WO2023105281A1

WO2023105281A1 - Soluble tigit recombinant proteins

Info

Publication number: WO2023105281A1
Application number: PCT/IB2022/000670
Authority: WO
Inventors: Julia GARCÍA PRADO; Miguel Ángel MARÍN LÓPEZ; Julieta CARABELLI
Original assignee: Fundaciò Privada Institut De Recerca De La Sida-Caixa
Priority date: 2021-12-11
Filing date: 2022-12-09
Publication date: 2023-06-15

Abstract

The present invention relates to soluble TIGIT recombinant proteins. Various forms of these polypeptides are disclosed and exemplified. Isolated nucleic acids, vectors and host cells expressing these polypeptides, as well their therapeutic applications in human health, are also within the scope of the present invention.

Description

SOLUBLE TIGIT RECOMBINANT PROTEINS

Field of the Invention

The present invention relates to soluble TIGIT recombinant proteins. Various forms of these polypeptides are disclosed and exemplified. Isolated nucleic acids, delivery vectors and host cells expressing these polypeptides, as well their therapeutic applications in human health, are also within the scope of the present invention.

Background of the Invention

The Human Immunodeficiency Virus (HIV), Hepatitis B virus (HBV), Hepatitis C virus (HCV), Coronavirus, Cytomegalovirus (CMV), and Epstein-Barr virus (EBV) infections represent major public health issues. Around 38 million people worldwide are presently infected with HIV. See UNAIDS, http://www.unaids.org/, November 2021. On the other hand, an estimated 296 and 58 million people were living with HBV and HCV, respectively, in 2019. See WHO https://www.who.int/, July 2021 , Wykes M, et al., Nat Rev Immunol. 2018; 18(2):91- 104). Similarly, the SARS-CoV-2 has caused more than over 250 million cases of COVID-19 and claimed the lives of more than 5 million people worldwide. Albeit less fatal, the worldwide seroprevalence of CMV and EBV is over 80% of the general population and thus constitutes a significant public health risk (Virgin H, et al., Cell 2009; 10:138(1):30-50).

The CD155 is a transmembrane glycoprotein highly expressed on dendritic cells (DC) and macrophages. CD155 also regulates NK cell and lymphocyte activation (Chan C, et al., Nat. Immunol. 2014; 5(5):431-438). CD155 has gained scientific interest recently as a therapeutic target in the field of tumor immunology due to its prominent endogenous and immune functions (Kucan P, et al., Cell. Molecular Immunol. 2018; 16: 40-52). CD155 is significantly overexpressed in several human malignancies (e.g., glioma, colorectal carcinoma, neuroblastoma, myeloid and lymphoblastic leukemias), whereas its expression is low or absent in most healthy tissues (Gromeier M, et al., Proc. Natl Acad. Sci. USA 2000; 97:6803-6808, Masson D, et al., Gut 2001 ; 49:236-240, Castriconi R, et al., Cancer Res. 2004; 64:9180-9184, Pende D, et al., Blood 2005; 105:2066-2073 and Carlsten M, et al., J. Immunol. 2009; 183:4921-4930). TIGIT (T cell immunoreceptor with Ig and ITIM domains), an inhibitory receptor, is mainly expressed on natural killer (NK), CD8+ T, CD4+ T and T regulatory (Treg) cells. It binds to CD155 with high affinity (Boles K, et al., Eur J Immunol. 2009; 39(3):695-703).

CD155 transmits immune signals via interacting with the inhibitory checkpoint receptor TIGIT, thereby inhibiting the function of T and NK cells. Several preclinical studies have supported the use of TIGIT blockade as a monotherapy or combined with other immune checkpoint inhibitors for the treatment of advanced solid malignant tumors (Liu L, et al., Oncol Rep 2021 ; 45:835-845). However, further work is required to better understand the role of TIGIT/CD155 interactions on DC functions and analyze its potential use on the therapy of other diseases or conditions besides cancer.

Summary of the Invention

The authors of the present invention have identified that soluble forms of the TIGIT proteins, dimers comprising a plurality of said soluble forms as well as fusion proteins comprising a soluble form of a TIGIT protein and an immunoglobulin Fc region or two copies of the soluble form of a TIGIT protein inhibit the binding of CD155 to TIGIT and thus are useful for the therapy of diseases or conditions wherein it is desired to inhibit the interaction between CD155 and TIGIT. Accordingly, in a first aspect, the invention relates to a TIGIT recombinant protein selected from the group of (i) a soluble TIGIT (sTIGIT) polypeptide, (ii) a soluble short TIGIT (ssTIGIT) polypeptide or (iii) a functionally equivalent variant thereof. In a second aspect, the invention relates to a fusion protein comprising a TIGIT recombinant protein according to the invention and an immunoglonbulin Fc region. In a third aspect, the invention relates to a fusion protein comprising two copies of the TIGIT recombinant protein, said copies being covalently linker by a linker region. In a fourth aspect, the invention relates to a dimer which comprises two TIGIT recombinant proteins according to the invention, wherein said TIGIT recombinant proteins are connected by the non-covalent interaction between dimerization domains in the TIGIT recombinant protein.

In an additional aspect, the invention relates to the nucleic acids encoding the TIGIT recombinant proteins or fusion proteins or dimers, to vectors comprising said nucleic acids and to host cells comprising the nucleic acids and vectors indicated before.

In a further aspect, the invention refers to pharmaceutical compositions comprising the TIGIT recombinant proteins, fusion proteins, dimers, nucleic acids, vectors, and host cells of the invention, or mixtures thereof. In another aspect, the invention is directed to a combination therapy comprising the TIGIT recombinant proteins, fusion proteins, dimers, multimers, nucleic acids, vectors, host cells, and pharmaceutical compositions of the invention and at least one other therapeutic agent.

In a still further aspect, the invention relates to the use of the TIGIT recombinant proteins, fusion proteins, dimers, multimers, nucleic acids, vectors, host cells, pharmaceutical compositions, and combinations therapies of the invention, or mixtures thereof, as a medicament. In a particular embodiment of this aspect, the invention refers to the use of the TIGIT recombinant proteins, fusion proteins, dimers, multimers, nucleic acids, vectors, host cells, pharmaceutical compositions, and combinations of the invention, or mixtures thereof, for preventing, inhibiting the progression or treating a HIV, HBV, HCV, Coronavirus, CMV.EBV, VZV, or tuberculosis infection and other infectious agents leading to immune dysfunction (Virgin H, 2009, supra). In an alternative form of this aspect, the invention relates to a method for preventing, inhibiting the progression or treating a HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV or tuberculosis infection in a subject which comprises the administration of a therapeutically effective amount of the TIGIT recombinant proteins, dimers, multimers, nucleic acids, vectors, host cells, pharmaceutical compositions, and combinations of the invention, or mixtures thereof, to the subject. In a further alternative form of this aspect, the invention refers to the use of the TIGIT recombinant proteins, nucleic acids, vectors, host cells, pharmaceutical compositions and combination therapies of the invention, or mixtures thereof, in the manufacture of a medicament for preventing, inhibiting the progression or treating a HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV or tuberculosis infection.

In another particular embodiment, the present inventions relates to the use of the TIGIT recombinant proteins, fusion proteins dimers, multimers, nucleic acids, vectors, host cells, pharmaceutical compositions, and combinations of the invention, or mixtures thereof, for preventing, inhibiting the progression or treating a cancer.

Additionally, the present invention relates to a method of preparing the TIGIT recombinant proteins, fusion proteins or dimers of the invention which comprises the steps of (a) culturing a host cell comprising a nucleic acid according to the invention, (b) expressing the nucleic acid sequence and (c) recovering the TIGIT recombinant proteins or dimers from the host cell culture.

In a still further aspect, the invention relates to a kit comprising the TIGIT recombinant proteins, fusion proteins, dimers, nucleic acids, vectors, host cells, pharmaceutical compositions or combination therapies of the invention, or mixtures thereof. Brief Description of the Drawings

Fig. 1. Production and validation of sIRs TIGIT proteins in mammalian system and validation by SDS and western-blot technologies to confirm size, presence of Fag-Tag and His-Tag and also murine Fc specificity for A. slR1 ; B. slR4 and C. slR9. Lane M1 : Protein Marker, BioRad, Cat., No. 16103674S, refer to annotated key on the left for size. Lane M2: Protein Marker, GenScript, Cat., No. M00673, refer to annotated key on the left for size. R: Reducing conditions,; NR: Non-reducing conditions. Primary antibody: Anti-mouse IgG (whole molecule) - peroxidase antibody produced in rabbit (Sigma Cat. No. A9044); Primary antibody: Mouse anti-His mAb (GenScriot, Cat. No. A00186)

Fig. 2. Biacore kinetics of TIGIT proteins to the human and murine CD155 ligands. The biacore technique measures the real-time binding association and dissociation rates (Response RU %) using Surface Plasmon Resonance (SPR) of receptor ligand interactions base on a chip interaction of muCD155 and huCD155 during the flow-through time (min). A. Kinetics of slR1 and slR2 interaction for huCD155. B. Kinetics of slR1 to slR4 interaction for muCD155. C. Kinetics of slR5 to slR8 interaction for muCD155.

Fig. 3. Gating strategy for ex vivo experiment using PBMCs from chronically HIV-1 infected individuals in cART. Live cells are analyzed in Lymphocytes and Non lymphocytes population. From non-lymph population we characterized CD155+ cells. From Lymphocyte we characterized CD3+CD8+ (CD8 T-cells), CD3+CD4+ (CD4 T-cells) and CD3-CD16+CD56+ (NK Cells) populations. In CD8 T-cells, CD4 T-cells and NK cells we analyze CD107a, I FNg, IL2, IL6, I L10, TIGIT CD45RA, CD27, CCR7.

Fig. 4. Pair-wise comparison of antigen independent immune response in the presence of lgG1 Fc control molecule (Fc Ctrol) and the slR2 Fc-TIGIT (slR2). slR2 enhance the frequency of CD8+TIGIT+ cells and stimulated the production of IFNg, TNF, IL-2, IL-10 in CD8+ T-cells and CD107a in CD8+TIGIT+ cells (A) and stimulated the production of IL-2 and IL-10 in CD4+ T-cells and CD107a in CD4+TIGIT+ cells (B). (C). slR2 enhance the frequency of CD4+TIGIT+ cells and stimulated the production of CD107a in CD8+TIGIT+ cells (D).

Fig. 5. Asymmetric sigmoidal 5PL regression obtained using a standard curve of SiR1 and slR6 binding murine CD155 chimera coated in an ELISA plate. R square of asymmetric sigmoidal 5PL regression is 0.993 and 0.999 for slR1 and slR6 respectively.

Fig. 6. Schematic representation of the general structure of the TIGIT recombinant proteins of the invention. A) Human T-cell immunoreceptor with Ig and ITIM domains (TIGIT) sequence obtained from Uniprot DataBase (Q495A1). Native signal peptide (white box), Ig- like V-type domain (grey box), homodimerization domain (yellow box) transmembrane domain (violet box) and cytoplasmatic domain (dark grey box), ITIM domain (orange). B) Soluble TIGIT design. For the soluble molecule design, the sequence onwards of the transmembrane domain was eliminated to allow the protein's secretion. sTIGIT prototypes were modified in the C terminal with a cloning spacer, a His-tag sequence and a STOP codon. sTIGIT v1 design maintains native signal peptide, whereas sTIGIT v2 has two variations of the signal peptide: azurocidin (AZU, pink box) and CD5 (CD5, light green box). Fc TIGIT chimera was generated from Azu sTIGIT inserting the Fc region of an lgG1 containing Myc and His Tag in the C’ terminal. sTIGIT v1 was cloned into expression plasmid pcDNA3.1 , whereas ssTIGIT v.2 and Fc TIGIT were cloned into expression plasmid pcDNA3.4. ssTIGIT v.2 sequences were optimized for human codon usage. Dimer generated from ssTIGIT monomers.

Sequence Listing

The nucleic and amino acid sequences depicted in the accompanying sequence listing are shown using the standard letter abbreviations and codes applied conventionally in the art. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:

SEQ ID NO:1 is the amino acid sequence of the soluble human TIGIT (sTIGIT) synthetic polypeptide.

SEQ ID NO:2 is the amino acid sequence of the slR2 hu ssTIGIT - hu Fc lgG1.

SEQ ID NO:3 is the amino acid sequence of the slR3 hu ssTIGIT - mu Fc lgG2c.

SEQ ID NO:4 is the amino acid sequence of the slR4 hu ssTIGIT - mu Fc lgG2c containing the APCPP mutation.

SEQ ID NO:5 is the amino acid sequence of the soluble murine TIGIT (sTIGIT) synthetic polypeptide.

SEQ ID NO:6 is the amino acid sequence of the slR6 mu ssTIGIT - mu Fc lgG2c.

SEQ ID NO:7 is the amino acid sequence of the slR7 mu ssTIGIT - mu Fc lgG2c containing the APCPP mutation.

SEQ ID NO:8 is the amino acid sequence of the slR8 mu ssTIGIT - mu Fc lgG1. SEQ ID NO:9 is the amino acid sequence of the slR9 hu ssTIGIT - mu Fc lgG1. SEQ ID NO:10 is the amino acid sequence of the slR10 hu ssTIGIT - hu Fc lgG4 S288P.

