WO2023102658A1 - Dérivés de mécaline glycosylés et leurs procédés d'utilisation - Google Patents

Dérivés de mécaline glycosylés et leurs procédés d'utilisation Download PDF

Info

Publication number
WO2023102658A1
WO2023102658A1 PCT/CA2022/051792 CA2022051792W WO2023102658A1 WO 2023102658 A1 WO2023102658 A1 WO 2023102658A1 CA 2022051792 W CA2022051792 W CA 2022051792W WO 2023102658 A1 WO2023102658 A1 WO 2023102658A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
glycosyl
mescaline
chemical
compound
Prior art date
Application number
PCT/CA2022/051792
Other languages
English (en)
Inventor
Jillian M. HAGEL
Kaveh MATINKHOO
David James PRESS
Ye CAI
Jessica Bik-jing LEE
Chang-Chun LING
Peter J. Facchini
Original Assignee
Enveric Biosciences Canada Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Enveric Biosciences Canada Inc. filed Critical Enveric Biosciences Canada Inc.
Publication of WO2023102658A1 publication Critical patent/WO2023102658A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
    • C07H15/20—Carbocyclic rings
    • C07H15/203—Monocyclic carbocyclic rings other than cyclohexane rings; Bicyclic carbocyclic ring systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
    • C07H15/26—Acyclic or carbocyclic radicals, substituted by hetero rings

Definitions

  • compositions and methods disclosed herein relate to a chemical compound known as mescaline. Furthermore, the compositions and methods disclosed herein relate in particular to glycosylated derivatives of mescaline.
  • the biochemical pathways in the cells of living organisms may be classified as being part of primary metabolism, or as being part of secondary metabolism. Pathways that are part of a cell’s primary metabolism are involved in catabolism for energy production or in anabolism for building block production for the cell. Secondary metabolites, on the other hand, are produced by the cell without having an obvious anabolic or catabolic function. It has long been recognized that secondary metabolites can be useful in many respects, including as therapeutic compounds.
  • Mescaline (chemical name 3,4,5 trimethoxyphenethylamine), for example, is a secondary metabolite that is naturally produced by certain cactus species belonging to a variety of genera within the plant family of Cactaceae.
  • Cactus species which can produce mescaline include, for example, cactus species belonging to the genus Lophophora, including Lophophora williamsii (peyote) and Lophophora diffusa and cactus species belonging to the genus Echinopsis/Trichocereus, including Echinopsis pachanoi/Trichocereus pachanoi (also known as San Pedro), Echinopsis peruviana/Trichocereus peruvianus (also known as Peruvian torch), (Echinopsis lageniformis/Tnchocereus bndgesii/ (also known as Peruvian torch), and Echinopsis lageniformis/Tnchocereus bndgesii/ (also known
  • mescaline is a psychoactive compound and is therefore used as a recreational drug.
  • Mescaline is also used in Native American religious ceremonies, and for spiritual purposes by Andean indigenous cultures.
  • mescaline has been evaluated for its potential in the treatment of addictions, notably alcohol addiction (Bogenschutz, M.P. and Johnson M. W. (2016), Prog, in Neuro- Psychopharmacol. & Biol. Psychiatry 64; 250- 258; Romeu, A.G. et al. (2017), Exp. Clin. Psychopharmacol. 2016 Aug; 24(4): 229-268).
  • mescaline Although the toxicity of mescaline is low, adverse side effects, including, for example, panic attacks, paranoia and psychotic states, sometimes together or individually referred to as “a bad trip”, are not infrequently experienced by mescaline users. Furthermore, mescaline can induce nausea and vomiting.
  • the present disclosure relates to mescaline and derivative compounds.
  • the present disclosure relates to glycosylated mescaline derivatives and methods of making and using these compounds.
  • the present disclosure provides, in at least one embodiment, in accordance with the teachings herein, a chemical compound having the chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • one, two or three of X 1 , X 2 , and X 3 can be a glycosyl group.
  • one, two or three of X 1 , X 3 , and X 4 can be a glycosyl group.
  • one, two or three of X 1 , X 4 , and X 5 can be a glycosyl group.
  • one, two or three of X 1 , X 2 , and X 4 can be a glycosyl group.
  • one, two or three of X 1 , X 2 , and X 5 can be a glycosyl group.
  • one, two or three of X 2 , X 3 , and X 4 can be a glycosyl group.
  • one, two or three of X 2 , X 4 , and X 5 can be a glycosyl group.
  • one, two or three of X 3 , X 4 , and X 5 can be a glycosyl group.
  • X 3 can be a glycosyl group, and the compound of formula (I) can possess a single glycosyl group.
  • X 3 can be a glycosyl group, and two of X 2 , X 4 , and X 5 can be an O-alkyl group.
  • X 3 can be a glycosyl group
  • X 2 and X 4 can be an O-alkyl group
  • the O-alkyl group can be independently or simultaneously selected from an O-(C 1 -C 6 )-alkyl group.
  • the O-alkyl group can be independently or simultaneously selected from an O-(C 1 -C 3 )-alkyl group.
  • the O-alkyl group can be a methoxy group (-OCH 3 ).
  • the compound of formula (I) when W is -N + (R 1 )(R 2 )(R 3 ), the compound of formula (I) can comprise a pharmaceutically acceptable anion.
  • the glycosyl group can be an O-linked glycosyl group.
  • the glycosyl group can be a C-linked glycosyl group.
  • the glycosyl group can be selected from a monosaccharide, disaccharide, or trisaccharide.
  • the glycosyl group can be a polysaccharide including at least four saccharide groups.
  • the glycosyl group can be selected from a pentosyl group, a hexosyl group, and a heptosyl group.
  • the glycosyl group can be selected from the groups consisting of a glucosyl group, a glucuronic acid group, a galactosyl group, a fucosyl group, a xylosyl group, an arabinosyl group, and a rhamnosyl group.
  • the glycosyl group can be a glucosyl group.
  • X 3 can be a glycosyl group
  • X 2 and X 4 can be an O-alkyl group, wherein the O-alkyl group can be independently or simultaneously selected from an O-(C 1 -C 6 )-alkyl group, and wherein the glycosyl group is a glucosyl group.
  • W can be -N(R 1 )(R 2 ), and R 1 can be a hydrogen atom, and R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • W can be -N(R 1 )(R 2 ), and R 1 can be a hydrogen atom, and R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 5-membered heterocyclic ring.
  • W can be -N(R 1 )(R 2 ), and R 1 can each be a hydrogen atom.
  • the chemical compound having formula (I) can be selected from a compound having formula (IV) and (V):
  • the present disclosure relates to pharmaceutical and recreational drug formulations comprising mescaline derivatives.
  • the present disclosure provides, in at least one embodiment, a pharmaceutical or recreational drug formulation comprising an effective amount of a chemical compound having the chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein (i) R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, together with a pharmaceutically acceptable excipient, diluent or carrier.
  • the present disclosure relates to methods of treatment of psychiatric disorders. Accordingly, the present disclosure further provides, in one embodiment, a method for treating a psychiatric disorder, the method comprising administering to a subject in need thereof a pharmaceutical formulation comprising a chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or (11) R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, wherein the pharmaceutical formulation is administered in an effective amount to treat the psychiatric disorder in the subject.
  • the disorder can be a 5- HT2A receptor mediated disorder, or a 5-HT 1A receptor mediated disorder.
  • the disorder can be a 5- HTIA receptor mediated disorder, wherein upon administration of an effective amount of the chemical compound to the subject, the chemical compound modulates a 5-HT 1A receptor, and does not modulate a 5-HT 2A receptor.
  • a dose can be administered of about 0.001 mg to about 5,000 mg.
  • the present disclosure provides, in at least one embodiment, a method for modulating a 5-HT 2A receptor or a 5-HT 1A receptor, the method comprising contacting the 5-HT 2A receptor or the 5-HT 1A receptor with a chemical compound having the chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, under reaction conditions sufficient to thereby modulate receptor activity.
  • the reaction conditions can be in vitro reaction conditions.
  • the reaction conditions can be in vivo reaction conditions.
  • the reaction conditions can be in vivo reaction conditions, and the in vivo reaction conditions comprise administering an effective amount of the chemical compound to a human or animal subject possessing a 5-HT 2A receptor and a 5-HT 1A receptor, wherein the 5-HT 1A receptor is modulated and the 5-HT 2A receptor is not modulated.
  • the present disclosure relates to methods of making glycosylated mescaline derivatives. Accordingly, in one aspect, the present disclosure provides, in at least one embodiment, a method of making a glycosylated mescaline derivative having the chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, wherein the method comprises performing at least one of the chemical reactions depicted in FIGS. 14A or 14B.
  • the compound having formula (I) can be a compound having chemical formula (II) or formula (III): wherein O-Q is a glycosyloxy group, and wherein the method involves the performance of the chemical reactions selected from
  • the compound having chemical formula (II) can have the chemical formula (IV): and the chemical reaction can be selected from the chemical reactions (d); (c) and (d); and (a), (b), (c), and (d), depicted in FIG. 14A.
  • the compound having chemical formula (III) can have the chemical formula (V): and the chemical reaction can be selected from the chemical reactions (h); (g) and (h); (f), (g) and (h); or (e), (f), (g), and (h), depicted in FIG. 14B.
  • the present disclosure provides, in at least one embodiment, a method of making a glycosylated mescaline derivative having the chemical formula (VII): wherein, X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, a glycosyl group, or an
  • O-alkyl group wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, and wherein one of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe, and Xe is an ethylamino group (-CH 2 -CH 2 NH 2 ) or , the method comprising: (A) reacting a compound having the chemical formula (VI): wherein, X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, an O-alkyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4
  • X1, X 2 , X 3 , X 4 , X 5 , and X 6 are an O-acetylated glycosyloxy group, wherein two of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, and one
  • X 1 and X 5 can be hydrogen, X 2 and X 4 can be methoxy, X 3 can be a hydroxyl group, and Xe can be compound (VII) can have the chemical formula (II) or (III): wherein O-Q is a glycosyloxy group.
  • the compound having formula (II) can be a compound having chemical formula (IV):
  • the compound having formula (III) can be a compound having chemical formula (V):
  • the present disclosure relates to methods of making glycosylated mescaline derivatives in a host cell. Accordingly, in one aspect, the present disclosure provides, in at least one embodiment, a method of making a glycosylated mescaline derivative the method comprising:
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring; and
  • X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O-alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • the glycosyl transferase can be encoded by a nucleic acid selected from:
  • nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a); (e) a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 2, SEQ.ID NO: 4, or SEQ.ID NO: 6;
  • nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a), (b), (c), (d), (e) or (f).
  • the method can further include a step comprising isolating the glycosylated mescaline derivative compound.
  • the host cell can be a microbial cell.
  • the host cell can be a bacterial cell or a yeast cell.
  • the present disclosure provides, in at least one embodiment, a use of a chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, in the manufacture of a pharmaceutical or recreational drug formulation.
  • the manufacture can comprise formulating the chemical compound with an excipient, diluent or carrier.
  • the present disclosure provides, in at least one embodiment, a use of a chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, together with a diluent, carrier, or excipient as a pharmaceutical or recreational drug formulation.
  • FIG. 1 depicts the chemical structure of mescaline and identifies a phenyl portion, comprising a substituted phenyl group, and an ethylamine portion of the chemical compound.
  • FIG. 2 depicts a certain prototype structure of mescaline and mescaline derivative compounds.
  • the prototype structure contains a phenyl portion and an ethylamine portion, as indicated.
  • Certain carbon atoms may be referred to herein by reference to their position within the prototype structure, i.e., Ci, C2, C3 etc. The pertinent atom numbering is shown.
  • the ethylamine chain extends from the Ci carbon of the phenyl portion.
  • the phenyl portion and optionally additionally the ethylamine portion may be substituted, and notably the amine (NH2) portion therein.
  • Mescaline derivatives comprising a substituted phenyl group, and an ethylamine side chain, or a substituted ethylamine chain, may be more specifically referred to herein as ethylamine analogues of mescaline or ethylamine mescaline derivatives.
  • certain compounds may be named in accordance with the same.
  • C3, C4 Cs are each bonded to a methoxy group.
  • mescaline derivatives include various chemical compounds shown herein, such as the chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring,
  • FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, 3I, 3J, 3K, 3L, 3M, 3N, 30, 3P, 3Q, and 3R depict the chemical structures of certain example ethylamine mescaline derivatives, notably 3,4,5-X 2 ,X 3 ,X 4 ethylamine mescaline derivatives (FIGS. 3A, 3B), 2,4,5-XI ,XS,X 4 ethylamine mescaline derivatives (FIGS. 3C, 3D), 2,3,4-XI ,X 2 ,XS ethylamine mescaline derivatives (FIGS.
  • each of X 1 , X 2 , X 3 , X 4 , and X 5 can be a glycosyl group, wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group can be an O-alkyl group, an O-acyl group, or a hydroxy group.
  • R 1 and R 2 can be an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or a hydrogen, atom, or R 1 and R 2 can be cyclized along with the nitrogen atom to which they are attached (FIGS.
  • R 1 , R 2 , and R 3 can be an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or a hydrogen, atom, or R 1 and R 2 can be cyclized along with the nitrogen atom to which they are attached, and wherein the positively charged nitrogen atom in compound is balanced by Z a negatively charged anion (FIGS. 3B, 3D, 3F, 3H, 3J, 3L, 3N, 3P, 3R).
