, one or more acridine, one or more 2-aminopurine, one or more 2-6- Diaminopurine, one or more 5-bromo-deoxyuridine, one or more reverse thymidine, one or more reverse dideoxythymidine, one or more dideoxycytidine, one or more 5 -methylcytidylic acid, one or more 5-hydroxymethylcytidines, one or more 2'alkoxy-modified ribonucleotides, optional 2'methoxy-modified ribonucleotides, one or Multiple isodeoxycytidines, one or more isodeoxyguanosines, one or more C3 groups, one or more photocleavable (PC) groups, one or more hexanediols, one or more iSp9 group, one or more iSp18 groups, a polymer or one or more thiol linkages.
The adapter according to any one of claims 1 to 5, wherein the end of L' away from S comprises a leader strand sequence;

The end of S away from L' is used to connect the target polynucleotide;

The motor protein is a protein capable of binding to a polynucleotide and controlling its movement through a pore; optionally, the motor protein is selected from one of polymerase, exonuclease, helicase and topoisomerase one or more, more optionally, the helicase is selected from one of Hel308 helicase, RecD helicase, Tral helicase, TrwC helicase, XPD helicase and DDA helicase or more.
A complex comprising the adapter of any one of claims 1 to 6, and the motor protein and/or the target polynucleotide;

Optionally, the motor protein is located on the blocking chain.
The preparation method of compound as claimed in claim 7, wherein, comprises:

S1: binding the Y1 chain containing L'-S to the motor protein, and the binding region is located in the L' chain;

S2: adding the PNA-R chain comprising the complementary chain L" to obtain the complex, wherein the motor protein is driven to the blocking chain by the PNA-R chain;

Optionally, the method includes

S101: Binding the annealed product of the Y1 chain comprising D 1 '-L'-SD 2 ', the Y2 chain comprising D 1 ” and the YB chain comprising D 2 ” to the motor protein, the binding region is located at the L of the annealed product 'chain at;

S102: Adding the PNA-R chain containing the complementary chain L" to obtain the complex, wherein the motor protein is driven to the blocking chain by the PNA-R chain.
A method of characterizing a polynucleotide of interest using the adapter of any one of claims 1 to 6 or the complex of claims 7 or 8;

Optionally, the method includes:

(a) moving the polynucleotide of interest across the transmembrane pore,

Wherein said target polynucleotide is connected with the adapter according to any one of claims 1 to 6 or the complex according to claim 7 or 8; and

(b) taking one or more electrical and/or optical measurements as the polynucleotide moves relative to the pore, wherein the measurements represent one or more characteristics of the polynucleotide and are determined by This characterizes the polynucleotide of interest.
A kit for characterizing polynucleotides, the kit is composed of any one of the following 1)-4):

1) comprising the independently packaged adapter according to any one of claims 1 to 6, optionally also comprising the independently packaged motor protein according to any one of claims 1 to 6;

2) comprising the complex as claimed in claim 7;

3) comprising the compound obtained by the preparation method as claimed in claim 8;

4) Contains the following components individually packaged:

The polynucleotide strand L', the blocking strand S, and the complementary strand L of the nucleotide strand L' for being connected to S in the adapter according to any one of claims 1 to 6 ", optionally, also comprising independently packaged motor protein as described in any one of claims 1 to 6.