SEQ ID NO: 11 is the nucleic acid sequence of the polynucleotide encoding slR1 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:12 is the nucleic acid sequence of the polynucleotide encoding slR2 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:13 is the nucleic acid sequence of the polynucleotide encoding slR3 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:14 is the nucleic acid sequence of the polynucleotide encoding slR4 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:15 is the nucleic acid sequence of the polynucleotide encoding slR5 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:16 is the nucleic acid sequence of the polynucleotide encoding slR6 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:17 is the nucleic acid sequence of the polynucleotide encoding slR7 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:18 is the nucleic acid sequence of the polynucleotide encoding slR8 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NO:19 is the nucleic acid sequence of the polynucleotide encoding slR9 containg the azurocidin signal sequence and a hexahistidine tag.

SEQ ID NQ:20 is the nucleic acid sequence of the polynucleotide encoding slR10 containg the azurocidin signal sequence and a hexahistidine tag.

Detailed Description of the Invention

The present invention relates to soluble TIGIT recombinant proteins. The TIGIT recombinant proteins of the present invention may inhibit the binding of CD155 to TIGIT and thus may be useful in preventing, inhibiting the progression or treating diseases or conditions associated to CD155 and TIGIT and their interaction. The TIGIT recombinant proteins of the present invention may also modulate the expression of several cytokines (e.g., TNFa, IL-10) related to the CD155.

1. Definitions of general terms and expressions The term “adeno-associated virus” or “AAV”, as used herein, refers to a virus member of the Parvoviridae family which comprises a linear, single-stranded DNA genome of about 5,000 nucleotides. At least 11 recognized serotypes of AAV (AAVI-11) are known in the art.

The term “AAV vector”, as used herein, refers to a nucleic acid having an AAV 5' inverted terminal repeat (ITR) sequence and an AAV 3' ITR flanking a polypeptide-coding sequence operably linked to transcription regulatory elements (e.g., promoters, enhancers) and a polyadenylation sequence. The AAV vector may include, optionally, one or more introns inserted between exons of the polypeptide-coding sequence (Samulski J, et al., Annu. Rev. Virol. 2014; 1 :427-451).

The term “AIDS”, as used herein, refers to the symptomatic phase of HIV infection, and includes both Acquired Immune Deficiency Syndrome (commonly known as AIDS) and “ARC,” or AIDS-Related Complex (Adler M, et a!., Brit. Med. J. 1987; 294: 1145-1147). The immunological and clinical manifestations of AIDS are well known in the art and include, for example, opportunistic infections and cancers resulting from immune deficiency.

The term “amino acid”, as used herein, refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Amino acids may be referred to herein by either their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

The term “antiretroviral therapy” or “ART”, as used herein, refers to the administration of one or more antiretroviral drugs (i.e., HIV antiretrovirals) to inhibit the replication of HIV. Typically, ART involves the administration of at least one antiretroviral agent (or, commonly, a cocktail of antiretrovirals) such as nucleoside reverse transcriptase inhibitor (e.g., zidovudine (AZT, lamivudine (3TC) and abacavir), non-nucleoside reverse transcriptase inhibitor (e.g., nevirapine and efavirenz) and protease inhibitor (e.g., indinavir, ritonavir and lopinavir). The term Highly Active Antiretroviral Therapy (“HAART”) refers to treatment regimens designed to suppress aggressively HIV replication and disease progression. HAART usually consists of three or more different drugs, such as, for example, two nucleoside reverse transcriptase inhibitors and a protease inhibitor.

The term “antibody”, as used herein, refers to an intact immunoglobulin of any isotype, or a fragment thereof that can compete with the intact antibody for specific binding to the target antigen, and includes, for instance, chimeric, humanized, fully human, and bispecific antibodies. An antibody is a species of an antigen binding protein. An intact antibody will generally comprise at least two full-length heavy chains and two full-length light chains, but in some instances can include fewer chains such as antibodies naturally occurring in camelids which can comprise only heavy chains. Antibodies can be derived solely from a single source, or can be “chimeric” that is, different portions of the antibody can be derived from two different antibodies as described further below. The antigen binding proteins, antibodies, or binding fragments can be produced in hybridomas, by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise indicated, the term "antibody" includes, in addition to antibodies comprising two full-length heavy chains and two full-length light chains, derivatives, variants, fragments, and muteins thereof, examples of which are described below.

The term “antigen binding region”, as used herein, refers to a protein, or a portion of a protein, that specifically binds a specified antigen (e.g., a paratope). For example, that portion of an antigen binding protein that contains the amino acid residues that interact with an antigen and confer on the antigen binding protein its specificity and affinity for the antigen is referred to as antigen binding region. An antigen binding region typically includes one or more “complementary binding regions” (“CDRs”). A CDR is an amino acid sequence that contributes to antigen binding specificity and affinity.

The terms “antiviral”, and “antiviral drug”, as used herein, refer to an active agent used for treating or preventing viral infections. Antivirals useful in Coronavirus infections therapy include, without limitations, adenosine triphosphate analogs (ATP). Examples of ATP include, but are not limited, to GS-441524, GS-5734 (i.e., Remdesivir), 2’-C-methyladenosine, 7- deaza-2’-C-methyladenosine, 2’-C-methylguanosine, 2’-C-methylcytidine, 2’-C-methyluridine, INX-08189, GS-7977 (i.e., Sofosbuvir), 2’-C-ethynyladenosine, NITD008, NITD449, 4’-azido, 4’-azido-aracytidine, BCX-4430 (i.e., Galidesivir), T-1106, 6-methyl-7-deazaadenine N- glycosidic, 2’,5’di-O-trityluridine, and 3’,5’di-O-trityluridine.

The term “CD155”, as used herein, refers to the Type I transmembrane glycoprotein (aka Poliovirus Receptor (PVR)). It is involved in the cellular poliovirus infection in primates. CD155 is characterized for 3 extracellular immunoglobulin-like domains, D1-D3. It is markedly expressed on dendritic cells (DC) and macrophages, and this expression is markedly increased upon activation. CD155 also regulates NK cell and lymphocyte activation (Chan C, et al., Nat Immunol 2014; 5(5):431-438). It plays a role in mediating tumor cell invasion and migration (UniProtKB accession number P15151).

The term “infectious diseases”, as used herein, refers to disorders caused by organisms, such as bacteria, viruses, fungi or parasites. Thus, infectious diseases can be viral, bacterial, parasitic or fungal infections.

The terms “CMV” or “Cytomegalovirus”, as used herein, refers to a genus of viruses in the order Herpesvirales, family Herpesviridae, subfamily Betaherpesvirinae. The CMV genus comprises 11 species including human betaherpesvirus 5 (HCMV, human cytomegalovirus, HHV-5), which is the species that infects humans. Diseases associated with HHV-5 include mononucleosis and pneumonia (ENA accession number GLI980198).

The term “CMV therapy”, as used herein, refers to any therapies, including blood products, immune therapies and drug therapies, approved or currently under evaluation for the prevention, inhibition of the progression or treatment of CMV or its related diseases. Examples of CMV therapies include antivirals such as Ganciclovir (CAS [82410-32-0]).

The term “codon optimized”, as used herein, refers to the alteration of codons in nucleic acids to reflect the typical codon usage of the host organism to improve the expression of a reference polypeptide without altering its amino acid sequence. There are several methods and software tools known in the art for codon optimization (Narum D, et al., Infect. Immun. 2001 ; 69(12)7250-7253), Outchkourov N, et a!., Protein Expr. Purif. 2002; 24(1):18-24, Feng L, et al., Biochemistry 2000; 39(50): 15399-15409 and Humphreys D, etal., Protein Expr. Purif. 2000; 20(2):252-264).

The term “comprising” or “comprises”, as used herein, discloses also “consisting of” according to the generally accepted patent practice.

The term “Coronavirus”, as used herein, refers to any member of the Coronaviridae viral family. The Coronaviridae family include single-stranded RNA viruses, about 120 nanometers in diameter. The family is divided in two subfamilies: Letovirinae and Coronavirinae. The Coronavirinae subfamily comprises the Alphacoronavirus (e.g., human coronavirus 229E (HCoV-229E), Betacoronavirus (e.g., human coronavirus HKU1 , human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), human coronavirus OC43 (HCoV- OC43), Middle East respiratory syndrome-related coronavirus (MERS-CoV or HCoV-EMC, the causative agent of MERS), severe acute respiratory syndrome coronavirus (SARS-CoV, the causative agent of SARS), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2, the causative agent of COVID-19), Deltacoronavirus, and Gammacoronavirus genus. Coronaviruses can also infect non-human subjects such as, for example, cattle (e.g., bovine coronavirus (BCV), cats (e.g., feline coronavirus (FCoV), dogs (e.g., canine coronavirus (CCoV), pigs (e.g., porcine coronavirus HKLI15, porcine epidemic diarrhea virus (PED or PEDV), rabbits (e.g., rabbit enteric coronavirus), and birds (e.g., infectious bronchitis virus (IBV), turkey coronavirus (TCV)). There are more than 40 species of Coronaviruses. The term “dendritic cell” (DC), as used herein, is an antigen-presenting cell existing in vivo, in vitro, ex vivo, or in a host or subject, or which can be derived from a hematopoietic stem cell or a monocyte. Dendritic cells and their precursors can be isolated from a variety of lymphoid organs (e.g., spleen, lymph nodes), as well as from bone marrow and peripheral blood. The DC has a characteristic morphology with thin sheets (lamellipodia) extending in multiple directions away from the dendritic cell body. Typically, dendritic cells express high levels of MHC and costimulatory (e.g., B7-1 and B7-2) molecules. Dendritic cells can induce antigen specific differentiation of T cells in vitro and are able to initiate primary T cell responses in vitro and in vivo. The term “dendritic cells” includes differentiated dendritic cells, whether immature and mature dendritic cells. These cells can be characterized by expression of certain cells surface markers (e.g., CD 11c, MHC class II, and at least low levels of CD80 and CD86). In addition, dendritic cells can be characterized functionally by their capacity to stimulate alloresponses and mixed lymphocyte reactions (MLR).

The term “EBV” or “Epstein-Barr virus”, as used herein, refers to a double-stranded DNA virus member of the herpes virus family (Zanella M, et al., Clinical Microbiol Rev 2020; 33(4):e00027-20.0). EBV spreads most commonly through bodily fluids, primarily saliva. EBV can cause infectious mononucleosis, also called mono, and other illnesses.

The term “fragment crystallizable region” or “Fc region”, as used herein, refers to the tail region of an antibody that interacts with cell surface receptors called Fc receptors and some proteins of the complement system.

The expression “functionally equivalent variant”, as used herein, refers to any sequence having additions, substitutions, deletions or combinations thereof in its amino acid or nucleotide sequence and/or which has been chemically modified with respect to said sequence and which substantially maintains the function of its reference polypeptide or polynucleotide. Thus, “functionally equivalent variant” refers to: (i) a polypeptide resulting from the modification, deletion or insertion or one or more amino acids and which substantially preserves the activity of its reference polypeptide and (ii) a polynucleotide resulting from the modification, deletion or insertion or one or more bases and which substantially preserves the activity of the polypeptide expressed by the reference nucleic acid. Functionally equivalent variants contemplated in the context of the present invention, include polypeptides showing at least 60%, 70%, 80%, 85%, 90%, 92%, 94%, 96%, 98%, 99% of similarity or identity with polypetide sequences SEQ ID NO: 9-13 or the polynucleotides showing at least 60%, 70%, 80%, 85%, 90%, 92%, 94%, 96%, 98%, 99% of similarity or identity with polynucleotide sequences SEQ ID NO:21-24. The degree of identity or similarity between two polypeptides or two polynucleotides is determined by using computer-implemented algorithms and methods that are widely known in the art. The identity and similarity between two sequences of amino acids is preferably determined using the BLASTP algorithm (Altschul S, etal., “BLAST Manual” (NCBI NLM NIH, Bethesda, MD, USA, 2001)). In addition, any protein containing an Ig-like V- type domain including an “(V/I)(S/T)Q” motif, a T(F/Y)P motif and the AX6G region described as relevant for TIGIT -CD155 interaction (Stengel K, et al., Proc Natl Acad Sci USA 2012;109(14):5399-5404) is also included within the scope of the present invention.

The term “HBV” or “Hepatitis B virus”, as used herein, refers to a partially doublestranded DNA virus, a species of the genus Orthohepadnavirus and a member of the Hepadnaviridae family of viruses. HBV is associated to acute and chronic hepatitis and may lead to the development of cirrhosis and hepatocellular carcinoma (Ryu W, Molecular Virology of Human Pathogenic Viruses (Academic Press, Cambridge, MA, USA, 2017, p. 247-260).

The term “HCV” or “Hepatitis C virus”, as used herein, refers to a single-stranded, positive-sense RNA virus member of the genus Hepacivirus in the family Flaviviridae (Rosen H, et al., NEJM 2011 ; 364(25):2429-2438). HCV may lead to liver disease and cirrhosis. In some cases, those with cirrhosis may develop serious complications such as liver failure, liver cancer, or dilated blood vessels in the esophagus and stomach.