  • FIGS. 4A, 4B, 4C, 4D, 4E, 4F, and 4G depict the chemical structures of certain example mescaline derivatives, notably, a 2-glycosyloxy-4,6-X 3 ,X 5 ethylamine mescaline derivative (FIG. 4A), a 4-glycosyloxy-2,6-X 1 ,X 5 ethylamine mescaline derivative (FIG. 4B), a 2,4- X 1 ,X 3 -6-glycosyloxy ethylamine mescaline derivative (FIG. 4C), a 2,4-di-glycosyloxy-6-X 5 ethylamine mescaline derivative (FIG.
  • a 2-glycosyloxy-4,6-X 3 ,X 5 ethylamine mescaline derivative FIGS. 4A, 4B, 4C, 4D, 4E, 4F, and 4G depict the chemical structures of certain example mescaline derivatives, notably
  • X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyloxy group can be an O-alkyl group, an O-acyl group, or a hydroxy group.
  • R 1 and R 2 can be an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or a hydrogen, atom, or (ii) R 1 and R 2 can be joined to form a heterocyclic ring along with the nitrogen atom to which they are attached.
  • FIGS. 5A, 5B, 5C, 5D, 5E, and 5F depict the chemical structures of certain example mescaline derivatives, notably, a 4-glycosyloxy-2,6-dihydroxy ethylamine mescaline derivative (FIG. 5A), a 4-glycosyloxy-2,6-methoxy ethylamine mescaline derivative (FIG. 5B), a 4-gly cosy I oxy-2, 6-acetoxy ethylamine mescaline derivative (FIG. 5C), a 2-ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative (FIG.
  • R 1 and R 2 can be an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or a hydrogen, atom, or (ii) R 1 and R 2 can be joined to form a heterocyclic ring along with the nitrogen atom to which they are attached.
  • FIGS. 6A, 6B, 6C, and 6D depict the chemical structures of certain example mescaline derivatives, notably, a 2-ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 and R 2 , are hydrogen atoms (FIG. 6A), a 2-ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 and R 2 , are acetyl groups (FIG.
  • FIG. 6B a 2-ethoxy-4-glycosyloxy-6- hydroxy ethylamine mescaline derivative, wherein R 1 is a hydrogen atom and R 2 , is an acetyl group
  • FIG. 6C a 2-ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 and R 2 are joined (along with the nitrogen atom to which they are attached) forming a piperidine group
  • FIGS. 7A, 7B, 7C, and 7D depict the chemical structures of certain example mescaline derivatives, notably, a 2-ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 , R 2 , and R 3 are hydrogen atoms, wherein the nitrogen atom is positively charged, and further including a negatively charged anion (Zj balancing the positively charged nitrogen atom (FIG.
  • FIG. 7A a 2- ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 and R 2 are hydrogen atoms, R 3 is an acetyl group and further including a negatively charged anion (Z-) balancing the positively charged nitrogen atom
  • FIG. 7B a 2- ethoxy-4-glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 is a hydrogen atom and R 2 , and R 3 are acetyl groups, and further including a negatively charged anion (Z-) balancing the positively charged nitrogen atom (FIG.
  • FIGS. 8A, 8B, 8C, 8D, 8E, 8F, 8G, 8H, 8I, and 8J depict the chemical structures of certain example mescaline derivatives, notably and a 2-ethoxy-4- glycosyloxy-6-hydroxy ethylamine mescaline derivative, wherein R 1 and R 2 are joined together (along with the nitrogen atom to which they are attached) forming a 6-membered heterocyclic ring wherein a carbon atom (togetherwith its hydrogen atoms, relative to piperidine) is substituted by an oxygen atom (to form a morpholinyl group), (FIG.
  • FIGS. 9A, 9B, 9C, 9D, 9E, 9F, 9G, 9H, 9I, 9J, 9K, 9L, 9M, and 9N depict the chemical structures of certain example mescaline derivatives, notably a 3-glycosyl-4-hydroxy ethylamine mescaline derivative (FIG. 9A), a 2-glycosyl-3,5- di-hydroxy ethylamine mescaline derivative (FIG. 9B), a 3,5-di-hydroxy-4-glycosyl ethylamine mescaline derivative (FIG. 9C), a 2-glycosyl-3-hydroxy ethylamine mescaline derivative (FIG.
  • the nitrogen atom within the depicted compound includes an electron pair (not shown) and carries no net charge.
  • the nitrogen within the depicted compound is positively charged. The positive charge is balanced by a negative anion Z'.
  • FIGS. 10A, 10B, 10C, 10D, 10E, 10F, and 10G depict the chemical structures of certain example mescaline derivatives, notably, a 2-hydroxy-4,6- X 3 ,X 5 ethylamine mescaline derivative (FIG. 10A), a 2,6-X 1 ,X 5 -4-hydroxy ethylamine mescaline derivative (FIG. 10B), a 2,4-X 1 ,X 3 -6-hydroxy ethylamine mescaline derivative (FIG. 10C), a 2,4-di-hydroxy-6-X 5 ethylamine mescaline derivative (FIG.
  • X 1 , X 2 , X 3 , X 4 , and X 5 which are not a hydroxy group can be an O-alkyl group, or an O-acyl group.
  • R 1 and R 2 can be an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or a hydrogen, atom, or (ii) R 1 and R 2 can be joined together, along with the nitrogen atom to which they are attached, to form a heterocyclic ring.
  • FIGS. 11A and 11 B depict example chemical reactions for synthesizing glycosylated mescaline derivatives.
  • FIG. 11A depicts an example chemical reaction for synthesizing a glycosylated mescaline derivative wherein the glycosyl group is bonded through its anomeric carbon atom and forming an O- linked glycosyl group notably a reaction wherein a 4-hydroxy-mescaline derivative (11A-1) is reacted with benzyloxycarbonyl chloride to form an N-protected phenol intermediate (11A-2) that undergoes further a SN2 nucleophilic substitution with a tetra-per-O-benzylated glycosyl bromide (11A-3) to form the O-glycosyl compound (11A-4); subsequently all benzyl groups in compound (11A-4) can be removed under a catalytic hydrogenation to form a 4-O-glycosyl-mescaline derivative (11 A- 5).
  • the free primary amino group in compound (11A-5) can be further N,N- dialkylated to from the corresponding tertiary mescaline amine (11A-6) that can undergo another N-alkylation to form the corresponding mescaline ammonium (11A-7).
  • FIG. 11 B depicts an example of chemical synthesis reaction wherein the glycosyl group is bonded through an anomeric carbon atom and forming a C-linked glycosyl group.
  • the highly activated 4-(2-choroethyl)-2,6-dimethoxyphenol (11 B- 1) is subjected to a glycosylation reaction with 1-O-acetyl-2,3,4,6-tetra-O-benzyl- D-glucopyranose (11 B-2) under the catalysis of boron trifluoride etherate, forming the corresponding 3-C-glycoside (11B-3) that contains a leaving group (Cl); subsequently, the primary chloride can be further displaced with either an N- substituted piperazine or a pyrrolidine to form respectively a 3-C-glycosylated mescaline derivatives (11B-4 and (11B-5 respectively. Finally, a palladium hydroxide assisted full debenzylations should afford the corresponding 3-C- glycosyl-4-hydroxy-2,5-dimethox-mescaline derivatives (11B-6 and (11 B-7 respectively.
  • FIG. 12 depicts an example chemical reaction for synthesizing a glycosylated mescaline derivative, notably a reaction wherein a 4-hydroxy- mescaline derivative is reacted with a per-O-silylated glycosyl iodide compound under basic conditions followed by an acid-mediated O-desilylation to form a 4- glycosyl-mescaline derivative.
  • FIG. 13 depicts an example biochemical reaction for synthesizing a glycosylated mescaline derivative, notably a 3-hydroxy-mescaline derivative is reacted with a UDP-glucose to form a 3-glucose-mescaline derivative, in a reaction catalyzed by a glycosyl transferase.
  • FIGS. 14A and 14B depict example synthesis pathways and chemical reactions for making certain example mescaline derivative compounds of the present disclosure, including example mescaline derivative compounds (IV), and (V). Individual chemical reactions are denoted as (a), (b), (c), and (d) in FIG. 14A and (e), (f), (g), and (h) in FIG. 14B.
  • FIGS. 15A, 15B, 15C, and 15D depict example reactions in an example chemical synthesis pathway for making a certain example compound according to the present disclosure, notably an example ethylamine mescaline derivative compound having chemical formula (IV).
  • FIGS. 16A, 16B, 16C, and 16D depict example reactions in an example chemical synthesis pathway for making certain example compound according to the present disclosure, notably an ethylamine mescaline derivative compound having chemical formula (V).
  • FIGS. 17A (I), 17A (II), 17B, 17C, 17D, 17E, 17F, 17G, 17H, 171, 17J, 17K, 17L, 17M, 17N, 170, and 17P depict various graphs representing certain experimental results, notably, graphs obtained in the performance of experimental assays to evaluate the efficacy of an example compound having chemical formula (IV), notably, a cell viability assay (FIGS. 17A(i) and 17A(ii)); a radioligand 5-HT 1A receptor binding assay using 2C-B (positive control) (FIG. 17B); a radioligand 5-HT 1A receptor binding assay using MDMA (positive control) (FIG.
  • FIG. 17C a radioligand 5-HT 1A receptor binding assay using mescaline (positive control) (FIG. 17D); a radioligand 5-HT 1A receptor binding assay using escaline (positive control) (FIG. 17E); a radioligand 5-HT 1A receptor binding assay using proscaline (positive control) (FIG. 17F); a radioligand 5-HT 1A receptor binding assay using DMSO (negative control) (FIG. 17G); a radioligand 5-HT 1A receptor binding assay using tryptophan (negative control) (FIG. 17H); a radioligand 5-HT 1A receptor binding assay using compound (IV) (FIG.
  • FIG. 171 a radioligand HT 2A receptor binding assay using 2C-B (positive control) (FIG. 17J); a radioligand 5- HT 2A receptor binding assay using MDMA (positive control) (FIG. 17K); a radioligand 5-HT 2A receptor binding assay using mescaline (positive control) (FIG. 17L); a radioligand 5-HT 2A receptor binding assay using escaline (positive control) (FIG. 17M); a radioligand 5-HT 2A receptor binding assay using proscaline (positive control) (FIG. 17N); a radioligand 5-HT 2A receptor binding assay using tryptophan (negative control) (FIG. 170); and a radioligand 5-HT 2A receptor binding assay using compound (IV) (FIG. 17P).
  • FIGS. 18A, 18B, and 18C depict various graphs representing certain experimental results, notably, graphs obtained in the performance of experimental assays to evaluate the efficacy of an example compound having chemical formula (V), notably, a cell viability assay (FIG. 18A); a radioligand 5-HT 1A receptor binding assay using compound (V) (FIG. 18B); and a radioligand 5-HT 2A receptor binding assay using compound (V) (FIG. 18C).
  • V cell viability assay
  • FIG. 18B a radioligand 5-HT 1A receptor binding assay using compound (V)
  • FIG. 18C depict various graphs representing certain experimental results, notably, graphs obtained in the performance of experimental assays to evaluate the efficacy of an example compound having chemical formula (V), notably, a cell viability assay (FIG. 18A); a radioligand 5-HT 1A receptor binding assay using compound (V) (FIG. 18B); and a radioligand 5-HT 2A receptor binding assay using compound
  • compositions, systems or processes will be described below to provide an example of an embodiment of each claimed subject matter. No embodiment described below limits any claimed subject matter and any claimed subject matter may cover processes, compositions or systems that differ from those described below.
  • the claimed subject matter is not limited to compositions, processes or systems having all of the features of any one composition, system or process described below or to features common to multiple or all of the compositions, systems or processes described below. It is possible that a composition, system or process described below is not an embodiment of any claimed subject matter.
  • compositions, system or process described below may be the subject matter of another protective instrument, for example, a continuing patent application, and the applicant(s), inventor(s) orowner(s) do not intend to abandon, disclaim or dedicate to the public any such subject matter by its disclosure in this document.
  • compositions, systems or processes will be described below to provide an example of an embodiment of each claimed subject matter. No embodiment described below limits any claimed subject matter and any claimed subject matter may cover processes, compositions or systems that differ from those described below.
  • the claimed subject matter is not limited to compositions, processes or systems having all of the features of any one composition, system, or process described below or to features common to multiple or all of the compositions, systems, or processes described below. It is possible that a composition, system or process described below is not an embodiment of any claimed subject matter.
  • any subject matter disclosed in a composition, system or process described below that is not claimed in this document may be the subject matter of another protective instrument, for example, a continuing patent application, and the applicant(s), inventor(s) orowner(s) do not intend to abandon, disclaim or dedicate to the public any such subject matter by its disclosure in this document.
  • ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formulae, all combinations and sub-combinations of ranges and specific embodiments therein are intended to be included.
  • any range of values described herein is intended to specifically include the limiting values of the range, and any intermediate value or sub-range within the given range, and all such intermediate values and sub-ranges are individually and specifically disclosed (e.g., a range of 1 to 5 includes 1 , 1.5, 2, 2.75, 3, 3.90, 4, and 5).