The term “HIV”, as used herein, include HIV-1 and HIV-2, SHIV and SIV. “HIV-1” means the human immunodeficiency virus type-1. HIV-1 includes, but is not limited to, extracellular virus particles and the forms of HIV-1 associated with HIV-1 infected cells. The HIV-1 virus may represent any of the known major subtypes (Classes A, B, C, D E, F, G and H) or outlying subtype (Group O) including laboratory strains and primary isolates. “HIV-2” means the human immunodeficiency virus type-2. HIV-2 includes, but is not limited to, extracellular virus particles and the forms of HIV-2 associated with HIV-2 infected cells. The term “SIV” refers to simian immunodeficiency virus which is an HIV-like virus that infects monkeys, chimpanzees, and other nonhuman primates. SIV includes, but is not limited to, extracellular virus particles and the forms of SIV associated with SIV infected cells.

The term “HIV exposure”, as used herein, refers to the contact of an uninfected subject with a subject having an HIV infection or AIDS, or the contact with body fluids from such HIV- infected subject, in which such fluids from the infected subject contact a mucous membrane, a cut or abrasion in the tissue (e.g., needle stick, unprotected sexual intercourse), or other surface of the uninfected subject in such a way that the virus could be transmitted from the infected subject or infected subject's body fluids to the uninfected subject. The term “HIV infection”, as used herein, refers to indications of the presence of the HIV virus in an individual including asymptomatic seropositivity, AIDS-related complex (ARC), and acquired immunodeficiency syndrome (AIDS).

The term “VZV” refers to varicella-zoster virus, also known as human herpesvirus 3 (HHV-3, HHV3) or Human alphaherpesvirus 3 (taxonomically), is one of nine known herpes viruses that can infect humans. It causes chickenpox (varicella) commonly affecting children and young adults, and shingles (herpes zoster) in adults but rarely in children. VZV infections are species-specific to humans.

The term “VZV infection”, as used herein, refers to indications of the presence of the VZV in an individual.

The term “tuberculosis” refers to a contagious bacterial infection that affects the lungs, but can spread to other organs. The most important and representative bacterial species causing tuberculosis is Mycobacterium tuberculosis or Koch's bacillus, belonging to the Mycobacterium tuberculosis complex. It is spread by the airborne route, when infected people cough, sneeze or spit.

The term “cancer” refers to a group of diseases involving abnormal, uncontrolled growth and proliferation (neoplasia) of cells that form one or more malignant tumors in the subject suffering cancer, with the potential to invade or spread (metastasize) to other tissues, organs or, in general, distant parts of the organism; metastasis is one of the hallmarks of the malignancy of cancer and cancerous tumors. The term “cancer” includes, but is not restricted to, breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, lung cancer, colorectal cancer, stomach/gastric cancer, endometrial/uterine/cervical cancer, bladder cancer, head and neck cancer, leukemia, cancer of the heart, of the small intestine, spleen, kidney, brain, skin, bone, bone marrow, blood, thymus, womb, testicles, hepatobiliary system and liver, sarcoma, cholangiocarcinoma, glioblastoma, multiple myeloma, lymphoma, adenoma, angiosarcoma, astrocytoma, epithelial carcinoma, germinoma, glioma, hemangioendothelioma, hemangiosarcoma, hematoma, hepatoblastoma, medulloblastoma, melanoma, neuroblastoma, hepatobiliary cancer, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma and teratoma. Furthermore, this term includes acrolentiginous melanoma, actinic keratosis adenocarcinoma, adenoid cystic carcinoma, adenomas, adenosarcoma, adenosquamus carcinoma, astrocytic tumors, Bartholin gland carcinoma, basal cell carcinoma, bronchial gland carcinoma, capillary carcinoid, carcinoma, carcinosarcoma, cystadenoma, endodermal sinus tumor, endometrial hyperplasia, endometrial stromal sarcoma, endometrioid adenocarcinoma, ependymal sarcoma, Ewing sarcoma, focal nodular hyperplasia, germ cell tumors, glucagonoma, hemangioblastoma, hemagioendothelioma, hemagioma, hepatic adenoma, hepatic adenomastosis, hepatocellular carcinoma, hepatobilliary cancer, insulinoma, intraepithelial neoplasia, squamous cell intraepithelial neoplasia, invasive squamous-cell carcinoma, large cell carcinoma, leiomyosarcoma, melanoma, malignant melonoma, malignant mesothelial tumor, medulobastoma, medulloepithelioma, mucoepidermoid carcinoma, neuroblastoma, neuroepithelial adenocarcinoma, nodular melanoma, osteosarcoma, papillary serous adenocarcinoma, pituitary tumors, plasmacytoma, pseudosarcoma, pulmonary blastoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, serous carcinoma, microcytic carcinoma, soft tissue carcinoma, somatostatin secreting tumor, squamous carcinoma, squamous cell carcinoma, undifferentiated carcinoma, uveal melanoma, verrucous carcinoma, vipoma, Wilm tumor, intracerebral cancer, rectal cancer, astrocytoma, microcytic cancer and non-microcytic cancer, metastatic melanoma, androgen-independent metastatic prostate cancer, androgen-dependent metastatic prostate cancer. The term cancer includes both primary tumors as well as metastatic tumors.

The terms “identical” or percent “identity” in the context of two or more nucleic acids or polypeptides refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art which can be used to obtain alignments of amino acid or nucleotide sequences. Examples of algorithms suitable for determining sequence similarity include, but are not limited to, the BLAST, Gapped BLAST, and BLAST 2.0, WU-BLAST-2, ALIGN, and ALIGN-2 algorithms (Altschul S, et al., Nuc. Acids Res. 1977; 25:3389-3402, Altschul S, et a!., J. Mol. Biol. 1990; 215:403-410, Altschul S, et a!., Meth. Enzymol. 1996; 266:460-480, Karlin S, et a!., Proc. Natl. Acad. Sci. USA 1990; 87:2264- 2268, Karlin S, et al., Proc. Natl. Acad. Sci. USA 1993; 90:5873-5877, Genentech Corp, South San Francisco, CA, US, https://blast.ncbi.nlm.nih.gov/Blast.cgi, November 2021). Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, for instance, by the Smith-Waterman local homology algorithm, by the Needleman-Wunsch homology alignment algorithm, by the Pearson-Lipman similarity search method, by computerized implementations of these algorithms or by manual alignment and visual inspection (Smith T, et al., Adv. Appl. Math. 1981 ; 2:482-489, Needleman S, et al., J. Mol. Biol. 1970; 48:443-453, Pearson W, et al., Lipman D, Proc. Natl. Acad. Sci. USA 1988; 85:2444-2448, the GAP, BESTFIT, FASTA and TFASTA programs, Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wl, USA; Ausubel F, etal., Eds., Short Protocols in Molecular Biology, 5th Ed. (John Wiley and Sons, Inc., New York, NY, USA, 2002)).

The term “kit”, as used herein, refers to a product containing the different reagents necessary for carrying out the uses and methods of the invention which is packed so as to allow their transport and storage. Materials suitable for packing the components of the kit include crystal, plastic (e.g., polyethylene, polypropylene, polycarbonate), bottles, vials, paper or envelopes.

The term “NK cell”, as used herein, refers to a “Natural Killer cell”, a type of cytotoxic lymphocyte critical to the innate immune system. NK cells provide rapid responses to virally infected cells and respond to tumor formation, acting at around 3 days after infection. Typically, immune cells detect HLA presented on infected cell surfaces, triggering cytokine release causing lysis or apoptosis. NK cells are unique, however, as they have the ability to recognize stressed cells in the absence of antibodies and HLA, allowing for a much faster immune reaction. NK cells are defined as large granular lymphocytes and constitute the third kind of cells differentiated from the common lymphoid progenitor generating B and T lymphocytes. NK cells are known to differentiate and mature in the bone marrow, lymph node, spleen, tonsils and thymus where they enter into circulation. NK cells express usually the surface markers CD16 (FcyRIII) and CD56 in humans.

The term “no Fab exchange mutation”, as used herein, refers to a mutation which Prevents in Vivo and in Vitro lgG4 Fab-arm Exchange. The no Fab exchange mutation used in the constructs according to the present invention is the S228P mutation as defined in Silva et al. (J.Biol.Chem., 2015, 290: 5462-5469), wherein the 228 position is defined with respect to the sequence of the human lgG4 immunoglobulin.

The terms “nucleic acid”, “polynucleotide” and “nucleotide sequence”, as used interchangeably herein, relate to any polymeric form of nucleotides of any length and composed of ribonucleotides or deoxyribonucleotides. The terms include both single-stranded and double-stranded polynucleotides, as well as modified polynucleotides (e.g., methylated, protected). Typically, the nucleic acid is a “coding sequence” which, as used herein, refers to a DNA sequence that is transcribed and translated into a polypeptide in a host cell when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

The term “operably linked”, as used herein, means that the nucleotide sequence encoding for a first polypeptide sequence of interest is linked to a regulatory sequence and/or the nucleotide sequence encoding for at least a second polypeptide sequence of interest in a manner that allows for expression of first polypeptide or the combined expression of the first and at least one second polypeptide (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell) (Auer H, Nature Biotechnol. 2006; 24: 41-43).

The term “tag” as used herein, refers to a peptide sequence genetically grafted onto a recombinant protein. Tags can be added to either end of the target protein, so they are either C-terminus or N-terminus specific or are both C-terminus and N-terminus specific. Some tags are also inserted at sites within the protein of interest; they are known as internal tags. The recombinant protein of the invention can comprise a Myc and/or Hys tag. A Myc tag is a polypeptide protein tag derived from the c-myc gene product. A His-tag, or polyhistidine tag, is a string of histidine residues at either the N or C terminus of a recombinant protein.

The expression “parenteral administration” and “administered parenterally”, as used herein, means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and, intrasternal injection and infusion.

The expression “pharmaceutically acceptable excipient”, as used herein, includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents that are physiologically compatible with the TIGIT recombinant proteins of the invention.

The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. The terms “prevent,” “preventing” and “prevention”, as used herein, refer to inhibiting the inception or decreasing the occurrence of a disease in a subject. The prevention may be complete (e.g., the total absence of pathological cells in a subject). The prevention may also be partial, such as, for example, lowering the occurrence of pathological cells in a subject. Prevention also refers to a reduced susceptibility to a clinical condition. Within the context of the present invention, the terms “prevent,” “preventing” and “prevention”, refer specifically to averting or reducing the probability of a HIV, HBV, HCV, Coronavirus, CMV.EBV VZV or tuberculosis infection in a subject sustaining HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV or tuberculosisexposure.

The term “recombinant protein”, as used herein, relates to proteins generated by gene technology which comprise two or more functional domains derived from different proteins. A recombinant protein may be obtained by conventional means (e.g., by means of gene expression of the nucleotide sequence encoding for said recombinant protein in a suitable cell).

The term “subject”, as used herein, refers to an individual or animal, such as a human, a nonhuman primate (e.g., chimpanzees and other apes and monkey species); farm animals, such as birds, fish, cattle, sheep, pigs, goats and horses; domestic mammals, such as dogs and cats; laboratory animals including rodents, such as mice, rats and guinea pigs. The term does not denote a particular age or sex. The term “subject” encompasses an embryo and a fetus. In some embodiments, the subject is a human.

The term “therapeutic agent” as used herein, refers to an atom, molecule or compound useful in the prevention, inhibition of the progression or treatment of a disease. Examples of therapeutic agents include, but are not limited to, antibodies, antibody fragments, HIV antiretrovirals, HBV, HCV, Coronavirus, CMV, VZV, or EBV antivirals, vaccines, cytotoxic agents, pro-apoptotic agents, toxins, nucleases (e.g., DNAses and RNAses), hormones, immunomodulators, chelators, boron compounds, photoactive agents or dyes, radionuclides, oligonucleotides, interference RNA, siRNA, RNAi, anti-angiogenic agents, chemotherapeutic agents, cytokines, chemokines, prodrugs, enzymes, binding proteins, peptides or combinations thereof.

The term “therapeutically effective amount”, as used herein, refers to the dose or amount of the TIGIT recombinant proteins, dimers, nucleic acids, vectors, host cells, pharmaceutical compositions of the invention or mixtures thereof that produces a therapeutic response or desired effect in a subject. The term “TIGIT”, as used herein, refers to the T cell immunoreceptor with Ig and ITIM domains), an inhibitory receptor expressed mainly in natural killer (NK), CD8+ T, CD4+ T and T regulatory (Treg) cells. It binds to CD155 with high affinity (Boles K, et al., Eur J Immunol. 2009; 39(3):695-703) (UniProtKB accession number Q495A1 for the human form and UniProtKB accession number P86176for the mouse form).

The term “treat” or “treatment”, as used herein, refers to the administration of the monoclonal antibodies of the invention, their compositions or combinations thereof for controlling the progression of a disease after its clinical signs have appeared. Control of the disease progression is understood to mean the beneficial or desired clinical results that include, but are not limited to, reduction of the symptoms, reduction of the duration of the disease, stabilization of pathological states (specifically to avoid additional deterioration), delaying the progression of the disease, improving the pathological state and remission (both partial and total). The control of progression of the disease also involves an extension of survival compared with the expected survival if treatment was not applied. Within the context of the present invention, the terms “treat” and “treatment” refer specifically to stopping or slowing the infection and destruction of healthy CD4+ T cells in a HIV, HBV, HCV, Coronavirus, CMV EBV, VZV and/or tuberculosis infected subject. It also refers to the stopping and slowing of the onset of symptoms of the acquired immunodeficiency disease such as extreme low CD4+ T cell count and repeated infections by opportunistic pathogens. Beneficial or desired clinical results include, but are not limited to, an increase in absolute naive CD4+ T cell count (range 10-3520), an increase in the percentage of CD4+ T cell over total circulating immune cells (range 1-50%), or an increase in CD4+ T cell count as a percentage of normal CD4+ T cell count in an uninfected subject (range 1-161%). “Treatment” can also mean prolonging survival of the infected subject as compared to expected survival if the subject does not receive any HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV and/or tuberculosis targeted treatment.

The term “vector”, as used herein, refers to a nucleic acid molecule, linear or circular, that comprises a nucleic acid of the invention operably linked to additional segments that provide for its autonomous replication in a host cell or according to the expression cassette of the nucleic acid molecule.

2. Soluble TIG IT recombinant proteins The present invention refers to a TIGIT recombinant protein selected from the group of (i) a soluble TIGIT (sTIGIT) polypeptide, (ii) a soluble short TIGIT (ssTIGIT) polypeptide or (iii) a functionally equivalent variant thereof.

In one embodiment, the TIGIT recombinant protein according to the invention comprises at least part of the Ig-like V-type domain of the TIGIT protein, preferably the complete Ig-like V-type domain of the TIGIT protein. In another embodiment, the TIGIT recombinant protein according to the invention does not comprise the transmembrane domain of the TIGIT protein.

Preferably, the TIGIT recombinant protein according to the invention comprises or consists of: amino acids 22 to 124 of the human TIGIT protein sequence as defined in SEQ ID NO: 30, amino acids 22 to 130 of the human TIGIT protein sequence as defined in SEQ ID NO: 30, amino acids 29 to 133 of the mouse TIGIT protein sequence as defined in SEQ ID NO:31 a functionally equivalent variant thereof of any the above.

In some embodiments, the TIGIT recombinant protein of the invention further comprises at least one tag. In yet another embodiment, TIGIT recombinant protein of the invention comprises a single tag, preferably an hexahistidine tag, a Myc tag or a Flag tag. In another embodiment, the TIGIT recombinant protein of the invention comprises two tags, preferably a Myc or a Flag tag followed by an hexahistidine tag. More poreferably, wherein the TIGIT recombinant protein of the invention comprises a Flag tag followed by an hexahistidine tag, both tags are connected by a linker region having the sequence NMHTG. In one embodiment, the tag/tags is/are located at the C-terminal position of the TIGIT recombinant protein. In one embodiment, the TIGIT recombinant protein of the invention is coupled at its C-terminus to a peptide having the sequence EQKLISEEDLNMHTGHHHHHH (SEQ ID NO:36) and which comprises a Myc tag and a hexahistidine tag connected by a NMHTG sequence. In one embodiment, the TIGIT recombinant protein of the invention is coupled at its C-terminus to a peptide having the sequence DYKDDDDKNMHTGHHHHHH (SEQ ID NO:37) and which comprises a Flag tag and a hexahistidine tag connected by a NMHTG sequence.

In some embodiments, the TIGIT recombinant protein of the invention comprises, essentially comprises or consists of a sequence selected from the group consisting of SEQ ID NO:1 or 5. In yet another embodiment, the TIGIT recombinant protein or fusion protein according to the invention consists of a sequence as defined in SEQ ID NO:1 or 5 and further comprises an hexahistidine tag at the C-terminal region.

3. Fusion proteins comprising a TIG IT recombinant protein and an immunoglobulin Fc region

In some embodiments the invention relates to a fusion protein comprising the TIGIT recombinant protein according to the invention and a Fc portion of an immunoglobulin.

These fusion proteins are capable of forming dimers by means of the interaction between the respective Fc regions within the monomers, which are stabilized by disulfide bridges formed between cysteine residues located in a CPPC/CKPP present in the Fc regions.

In some embodiments, the Fc portion of an immunoglobulin derives from a human immunoglobulin or from a mouse immunoglobulin. In some embodiments, the Fc portion of the immunoglobulin is located C-terminally with respect to the TIGIT recombinant protein. In yet another embodiment, the Fc portion is from a human immunoglobulin and said human immunoglobulin is an I gG 1 , I gG2, lgG4. In yet another embodiment, the Fc portion is from a mouse immunoglobulin, wherein the Fc portion of the mouse immunoglobulin is an Fc portion of lgG1 or lgG2c or a a functionally equivalent variant thereof. In yet another embodiment, the fusion protein according to the invention comprises a TIGIT recombinant protein of human origin and a Fc portion is of a human immunoglobulin or a TIGIT recombinant protein of mouse origin and the Fc portion of a mouse immunoglobulin.

In yet another embodiment, the fusion protein according to the invention comprises a Fc portion of the human lgG4 immunoglobulin and carries a no Fab exchange mutation.

In yet another embodiment, the fusion protein according to the invention comprises a Fc portion of the mouse lgG2c immunoglobulin which carries a deletion of the PCPP region

In some embodiments, the fusion protein of the invention further comprises at least one tag. In yet another embodiment, the fusion protein of the invention comprises a single tag, preferably an hexahistidine tag, a Myc tag or a Flag tag. In another embodiment, the fusion protein of the invention comprises two tags, preferably a Myc or a Flag tag followed by an hexahistidine tag. More poreferably, wherein , the fusion protein of the invention comprises a Flag tag followed by an hexahistidine tag, both tags are connected by a linker region having the sequence NMHTG. In one embodiment, the tag/tags is/are located at the C-terminal position of the fusion protein. In one embodiment, the fusion protein of the invention is coupled at its C-terminus to a peptide having the sequence EQKLISEEDLNMHTGHHHHHH (SEQ ID NO:36) and which comprises a Myc tag and a hexahistidine tag connected by a NMHTG sequence. In one embodiment, the fusion protein of the invention is coupled at its C-terminus to a peptide having the sequence DYKDDDDKNMHTGHHHHHH (SEQ ID NO:37) and which comprises a Flag tag and a hexahistidine tag connected by a NMHTG sequence.

In some embodiments, the fusion protein of the invention comprises, essentially comprises or consists of a sequence selected from the group consisting of SEQ ID NO:2-4 or 6-10. In yet another embodiment, the TIGIT recombinant protein or fusion protein according to the invention consists of a sequence as defined in SEQ ID NO:2-4 r 6-10 and further comprises an hexahistidine tag at the C-terminal region.

4. Fusion proteins comprising two copies of a TIGIT recombinant protein

In another embodiment, the invention relates to a fusion protein comprising two TIGIT recombinant proteins according to the invention wherein the two TIGIT recombinant proteins are covalently bonded by a linker region. These fusion proteins can also be referred to as covalently-connected dimers, since they are formed by two monomers which are also connected at their ends by a covalent linker. In one embodiment, the linker connecting the first and second TIGIT recombinant proteins contains a sequence as defined in SEQ ID NO:38 (GGGGGS) , 39 (GGSGGS ) or 40 (GSSGSS).

In another embodiment, the fusion protein according to the invention comprises two TIGIT recombinant proteins of human origin. In yet another embodiment, the fusion protein according to the invention comprises two TIGIT recombinant proteins of mouse origin. In yet another embodiment, the the fusion protein according to the invention comprises a first TIGIT recombinant protein of human origin and a second TIGIT recombinant protein of murine origin, wherein the TIGIT recombinant protein of human origin can be located N-terminal or C- terminal with respedct to the TIGIT recombinant protein of muse origin.

In a particular embodiment, the two TIGIT recombinant proteins are covalently bonded by a linker region.

5. Dimers of the invention

In another particular embodiment, the present invention refers to a dimer, hereinafter the dimer of the invention, which results from the assembly of two TIGIT recombinant proteins by means of a dimerization domain in each monomer. In some embodiment, the dimer of the invention comprises two two TIGIT recombinant proteins derived from human TIGIT, wherein the dimer is formed by means of the homodimerization domain in the human TIGIT protein, corresponding to amino acids 32 to 42 of the human TIGIT precursor as defined in SEQ ID NQ:30.

In some embodiment, the dimer of the invention comprises two two TIGIT recombinant proteins derived from mouse TIGIT, wherein the dimer is formed by means of the homodimerization domain in the mouse TIGIT protein, corresponding to amino acids 35 to 45 of the human TIGIT precursor as defined in SEQ ID NO:31.

In some embodiments, the dimer according to the invention is characterized in that at least one of the momomers comprises a tag. In yet another embodiment, the tag is a Myc and/or His tag.

The TIGIT recombinant proteins, fusion proteins and dimers of the invention inhibit the binding of CD155 to TIGIT and thus are useful for the therapy of diseases or conditions associated to the CD155 and TIGIT and their interaction.

In some embodiments, the TIGIT recombinant proteins, fusion proteins and dimers of the invention can be chemically modified by covalent conjugation to a polymer, for example, to increase their circulating half-life. Methods of attaching polypeptides to polymers are known in the art (US4766106, US4179337, US4495285 and US4609546). In some embodiments, the polymers are polyoxyethylated polyols and polyethylene glycol (PEG). PEG is a water- soluble polymer that has the general formula: R(O--CH2--CH2)n O--R where R can be hydrogen or a protective group such as an alkyl or alkanol group. In some embodiments, the protective group has between 1 and 8 carbons, preferably it is methyl. In some embodiments, n is an integer between 1 and 1 ,000 and, preferably between 2 and 500. PEG has a preferred average molecular weight between 1 ,000 and 40,000, more preferably between 2,000 and 20,000 and most preferably between 3,000 and 12,000.

6. Nucleic acids, vectors, and host cells

In another aspect, the invention relates to the nucleic acids encoding the TIGIT recombinant proteins or fusion proteins of the invention to vectors comprising said nucleic acids and to the host cells comprising the nucleic acids and/or vectors indicated before. In some embodiments, the nucleic acids are polynucleotides, including, but not limited to, deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages.

In a particular embodiment, the nucleic acids of the invention comprise polynucleotides encoding for (i) a soluble TIGIT polypeptide, (ii) a short soluble TIGIT polypeptide or (iii) a functionally equivalent variant thereof.

In another particular embodiment, the polynucleotides encoding for (i) the soluble TIGIT polypeptide, (ii) the short solubleTIGIT polypeptide or (iii) the functionally equivalent variant thereof are operably linked to polynucleotides encoding for a Fc portion of a human immunoglobulina. In a more particular embodiment, the human immunoglobuline is lgG1 or a functionally equivalent variant thereof.

In another particular embodiment, the aforesaid polynucleotides are further operably linked to a polynucleotide sequence encoding for a tag. In a more particular embodiment, the tag is a Myc and/or Hys tag or a functionally equivalent variant thereof.

In another particular embodiment, the nucleid acid of the invention comprise a signal sequence. In a more particular embodiment, the signal sequence is the TIGIT native signal sequence, the azurocidin signal sequence or the CD5 signal sequence.

In another particular embodiment, the nucleic acids of the invention comprise the polynucleotide sequences SEQ ID NO: 11-20 or the functionally equivalent variants thereof. In another particular embodiment, the nucleic acids of the invention comprise polynucleotide sequences encoding for at least two operably linked TIGIT recombinant proteins. In some embodiments, the polynucleotide sequences are identical. In some embodiments, the polynucleotide sequences are different.

The functionally equivalent variants of the nucleic acids of the invention may be obtained by means of the insertion, deletion or substitution of one or several nucleotides with respect to their reference sequences. In some embodiments, the polynucleotides encoding for functionally equivalent variants of the nucleic acids of the invention are polynucleotides whose sequences allows them to hybridize in highly restrictive conditions with their nucleic acids of reference. Typical conditions of highly restrictive hybridization include incubation in 6 X SSC (1 X SSC: 0.15 M NaCI, 0.015 M sodium citrate) and 40% formamide at 42°C during 14 hours, followed by one or several washing cycles using 0.5 X SSC, 0.1 % SDS at 60°C. Alternatively, highly restrictive conditions include those comprising a hybridization at a temperature of approximately 50-55°C in 6 X SSC and a final washing at a temperature of 68°C in 1-3 X SSC. Moderate restrictive conditions comprise hybridization at a temperature of approximately 50°C until around 65°C in 0.2 or 0.3 M NaCI, followed by washing at approximately 50°C until around 55°C in 0.2 X SSC, 0.1 % SDS (sodium dodecyl sulphate). In some embodiments, the nucleic acids of the invention are codon optimized.

In another particular embodiment, a variant of a nucleic acid having at least 80%, 85%, 90%, 95%, or 99% similarity to its reference nucleic acid is used instead, wherein said variant encodes a TIGIT recombinant protein or dimer of the invention or a functionally equivalent variant thereof.

The nucleic acids of the invention may require treatment with restriction enzymes for their ligation into a suitable vector (e.g., 1 , 2 or 3 terminal nucleotides may be removed). In some embodiments, the invention relates to said nucleic acids, wherein they have been cut at each end with a restriction enzyme.

In some embodiments, the present invention relates to an expression cassette comprising a nucleic acid of the invention, a promoter sequence and a 3’-UTR and, optionally, a selection marker.