  • other terms of degree such as “substantially” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of the modified term if this deviation would not negate the meaning of the term it modifies.
  • mescaline refers to a chemical compound having the structure set forth in FIG. 1. It is noted that mescaline is also known in the art as 3,4,5 trimethoxyphenethylamine.
  • mescaline prototype structure refers to the chemical structure shown in FIG. 2.
  • the mescaline derivatives disclosed herein include the mescaline derivative prototype structure shown in FIG. 2, wherein various atoms may be substituted, as herein described. It is noted that the prototype structure comprises a phenyl portion and an ethylamine portion. Furthermore, it is noted that specific carbon atoms in the mescaline derivative prototype structure are numbered.
  • Ci of the phenyl portion
  • C2 of the phenyl portion
  • ethylamine chain extends from the Ci carbon atom of the phenyl portion of the prototype structure.
  • hydroxy group refers to a molecule containing one atom of oxygen bonded to one atom of hydrogen and having the chemical formula -OH. A hydroxy group through its oxygen atom may be chemically bonded to another entity.
  • glycosylated refers to a saccharide group, such as a mono-, di-, tri-, oligo-, or a polysaccharide group, which can be or has been bonded from its anomeric carbon either in the pyranose or furanose form, either in the a or the p conformation, or can be or has been bonded from a non-anomeric carbon atom, and can be in the pyranose orfuranose form.
  • the saccharide group can be bonded via an oxygen atom to another entity, the bonded saccharide group, inclusive of the oxygen atom, may be referred to herein as a “glycosyloxy” group, and can be said to be “O-glycosylated” or “O- linked”.
  • glycosyl group includes glycosyloxy groups.
  • the saccharide group may also be bonded from a carbon atom and can then be said to be “C-glycosylated” or “C-linked”.
  • Example monosaccharide groups include, but are not limited to, a pentosyl, a hexosyl, or a heptosyl group.
  • glycosyl group may also be substituted with various groups. Such substitutions may include lower alkyl, lower alkoxy, acyl, carboxy, carboxyamino, amino, acetamido, halo, thio, nitro, keto, and phosphatyl groups, wherein the substitution may be at one or more positions on the saccharide. Included in the term glycosyl are further stereoisomers, optical isomers, anomers, and epimers of the glycosyl group.
  • a hexose group for example, can be either an aldose or a ketose group, can be of D- or L-configuration, can assume either an a- or p- conformation, and can be a dextro- or levo-rotatory with respect to plane-polarized light.
  • Example glycosyl groups further include, glucosyl group, glucuronic acid group, a galactosyl group, a fucosyl group, a xylosyl group, an arabinosyl group, and a rhamnosyl group.
  • alkyl group refers to a hydrocarbon group arranged in a chain having the chemical formula -C n H 2n+1 .
  • Alkyl groups include, without limitation, methyl groups (-CH 3 ), ethyl groups (-C 2 H 5 ), propyl groups (-C 3 H 7 ) and butyl groups (-C 4 H 9 ).
  • the alkyl groups (including O-alkyl, and the alkyl groups present in acyl and O-acyl) in any of the embodiments of the disclosure is C 1 -C 20 - alkyl.
  • the alkyl group is Ci-Cw-alkyl.
  • the alkyl group is C 1 -C 6 -alkyl.
  • the alkyl group is C 1 -C 3 -alkyl.
  • the alkyl group is methyl, ethyl, propyl, butyl, or pentyl.
  • O-alkyl group refers to a hydrocarbon group arranged in a chain having the chemical formula -O-C n H 2n+ 1 .
  • Alkyl groups include, without limitation, O-methyl groups (-O-CH 3 ), O-ethyl groups (-O-C 2 H 5 ), O-propyl groups (-O-C 3 H 7 ) and O-butyl groups (-O-C 4 H 9 ).
  • acyl group refers to a carbon atom double bonded to an oxygen and single bonded to an alkyl group. The carbon atom further can be bonded to another entity.
  • O-acyl group refers to an acyl group in which the carbon atom is single bonded to an additional oxygen atom.
  • the additional oxygen atom can be bonded to another entity.
  • aryl group refers to an aromatic ring compound in which at least one hydrogen compound has been removed from the aromatic ring to permit the bonding of a carbon atom in the aromatic ring to another entity.
  • the aryl groups can optionally be a substituted C 6 -C 14 -aryl.
  • the aryl group can further optionally be substituted C 6 -C 10 -aryl, or phenyl.
  • Further aryl groups include phenyl, naphthyl, tetrahydronaphthyl, phenanthrenyl, biphenylenyl, indanyl, or indenyl and the like.
  • Boc refers to tert-butyloxycarbonyl.
  • An NHBoc group can be formed by reacting an amino group containing compound with di-tert-butyl dicarbonate and form an NHBoc group.
  • 5-HT 2A receptor refers to a subclass of a family of receptors for the neurotransmitter and peripheral signal mediator serotonin. 5-HT 2A receptors can mediate a plurality of central and peripheral physiologic functions of serotonin. Central nervous system effects can include mediation of hallucinogenic effects of hallucinogenic compounds.
  • the term “modulating 5-HT 2A receptors”, as used herein, refers to the ability of a compound disclosed herein to alter the function of 5-HT 2A receptors.
  • a 5-HT 2A receptor modulator may activate the activity of a 5-HT 2A receptor, may activate or inhibit the activity of a 5-HT 2A receptor depending on the concentration of the compound exposed to the 5-HT 2A receptor, or may inhibit the activity of a 5- HT 2A receptor. Such activation or inhibition may be contingent on the occurrence of a specific event, such as activation of a signal transduction pathway, and/or maybe manifest only in particular cell types.
  • a 5-HT 2A receptor modulator may increase the probability that such a complex forms between the 5-HT 2A receptor and the natural binding partner, may increase or decrease the probability that a complex forms between the 5-HT 2A receptor and the natural binding partner depending on the concentration of the compound exposed to the 5-HT 2A receptor, and or may decrease the probability that a complex forms between the 5-HT 2A receptor and the natural binding partner.
  • 5-HT 2A receptor-mediated disorder refers to a disorder that is characterized by abnormal 5-HT 2A receptor activity.
  • a 5-HT 2A receptor-mediated disorder may be completely or partially mediated by modulating 5-HT 2A receptors.
  • a 5-HT 2A receptor-mediated disorder is one in which modulation of 5-HT 2A receptors results in some effect on the underlying disorder e.g., administration of a 5-HT 2A receptor modulator results in some improvement in at least some of the subjects being treated.
  • 5-HT 1A receptor refers to a subclass of a family of receptors for the neurotransmitter and peripheral signal mediator serotonin. 5-HT 1A receptors can mediate a plurality of central and peripheral physiologic functions of serotonin. Ligand activity at 5-HT 1A is generally not associated with hallucination, although many hallucinogenic compounds are known to modulate 5-HT 1A receptors to impart complex physiological responses (Inserra et al., 2020, Pharmacol Rev 73: 202).
  • the term “modulating 5-HT 1A receptors”, as used herein, refers to the ability of a compound disclosed herein to alter the function of 5-HT 1A receptors.
  • a 5-HT 1A receptor modulator may activate the activity of a 5-HT 1A receptor, may activate or inhibit the activity of a 5-HT 1A receptor depending on the concentration of the compound exposed to the 5-HT 1A receptor, or may inhibit the activity of a 5- HTIA receptor. Such activation or inhibition may be contingent on the occurrence of a specific event, such as activation of a signal transduction pathway, and/or maybe manifest only in particular cell types.
  • a 5-HT 1A receptor modulator may increase the probability that such a complex forms between the 5-HT 1A receptor and the natural binding partner, may increase or decrease the probability that a complex forms between the 5-HT 1A receptor and the natural binding partner depending on the concentration of the compound exposed to the 5-HT 1A receptor, and or may decrease the probability that a complex forms between the 5-HT 1A receptor and the natural binding partner.
  • 5-HT 1A receptor-mediated disorder refers to a disorder that is characterized by abnormal 5-HT 1A receptor activity.
  • a 5-HT 1A receptor-mediated disorder may be completely or partially mediated by modulating 5-HT 1A receptors.
  • a 5-HT 1A receptor-mediated disorder is one in which modulation of 5-HT 1A receptors results in some effect on the underlying disorder e.g., administration of a 5-HT 1A receptor modulator results in some improvement in at least some of the subjects being treated.
  • glycosyl transferase refers to any and all enzymes comprising a sequence of amino acid residues which is (i) substantially identical to the amino acid sequences constituting any glycosyl transferase polypeptide set forth herein, including, for example, SEQ.ID NO: 2, or (ii) encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any glycosyl transferase set forth herein, but for the use of synonymous codons.
  • nucleic acid sequence encoding a glycosyl transferase refers to any and all nucleic acid sequences encoding a glycosyl transferase polypeptide, including, for example, SEQ.ID NO: 1.
  • Nucleic acid sequences encoding a glycosyl transferase polypeptide further include any and all nucleic acid sequences which (i) encode polypeptides that are substantially identical to the glycosyl transferase polypeptide sequences set forth herein; or (ii) hybridize to any glycosyl transferase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.
  • nucleic acid refers to a sequence of nucleoside or nucleotide monomers, consisting of naturally occurring bases, sugars and intersugar (backbone) linkages. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof.
  • the nucleic acids of the present disclosure may be deoxyribonucleic nucleic acids (DNA) or ribonucleic acids (RNA) and may include naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The nucleic acids may also contain modified bases.
  • modified bases include aza and deaza adenine, guanine, cytosine, thymidine and uracil, and xanthine and hypoxanthine.
  • a sequence of nucleotide or nucleoside monomers may be referred to as a polynucleotide sequence, nucleic acid sequence, a nucleotide sequence or a nucleoside sequence.
  • polypeptide refers to any and all polypeptides comprising a sequence of amino acid residues which is (i) substantially identical to the amino acid sequence constituting the polypeptide having such reference SEQ.ID NO, or (ii) encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding the polypeptide having such reference SEQ.ID NO, but for the use of synonymous codons.
  • a sequence of amino acid residues may be referred to as an amino acid sequence, or polypeptide sequence.
  • nucleic acid sequence encoding a polypeptide refers to any and all nucleic acid sequences encoding a polypeptide having such reference SEQ.ID NO.
  • Nucleic acid sequences encoding a polypeptide, in conjunction with a reference SEQ.ID NO further include any and all nucleic acid sequences which (i) encode polypeptides that are substantially identical to the polypeptide having such reference SEQ.ID NO; or (ii) hybridize to any nucleic acid sequences encoding polypeptides having such reference SEQ.ID NO under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.
  • substantially identical it is meant that two amino acid sequences preferably are at least 70% identical, and more preferably are at least 85% identical and most preferably at least 95% identical, for example 96%, 97%, 98% or 99% identical.
  • amino acid sequences of such two sequences are aligned, using for example the alignment method of Needleman and Wunsch (J. Mol. Biol., 1970, 48: 443), as revised by Smith and Waterman (Adv. Appl. Math., 1981 , 2: 482) so that the highest order match is obtained between the two sequences and the number of identical amino acids is determined between the two sequences.
  • a particularly preferred method for determining the percentage identity between two polypeptides involves the Clustal W algorithm (Thompson, J D, Higgines, D G and Gibson T J, 1994, Nucleic Acid Res 22(22): 4673-4680 together with the BLOSUM 62 scoring matrix (Henikoff S & Henikoff, J G, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919 using a gap opening penalty of 10 and a gap extension penalty of 0.1 , so that the highest order match obtained between two sequences wherein at least 50% of the total length of one of the two sequences is involved in the alignment.
  • the parameters in the wash conditions that determine hybrid stability are sodium ion concentration and temperature.
  • a 1 % mismatch may be assumed to result in about a 1 ° C. decrease in Tm, for example if nucleic acid molecules are sought that have a >95% identity, the final wash temperature will be reduced by about 5° C.
  • stringent hybridization conditions are selected.
  • Moderately stringent hybridization conditions include a washing step in 3xSSC at 42° C. It is understood however that equivalent stringencies may be achieved using alternative buffers, salts and temperatures.
  • polynucleotides or polypeptides refers to polynucleotides or polypeptides capable of performing the same function as a noted reference polynucleotide or polypeptide.
  • a functional variant of the polypeptide set forth in SEQ.ID NO: 2 refers to a polypeptide capable of performing the same function as the polypeptide set forth in SEQ.ID NO: 2.
  • Functional variants include modified a polypeptide wherein, relative to a noted reference polypeptide, the modification includes a substitution, deletion or addition of one or more amino acids. In some embodiments, substitutions are those that result in a replacement of one amino acid with an amino acid having similar characteristics.
  • substitutions include, without limitation (i) glutamic acid and aspartic acid; (i) alanine, serine, and threonine; (iii) isoleucine, leucine and valine, (iv) asparagine and glutamine, and (v) tryptophan, tyrosine and phenylalanine.
  • Functional variants further include polypeptides having retained or exhibiting an enhanced mescaline or mescaline derivative biosynthetic bioactivity.
  • Chimeric nucleic acids refers to at least two linked nucleic acids which are not naturally linked.
  • Chimeric nucleic acids include linked nucleic acids of different natural origins.
  • a nucleic acid constituting a microbial promoter linked to a nucleic acid encoding a plant polypeptide is considered chimeric.