In yet another embodiment, the present invention relates to a vector comprising a nucleic acid of the invention. In an additional aspect of this embodiment, the nucleic acid of the invention is contained in an expression cassette comprised by said vector. Suitable vectors according to the present invention include, but are not limited to, prokaryotic vectors, such as pUC18, pUC19, and Bluescript plasmids and derivatives thereof, like the mp18, mp19, pBR322, pMB9, ColE1 , pCRI and RP4 plasmids; phages and shuttle vectors, such as pSA3 and pAT28 vectors; expression vectors in yeasts, such as 2-micron plasmid type vectors; integration plasmids; YEP vectors; centromeric plasmids and analogues; expression vectors in insect cells, such as the vectors of the pAC series and of the pVL series; expression vectors in plants, such as vectors of the pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series and analogues; and expression vectors in superior eukaryotic cells either based on viral vectors (e.g., adenoviruses, adeno-associated viruses, retroviruses, lentiviruses) as well as non-viral vectors, such as the pSilencer 4.1-CMV (Ambion®, Life Technologies Corp., Carlsbad, CA, US), pcDNA3, pcDNA 3.1 , pcDNA3.1/hyg pHCMV/Zeo, pCR3.1 , pEFI/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6A/5-His, pVAXI, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1 , pML2d, and pTDTI vectors. In some embodiments, the vector is a pcDNA3.4 vector.

In a particular embodiment, the viral vector is an AAV vector. AAV vectors encoding the TIGIT recombinant proteins or dimers of the invention may be constructed according to molecular biology techniques well known in the art (Brown T, Gene Cloning (Chapman & Hall, London, GB, 1995); Watson R, et al., Recombinant DNA, 2nd Ed. (Scientific American Books, New York, NY, USA, 1992); Alberts B, et al., Molecular Biology of the Cell (Garland Publishing Inc., New York, NY, USA, 2008); Innis M, et al., Eds., PCR Protocols. A Guide to Methods and Applications (Academic Press Inc., San Diego, CA, USA, 1990); Erlich H, Ed., PCR Technology. Principles and Applications for DNA Amplification (Stockton Press, New York, NY, USA, 1989); Sambrook J, et al., Molecular Cloning. A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 1989); Bishop T, et al., Nucleic Acid and Protein Sequence. A Practical Approach (IRL Press, Oxford, GB, 1987); ReznikoffW, Ed., Maximizing Gene Expression (Butterworths Publishers, Stoneham, MA, USA, 1987); Davis L, et al., Basic Methods in Molecular Biology (Elsevier Science Publishing Co., New York, NY, USA, 1986), Schleef M, Ed., Plasmid for Therapy and Vaccination (Wiley-VCH Verlag GmbH, Weinheim, DE, 2001)).

For instance, HEK-293 cells (expressing E1 genes), a helper plasmid providing adenovirus function, a helper plasmid providing AAV rep genes from serotype 2 and cap genes from the desired serotype (e.g., AAV8) and, finally, the backbone plasmid with ITRs and the construct of interest may be employed. To generate an AAV vector expressing the TIGIT recombinant protein or dimer of the invention, the cDNA of the recombinant protein or dimer may be cloned into an AAV backbone plasmid under the control of a ubiquitous (e.g., CAG) or a cell-specific promoter. AAV vectors (viral vector particles) may be generated by helper virus-free transfection of HEK293 cells using three plasmids with modifications (Matsushita T, et al., Gene Ther. 1998; 5:938-945 and Wright J, et al., Mol. Ther. 2005; 12:171-178). Cells may be cultured to 70% confluence in roller bottles (RB) (Corning Inc., Corning, NY, USA) in DM EM (Dulbeccos's Modified Eagle Medium) supplemented with 10% BFS (bovine fetal serum) and then cotransfected with: 1) a plasmid carrying the expression cassette flanked by the viral ITRs (described above); 2) a helper plasmid carrying the AAV rep2 and the correspondent cap (cap1 and cap9 genes; and 3) a plasmid carrying the adenovirus helper functions. Vectors may then be purified by two consecutives cesium chloride gradients using either a standard protocol or an optimized protocol as previously described (Ayuso E, et al., Gene Ther. 2010; 17:503-510). Vectors may be further dialyzed against PBS, filtered, titred by qPCR (quantitative polymerase chain reaction) and stored at -80°C until use.

In another particular embodiment, the present invention relates to a host cell comprising a nucleic acid, expression cassette or vector of the invention. Host cells to be used according to the present invention can be of any cell type, including both eukaryotic cells and prokaryotic cells. In some embodiments, the eukaryotic cells comprise HEK-293, Expi293F and CHO cells.

7. Pharmaceutical compositions

In a further aspect, the present invention refers to a pharmaceutical composition containing at least one of the TIGIT recombinant proteins, fusion protein dimers, nucleic acids, vectors or host cells of the invention (hereinafter referred singly or jointly as “active agent(s) of the invention”) or a mixture thereof, formulated with a pharmaceutically acceptable carrier. Said pharmaceutical compositions are used for preventing, inhibiting the progression or treating a HIV, HBV, HCV, Coronavirus, CMV.EBV, VZV or tuberculosis infection in a subject. In some embodiments, the compositions include a mixture of multiple (e.g., two or more) TIGIT recombinant proteins, fusion proteins dimers, nucleic acids, vectors or host cells of the invention. In some embodiments, the composition includes at least one TIGIT recombinant protein or fusion protein of SEQ ID NO:1-10 or the nucleic acids, vectors or host cells expressing said TIGIT recombinant proteins or fusion proteins or a mixture thereof. The preparation of pharmaceutical compositions comprising the TIGIT recombinant proteins, fusion proteins or dimers of the invention is known in the art (McNally E, et al., Eds., Protein Formulation and Delivery (Marcel Dekker, Inc., New York, NY, USA, 2000), Hovgaard L, et al., Eds., Pharmaceutical Formulation Development of Peptides and Proteins, 2^nd Ed. (CRC Press, Boca Raton, FL, USA, 2012) and Akers M, et al., Pharm Biotechnol. 2002; 14:47-127).

In a particular embodiment, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active agent of the invention may be coated in a material to protect the agent from the action of conditions that may inactivate the agent.

In another particular embodiment of the present invention, pharmaceutical compositions specifically suitable for gene therapy are provided. Said pharmaceutical compositions comprise at least one of the nucleic acids or vectors of the invention or their mixture and are prepared according to methods known in the art (Andre S, et al., J. Virol. 1998, 72:1497-1503; Mulligan M, Webber J, AIDS 1999; 13(Suppl A):S105-S112; O'Hagan D, et al., J. Virol. 2001 ; 75:9037-9043 and Rainczuk A, et al., Infect. Immun. 2004; 72:5565- 5573). The particular vector backbone into which the nucleic acids of the invention are inserted is not important as long as said nucleic acid is adequately expressed in a subject. Examples of suitable vectors include, but are not limited to, viruses and plasmids. In some embodiments, an AAV vector is used when a viral vector is employed. In some embodiments, a pcDNA3.4 and pVAX1 (Invitrogen, Carlsbad, CA, USA); DNA sequences available at the Invitrogen website http://www.thermofisher.com/uk/en/home/brands/invitroqen.html, November 2021 2015); pNGVL (National Gene Vector Laboratory, University of Michigan, Ml, USA); and p414cyc (ATCC accession number 87380) and p414GALS (ATCC accession number 87344) is used when a plasmidic vector is employed. Preferably, a pcDNA3.4 plasmid is utilized as plasmidic vector.

The design of gene therapy products is known in the art (Donnelly J, et al., Annu. Rev. Immunol. 1997; 15:617-648; Robinson H, Pertmer T, Adv. Virus Res. 2000; 55:1-74; Gurunathan S, et al., Annu. Rev. Immunol. 2000; 18:927-974 (2000) and Ulmer J, Curr. Opin. Drug Discov. Devel. 2001 ; 4:192-197). Typically, the nucleic of the polypeptide of interest is cloned into a bacterial plasmid that is optimized for expression in eukaryotes and consists of the following: (i) an origin of replication for propagation in bacteria, usually an E. coli origin such as ColE1 , (ii) an antibiotic resistance gene, usually kanamycin, for selection of the plasmid in bacteria, (iii) a strong promoter for optimal expression in mammalian cells like cytomegalovirus (CMV) or simian virus 40 (SV40), (iv) multiple cloning site downstream of the promoter for insertion of the gene of interest and (v) SV40 or bovine growth hormone (BGH) polyadenylation signal for stabilization of mRNA. Still another object of the present invention is to deliver vectors utilizing non-pathogenic or attenuated bacterial strains harboring plasmids capable of expressing the TIGIT recombinant proteins, fusion proteins or dimers of the invention, such as, but not restricted to, Escherichia spp., Salmonella spp., Shigella spp., Mycobacterium spp. and Listeria spp when such approach is feasible (e.g., when the polypeptide of interest is not glycosylated).

The particular Escherichia strain employed is not critical to the present invention. Examples of Escherichia strains which can be employed in the present invention include Escherichia coli strains DH5a, HB 101 , HS-4, 4608-58, 1184-68, 53638-C-17, 13-80, and 6- 81 , enterotoxigenic E. coli, enteropathogenic E. coli and enterohemorrhagic E. coli (Sambrook, 1989, supra, Sansonetti P, et al., Ann. Microbiol. 1982; 132A:351-355); Evans D, et al., Infect. Immun. 1975; 12:656-667; Donnenberg S, et al., J. Infect. Dis. 1994; 169:831- 838 and McKee M, O'Brien A, Infect. Immun. 1995; 63:2070-2074).

The particular Salmonella strain employed is not critical to the present invention. Examples of Salmonella strains that can be employed in the present invention include S. typhi (ATCC accession number 7251), S. typhimurium (ATCC accession number 13311), S. galinarum (ATCC accession number 9184), S. enteriditis (ATCC accession number 4931), S. typhimurium (ATCC accession number 6994), S. typhi aroC, aroD double mutant (Hone D, et al., Vaccine 1991 ; 9:810-816) and S. typhimurium aroA mutant (Mastroeni D, et al., Micro. Pathol. 1992; 13:477-491).

The particular Shigella strain employed is not critical to the present invention. Examples of Shigella strains that can be employed in the present invention include S. flexneri (ATCC accession number 29903), S. flexneri CVD 1203 (ATCC accession number 55556), S. flexneri 15D (Sizemore D, et al., Vaccine 1997; 15:804-807; Sizemore D, etal., Science 1995, 270:299-302), S. sonnei (ATCC accession number 29930) and S. dysenteriae (ATCC accession number 13313).

The particular Mycobacterium strain employed is not critical to the present invention. Examples of Mycobacterium strains that could be employed in the present invention include M. tuberculosis CDC1551 strain (Griffith T, et al., Am. J. Respir. Crit. Care Med. 1995; 152:808-811), M. tuberculosis Beijing strain (van Soolingen D, et al., J. Clin. Microbiol. 1995; 33:3234-3238), M. tuberculosis H37Rv strain (ATCC accession number 25618), M. tuberculosis pantothenate auxotroph strain (Sambandamurthy V, Nat. Med. 2002; 8:1171- 1174, M. tuberculosis rpoV mutant strain (Collins D, et al., Proc. Natl. Acad. Sci USA. 1995; 92: 8036, M. tuberculosis leucine auxotroph strain (Hondalus M, et al., Infect. Immun. 2000; 68(5):2888-2898), BCG Danish strain (ATCC accession number 35733), BCG Japanese strain (ATCC accession number 35737), BCG, Chicago strain (ATCC accession number 27289), BCG Copenhagen strain (ATCC No. 27290), BCG Pasteur strain (ATCC accession number 35734), BCG Glaxo strain (ATCC accession number 35741), BCG Connaught strain (ATCC accession number 35745) and BCG Montreal (ATCC accession number 35746).

The particular Listeria strain employed is not critical to the present invention. Examples of Listeria monocytogenes strains which can be employed in the present invention include, but are not restricted to, L. monocytogenes strain 10403S (Stevens R, et al., J. Virol. 2004; 78:8210-8218), L. ivanovii and L. seeligeri strains (Haas A, et al., Biochim. Biophys. Acta. 1992; 1130:81-84) or mutant L. monocytogenes strains such as (i) actA pIcB double mutant (Peters C, et al., FEMS Immunol. Med. Microbiol. 2003; 35:243-253 and Angelakopoulos H, et al., Infect. Immun. 2002; 70:3592-3601) or (ii) dal dat double mutant for alanine racemase gene and D-amino acid aminotransferase gene (Thompson R, et al., Infect. Immun. 1998; 66:3552-3561).

Methods for delivering vectors using bacterial vehicles are well known in the art (US6500419, US5877159, and US5824538; Shata M, et a!., Mol. Med. Today 2000; 6:66-71 ; Hone D, et a!., J. Virol. 2001 ; 75:9665-9670; Shata M, et a!., Vaccine 2001 ; 20:623-629; Rapp II and Kaufmann S, Int. Immunol. 2004, 16:597-605; Dietrich G, et al., Curr. Opin. Mol. Ther. 2003; 5:10-19 and Gentschev I, et al., J. Biotechnol. 2000; 83:19-26). The type of plasmid delivered by said bacterial vehicles for expressing the TIGIT recombinant proteins or dimers of the invention is not critical.

In an additional embodiment, the use of an AAV vector for delivering the nucleic acids of the invention is also provided.

The pharmaceutical compositions of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route or mode of administration will vary depending upon the desired results. The active agents of the invention can be prepared with carriers that will protect the agent against rapid release, such as a controlled release formulation, including implants, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid. Many methods for the preparation of such formulations are generally known to in the art (Robinson J, et al., Eds., Sustained and Controlled Release Drug Delivery Systems (Marcel Dekker, Inc., New York, NY, USA, 1978)).