  • Chimeric nucleic acids also may comprise nucleic acids of the same natural origin, provided they are not naturally linked.
  • a nucleic acid constituting a promoter obtained from a particular cell-type may be linked to a nucleic acid encoding a polypeptide obtained from that same cell-type, but not normally linked to the nucleic acid constituting the promoter.
  • Chimeric nucleic acids also include nucleic acids comprising any naturally occurring nucleic acids linked to any non-naturally occurring nucleic acids.
  • pharmaceutical formulation refers to a preparation in a form which allows an active ingredient, including a psychoactive ingredient, contained therein to provide effective treatment, and which does not contain any other ingredients which cause excessive toxicity, an allergic response, irritation, or other adverse response commensurate with a reasonable risk/benefit ratio.
  • the pharmaceutical formulation may contain other pharmaceutical ingredients such as excipients, carriers, diluents, or auxiliary agents.
  • the term “recreational drug formulation”, as used herein, refers to a preparation in a form which allows a psychoactive ingredient contained therein to be effective for administration as a recreational drug, and which does not contain any other ingredients which cause excessive toxicity, an allergic response, irritation, or other adverse response commensurate with a reasonable risk/benefit ratio.
  • the recreational drug formulation may contain other ingredients such as excipients, carriers, diluents, or auxiliary agents.
  • the term “effective for administration as a recreational drug”, as used herein, refers to a preparation in a form which allows a subject to voluntarily induce a psychoactive effect for non-medical purposes upon administration, generally in the form of self-administration.
  • the effect may include an altered state of consciousness, satisfaction, pleasure, euphoria, perceptual distortion, or hallucination.
  • the term “effective amount”, as used herein, refers to an amount of an active agent, pharmaceutical formulation or recreational drug formulation, sufficient to induce a desired biological or therapeutic effect, including a prophylactic effect, and further including a psychoactive effect. Such effect can include an effect with respect to the signs, symptoms or causes of a disorder, or disease or any other desired alteration of a biological system.
  • the effective amount can vary depending, for example, on the health condition, injury stage, disorder stage, or disease stage, weight, or sex of a subject being treated, timing of the administration, manner of the administration, age of the subject, and the like, all of which can be determined by those of skill in the art.
  • treating and “treatment”, and the like, as used herein, are intended to mean obtaining a desirable physiological, pharmacological, or biological effect, and includes prophylactic and therapeutic treatment.
  • the effect may result in the inhibition, attenuation, amelioration, or reversal of a sign, symptom orcause of a disorder, or disease, attributable to the disorder, or disease, which includes mental and psychiatric diseases and disorders.
  • Clinical evidence of the prevention or treatment may vary with the disorder, or disease, the subject and the selected treatment.
  • pharmaceutically acceptable refers to materials, including excipients, carriers, diluents, or auxiliary agents, that are compatible with other materials in a pharmaceutical or recreational drug formulation and within the scope of reasonable medical judgement suitable for use in contact with a subject without excessive toxicity, allergic response, irritation, or other adverse response commensurate with a reasonable risk/benefit ratio.
  • substantially pure and “isolated”, as may be used interchangeably herein describe a compound, e.g., a mescaline derivative, which has been separated from components that naturally accompany it.
  • a compound is substantially pure when at least 60%, more preferably at least 75%, more preferably at least 90%, 95%, 96%, 97%, or 98%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest.
  • Purity can be measured by any appropriate method, e.g., in the case of polypeptides, by chromatography, gel electrophoresis or HPLC analysis.
  • the present disclosure relates to mescaline derivatives, notably mescaline derivatives comprising a substituted phenyl group, and an ethylamine side chain, ora substituted ethylamine chain (/.e., glycosylated ethylamine mescaline derivatives).
  • mescaline derivatives notably mescaline derivatives comprising a substituted phenyl group, and an ethylamine side chain, ora substituted ethylamine chain (/.e., glycosylated ethylamine mescaline derivatives).
  • the herein provided glycosylated ethylamine mescaline derivatives exhibit functional properties which deviate from the functional properties of mescaline.
  • the glycosylated ethylamine mescaline derivatives can exhibit pharmacological properties which deviate from mescaline, including for example with respect to in vivo or in vitro interaction with certain receptors, for example 5-HTiA or 5-HT 2A receptors.
  • the glycosylated ethylamine mescaline derivatives may exhibit physico-chemical properties which differ from mescaline.
  • glycosylated ethylamine mescaline derivatives may exhibit superior solubility in a solvent, for example, an aqueous solvent.
  • the glycosylated ethylamine mescaline derivatives in this respect are useful in the formulation of pharmaceutical and recreational drug formulations.
  • the glycosylated ethylamine mescaline derivatives of the present disclosure can conveniently be biosynthetically produced.
  • the practice of this method avoids the extraction of mescaline from cactus plants and the performance of subsequent chemical reactions to achieve mescaline derivatives.
  • the growth of cactus plants can be avoided thus limiting the dependence on climate and weather, and potential legal and social challenges associated with the cultivation of cactus plants containing psychoactive compounds.
  • the method can efficiently yield substantial quantities of the mescaline derivatives.
  • glycosylated ethylamine mescaline derivatives will be described. Thereafter example methods of using and making the glycosylated ethylamine derivatives will be described.
  • the present disclosure provides derivatives of a compound known as mescaline of which the chemical structure is shown in FIG. 1.
  • the derivatives herein provided are, in particular, ethylamine glycosylated mescaline derivatives.
  • the present disclosure provides, in accordance with the teachings herein, in at least one embodiment, a chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O-alkyl group, an O-acyl group, or a hydroxy group.
  • X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group, or a hydrogen atom, are an O-alkyl group, an O-acyl group, or a hydroxy group.
  • W is either -N(R 1 )(R 2 ) or W is -N + (R 1 )(R 2 )(R 3 ), wherein (i) when W is -N(R 1 )(R 2 ), R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring; or wherein (ii) when W is -N + (R 1 )(R 2 )(R 3 ), R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two
  • X 1 , X 2 and X 3 can be one, two or three glycosyl groups.
  • one of X 1 , X 2 and X 3 can be a glycosyl group, and the two non-glycosylated substituents X 1 , X 2 and X 3 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 1 , X 2 and X 3 can be a glycosyl group, and the nonglycosylated substituent of X 1 , X 2 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 1 , X 2 and X 3 can be glycosylated.
  • X 4 and X 5 are a hydrogen atom.
  • Example compounds in accordance with the foregoing embodiments are further shown in FIGS. 3E and 3F.
  • X 1 , X 3 and X 4 can be one, two or three glycosyl groups.
  • one of X 1 , X 3 and X 4 can be a glycosyl group, and the two nonglycosylated substituents X 1 , X 3 and X 4 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 1 , X 3 and X 4 can be a glycosyl group, and the non-glycosylated substituent of X 1 , X 3 and X 4 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 1 , X 3 and X 4 can be glycosylated.
  • X 2 and X 5 are a hydrogen atom.
  • Example compounds in accordance with the foregoing embodiments are further shown in FIGS. 3C and 3D.
  • X 1 , X 3 and X 5 can be one, two or three glycosyl groups.
  • one of X 1 , X 3 and X 5 can be a glycosyl group, and the two nonglycosylated substituents X 1 , X 3 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 1 , X 3 and X 5 can be a glycosyl group, and the non-glycosylated substituent of X 1 , X 3 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 1 , X 3 and X 5 can be glycosylated.
  • X 2 and X 4 are a hydrogen atom.
  • X 1 , X 2 and X 4 can be one, two or three glycosyl groups.
  • one of X 1 , X 2 and X 4 can be a glycosyl group, and the two non- glycosylated substituents X 1 , X 2 and X 4 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 1 , X 2 and X 4 can be a glycosyl group, and the non-glycosylated substituent of X 1 , X 3 and X 4 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 1 , X 2 and X 4 can be glycosylated.
  • X 3 and X 5 are a hydrogen atom.
  • X 1 , X 4 and X 5 can be one or two or three glycosyl groups.
  • one of X 1 , X 4 and X 5 can be a glycosyl group, and the two non- glycosylated substituents X 1 , X 4 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 1 , X 4 and X 5 can be a glycosyl group, and the non-glycosylated substituent of X 1 , X 4 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 1 , X 4 and X 5 can be glycosylated.
  • X 2 and X 3 are a hydrogen atom.
  • X 1 , X 2 and X 5 can be one or two or three glycosyl groups.
  • one of X 1 , X 2 and X 5 can be a glycosyl group, and the two nonglycosylated substituents X 1 , X 2 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 1 , X 2 and X 5 can be a glycosyl group, and the non-glycosylated substituent of X 1 , X 2 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 1 , X 2 and X 5 can be glycosylated.
  • X 3 and X 4 are a hydrogen atom.
  • X 2 , X 3 and X 4 can be one or two or three glycosyl groups.
  • one of X 2 , X 3 and X 4 can be a glycosyl group, and the two non- glycosylated substituents X 2 , X 3 and X 4 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 2 , X 3 and X 4 can be a glycosyl group, and the non-glycosylated substituent of X 2 , X 3 and X 4 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 2 , X 3 and X 4 can be glycosylated.
  • X 1 and X 5 are a hydrogen atom.
  • X 2 , X 4 and X 5 can be one or two or three glycosyl groups.
  • one of X 2 , X 4 and X 5 can be a glycosyl group, and the two non- glycosylated substituents X 2 , X 4 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 2 , X 4 and X 5 can be a glycosyl group, and the non-glycosylated substituent of X 2 , X 4 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 2 , X 4 and X 5 can be glycosylated.
  • X 1 and X 3 are a hydrogen atom.
  • X 3 , X 4 and X 5 can be one or two or three glycosyl groups.
  • one of X 3 , X 4 and X 5 can be a glycosyl group, and the two nonglycosylated substituents X 3 , X 4 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or, in another embodiment, two of X 3 , X 4 and X 5 can be a glycosyl group, and the non-glycosylated substituent of X 3 , X 4 and X 5 can be O-alkyl group, an O-acyl group, or a hydroxy group; or in yet another embodiment, all three of X 3 , X 4 and X 5 can be glycosylated.
  • X 1 and X 2 are a hydrogen atom.
  • FIGS. 4A - 4G Shown further in FIGS. 4A - 4G are several example embodiments in according with the foregoing.
  • X 1 can be a glycosyl group.
  • X 3 and X 5 can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 3 can be a glycosyl group (see: further also example ethylamine mescaline derivative compounds (IV) and (V), herein).
  • X 1 and X 5 can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 5 can be a glycosyl group.
  • X 1 and X 3 can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 1 and X 5 can each be a glycosyl group. Furthermore, X 5 can be selected from a hydroxy group, an O-alkyl group, or an O- acyl group. Furthermore, X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 1 and X 5 can each be a glycosyl group.
  • X 3 can be selected from a hydroxy group, an O-alkyl group, or an O- acyl group.
  • X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 3 and X 5 can each be a glycosyl group.
  • X 1 can be a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 1 , X 3 and X 5 can each be a glycosyl group.
  • X 2 and X 4 can be hydrogen atoms, and the mescaline derivative can be said to be an ethylamine mescaline derivative.
  • X 1 , X 3 and X 5 are substituents bonded to carbon atoms C2, C4 and Ce, respectively.
  • X 2 and X 4 are hydrogen atoms.
  • all of compounds shown in FIGS. 4A - 4G correspond with the compound shown in FIG. 3G.
  • FIGS. 4A - 4G represent example embodiments.
  • any one, any two, or all three of X 1 , X 2 , X 3 , X 4 , and X 5 can be glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group or a hydrogen atom, are independently selected from a hydroxy group atom, an O-alkyl group, or an O- acyl group.
  • the glycosyl groups in accordance with the present disclosure, can be any glycosyl group, including a mono-, di-, tri- oligo- or a polysaccharide group, bonded from the anomeric carbon, either in the pyranose or furanose form, either in the a- or the p-conformation, or bonded from a non-anomeric carbon atom in either the furanose or pyranose form.
  • the glycosyl groups in accordance herewith may be O- linked glycosyl groups (/.e., glycosyloxy groups) or C-linked glycosyl groups.
  • the glycosyl group may also be substituted with various groups.
  • substitutions may include lower alkyl, lower alkoxy, acyl, carboxy, carboxyamino, amino, acetamido, halo, thio, nitro, keto, and phosphatyl groups.
  • Such substitutions may be at one or more positions on the saccharide.
  • the glycosyl group may be a D-glucosyl group, D-fructosyl group, D-mannosyl group, D-ribosyl group, D-talosyl group, D- lyxosyl group, D-allosyl group, D-altrosyl group, D-gulosyl group, D-isosyl group, D-quinovosyl group, D-maltosyl group, D-cellobiosyl group, D-lactosyl group, D- maltotiosyl group, D-glucuronic acid group, D-galactosyl group, D-fucosyl group, D-xylosyl group, D-arabinosyl group, or a D-rhamnosyl group.
  • the glycosyl group may be an L-glucosyl group, L-fructosyl group, L-mannosyl group, L-ribosyl group, L-talosyl group, L- lyxosyl group, L-allosyl group, L-altrosyl group, L-gulosyl group, L-isosyl group, L- quinovosyl group, L-maltosyl group, L-cellobiosyl group, L-lactosyl group, L- maltotiosyl group, L-glucuronic acid group, L-galactosyl group, L-fucosyl group, L- xylosyl group, L-arabinosyl group, or a L-rhamnosyl group.