To administer an active agent of the invention by certain routes of administration, it may be necessary to coat the agent with, or co-administer the agent with, a material to prevent its inactivation or to ensure its proper distribution in vivo. For example, the agent may be administered to a subject in an appropriate carrier (e.g., liposome) or a diluent. Pharmaceutically acceptable diluents include, but are not limited to, saline and aqueous buffer solutions. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan G, et al., J. Neuroimmunol. 1984; 7:27-41). Many methods of manufacturing liposomes are known in the art (US4522811 , US5374548, and US5399331). The liposomes may comprise one or more moieties which are selectively transported into specific cells or organs and thus enhance targeted drug delivery. Exemplary targeting moieties include folate or biotin, mannosides and surfactant protein A receptor. In some embodiments, the active agents of the invention are formulated in liposomes; in a more preferred embodiment, the liposomes include a targeting moiety. In some embodiments, the active agents in the liposomes are delivered by bolus injection.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media in the preparation of the pharmaceutical compositions of the invention is contemplated herein in so far as their use is not incompatible with the active agents of the invention. Supplementary active compounds can also be incorporated into the pharmaceutical compositions.

Pharmaceutical compositions are typically sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome or other ordered structure suitable to active agent concentration. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol) or suitable mixtures thereof. The proper fluidity can be maintained, for example, by using a coating such as lecithin, by reducing the deviation in particle size and by using surfactants. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, polyalcohols (e.g., mannitol, sorbitol) or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition compounds that delay absorption (e.g., monostearate salts, gelatin).

Sterile injectable solutions can be prepared by incorporating the active agent of the invention in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the active agent into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying (i.e. , lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.

Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased, as indicated by the exigencies of the therapeutic situation. For example, the TIGIT recombinant proteins or dimers of the invention may be administered once or twice weekly by subcutaneous injection or once or twice monthly by subcutaneous injection.

It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active agent calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention is dictated by and directly dependent on the unique characteristics of the active agent and the particular therapeutic effect to be achieved.

Examples of pharmaceutically-acceptable antioxidants include, but are not limited to, water soluble antioxidants (e.g., ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite), oil-soluble antioxidants (e.g., ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol) and metal chelating agents (e.g., citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid). The formulations of the pharmaceutical compositions of the invention include those suitable for oral, nasal, topical (e.g., buccal and sublingual), rectal, vaginal or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods known in the art. The amount of active agent which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated and the particular mode of administration. The amount of active agent which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, this amount will range from about 0.001% to about 90% of active agent, preferably from about 0.005% to about 70% and, most preferably, from about 0.01% to about 30%. Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate. Dosage forms for the topical or transdermal administration of compositions of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active agent of the invention may be mixed under sterile conditions with a pharmaceutically acceptable carrier and with any preservatives, buffers or propellants which may be required.

The pharmaceutical compositions of the invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents (e.g., paraben, chlorobutanol, phenol sorbic acid). It may also be desirable to include isotonic agents (e.g., sugars, sodium chloride) into the compositions.

Actual dosage levels of the active agents in the pharmaceutical compositions of the present invention may be varied for attaining the desired therapeutic response in a subject. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular agent of the invention employed, its amount, the route of administration, the time of administration, the rate of excretion or expression of the particular active agent employed, the duration of the treatment, other drugs, compounds or materials used in combination with the particular pharmaceutical compositions employed, the age, sex, weight, condition, general health and prior medical history of the subject being treated and other similar factors known in the medical arts. A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the therapeutically effective amount of the active agent(s) required. For example, the physician or veterinarian could start doses of the active agents of the invention employed in the pharmaceutical composition at levels lower than that required for achieving the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. In general, a suitable daily dose of a composition of the invention will be that amount of the active agent which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. It is preferred that administration be parenteral, more preferably intravenous, intramuscular, intraperitoneal or subcutaneous. If desired, the effective daily dose of a pharmaceutical composition may be administered as two, three, four, five, six or more subdoses applied separately at appropriate intervals throughout the day, optionally, in unit dosage forms. While it is possible for an active agent of the invention to be administered alone, it is preferable to administer said agent as a pharmaceutical composition.

The pharmaceutical compositions of the invention can be administered with medical devices known in the art. For example, in some embodiments, the pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device (US5399163, US5383851 , US5312335, US5064413, US4941880, US4790824 or US4596556). Examples of well-known implants and modules useful in the present invention include, but are not limited to, infusion pumps for dispensing medications at different rates (e.g., US4447233 (non-implantable, controlled rate), US4447224 (implantable, variable rate), US4487603 (implantable, controlled rate)), devices for administering medicaments through the skin (e.g., US4486194) and osmotic drug delivery systems (e.g., US4439196 and US 4475196). Many other such implants, delivery systems and modules are known to those skilled in the art.

The pharmaceutical compositions of the invention must be sterile and fluid to the extent that the composition is deliverable by syringe. In addition to water, the carrier can be an isotonic buffered saline solution, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyetheylene glycol) and suitable mixtures thereof. Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols (e.g., mannitol, sorbitol) and sodium chloride in the composition. Long-term absorption of the injectable compositions can be brought about by including an agent which delays absorption (e.g., aluminum monostearate, gelatin) in the composition.

8. Methods of treatment and prevention

In some embodiments, the invention is directed to a method for preventing, inhibiting the progression or treating an infectious disease in a subject. In a particular embodiment, the invention is directed to a method for preventing, inhibiting the progression or treating a HIV, HBV, HCV, Coronavirus, CMV.EBV, VZV or tubercilosis infection in a subject which comprises the administration to said subject of at least one of the TIGIT recombinant proteins, fusion proteins, dimers, nucleic acids, vectors, host cells or pharmaceutical compositions of the invention, or a mixture thereof. The beneficial treatment or preventive effects of the active agents and pharmaceutical compositions of the invention in relation to a HIV, HBV, HCV, Coronavirus, CMV.EBV, VZV or tuberculosis infection include, for example, preventing or delaying initial infection of a subject exposed to HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV or tuberculosis infection, reducing viral burden in a subject infected with such viruses, prolonging the asymptomatic phase of said infections, maintaining low viral loads in infected subjects whose virus levels have been lowered via antiviral therapy, including anti-retroviral therapy (AT), increasing levels of CD4 T cells or lessening the decrease in CD4 T cells in drug naive subjects and in treated subjects, increasing the overall health or quality of life in an infected subject and prolonging the life expectancy of chronically infected subject. A physician or veterinarian can compare the effect of the treatment with the subject's condition prior to treatment, or with the expected condition of an untreated subject, to determine whether the treatment is effective in preventing, inhibiting the progression or treating a HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV or tuberculosis infection.

The active agents and pharmaceutical compositions of the invention may be particularly useful in preventing, inhibiting the progression or treating a HIV infection or AIDS. While all subjects that can be afflicted with HIV or their equivalents can be treated in this manner (e.g., chimpanzees, macaques, baboons or humans), the active agents and pharmaceutical compositions of the invention are directed particularly to their therapeutic uses in humans. Often, more than one administration may be required to bring about the desired therapeutic effect; the exact protocol (dosage and frequency) can be established by standard clinical procedures.

The present invention further relates to reducing or eliminating the symptoms associated with HIV infection or AIDS. These include symptoms associated with the minor symptomatic phase of HIV infection, including, for example, shingles, skin rash and nail infections, mouth sores, recurrent nose and throat infection and weight loss. In addition, further symptoms associated with the major symptomatic phase of HIV infection, include, for instance, oral and vaginal thrush (Candida), persistent diarrhea, weight loss, persistent cough and reactivated tuberculosis or recurrent herpes infections, such as cold sores (herpes simplex). Other symptoms of full-blown AIDS which can be treated in accordance with the present invention include, for instance, diarrhea, nausea and vomiting, thrush and mouth sores, persistent, recurrent vaginal infections and cervical cancer, persistent generalized lymphadenopathy (PGL), severe skin infections, warts and ringworm, respiratory infections, pneumonia, especially Pneumocystis carinii pneumonia (POP), herpes zoster (or shingles), nervous system problems, such as pains, numbness or “pins and needles” in the hands and feet, neurological abnormalities, Kaposi's sarcoma, lymphoma, tuberculosis or other similar opportunistic infections.

In some embodiments, the active agents or pharmaceutical compositions of the invention are administered to an HIV-infected subject or a subject exposed to HIV in combination with at least one therapeutic agent. Preferably, the therapeutic agent is indicated commonly for the prevention or treatment of HIV or AIDS. Suitable therapeutic agents include, but are not limited to, drugs forming part of current antiretroviral therapy (AT) and highly active antiretroviral therapy (HAART) protocols such as non-nucleoside reverse transcriptase inhibitor (e.g., efavirenz, nevirapine, delavirdine, etravirine, rilpivirine), nucleoside analogue reverse transcriptase inhibitors (e.g., zidovudine, tenofovir, lamivudine, emtricitabine) and protease inhibitors (e.g., saquinavir, ritonavir, indinavir, nelfinavir, amprenavir), referred hereinafter independently or jointly as “HIV antiretroviral(s)”. In some embodiments, at least one active agent or pharmaceutical composition of the invention and at least one HIV antiretroviral are administered to the subject together at the same time. In some embodiments, at least one active agent or pharmaceutical composition of the invention is administered before any HIV antiretroviral is applied to the subject. In some embodiments, at least one active agent or pharmaceutical composition of the invention is administered after a HIV antiretroviral has been applied to the subject, such as, for example, after the interruption of an AT or HAART protocol.

In other embodiments, the invention is directed to a method for preventing, inhibiting the progression or treating a cancer. In a particular embodiment, the cancer is selected from the list consisting of breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, lung cancer, colorectal cancer, stomach/gastric cancer, endometrial/uterine/cervical cancer, bladder cancer, head and neck cancer, leukemia, sarcoma, cholangiocarcinoma, glioblastoma, multiple myeloma or lymphoma.

9. Kits

In a further aspect, the present invention refers to kits comprising the TIGIT recombinant proteins, fusion proteins, dimers, nucleic acids, expression vectors, host cells, pharmaceutical composition, and combination therapies of the invention, or a mixture thereof and instructional materials for their use. The components of the kits of the invention may be optionally packed in suitable containers and be labeled for preventing, inhibiting the progression and treating a HIV, HBV, HCV, Coronavirus, CMV.EBV, VZV or tuberculosis infection or their related conditions. The components of the kits of the invention may be optionally packed in suitable containers and be labeled for preventing, inhibiting the progression and treating of cancer. The components of the kits may be stored in unit or multidose containers as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (e.g., the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The kits may further comprise more containers comprising a pharmaceutically acceptable carrier. They may further include other materials desirable from a commercial and user standpoint, including, but not limited to, buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable host cells or other active agents. The kits can contain instructions customarily included in commercial packages of diagnostic and therapeutic products that contain information, for example, about the indications, usage, dosage, manufacture, administration, contraindications or warnings concerning the use of such diagnostic and therapeutic products.

All publications mentioned herein are incorporated in their entirety by reference. Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention, unless specified.

Example 1

Amplification of TIGIT expression plasmids

The TIGIT expression plasmids were amplified in 3 consecutive days following the protocol detailed below. All prototypes were synthesized with an azurocidin signal peptide and a 6his-tag into pcDNA3.4 plasmid by Genscript. See Fig. 1 and 2.

Day 1: Plasmid transformation in E. coli competent cells

A One Shot™ OmniMAX™ 2 T1 R Chemically Competent E. coli (Ref. C854003, Invitrogen) was used according to the manufacturer's instructions. 10 pg-100 ng of DNA were added to one vial of One-Shot cells OmniMAX™ 2 T1 R chemically competent E. coli (Ref. C854003, Invitrogen), and were mixed gently. The vial was incubated on ice for 30 minutes. The cells were heat-shocked for 30 seconds at 42°C without shaking, and then were placed on ice for 2 minutes. 250 pL of pre-warmed S.O.C. medium was added to each vial. The vials were then stirred horizontally at 37°C for 1 hour at 225 rpm in a shaking incubator. 25-100 pL of the diluted transformation mix were spread on a pre-warmed selective plate (10 pg/mL ampicillin LB Agar (ampicillin, Ref. A5354, Merck; agar, Ref. 22700041 , Life Technologies)) and were incubated at 37°C overnight.

Day 2: Selection of positive E. coli colonies

Colonies were selected and grown in 3mL of ampicillin-LB selective media (ampicillin, Ref. A5354, Merck; media, Ref. 12780029, Life Technologies) at 37°C for 4 h at 225 rpm in a shaking incubator. Then the volume was escalated to 200 mL and the cultures were grown overnight at 37°C at 225 rpm in a shaking incubator.

Day 3: Plasmid DNA purification and validation

A ZymoPURE™ II Plasmid Maxiprep Kit (Ref. D4202, Zymo Research) was used following the manufacturer's instructions. Cultures were centrifuged for 30 min at 3000 g to obtain pellets of bacteria cells. Plasmid DNA was purified with ZymoPURE™ II Plasmid Maxiprep Kit was used according to the manufacturer's instructions. DNA was sterilized with 0.22 pm filter. DNA concentration was determined by measuring absorbance at 260 nm using a nano-spectrophotometer. Plasmid digestion was analyzed with restriction enzymes FastDigest Notl (Ref. FD0593, Thermo Scientific) and Xbal (Ref. FD0685, Thermo Scientific) in electrophoretic run of 1% agarose for the release of the expected insert (sTIGIT). See Fig. 1 B. The purified plasmid was sequenced for final confirmation. The universal primers: CMV-F (CGCAAATGGGCGGTAGGCGTG) and WRPE-R (CATAGCGTAAAAGGAGCAACA) were used for confirmation.

Example 2

TIG IT recombinant proteins production by transfection in Expi293F cells

The TIGIT recombinant proteins were produced following the protocol detailed below over a period of 9 consecutive days. See Fig. 1 and 2.

Day 1: Subculture cells

Acridine orange (Ref. A6014, Merck) and DAPI (Ref. D9542, Merck) were employed for determining viable Expi293F™ cell density (Ref. A14527, Gibco) and percent viability. Subculture and expand Expi293F™ cells were further cultured and expanded until cell density of approximately 3-5 x 10⁶ viable cells/mL was reached.

Day 2: Plate cells

The cell density and percent viability of the viable Expi293F™ cells were determined. The Expi293F™ cells were expanded to a final density of 2.5-3 x 10⁶ viable cells/mL. The cells were allowed to grow overnight.

Day 3: Plasmid transfection in Expi293F cells

A ExpiFectamine™ 293 Transfection Kit (Ref. A14524, Gibco) was used according to the manufacturer's instructions. The viable Expi293F™ cell density and percent viability were determined. The cells were diluted to a final density of 3x10⁶ viable cells/mL with fresh, prewarmed Expi293™ Expression Medium (200 mL; Ref. A1435101 , Gibco). Plasmid DNA (pcDNA3.4_sTIGIT_SP-Azu) was diluted with Opti-MEM medium (Total plasmid DNA concentration of 1.0 pg/mL of culture volume; Ref. 31985070, Gibco). Then, the ExpiFectamine™ 293 reagent was diluted with Opti-MEM medium and was mixed by swirling or inversion. The diluted ExpiFectamine™ 293 reagent was added to the diluted plasmid DNA, and then mixed by swirling or inversion. The ExpiFectamine™ 293/plasmid DNA complexes were incubated at room temperature for 10-20 minutes. The complexes were slowly transferred to the cells by swirling the culture flask gently during addition. Then, the cells were incubated in a 37°C incubator with >80% relative humidity and 8% CO2 on an orbital shaker.

Day 4: Transfection enhancers addition

ExpiFectamine™ 293 Transfection (Ref. A14524, Gibco) Enhancer 1 and Enhancer 2 were added to the transfection flask 8-22 hours post transfection. The flask was gently swirled during addition.

Day 9: Han/est cell culture supernatant

The culture supernatant with the protein of interest was harvested 5-7 days post transfection. The supernatant was centrifuged at 300g during 5 min to obtain cell pellets. The supernatant was kept, and the cells were discarded. The supernatant was centrifuged at 900 g during 10 min, and then filtered using disposable sterile 0.22 pm filter units.

Example 3

TIGIT proteins purification and quantification and validation

The TIGIT recombinant proteins obtained as per the previous example were purified and quantified according to the protocol detailed below over a period of 2 consecutive days.

Day 1: Purification by metal affinity chromatography using HisTrap™ Excel columns (Ref GE17-3712-06, Merck

The pump tubing was filled with distilled water. The ethanol of the column was washed out with 5 column volumes (CV) of distilled water at a flow rate of 5 mL/min. The column was equilibrated with at least 5 CV of 500 mM NaCI-PBS (Ref. 10010056, Gibco) at 5 mL/min. The sample was loaded at a flow rate of 5 mL/min. The sample was washed with 20 CV of 500mM NaCI-10mM imidazole-PBS at 5 mL/min. Then, the sample was eluted applying a linear elution gradient (10 to 20 CV) from 10 to 500mM imidazole in 500mM NaCI-PBS at a flow rate of 5 mL/min. Imidazole was removed from the fractions using an Amicon® Ultra-15 Centrifugal Filter Unit (Ref. GE17-3712-06, Merck). See Fig. 3A and C.

Day 2: Validation by Coomassie blue staining and Western Blot

Protein concentration was determined by measuring absorbance at 280 nm using a nano-spectrophotometer. The purity and integrity of sTIGIT proteins were verified in a 4-20% SDS-PAGE, dyed with Coomassie blue (Imperial Protein Stain, Ref. A1435101 , Thermo Scientific). Alternatively, the protein specificity was verified via Western Blot using Immun- Blot® Low Fluorescence PVDF/Filter paper sets (Ref. 162-0261 , Bio-Rad), and 1/1000 anti- TIGIT monoclonal antibody (clone 4C5B9, Ref. MAB21338, Abnova) or 1/1000 purified anti- 6-His epitope Tag antibody (clone 6-His, Ref. 906101 , Biolegend) with 1/20000 IRDye® 800CW goat anti-mouse IgG secondary antibody (Ref. 926-32210, Li-Cor). See Fig. 3B and D.

Example 4

Binding and affinity of TIGIT proteins for murine and human CD155 ligands by Biacore assay The use of Biacore determines the affinity and binding kinetics of a ligand for its receptor, in this case, murine and human CD155, muCD155, and huCD155, respectively to the TIGIT proteins. The technique measures the real-time binding association and dissociation rates (Response Rll %) using Surface Plasmon Resonance (SPR) of receptor- ligand interactions based on a chip interaction of mCD155 and hCD155 during the flow-through of TIGIT proteins. Briefly, Biacore T100 Running Buffer PBS-T, mu or hu CD155 was immobilized in a sensor chip by NHS/EDC chemistry, 500RU’s of ligand immobilized in Fc2.

Example 5

In vitro functional assays of TIGIT proteins for immunogenicity in Peripheral blood lymphocytes

Functional assays in vitro were conducted using a PBMCs cell culture in the presence of sIRS (e.g., sTIGIT, FC TIGIT) to block TIGIT binding partners (e.g., CD155). See Fig. 5-7. The activity of sIRS is determined in antigen-independent (no peptide stimuli) and antigendependent (e.g., HIV, SARS-Cov-2, EBV, CMV peptide pool stimuli) assay. Functional assays evaluated the capability of CD8+ T cells, CD4+ T cells, NK cells and monocytes/granulocytes for producing TNF, IFND, IL-2, IL-10, and express CD107a degranulation marker in the presence of si Rs. PBMCs for the functional assays were obtained from fresh or cryopreserved blood of (a) uninfected donors (b) donors screened for CMV, EBV, and SARS-CoV-2 antiviral response and (c) chronically infected HIV-1 individuals.

Day 1 : : PBMCs processing and experimental set-up

The PBMCs were processed and allowed to rest in R20 (RPMI 1640 medium (Ref. 21875, ThermoFisher), penicillin-streptomycin (5,000 U/mL, Ref. 15070063, ThermoFisher), 20% fetal bovine serum decomplemented (FBS, Ref. 10099-141 , Invitrogen)) during 4h at 37°C with 5% CO2. Cell density and viability were determined after 2-4h of PBMCs resting. Then, the PBMCs were centrifuged at 400g for 5 min and the medium was changed to R10 (RPMI 1640 medium (Ref. 21875, ThermoFisher), penicillin-streptomycin (5,000 U/mL, Ref. 15070063, ThermoFisher), 10% FBS (Ref. 10099-141 , Invitrogen) with anti-CD28 (1 pg/mL, Ref. 340975, BD Biosciences) and anti-CD107a PE-Cy5 (1/50, Ref. 555802, clone H4A3, BD Biosciences). 1x10⁶ cells/mL per well were poured to a 48-well plate. The corresponding stimuli were added to each plate well as follows: 1) For the antigen independent assay, the PBMCs were cultured in the presence or absence of the recombinant proteins (10 pg/mL): sTIGIT, FC-TIGIT, and FC- control. For positive control, PBMCs were stimulated with staphylococcal enterotoxin B (SEB, Ref. S4881-1MG, Sigma-Aldrich) at 1 pg/mL.

2) For the antigen dependent assays, PBMCs were cultured in the presence or absence of the recombinant proteins (10 pg/mL): sTIGIT, FC-TIGIT, and FC- control with the corresponding stimuli (HIV, SARS-Cov-2, EBV or CMV peptide pool stimuli). For positive control, PBMCs were stimulated with SEB (Ref. S4881- 1 MG, Sigma-Aldrich) at 1 pg/mL.

The cells were subsequently incubated at 37°C with 5% CO2for 2h. Afterwards, the following protein transport inhibitors were added to the culture: brefeldin A solution (1x; Ref. 555029, BD Biosciences) and monensin solution (1x; Ref. 554724, BD Biosciences). The cells were then incubated for 12-14h at 37°C with 5% CO2.

Day 2: Flow cytometry staining and acquisition

The PBMCs were harvested after stimulation and overnight incubation. The cells were centrifuged at 900g during 3 min. The supernatants were discarded. The cells were then washed twice with 0.2 mL of phosphate buffered saline solution 1X (PBS 1X, Ref. 10010023, Gibco). Afterwards, 50 pL of Live/Dead probe (APC-Cy7, Ref. L23102, Invitrogen) previously diluted 1 :2000 in PBS 1x were added to the cells. The cells were incubated in the dark at room temperature for 25 min. Subsequently, the cells were washed twice with 0.2 mL of PBS 1X.

The FC receptors were then blocked with human TruStain FcX (Ref. 422301 , Biolegend) following manufacturer's indications. The cells were washed once with 0.2 mL of PBS 1X. For surface staining, 50 pL/well of brilliant stain buffer (Ref. 563794, BD Biosciences), containing a cocktail of surface antibodies, were added. The PBMCs were incubated in the dark at room temperature for 20 min.

Flow cytometry panel: Alexa Fluor® 647 anti-Human CD4 (clone RPA-T4, Ref. 557707, BD Biosciences), Alexa Fluor® 700 anti-human TNF-a (clone MAb1 , Ref. 502928, Biolegend); Fixable Near-IR Dead Cell dye (Ref. L10119, Invitrogen); APC-H7 anti-Human

CD3 (clone SK7, Ref. 560275, BD Biosciences), PE anti-human IL-10 (clone JES3-9D7, Ref. 501404, Biolegend); PE-CF594 anti-Human CD197 (CCR7) (clone 150503, Ref. 562381 , BD Biosciences); PE-Cy™5 anti-Human CD107a (clone H4A3, Ref. 555802, BD Biosciences); PE-Cyanine7 anti-Human TIGIT (clone MBSA43, Ref. 25-9500-42, ThermoFisher); FITC antihuman CD16 (clone 3G8, Ref. 302006, Biolegend); BB700 Anti-Human PVR (CD155) (clone SKII.4, Ref. 748241 , BD Biosciences), BV421 Anti-Human CD56 (NCAM-1) (clone B159, Ref. 740076, BD Biosciences); V500 Anti-Human CD8 (clone RPA-T8, Ref. 560774, BD Biosciences); BV605 Anti-Human CD27 (clone L128, Ref. 562655, BD Biosciences); BV650 Anti-Human IL-2 (clone MQ1-17H12, Ref. 564166, BD Biosciences); BV711 Anti-Human IFN- y (clone B27, Ref. 564039, BD Biosciences); and BV786 Anti-Human CD45RA (clone HI100, Ref. 563870, BD Biosciences).

Afterwards, the cells were washed twice with 0.2 mL of PBS 1X. Then, the PBMCs cells were fixed with 50 pL/well of fixation medium (Medium A, Ref. GAS001S100, Invitrogen) in the dark at room temperature for 15 min. The cells were washed twice with 0.2 mL of PBS 1X.

For intracellular staining, the PBMCs were incubated with 50 pL/well of permeabilization medium (Medium B, Ref. GAS002S100, Invitrogen) containing a mix of intracellular antibodies for cytokines. The cells were incubated in the dark at room temperature for 20 min. The PBMCs were the washed twice with 0.2 mL of PBS 1X. The PBMCs were fixed with 0.2 mL of 1 % formaldehyde solution before flow cytometry acquisition.

The production of TNF, IFNy, IL-2, IL-10, and the expression of CD107a degranulation marker in CD8+ T cells, CD4+ T cells, NK cells, and monocytes/granulocytes CD155+ were analyzed using a FlowJo software v10.7.1 (BD Biosciences). See Fig. 8 and 9. Example 6

ELISA for quantitative measurement of TIGIT proteins concentration in serum and plasma samples

Day 1: Plate coating and samples incubation

The 96-well/plate was coated with recombinant human and murine CD155/PVR Fc Chimera (9174-CD and 9670-CD; R&D Systems) at 2.5 pg/mL in ELISA 1x Coating Buffer (421701 , Biolegend) for 18h. After coating, the plate was washed with Wash Buffer (0.05 PBS/Tween) and blocked using Blocking Buffer (PBS with 3% FBS) for 2 hours. Then, the plate was washed with Wash Buffer, and 100ul of serums/plasma or serial dilution standards will be incubated at 2-8°C overnight.