  • the glycosyl group is a glycosyloxy group (/.e., a glycosyl group formed by bonding of the saccharide through its anomeric carbon atom).
  • the glycosyl group can be a glycosyloxy group selected from a glucosyloxy group, fructosyloxy group, mannosyoxy group, ribosyloxy group, talosyloxy group, lyxosyloxy group, allosyloxy group, altrosyloxy group, gulosyloxy group, isosyloxy group, quinovosyloxy group, maltosyloxy group, cellobiosyloxy group, lactosyloxy group, maltotiosyloxy group, glucuronicoxy acid group, galactosyloxy group, fucosyloxy group, xylosyloxy group, arabinosyloxy group, or a glycosyloxy group selected from a glucosyloxy group, fruct
  • the glycosyl groups are identical glycosyl groups (e.g., two glucosyl groups, two galactosyl groups, three galactosyl groups etc.). In other embodiments, the glycosyl groups may be different glycosyl groups (e.g., a glucosyl and a fucosyl group; a fucosyl group and a galactosyl group; a glucosyl group, a fucosyl group and a lactosyl group etc.).
  • the glycosyl groups may C-linked or O- linked.
  • Examples of compounds comprising O-linked glycosyl groups in accordance herewith are shown in FIGS. 4A - 4G, 5A - 5F, 6A - 6D, 7A - 7D, and 8A - 8J.
  • Examples of compounds comprising C-linked glycosyl groups in accordance herewith are shown in FIGS. 9A - 9N.
  • the chemical formula (I) may comprise at least one O-linked glycosyl group, and at least one C-linked glycosyl group.
  • Alkyl groups include, without limitation, methoxy groups (- OCH 3 ), ethoxy groups (-OC 2 H 5 ), propoxy groups (-OC3H7) and butoxy groups (- OC 4 H 9 ).
  • Acyl groups include, without limitation, acetoxy groups (-OCOCH 3 ), propanoxy groups (-OCOCH 2 CH 3 ) and butanoxy groups (-OCOCH 2 CH 2 CH 3 ).
  • X 3 is a glycosyl group, notably a glycosyloxy group, and X 1 and X 5 are each a hydroxy group.
  • X 3 is a glycosyl group, notably a glycosyloxy group, and X 1 and X 5 are each a methoxy group.
  • X 3 is a glycosyl group, notably a glycosyloxy group, and X 3 and X 5 are each an acetoxy group.
  • X 3 is a glycosyl group, notably a glycosyloxy group, and X 1 is an ethoxy group, X 5 is a hydroxy group.
  • X 3 is a glycosyl group, notably a glycosyloxy group, and X 1 is a hydroxy group atom and X 5 is a propionate group.
  • X 3 is a glycosyl group, notably a glycosyloxy group, and X 1 is an acetoxy group and X 5 is a proprionate group.
  • X 3 is a glycosyl group
  • X 2 and X 4 are each a methoxy group.
  • X 1 , X 3 and X 5 are substituents bonded to carbon atoms C2, C4 and Ce, respectively.
  • X 2 and X 4 are hydrogen atoms.
  • the compounds shown in FIGS. 5A - 5F correspond with the compound shown in FIG. 3G.
  • X 3 is a glycosyloxy group.
  • the compounds shown in FIGS. 5A - 5F correspond with the compound shown in FIG. 4B. It is to be clearly understood, that, in this respect, FIGS.
  • any one, any two, or three of X 1 , X 2 , X 3 , X 4 , and X 5 can be a glycosyloxy group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyloxy group or a hydrogen atom, can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • any one, any two, or three of X 1 , X 2 , X 3 , X 4 , and X 5 can be a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group or a hydrogen atom, can be Independently selected from a hydroxy group, an O- alkyl group, or an O-acyl group.
  • W can be -N(R 1 )(R 2 ), and R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • R 1 and R 2 are each a hydrogen atom.
  • R 1 and R 2 are each an acetyl group.
  • R 1 is a hydrogen atom
  • R 2 is an acetyl group.
  • R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, and form a 6-member heterocyclic ring (piperidine ring).
  • W can be -N(R 1 )(R 2 ), and R 1 and/or and R 2 can be an alkyl-aryl group, for example a CH 2 -phenyl group, or substituted aryl group, or substituted CH 2 -phenyl group wherein the phenyl group is substituted with at least one halogen atom (Cl, F, Br, I).
  • R 1 or R 2 is an alkyl-aryl group
  • the remaining R 1 or R 2 can, for example, be a hydrogen atom or an alkyl group.
  • W can be -N + (R 1 )(R 2 )(R 3 ), and R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • the nitrogen atom in compound (I) is positively charged, compound (I) further including a negatively charged anion balancing the positively charged nitrogen atom.
  • R 1 , R 2 , and R 3 are each a hydrogen atom. Furthermore, the nitrogen atom is positively charged, and compound (I) further includes a negatively charged anion balancing the positively charged nitrogen atom.
  • R 1 , and R 2 are each a hydrogen atom, and R 3 is an acetyl group. Furthermore, the nitrogen atom is positively charged, and compound (I) further includes a negatively charged anion balancing the positively charged nitrogen atom.
  • R 1 , and R 2 are each an acetyl group and R 3 is a hydrogen atom. Furthermore, the nitrogen atom is positively charged, and compound (I) further includes a negatively charged anion balancing the positively charged nitrogen atom.
  • R 1 and R 2 are joined to form a piperidine ring, and R 3 is a hydrogen atom. Furthermore, the nitrogen atom is positively charged, and compound (I) further includes a negatively charged anion balancing the positively charged nitrogen atom.
  • W ean be -N + (R 1 )(R 2 )(R 3 ), and one, two or three, of R 1 R 2 and R 3 can be an alkyl-aryl group, for example a CH 2 - phenyl group, or substituted aryl group, or substituted CH 2 -phenyl group wherein the phenyl group is substituted with at least one halogen atom (Cl, F, Br, I).
  • the nitrogen atom is positively charged
  • compound (I) further includes a negatively charged anion balancing the positively charged nitrogen atom.
  • R 1 , R 2 , or R 3 is an alkyl-aryl group
  • the remaining R 1 , R 2 , or R 3 can, for example, be a hydrogen atom or an alkyl group.
  • FIGS. 6A - 6D and 7A - 7D correspond with the compound shown in FIG. 3G and FIG. 3H, respectively.
  • X 3 is a glycosyloxy group.
  • the compounds shown in FIGS. 6A - 6D and 7A - 7D correspond with the compound shown in FIG. 4B.
  • X 1 is an ethoxy group and X 5 is a hydroxy group.
  • FIGS. 6A - 6D and 7A correspond with the compound shown in FIG. 5D. It is to be clearly understood, that, in this respect, the compounds shown in FIGS. 6A - 6D and 7A
  • any one, any two, or three of X 1 , X 2 , X 3 , X 4 , and X 5 can be a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group or a hydrogen atom, can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • any one, any two, or three of X 1 , X 2 , X 3 , X 4 , and X 5 can be a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group or a hydrogen atom, can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • any one, any two, or three of X 1 , X 2 , X 3 , X 4 , and X 5 can be a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein X 1 , X 2 , X 3 , X 4 , and X 5 which are not a glycosyl group or a hydrogen atom, can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • W ean be -N + (R 1 )(R 2 )(R 3 ), and R 1 , R 2 and R 3 , and in some embodiments, any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • the nitrogen atom in compound (I) is positively charged, compound (I) further including a negatively charged anion balancing the positively charged nitrogen atom.
  • R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, forming a 6- membered heterocyclic ring, a carbon atom (together with its hydrogen atoms, relative to piperidine) is substituted by an oxygen atom.
  • R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, forming a 6- membered heterocyclic ring, a carbon atom (together with its hydrogen atoms, relative to piperidine) is substituted by a nitrogen atom bonded to a hydrogen atom.
  • R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, forming a 6- membered heterocyclic ring, a carbon atom (together with its hydrogen atoms, relative to piperidine) is substituted by a nitrogen atom bonded to a methyl group.
  • the methyl group represents an example of an alkyl group.
  • the nitrogen atom may be bonded to other alkyl groups.
  • R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, forming a 6- membered heterocyclic ring, a carbon atom (together with its hydrogen atoms, relative to piperidine) is substituted by a nitrogen atom bonded to an acetyl group.
  • the acetyl group represents an example of an acyl group.
  • the nitrogen atom may be bonded to other acyl groups.
  • R 3 is a hydrogen atom
  • the compound further includes a negatively charged anion (Z-) balancing the positively charged nitrogen atom.
  • Z- negatively charged anion
  • Example embodiments in this respect are shown in FIGS. 8F - 8J.
  • the negatively charged anion can vary in different embodiments, and includes a chloride ion (Cl-), a hydroxy ion (OH'), fluorine ion (F ) , an iodine ion (l _ ), a sulfate ion (SO4 2 '), or a phosphate ion (PO4 3 ), for example.
  • R 1 and R 2 are joined forming a 6-membered heterocyclic ring
  • a first carbon atom (together with its hydrogen atoms, relative to piperidine) is substituted by a nitrogen atom
  • the nitrogen atom and a second carbon atom are further joined to form a 5-membered heterocyclic ring
  • R 3 is a hydrogen atom and further including a negatively charged anion (Z-) balancing the positively charged nitrogen atom.
  • the 5- membered heterocyclic group represents an example of a bicyclic heterocyclic ring.
  • the nitrogen atom may be bonded to form other bicyclic heterocyclic rings.
  • glycosylated mescaline derivative can be a compound having formula (IV) or (V):
  • the present disclosure provides glycosylated mescaline derivatives.
  • the present disclosure provided, in particular, a chemical compound having the chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10- membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • a glycosyl group including a glycosyloxy group
  • a (C 1 -C 20 )-alkyl group a -0-(C 1 -C 20 )-alkyl group
  • a hydroxy group e.g
  • a glycosyl group including a glycosyloxy group
  • a (C 1 -C 6 )-alkyl group a -O-(C 1 -C 6 )-alkyl group
  • a hydroxy group
  • X 1 , X 2 , X 3 , X 4 , and X 5 can be independently or simultaneously a hydrogen atom, a glycosyl group (including a glycosyloxy group), a (C 1 -C 3 )-alkyl group (-CH 2 -CH 2 -CH 3 (propyl); -CH 2 -CH 3 (ethyl); or -CH 3 (methyl)), a -O-(C 1 -C 3 )-alkyl group (-OC 3 H 7 (O-propyl; propoxy); -OC 2 H 5 (O-ethyl; ethoxy); or-OCH 3 (O-methyl; methoxy), a (C 1 -C 3 )-O-acyl group (e.g.
  • R 1 , R 2 , or R 3 can be independently or simultaneously an alkyl group, (C 1 -C 20 )-alkyl group, (C 1 -C 10 )-alkyl group, (C 1 -C 6 )- alkyl group, or (C 1 -C 3 )-alkyl group (-CH 2 -CH 2 -CH 3 (propyl); -CH 2 -CH 3 (ethyl); or - CH 3 (methyl)).
  • R 1 , R 2 , and R 3 can be independently or simultaneously a (C 1 -C 20 )-alkyl-aryl group, (Ci-Cw)-alkyl-aryl group, a (C 1 -C 6 )- alkyl-aryl group, (C 1 -C 3 )-alkyl-aryl group, for example, a Ci-alkyl-aryl group, (-CH 2 - phenyl; -CH 2 -naphthyl, -CH 2 -tetrahydronaphthyl; -CH 2 -indanyl etc.); or a C2-alkyl- aryl group (-CH 2 -CH 2 -phenyl; -CH 2 -CH 2 -naphthyl; -CH 2 -CH 2 -tetrahydronaphthyl; - CH 2 -CH 2 -indanyl etc.), or
  • the aryl group can optionally be substituted including, for example, with one or more halogens (Cl, F, Br, I), one or more alkyl group ((C 1 -C 20 )-alkyl group, (C 1 - C 10 )-alkyl group, (C 1 -C 6 )-alkyl group, or (C 1 -C 3 )-alkyl group (-CH 2 -CH 2 -CH 3 (propyl); -CH 2 -CH 3 (ethyl); or -CH 3 (methyl)), or an O-alkyl group (C 1 -C 20 )-0-alkyl group, (Ci-Cw)-O-alkyl group, (C 1 -C 6 )-O-alkyl group, one or more (C 1 -C 3 )-O-alkyl group (-OC 3 H 7 (O-propyl; propoxy); -
  • any two of R 1 , R 2 , and R 3 can be a joined together to form a 3-10-membered heterocyclic ring, a 3-9-membered heterocyclic ring, or a 3-6-membered heterocyclic ring, or a 5-6-membered ring.
  • X 3 can be a glycosyl group, and the compound of formula (I) can possess a single glycosyl group.
  • X 3 can be a glycosyl group, and two of X 2 , X 4 , and X 5 can be an O-alkyl group.
  • X 3 can be a glycosyl group, and X 2 and X 4 can be an O-alkyl group.
  • the O-alkyl group can be independently or simultaneously selected from an O-(C 1 -C 6 )-alkyl group, an O- (C 1 -C 3 )-alkyl group, or a methoxy group (OCH 3 ).
  • glycosylated mescaline derivatives of the present disclosure may be used to prepare a pharmaceutical or recreational drug formulation.
  • the present disclosure further provides in another aspect, pharmaceutical and recreational drug formulations comprising glycosylated ethylamine mescaline derivatives.
  • the present disclosure provides in a further embodiment a pharmaceutical or recreational drug formulation comprising a chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, together with a diluent, carrier or excipient.
  • the pharmaceutical or recreational drug formulations may be prepared as liquids, tablets, capsules, microcapsules, nanocapsules, trans-dermal patches, gels, foams, oils, aerosols, nanoparticulates, powders, creams, emulsions, micellar systems, films, sprays, ovules, infusions, teas, decoctions, suppositories, etc. and include a pharmaceutically acceptable salt or solvate of the glycosylated mescaline derivative compound together with an excipient.
  • excipient as used herein means any ingredient other than the chemical compound of the disclosure.
  • excipient may depend on factors such as the particular mode of administration, the effect of the excipient on solubility of the chemical compounds of the present disclosure and methods for their preparation will be readily apparent to those skilled in the art.
  • Such compositions and methods for their preparation may be found, for example, in “Remington’s Pharmaceutical Sciences”, 2 2n d Edition (Pharmaceutical Press and Philadelphia College of Pharmacy at the University of the Sciences, 2012).
  • compositions comprising the glycosylated mescaline derivatives of the present disclosure may be administered orally.
  • Oral administration may involve swallowing, so that the compound enters the gastrointestinal tract, or buccal or sublingual administration may be employed by which the compound enters the blood stream directly from the mouth.
  • Formulations suitable for oral administration include both solid and liquid formulations.
  • Solid formulations include tablets, capsules (containing particulates, liquids, microcapsules, or powders), lozenges (including liquid-filled lozenges), chews, multi- and nano-particulates, gels, solid solutions, liposomal preparations, microencapsulated preparations, creams, films, ovules, suppositories and sprays.
  • Liquid formulations include suspensions, solutions, syrups and elixirs. Such formulations may be employed as fillers in soft or hard capsules and typically comprise a carrier, for example, water, ethanol, polyethylene glycol, propylene glycol, methylcellulose, or a suitable oil, and one or more emulsifying agents and/or suspending agents. Liquid formulations may also be prepared by the reconstitution of a solid, for example, from a sachet.
  • Binders are generally used to impart cohesive qualities to a tablet formulation. Suitable binders include microcrystalline cellulose, gelatin, sugars, polyethylene glycol, natural and synthetic gums, polyvinylpyrrolidone, pregelatinized starch, hydroxypropyl cellulose and hydroxypropyl methylcellulose. [00213] Tablets may also contain diluents, such as lactose (monohydrate, spray-dried monohydrate, anhydrous and the like), mannitol, xylitol, dextrose, sucrose, sorbitol, microcrystalline cellulose, starch and dibasic calcium phosphate di hydrate.
  • lactose monohydrate, spray-dried monohydrate, anhydrous and the like
  • mannitol xylitol
  • dextrose sucrose
  • sorbitol microcrystalline cellulose
  • starch and dibasic calcium phosphate di hydrate.
  • Tablets may also optionally comprise surface active agents, such as sodium lauryl sulfate and polysorbate 80.
  • surface active agents may comprise from 0.2% (w/w) to 5% (w/w) of the tablet.
  • Tablets may further contain lubricants such as magnesium stearate, calcium stearate, zinc stearate, sodium stearyl fumarate, and mixtures of magnesium stearate with sodium lauryl sulphate.
  • Lubricants generally comprise from 0.25% (w/w) to 10% (w/w), from 0.5% (w/w) to 3% (w/w) of the tablet.
  • tablets may contain a disintegrant.
  • disintegrants include sodium starch glycolate, sodium carboxymethyl cellulose, calcium carboxymethyl cellulose, croscarmellose sodium, crospovidone, polyvinylpyrrolidone, methyl cellulose, microcrystalline cellulose, lower alkyl-substituted hydroxypropyl cellulose, starch, pregelatinized starch and sodium alginate.
  • the disintegrant will comprise from 1 % (w/w) to 25% (w/w) or from 5% (w/w) to 20% (w/w) of the dosage form.
  • auxiliary ingredients include antioxidants, colourants, flavouring agents, preservatives and taste-masking agents.
  • the chemical compound of the present disclosure may make up from 1 % (w/w) to 80 % (w/w) of the dosage form, more typically from 5% (w/w) to 60% (w/w) of the dosage form.
  • Exemplary tablets contain up to about 80% (w/w) of the chemical compound, from about 10% (w/w) to about 90% (w/w) binder, from about 0% (w/w) to about 85% (w/w) diluent, from about 2% (w/w) to about 10% (w/w) disintegrant, and from about 0.25% (w/w) to about 10% (w/w) lubricant.
  • the pharmaceutical and recreational drug formulations comprising the glycosylated ethylamine mescaline derivatives of the present disclosure may also be administered directly into the blood stream, into muscle, or into an internal organ.
  • the pharmaceutical and recreational drug formulations can be administered parenterally (for example, by subcutaneous, intravenous, intraarterial, intrathecal, intraventricular, intracranial, intramuscular, or intraperitoneal injection).
  • Parenteral formulations are typically aqueous solutions which may contain excipients such as salts, carbohydrates and buffering agents (in one embodiment, to a pH of from 3 to 9), but, for some applications, they may be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile water.
  • excipients such as salts, carbohydrates and buffering agents (in one embodiment, to a pH of from 3 to 9)
  • a suitable vehicle such as sterile water.
  • Formulations comprising the glycosylated ethylamine mescaline derivatives of the present disclosure for parenteral administration may be formulated to be immediate and/or modified release.
  • Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release.
  • the chemical compounds of the disclosure may be formulated as a solid, semi-solid, or thixotropic liquid for administration as an implanted depot providing modified release of the active compound.
  • Examples of such formulations include drug-coated stents and poly(dl-lactic-coglycolic)acid (PGLA) microspheres.
  • the pharmaceutical or recreational drug formulations of the present disclosure also may be administered topically to the skin or mucosa, i.e., dermally or transdermally.
  • Example pharmaceutical and recreational drug formulations for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, cosmetics, oils, eye drops, dressings, foams, films, skin patches, wafers, implants, sponges, fibres, bandages and microemulsions. Liposomes may also be used.
  • Example carriers include alcohol, water, mineral oil, liquid petrolatum, white petrolatum, glycerin, polyethylene glycol and propylene glycol.
  • Penetration enhancers may be incorporate (see: for example, Finnm, B. and Morgan, T.M., 1999 J. Pharm. Sci, 88 (10), 955-958).
  • Topical administration include delivery by electroporation, iontophoresis, phonophoresis, sonophoresis and microneedle or needle-free (e.g., PowderjectTM, BiojectTM, etc.) injection.
  • Pharmaceutical and recreational drug formulations for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders.
  • the liquid or solid pharmaceutical compositions can contain suitable pharmaceutically acceptable excipients.
  • the pharmaceutical compositions are administered by the oral or nasal respiratory route for local or systemic effect.
  • Pharmaceutical compositions in pharmaceutically acceptable solvents can be nebulized by use of inert gases. Nebulized solutions can be inhaled directly from the nebulizing device, or the nebulizing device can be attached to a face mask tent, or intermittent positive pressure breathing machine.
  • Solution, suspension, or powder pharmaceutical compositions can be administered, e.g., orally or nasally, from devices that deliver the formulation in an appropriate manner.
  • the glycosylated ethylamine mescaline compounds of present disclosure are used as a recreational drug
  • the compounds may be included in compositions such as a food or food product, a beverage, a food seasoning, a personal care product, such as a cosmetic, perfume or bath oil, or oils (both for topical administration as massage oil, or to be burned or aerosolized).
  • a personal care product such as a cosmetic, perfume or bath oil, or oils (both for topical administration as massage oil, or to be burned or aerosolized).
  • the chemical compounds of the present disclosure may also be included in a “vape” product, which may also include other drugs, such as nicotine, and flavorings.
  • the pharmaceutical formulations comprising the chemical compounds of the present disclosure may be used to treat a subject, and in particular to treat a psychiatric disorder in a subject.
  • the present disclosure includes in a further embodiment, a method for treating a psychiatric disorder, the method comprising administering to a subject in need thereof a pharmaceutical formulation comprising a chemical compound having chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, together with a diluent, carrier or excipient.
  • Psychiatric disorders that may be treated include, for example, neurodevelopmental disorders such as intellectual disability, global development delay, communication disorders, autism spectrum disorder, and attention-deficit hyperactivity disorder (ADHD); bipolar and related disorders, such as mania, and depressive episodes; anxiety disorder, such as generalized anxiety disorder (GAD), agoraphobia, social anxiety disorder, specific phobias (natural events, medical, animal, situational, for example), panic disorder, and separation anxiety disorder; stress disorders, such as acute stress disorder, adjustment disorders, post-traumatic stress disorder (PTSD), and reactive attachment disorder; dissociative disorders, such as dissociative amnesia, dissociative identity disorder, and depersonalization/derealization disorder; somatoform disorders, such as somatic symptom disorders, illness anxiety disorder, conversion disorder, and factitious disorder; eating disorders, such as anorexia nervosa, bulimia nervosa, rumination disorder, pica, and binge-eating disorder; sleep disorders, such as narcolepsy, insomnia
  • substance-related disorders such as alcohol- related disorders, cannabis related disorders, inhalant-use related disorders, stimulant use disorders, and tobacco use disorders
  • neurocognitive disorders such as delirium
  • schizophrenia compulsive disorders, such as obsessive compulsive disorders (OCD), body dysmorphic disorder, hoarding disorder, trichotillomania disorder, excoriation disorder, substance/medication induced obsessive-compulsive disorder, and obsessive-compulsive disorder related to another medical condition
  • personality disorders such as antisocial personality disorder, avoidant personality disorder, borderline personality disorder, dependent personality disorder, histrionic personality disorder, narcissistic personality disorder, obsessive-compulsive personality disorder, paranoid personality disorder, schizoid personality disorder, and schizotypal personality disorder.
  • the compounds of the present disclosure may be used to be contacted with a 5-HT 2A receptor to thereby modulate the 5-HT 2A receptor.
  • Such contacting includes bringing a compound of the present disclosure and 5- HT 2A receptor together under in vitro conditions, for example, by introducing the compounds in a sample containing a 5-HT 2A receptor, for example, a sample containing purified 5-HT 2A receptors, or a sample containing cells comprising 5- HT 2A receptors.
  • In vitro conditions further include the conditions described in Examples 1 and 2 hereof.
  • Contacting further includes bringing a compound of the present disclosure and 5-HT 2A receptor together under in vivo conditions.
  • Such in vivo conditions include the administration to an animal or human subject, for example, of a pharmaceutically effective amount of the compound of the present disclosure, when the compound is formulated together with a pharmaceutically active carrier, diluent or excipient, as hereinbefore described, to thereby treat the subject.
  • the compound may activate the 5-HT 2A receptor or inhibit the 5-HT 2A receptor.
  • condition that may be treated in accordance herewith can be any 5-HT 2A receptor mediated disorder.
  • disorders include, but are not limited to schizophrenia, psychotic disorder, attention deficit hyperactivity disorder, autism, and bipolar disorder.
  • the compounds of the present disclosure may be used to be contacted with a 5-HT 1A receptor to thereby modulate the 5-HT 1A receptor.
  • Such contacting includes bringing a compound of the present disclosure and 5- HTIA receptor together under in vitro conditions, for example, by introducing the compounds in a sample containing a 5-HT 1A receptor, for example, a sample containing purified 5-HT 1A receptors, or a sample containing cells comprising 5- HTIA receptors.
  • In vitro conditions further include the conditions described in Examples 1 and 2 hereof.
  • Contacting further includes bringing a compound of the present disclosure and 5-HT 1A receptor together under in vivo conditions.
  • Such in vivo conditions include the administration to an animal or human subject, for example, of a pharmaceutically effective amount of the compound of the present disclosure, when the compound is formulated together with a pharmaceutically active carrier, diluent or excipient, as hereinbefore described, to thereby treat the subject.
  • the compound may activate the 5-HT 1A receptor or inhibit the 5-HT 1A receptor.
  • the reaction conditions can be in vivo reaction conditions, and the in vivo reaction conditions can comprise administering an effective amount of the chemical compound to a human or animal subject possessing a 5-HT 1A receptor and a 5-HT 2A receptor, wherein the 5-HT 1A receptor is modulated, and wherein at the same time the 5-HT 2A receptor is not modulated, or substantially modulated.
  • the condition that may be treated in accordance herewith can be any 5-HT 1A receptor mediated disorder.
  • Such disorders include, but are not limited to schizophrenia, psychotic disorder, attention deficit hyperactivity disorder, autism, and bipolar disorder.
  • the disorder can be a 5-HT 1A receptor mediated disorder, wherein upon administration of the chemical compound to the subject, the chemical compound modulates a 5-HT 1A receptor, without however modulating, or substantially modulating, a 5-HT 2A receptor in the subject.
  • glycosylated mescaline derivatives of the present disclosure may be prepared in any suitable manner, including by any organic chemical synthesis methods, biosynthetic methods, or a combination thereof.