Day 2: Plate read-out

The next day, the plate was washed with wash buffer. Then, biotinylated 6-His antibody (Cat 906103, Biolegend) at 1 :1000 dilution will be added (100ul/well) and incubated at room temperature for 2 hours. Plate was washed with wash buffer to eliminate the excess of the biotinylated antibody. Avidin-HRP conjugate (Cat 405103, Biolegend) at 1 :2000 dilution was added (100 ul/well) and incubated at room temperature for 30 minutes. Plate was washed with wash buffer, and chromogenic substrate 1-Step™ Slow TMB-ELISA (Cat. 34024 ThermoFisher) was added (50ul/well). The plate was incubated at room temperature for 5-10 minutes until optimal development of color. Then, 100 ul of stop Solution (2M, H2SO4) was added. The Plate was read at 450 nm -540 nm on an ELISA plate reader.

RESULTS . TIGIT proteins prototypes design and protein production

The TIGIT proteins designed comprise a battery of TIGIT soluble inhibitory receptors of SiRs. All prototypes were synthesized with an azurocidin signal peptide and a 6His-tag into pcDNA3.4 plasmid by Genescript. In Table.1, it is summarized the information regarding protein design, including a total of 10 proteins based on human, murine, and hybrid candidates (human receptor and murine Fc). Also, authors have designed effector molecules with a deletion of four amino acids (APCPP) to favour the folding of the dimmer and increase affinity for the ligand. The no effector Fc molecules variants have been included to avoid undesirable immunological effects of Fc regions, such as complement activation or binding to Fc receptors. All sequence information is included in Seq_slRs doc at gene and peptide level. The folding mutation (deletion of PCPP) is located in the 138P-141 P of SiR3 to generate SiR4. The folding mutation (deletion of PCPP) is located in the 134P-137P of SiR6 to generate SiR7. Differences in the location of PCPP mutation are due to the length of the Ig-like V-type domain (Fig 1) of SiR3 and SiR6. The decision for generating deletion of PCPP mutant was based on in silico modeling of slR3 and slR6 in l-TASSER server.

Table 1. Summary of TIGIT soluble inhibitory receptors (sIRs) candidates

Briefly, proteins were produced by transfection in Expi293 cells and purified as previously described in the material and methods section. Authors have included the production and validation of slR1 , slR4, and slR9 proteins to confirm size and specificity by his-Tag and Flag- Tag by SDS-Page and Western blot analyses in both reducing (R) and non-reducing conditions (NR) (Figure 1 A-C). The signal sequence (SP Azu, MTRLTVLALLAGLLASSRA) is included in the prototypes listed in the sequences of slR1-slR10, the mature protein contains this sequence, but the SP Azu sequence is removed during secretion in Expi293F cells.

2.Binding and affinity of TIGIT proteins for murine and human CD155 ligands by Biacore assay

The sIRs proteins 1 to 8 were tested for binding and affinity to CD155 both, the human receptor (slR1-2) and the murine receptor (slR1-8). Table.2 summarizes the information on the TIGIT proteins tested. The sIRs proteins 1 to 8 were tested for binding and affinity to CD155, both the human receptor (slR1-2) and the murine receptor (slR1-8). Thus, we found that both SiR1 and SiR2 acted as a binder for huCD155 with differential kinetics and dissociation constants (Kd). Therefore, target engagement and affinity to huCD155 are higher for SiR2 than for SiR1 (Figure 2A). Similar findings were observed for the Kd of SIR2 and SiR1 to the muCD155 ligand (Figure 2B). For the murine and hybrid SiRs, we observed the following range SiR5 (ND) > SiR6, 7, 8 > SiR3, 4 in the Kd for muCD155. In this way, we found a higher affinity of hybrid molecules over the human or fully murine for the muCD155 (Figure 2C). Besides, consistent differences between monomeric (SiR1 and 5) candidates and the dimeric candidates (SiR2, 3, 4, 6, 7, and 8) in Kd demonstrated a higher affinity for CD155 ligand of the dimeric candidates through heterodimeric interactions.

Table 2. Summary of biacore results of TIGIT soluble inhibitory receptors (sIRs) candidates for human and murine CD155 (huCD155; muCD155)

ND; not determined

3. Immune modulatory properties of TIGIT proteins in PBCMs

To evaluate the immune modulatory potential of TIGIT proteins, we performed in vitro functional assays using a PBMCs cell culture in the presence of SiRs to block TIGIT binding partners. The activity of SiRs was determined in antigen-independent (no peptide stimuli) and antigen-dependent (e.g., HIV, SARS-Cov-2, EBV, CMV peptide pool stimuli) manner. These functional assays evaluated the capability of CD8+ T cells, CD4+ T cells, NK cells and monocytes/granulocytes for producing TNF, IFNg, IL-2, IL-10, and express CD107a degranulation marker in the presence of si Rs. PBMCs for the functional assays included (a) uninfected donors, (b) donors screened for CMV, EBV, and SARS-CoV-2 antiviral response, and (c) People living with HIV-1 (PLWH) on antiretroviral treatment. The total gatting strategy is represented in Figure 3.

Additionally, as shown in Figure 4 using PBMCS from PLWH, we found that in an antigenindependent manner, slR2 increased the production of IFNg (p=0.0015), TNF (p=0.0026), IL-2 (p=0.022) and IL-10 (p=0.0009) in CD8* T-cells and increased the production of IL-2 (p=0.055) and IL-10 (p<0.0001) in CD4⁺ T-cells. In addition, the presence of SiR2 increased the frequency of TIGIT⁺CD8⁺ (p<0.0001) and TIGIT⁺CD4⁺ (p=0.0017) cells with a specific increase of CD107a (Figure 4 A-B). However, in an antigen-dependent manner, the presence of HIV-1 Gag favoured a specific increase of CD107a in TIGIT⁺CD8⁺(p=0.0033) and TIGIT⁺CD4⁺(p=0.0024) T-cells in the absence of IFNg, TNF, IL-2, and IL-10 production (Figure 4 C-D). No effect was found for slR1. 4 Quantification of SiR in serum and plasma samples

To quantify the concentration of SiR in serum and plasma samples, we developed a ELISA using murine or human CD155 chimera coated in an ELISA plate as summarized in the material and methods section. The anti-His-Tag antibody detected the SiR immobilized by interacting with CD155 covered in the ELISA plate as shown in Fig. 6.

Claims

48

1 . A TIGIT recombinant protein selected from the group of (i) a soluble TIGIT (sTIGIT) polypeptide, (ii) a soluble short TIGIT (ssTIGIT) polypeptide or (iii) a functionally equivalent variant thereof.

2. The TIGIT recombinant protein according to claim 1 wherein the TIGIT recombinant protein comprises at least part of the Ig-like V-type domain of the TIGIT protein and the does not comprise the transmembrane domain of the TIGIT protein.

3. The TIGIT recombinant protein according to claims 1 or 2 wherein the TIGIT recombinant protein comprises amino acids 22 to 124 of the human TIGIT protein sequence as defined in SEQ ID NO: 30, amino acids 22 to 130 of the human TIGIT protein sequence as defined in SEQ ID NO: 30, amino acids 29 to 133 of the mouse TIGIT protein sequence as defined in SEQ ID NO:31 or a functionally equivalent variant thereof of any of said regions.

4. A fusion protein comprising the TIGIT recombinant protein according to any of claims 1 to 3 and a Fc portion of a human immunoglobulin or of a mouse immunoglobulin.

5. The fusion protein according to claim 4 wherein the Fc portion of a human immunoglobulin or of a mouse immunoglobulin is located C-terminally with respect to the TIGIT recombinant protein.

6. The fusion protein according to claim 4, wherein the Fc portion of a human immunoglobulin is an Fc portion of lgG1 , lgG2, lgG4, wherein the Fc portion of a human mouse immunoglobulin is an Fc portion of I gG 1 or lgG2c or a a functionally equivalent variant thereof.

7. The fusion protein according to claim 4 wherein the TIGIT recombinant protein is of human origin and the Fc portion is of a human immunoglobulin or wherein the TIGIT recombinant protein is of mouse origin and the Fc portion is of a mouse immunoglobulin.

8. The fusion protein according to claim 5 wherein the Fc portion of a human immunoglobulin is an Fc portion of lgG4 carrying a no Fab exchange mutation.

9. The fusion protein according to claim 5 wherein the Fc portion of a mouse immunoglobulin is an Fc portion of lgG2c carrying a deletion of the PCPP region 49

10. A fusion protein comprising two TIGIT recombinant proteins as defined in any of claims 1 to 3 wherein the two TIGIT recombinant proteins are covalently bonded by a linker region.

11. The fusion protein according to claim 10 wherein the two TIGIT recombinant proteins are of human origin, the two TIGIT recombinant proteins are of murine origin or wherein one of the TIGIT recombinant protein is of mouse origin and one of the TIGIT recombinant proteins are of mouse origin.

12. The TIGIT recombinant protein according to any of claims 1 to 3, the fusion protein according to any of claims 4 to 11 further comprising a tag.

13. The TIGIT recombinant protein or the fusion protein according to claim 12 wherein the tag is a Myc and/or His tag.

14. The TIGIT recombinant protein or fusion protein according to any of claims 1 to 13 comprising, essentially comprising or consisting of a sequence selected from the group consisting of SEQ ID NO:1 to 10.

15. The TIGIT recombinant protein or fusion protein according to claim 15 further comprising an hexahistidine tag at the C-terminal region.

16. A dimer comprising two fusion proteins according to any of claims 1 to 15, said dimer resulting from the assembly of the two fusion proteins by means of dimerization domain in each monomer.

17. The dimer according to claim 16 wherein at least one of the momomers comprises a tag.

18. The dimer according to claim 17 wherien the tag is a Myc and/or His tag.

19. An isolated nucleic acid encoding a TIGIT recombinant protein according to any of claims 1 to 3 or a fusion protein according to any of claims 4 to 15.

20. The isolated nucleic acid according to claim 19 wherein the sequence encoding the TIGIT recombinant protein or the fusion protein is operatively linked to a sequence encoding a signal sequence.

21 . The isolated nucleic acid according to claim 20, wherein the signal sequence is the TIGIT native signal sequence as defined in SEQ ID NO:21 , the azurocidin signal sequence as defined in SEQ ID NO:22 or the CD5 signal sequence as defined in SEQ ID NO:23.

22. The isolated nucleic acid according to any of claims 11 to 13, wherein the isolated nucleic acid comprises, essentially comprisies or consists of a sequence selected from the group consisting of SEQ ID NO:11 to 20. 50 The nucleic acid according to any of claims 19 to 22, wherein the nucleic acid is codon optimized for its expression in human cells. A vector comprising a nucleic acid according to any of claims 19 to 23. A host cell comprising a TIGIT recombinant protein according to any of claims 1 to 3, a fusion protein according to any of claims 4 to 15, a dimer according to any of claims 16 to 18, a nucleic acid according to any of claims 19 to 23 or a vector according to claim 24. A pharmaceutical composition comprising a therapeutically effective amount of a TIGIT recombinant protein according to any of claims 1 to 3, a fusion protein according to any of claims 4 to 15, a dimer according to any of claims 16 to 18, a nucleic acid according to any of claims 19 to 23, a vector according to claim 24 or a host cell according to claim 25. A TIGIT recombinant protein according to any of claims 1 to 3, a fusion protein according to any of claims 4 to 15, a dimer according to any of claims 16 to 18, a nucleic acid according to any of claims 19 to 23, a vector according to claim 24 or a host cell according to claim 25 for use as a medicament. A TIGIT recombinant protein according to any of claims 1 to 3, a fusion protein according to any of claims 4 to 15, a dimer according to any of claims 16 to 18, a nucleic acid according to any of claims 19 to 23, a vector according to claim 24 or a host cell according to claim 25 for use in the prevention, the inhibition of the progression or in the treatment of an infectious disease. The TIGIT recombinant protein according to any of claims 1 to 3, a fusion protein according to any of claims 4 to 15, a dimer according to any of claims 16 to 18, a nucleic acid according to any of claims 19 to 23, a vector according to claim 24 or a host cell according to claim 25 for use according to claim 24 wherein the infectious disease is caused by HIV, HBV, HCV, Coronavirus, CMV, EBV, VZV or is a tuberculosis infection. A TIGIT recombinant protein according to any of claims 1 to 3, a fusion protein according to any of claims 4 to 15, a dimer according to any of claims 16 to 18, a nucleic acid according to any of claims 19 to 23, a vector according to claim 24 or a host cell according to claim 25 for use in the prevention, the inhibition of the progression or in the treatment of cancer. A combination therapy comprising a TIGIT recombinant protein according to any of claims 1 to 7, a dimer according to any of claims 8 to 10, a nucleic acid according to any of claims 11 to 15, a vector according to claim 16, or a host cell according to claim 17 and at least a therapeutic agent.

32. The combination therapy according to claim 23, wherein the therapeutic agent is an antibody, an antiviral or a vaccine.

33. A method for obtaining a TIGIT recombinant protein according to any of claims 1 to 7, or a dimer according to any of claims 8 to 10, comprising the steps of (a) culturing a host cell comprising a nucleic acid according to any of claims 11 to 15, (b) expressing the nucleic acid and (c) recovering the TIGIT recombinant protein or dimer from the host cell culture.

34. A kit comprising a TIGIT recombinant protein according to any of claims 1 to 7, a dimer according to any of claims 8 to 10, a nucleic acid according to any of claims 11 to 15, a vector according to claim 16, a host cell according to claim 17, a pharmaceutical composition according to claim 18, a combination therapy according to any of claims 23 or 24, or a mixture thereof, and instructional materials for their use.