  • One suitable method of to making the glycosylated ethylamine mescaline derivatives of the present disclosure initially involves selecting and obtaining or preparing a hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide-containing mescaline derivative compound and a glycosyl compound and reacting the hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide- containing mescaline derivative compound and a glycosyl compound to obtain the glycosyl mescaline derivatives of the present disclosure.
  • Suitable hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide-containing mescaline derivative compounds include compounds comprising the prototype structure shown in FIG. 2, including, for example, the hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide-containing containing mescaline derivative having the formula (X): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O-alkyl group, an O-acyl group, or a hydroxy group wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a hydroxy group, alkoxy group, acyloxy group, alkyl group, amino group, acylamino group, or a halide, wherein two of X 1
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(Rs), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • one, two, or three of X 1 , X 2 , X 3 , X 4 , and X 5 can be a hydroxy group, an alkoxy group, an acyloxy group, an alkyl group, an amino group, an acylamino group, or a halide.
  • the hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide- containing mescaline derivative compounds may be provided in a more or less chemically pure form, for example, in the form of a hydroxy-containing mescaline derivative preparation having a purity of at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least 99.9%.
  • the hydroxy-containing mescaline derivative may be chemically synthesized or obtained from a fine chemical manufacturer.
  • glycosyl compounds of the present disclosure in general, in accordance herewith any glycosyl compound may be selected, obtained or prepared and used.
  • Suitable glycosyl compounds include, for example, hexosyl or pentosyl compounds. Further suitable compounds include monosaccharides, disaccharides, trisaccharides, and polysaccharides. Further suitable compounds include substituted glycosyl compounds, for example, acetylated glycosyl compounds, wherein all hydroxyl groups are substituted by acetyl groups.
  • glycosyl compounds which may be selected are glucose and glucosyl containing compounds and glucose and glucosyl derivatives, such as undine diphosphate glucose (UDP-glucose), including D- and L-glucose and glucosyl derivatives.
  • UDP-glucose undine diphosphate glucose
  • glycosyl compounds which may be selected are glucuronic acid and glucuronic acid containing compounds and glucuronic acid derivatives thereof, including D- and L-glucuronic acid and glucuronic derivatives.
  • glycosyl compounds which may be selected are galactose and galactosyl, and galactose and galactosyl containing compounds and galactose and galactosyl derivatives, such as uridine diphosphate galactose (UDP-galactose), including D- and L-galactose and galactosyl derivatives.
  • UDP-galactose uridine diphosphate galactose
  • D- and L-galactose and galactosyl derivatives include D- and L-galactose and galactosyl derivatives.
  • glycosyl compounds which may be selected are fucose and fucosyl containing compounds and fucose and fucosyl derivatives, including D- and L-fucose and fucosyl derivatives.
  • glycosyl compounds which may be selected are xylose and xylosyl containing compounds and xylose and xylosyl and derivatives, including D- and L-xylose and xylosyl derivatives.
  • glycosyl compounds which may be selected are arabinose and arabinosyl containing compounds and arabinose and arabinosyl derivatives, including D- and L- arabinose and arabinosyl derivatives.
  • glycosyl compounds which may be selected are rhamnose and rhamnosyl containing compounds and rhamnose and rhamnosyl derivatives, including D- and L-rhamnose and rhamnosyl derivatives.
  • the glycosyl compound may be provided in a more or less chemically pure form, for example, in the form of a glycosyl compound preparation having a purity of at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least 99.9%.
  • the glycosyl compound may be chemically synthesized or obtained from a fine chemical manufacturer.
  • a hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide-containing mescaline derivative and a glycosyl compound are provided, and the hydroxy-, alkoxy-, acyloxy-, alkyl-, amino-, acylamino-, or halide-containing mescaline derivative compound and a glycosyl compound are contacted to react in a chemical reaction resulting in the formation of a glycosylated mescaline derivative compound.
  • the glycosylated mescaline derivative can be formed in a reaction between a glycosyl compound and a hydroxycontaining mescaline derivative, wherein the hydroxy group of the hydroxycontaining mescaline derivative reacts with the glycosyl compound to form a glycosidic bond. It is noted that the example reaction depicted in FIG.
  • FIG. 12 shows a reaction between a glucose and chemical compound (II) which is a 4-hydroxy- mescaline derivative, wherein X 1 , X 3 , and X 5 are substituent groups, and wherein X 2 and X 4 are hydrogen atoms, wherein one of X 1 , X 3 , and X 5 , namely X 3 , is a hydroxy group, and X 1 , X 5 are a methoxy group, and X 2 and X 4 are hydrogen atoms.
  • II glucose and chemical compound
  • one, two or three of X 1 , X 2 , X 3 , X 4 , and X 5 in compound (X) can be hydroxy groups.
  • one, two or three of X 2 , X 3 and X 4 in compound (X) can be a hydroxy group, wherein when (i) one of X 2 , X 3 , and X 4 , is an hydroxy group, the other two of X 2 , X 3 and X 4 are independently selected from a glycosyloxy group, an O-alkyl group, an O-acyl group, and each of X 1 and X 5 are a hydrogen atom, (ii) when two of X 2 , X 3 , and X 4 , are an hydroxy group, the other one of X 2 , X 3 and X 4 is selected from a glycosyloxy group an O-alkyl group, an O- acyl group, and each of X 1 , and X 5 are a hydrogen atom, and (iii) when three of X 2 , X 3 , and X 4 , are an hydroxy group,
  • one, two or three of X 1 , X 3 and X 4 in compound (X) can be a hydroxy group, wherein when (i) one of X 1 , X 3 , and X 4 , is an hydroxy group, the other two of X 1 , X 3 and X 4 are independently selected from a glycosyloxy group, an O-alkyl group, an O-acyl group, and each of X 2 and X 5 are a hydrogen atom, (ii) when two of X 1 , X 3 , and X 4 , are an hydroxy group, the other one of X 1 , X 3 and X 4 is selected from a glycosyloxy group an O-alkyl group, an O- acyl group, and each of X 2 , and X 5 are a hydrogen atom, and (iii) when three of X 1 , X 3 , and X 4 , are an hydroxy group, each of
  • one, two or three of X 1 , X 2 and X 3 in compound (X) can be a hydroxy group, wherein when (i) one of X 1 , X 2 , and X 3 , is an hydroxy group, the other two of X 1 , X 2 and X 3 are independently selected from a glycosyloxy group, an O-alkyl group, an O-acyl group, and each of X 4 and X 5 are a hydrogen atom, (ii) when two of X 1 , X 2 , and X 3 , are an hydroxy group, the other one of X 1 , X 2 and X 3 is selected from a glycosyloxy group an O-alkyl group, an O- acyl group, and each of X 4 , and X 5 are a hydrogen atom, and (iii) when three of X 1 , X 2 , and X 3 , are an hydroxy group, each of
  • one, two or three of X 1 , X 3 and X 5 in compound (X) can be a hydroxy group, wherein when (i) one of X 1 , X 3 , and X 5 , is an hydroxy group, the other two of X 1 , X 3 and X 5 are independently selected from a glycosyloxy group, an O-alkyl group, an O-acyl group, and each of X 1 and X 5 are a hydrogen atom, (ii) when two of X 1 , X 3 , and X 5 , are an hydroxy group, the other one of X 1 , X 3 and X 5 is selected from a glycosyloxy group an O-alkyl group, an O- acyl group, and each of X 2 , and X 4 are a hydrogen atom, and (iii) when three of X 1 , X 3 , and X 5 , are an hydroxy group, each of
  • one, two or three of X 1 , X 2 and X 4 in compound (II) can be a hydroxy group, wherein when (i) one of X 1 , X 2 , and X 4 , is an hydroxy group, the other two of X 1 , X 2 and X 4 are independently selected from a glycosyloxy group, an O-alkyl group, an O-acyl group, and each of X 3 and X 5 are a hydrogen atom, (ii) when two of X 1 , X 2 , and X 4 , are an hydroxy group, the other one of X 1 , X 2 and X 4 is selected from a glycosyloxy group an O-alkyl group, an O- acyl group, and each of X 3 , and X 5 are a hydrogen atom, and (iii) when three of X 1 , X 2 , and X 4 , are an hydroxy group, each
  • any two of the R 1 , R 2 , R 3 groups can be joined together, along with the nitrogen atom to which they are attached, to form a 4-10-membered heterocyclic ring, wherein one or more carbons in the ring may be substituted with O, or NR7, wherein R7 is a hydrogen atom, or an alkyl, aryl or acyl group.
  • FIGS. 10A - 10G shown therein are example hydroxy-containing mescaline derivatives.
  • X 1 can be a hydroxy group.
  • X 3 and X 5 can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 3 can be a hydroxy group.
  • X 1 and X 5 can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 5 can be a hydroxy group.
  • X 1 and X 3 can be independently selected from a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 1 and X 5 can each be a hydroxy group. Furthermore, X 5 can be selected from a hydroxy group, an O-alkyl group, or an O- acyl group.
  • X 1 and X 5 can each be a hydroxy group.
  • X 3 can be selected from a hydroxy group, an O-alkyl group, or an O- acyl group.
  • X 3 and X 5 can each be a hydroxy group.
  • X 1 can be a hydroxy group, an O-alkyl group, or an O-acyl group.
  • X 1 , X 3 and X 5 can each be a hydroxy group.
  • FIGS. 10A - 10G X 1 , X 3 and X 5 , in the chemical compound having chemical formula (II), are substituents bonded to carbon atoms C2, C4 and Ce, respectively. Furthermore, X 2 and X 4 are hydrogen atoms.
  • the compounds shown in FIGS. 10A - 10G can be understood to correspond with the compound shown in FIG. 3G. It is further noted that the hydroxy-containing derivatives shown in FIGS. 10A - 10G may be used to make the glycosyl mescaline derivatives shown in FIGS. 4A - 4G, respectively. It is to be clearly understood, that, in this respect, FIGS.
  • mescaline derivative compounds shown in FIGS. 3A - 3F, and 3H - 3R may be selected, wherein any one, any two, or all three of X 1 , X 2 , X 3 , X 4 , and X 5 can be hydroxy groups, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein two X 1 , X 2 , X 3 , X 4 , and X 5 groups which are not a hydroxy group or a hydrogen atom, can be independently selected from an O-alkyl group, or an O-acyl group. Any thus selected hydroxy-containing mescaline derivatives may all be used to make glycosyl mescaline derivatives.
  • groups other than hydroxy groups may be used to facilitate a reaction between a glycosyl group and a mescaline derivative.
  • groups include, for example, alkoxy groups, alkyl groups, acylamido groups or halides, all of which may be included in mescaline derivatives in a manner similar to the hereinbefore described hydroxy-mescaline derivatives.
  • FIGS. 11A and 11B Further example reactions to make the glycosylated mescaline derivatives are depicted in FIGS. 11A and 11B.
  • FIG. 11A depicts example reactions for synthesizing glycosylated mescaline derivatives wherein the glycosyl groups are O-linked.
  • FIG. 11B depicts example reactions for synthesizing glycosylated mescaline derivatives wherein the glycosyl groups are C-linked.
  • FIG. 11 A depicts an example chemical reaction for synthesizing a glycosylated mescaline derivative wherein the glycosyl group is bonded through its anomeric carbon atom and forming an O-linked glycosyl group notably a reaction wherein a 4-hydroxy-mescaline derivative (11A-1) is reacted with benzyloxycarbonyl chloride to form an N-protected phenol intermediate (11A- 2) that undergoes further a SN2 nucleophilic substitution with a tetra-per-O- benzylated glycosyl bromide (11A-3) to form the O-glycosyl compound (11A-4); subsequently all benzyl groups in compound (11A-4) can be removed under a catalytic hydrogenation to form a 4-O-glycosyl-mescaline derivative (11A-5).
  • a 4-hydroxy-mescaline derivative 11A-1
  • benzyloxycarbonyl chloride to form an N-protected phenol intermediate (
  • the free primary amino group in compound (11A-5) can be further N,N-dialkylated to from the corresponding tertiary mescaline amine (11 A-6) that can undergo another N-alkylation to form the corresponding mescaline ammonium (11A-7).
  • FIG. 11B depicts an example of chemical synthesis reaction wherein the glycosyl group is bonded through an anomeric carbon atom and forming a C-linked glycosyl group.
  • the highly activated 4-(2-choroethyl)-2,6-dimethoxyphenol (11 B-1) is subjected to a glycosylation reaction with 1-O-acetyl-2,3,4,6-tetra-O-benzyl-D-glucopyranose (11B-2) under the catalysis of boron trifluoride etherate, forming the corresponding 3-C-glycoside (11B-3) that contains a leaving group (Cl); subsequently, the primary chloride can be further displaced with either an N-substituted piperazine or a pyrrolidine to form respectively a 3-C-glycosylated mescaline derivatives (11 B-4 and (11 B-5 respectively. Finally, a palladium hydroxide assisted full debenzylations should afford the corresponding 3-C-glycosyl-4-hydroxy-2,5- dimethox-mescaline derivatives (11 B-6 and (11 B-7 respectively.
  • FIGS. 14A and 14B Yet further example reactions to make glycosylated ethylamine mescaline derivatives are depicted in FIGS. 14A and 14B.
  • the present disclosure provides, a method of making a glycosylated mescaline derivative having the chemical formula (I): wherein, X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, a glycosyl group, an O- alkyl group, an O-acyl group, or a hydroxy group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , and X 5 , are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , and X 5 are a hydrogen atom, and wherein
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring, wherein the method comprises performing at least one of the chemical reactions depicted in FIGS. 14A or 14B.
  • the compound having formula (I) can be a compound having chemical formula (II) or formula (III): wherein O-Q is a glycosyloxy group, and wherein the method involves the performance of the chemical reactions selected from
  • the compound having chemical formula (II) can have the chemical formula (IV): and the chemical reaction can be selected from the chemical reactions (d); (c) and (d); and (a), (b), (c), and (d), depicted in FIG. 14A.
  • the compound having chemical formula (III) can have the chemical formula (V):
  • the chemical reaction can be selected from the chemical reactions (h); (g) and (h); (f), (g) and (h); or (e), (f), (g), and (h), depicted in FIG. 14B.
  • the present disclosure provides, a method of making a glycosylated mescaline derivative having the chemical formula (VII): wherein, X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, a glycosyl group, or an O-alkyl group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a glycosyl group, wherein two of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, and wherein one of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe, and Xe is an ethylamino group (-
  • Xe are a hydroxy group, wherein two of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, and one of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe is
  • ⁇ NHBoc with an O-acetylated glycosyl compound, wherein one of the carbon atoms of the O-acetylated glycosyl compound is substituted with a bromine atom, to form a compound having chemical formula (VIII): wherein, X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, an O- acetylated glycosyloxy group, or an O-alkyl group, wherein 1 to 3 of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe, are an O-acetylated glycosyloxy group, wherein two of X 1 , X 2 , X 3 , X 4 , X 5 , and Xe are a hydrogen atom, and one
  • X 1 and X 5 can be hydrogen, X 2 and X 4 can be methoxy, X 3 can be a hydroxyl group, and Xe can , and compound (VII) can have the chemical formula (II) or (III):
  • O-Q is a glycosyloxy group
  • the compound having formula (II) can be a compound having chemical formula (IV):
  • the compound having formula (III) can be a compound having chemical formula (V):
  • the reactants are reacted under reaction conditions which permit the reactants to chemically react with each other and form a product, i.e., the glycosylated mescaline derivatives of the present disclosure.
  • reaction conditions may be selected, adjusted and optimized as known by those of skill in the art.
  • the reaction may be catalyzed by initially preparing a glycosyl derivative compound to enhance the reactivity between the glycosyl compound and the hydroxycontaining mescaline derivative.
  • the anomeric carbon of the glycosyl compound may be complexed with a halogen, such as bromide and chloride, and furthermore the reaction may be performed in the presence of, for example, Ag2COs or another heavy metal-based compound, which can act as an acid (HCI or HBr) scavenger.
  • a halogen such as bromide and chloride
  • Other glycosyl compound derivatives include acylate (such as acetate), imidate (such as trichloroacetimidate), thioalkyl or thioaryl of glycosyl compound derivatives.
  • the reactions may be conducted in any suitable reaction vessel (e.g., a tube, bottle).
  • suitable solvents that may be used are polar solvents such as, for example, dichloromethane, dichloroethane, toluene, and so-called participating solvents such as acetonitrile and diethyl ether.
  • Suitable temperatures may range from, for example, e.g., from about -78 °C to about 60 °C.
  • catalysts also known as promoters, may be included in the reaction such as iodonium dicollidine perchlorate (IDCP), any silver or mercury salts, trimethylsilyl trifluoromethanesulfonate (T MS -trifl ate, TMSOTf), or trifluoronmethanesulfonic acid (triflic acid, TfOH), N-iodosuccinimide, methyl triflate.
  • IDCP iodonium dicollidine perchlorate
  • TMSOTf trimethylsilyl trifluoromethanesulfonate
  • TfOH trifluoronmethanesulfonic acid
  • reaction times may be varied.
  • reaction conditions may be optimized, for example, by preparing several glycosyl compound preparations and hydroxy-containing mescaline derivative preparations and reacting these in different reaction vessels under different reaction conditions, for example, different temperatures, using different solvents etc., evaluating the obtained glycosylated mescaline derivative reaction product, adjusting reaction conditions, and selecting a desired reaction condition.
  • reaction conditions for example, different temperatures, using different solvents etc.
  • the reaction may be catalyzed by a glucosyl transferase.
  • a glucosyl transferase Referring now to FIG. 13, shown therein is an example chemical reaction catalyzed by a UDP glycosyl transferase wherein the glucose moiety of UDP-glucose is transferred to a 3-hydroxy-mescaline derivative in a chemical reaction which results in the formation of a glycosidic bond, and which is catalyzed by a UDP glycosyl transferase.
  • the glycosylated mescaline derivative can be formed in a reaction between a UDP-glycosyl compound and a hydroxy-containing mescaline derivative, wherein the hydroxy group reacts with the glycosyl group of the UDP- glycosyl compound to form a glycosidic bond, and wherein the reaction is catalyzed by the UDP-glycosyl transferase.
  • the reaction shown in FIG. 13 can be carried out in vitro.
  • the reaction constituents i.e., a hydroxy-containing mescaline derivative, a glycosyl compound, and a glycosyl transferase can be contacted and reacted in vitro, for example, in a tube, bottle, or dish, or other suitable reaction vessel.
  • Suitable in vitro reaction conditions are generally reaction conditions which are approximately physiological conditions.
  • in vitro physiological conditions can comprise, for example, 50-200 mM NaCI or KCI, pH 6.5-8.5, 20-45° C, or 30-40° C.
  • aqueous conditions may be selected by the practitioner according to conventional methods.
  • buffered aqueous conditions may be applicable: 10-250 mM NaCI, 5-50 mM Tris HC1 , pH 5-8, with optional addition of divalent cation(s) and/or metal chelators and/or nonionic detergents and/or membrane fractions and/or anti-foam agents and/or scintillants. All reaction constituents may be mixed, for example by gentle stirring or shaking the reaction vessel. Reaction times may vary, but generally the glycosylated mescaline compound can be formed in less than about 30 minutes, for examples less than about 20 minutes, or less than about 5 minutes.
  • reaction conditions for example, by preparing multiple reaction vessels, performing the in vitro reaction under multiple reaction conditions and evaluating the formation of glycosylated mescaline compound under these different reaction conditions. Subsequently a desired reaction condition may be selected.
  • the glycosylated mescaline derivatives may be formed biosynthetically. Accordingly, the present disclosure further includes in one embodiment, a method of making a glycosylated mescaline derivative, the method comprising:
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring; and
  • W is -N(R 1 )(R 2 ) or -N + (R 1 )(R 2 )(R 3 ), wherein
  • R 1 and R 2 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or R 1 and R 2 are joined together, along with the nitrogen atom to which they are attached, to form a 3- 10-membered heterocyclic ring; or
  • R 1 , R 2 and R 3 are independently or simultaneously a hydrogen atom, an alkyl group, an acyl group, or an alkyl-aryl group, wherein the aryl group is optionally substituted, or any two of R 1 , R 2 and R 3 are joined together, along with the nitrogen atom to which they are attached, to form a 3-10-membered heterocyclic ring.
  • any hydroxy-containing compounds of the formula (II) may be used including any and all of the hereinbefore described hydroxycontaining compounds, such as, for example, the compounds shown in FIGS. 4A - 4G, 11 and 12.
  • host cells that can be used in accordance with the present disclosure, it is initially noted that a variety of host cells may be selected in accordance with the present disclosure, including microorganism host cells, plant host cells, and animal host cells.
  • the host cell includes a glycosyl transferase.
  • Such cells can be obtained in at least two ways. First, in some embodiments, host cells may be selected in which a glycosyl transferase is naturally present. Second, in some embodiments, a host cell that not naturally produces a suitable glycosyl transferase may modulated to produce a glycosyl transferase. Thus, for example, a nucleic acid sequence encoding a glycosyl transferase may be introduced into a host cell, and upon cell growth the host cells can make the glycosyl transferase.
  • a nucleic acid sequence encoding a glycosyl transferase further includes one or more additional nucleic acid sequences, for example, a nucleic acid sequences controlling expression of the glycosyl transferase, and these one or more additional nucleic acid sequences together with the nucleic acid sequence encoding the glycosyl transferase can be said to form a chimeric nucleic acid sequence.
  • a host cell which upon cultivation expresses the chimeric nucleic acid can be selected and used in accordance with the present disclosure.
  • Suitable host cells in this respect include, for example, microbial cells, such as bacterial cells, yeast cells, for example, and algal cells or plant cells.
  • microbial cells such as bacterial cells, yeast cells, for example, and algal cells or plant cells.
  • algal cells or plant cells A variety of techniques and methodologies to manipulate host cells to introduce nucleic acid sequences in cells and attain expression exists and are well known to the skilled artisan. These methods include, for example, cation-based methods, for example, lithium ion or calcium ion-based methods, electroporation, biolistics, and glass beads- based methods.
  • the methodology to introduce nucleic acid material in the host cell may vary, and, furthermore, methodologies may be optimized for uptake of nucleic acid material by the host cell, for example, by comparing uptake of nucleic acid material using different conditions.
  • Detailed guidance can be found, for example, in Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, 2012, Fourth Ed. It is noted that the chimeric nucleic acid is a non-naturally occurring chimeric nucleic acid sequence and can be said to be heterologous to the host cell.
  • the glycosyl transferase can be selected a nucleic acid sequence selected from the nucleic acid sequences consisting of:
  • nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a);
  • nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a) but for the degeneration of the genetic code;
  • nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a), (b), (c), (d), (e) or (f).
  • any of the nucleic acid sequences set forth in (a), (b), (c), (d), (e), (f) or (g) may be selected and introduced into a host cell.
  • E. coli Escherichia coli.
  • the preparation of the E. coli vectors may be accomplished using commonly known techniques such as restriction digestion, ligation, gel electrophoresis, DNA sequencing, the polymerase chain reaction (PCR) and other methodologies.
  • PCR polymerase chain reaction
  • a wide variety of cloning vectors is available to perform the necessary steps required to prepare a recombinant expression vector.
  • vectors with a replication system functional in E. coli are vectors such as pBR 3 22, the pUC series of vectors, the M13 mp series of vectors, pBluescript etc. Suitable promoter sequences for use in E.
  • coli include, for example, the T7 promoter, the T5 promoter, tryptophan (trp) promoter, lactose (lac) promoter, tryptophan/lactose (tac) promoter, lipoprotein (Ipp) promoter, and A phage PL promoter.
  • cloning vectors contain a marker, for example, an antibiotic resistance marker, such as ampicillin or kanamycin resistance marker, allowing selection of transformed cells.
  • Nucleic acid sequences may be introduced in these vectors, and the vectors may be introduced in E. coli by preparing competent cells, electroporation or using other well-known methodologies to a person of skill in the art. E.
  • yeast cell Another example host cell that may be conveniently used is a yeast cell.
  • Example yeast host cells that can be used are yeast cells belonging to the genus Candida, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Pichia, Hansenula, and Yarrowia.
  • the yeast cell can be a Saccharomyces cerevisiae cell, a Yarrowia lipolytica cell, or Pichia pastoris cell.
  • yeast host cells include, for example, Yip type vectors, YEp type vectors, YRp type vectors, YCp type vectors, pGPD-2, pAO815, pGAPZ, pGAPZa, pHIL-D2, pHIL-S1 , pPIC3.5K, pPIC9K, pPICZ, pPICZa, pPIC3K, pHWO10, pPUZZLE and 2 pm plasmids.
  • Such vectors are known to the art and are, for example, described in Cregg et al., Mol Biotechnol.
  • Suitable promoter sequences for use in yeast host cells are also known and described, for example, in Mattanovich et al., Methods Mol. Biol., 2012, 824:329-58, and in Romanos et al., 1992, Yeast 8: 423- 488.
  • suitable promoters for use in yeast host cells include promoters of glycolytic enzymes, like triosephosphate isomerase (TPI), phosphoglycerate kinase (PGK), glyceraldehyde-3-phosphate dehydrogenase (GAPDH or GAP) and variants thereof, lactase (LAC) and galactosidase (GAL), P.
  • TPI triosephosphate isomerase
  • PGK phosphoglycerate kinase
  • GAP glyceraldehyde-3-phosphate dehydrogenase
  • LAC lactase
  • GAL galactosidase
  • PPGI glucose-6- phosphate isomerase promoter
  • PPGK 3-phosphoglycerate kinase promoter
  • GAP glycerol aldehyde phosphate dehydrogenase promoter
  • PTEF translation elongation factor promoter
  • ENO-1 S. cerevisiae enolase
  • GAL1 S. cerevisiae galactokinase
  • ADH1 S. cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
  • ADH1 ADH2/GAP
  • TPI S. cerevisiae triose phosphate isomerase
  • yeast host cells can be used in yeast, as well as marker genes providing genetic functions for essential nutrients, for example, leucine (LEU2), tryptophan (TRP1 and TRP2), uracil (URA3, URA5, URA6), histidine (HIS3), and the like.
  • LEU2 leucine
  • TRP1 and TRP2 tryptophan
  • URA6 uracil
  • HIS3 histidine
  • a host cell comprising a chimeric nucleic acid comprising (i) a nucleic acid sequence controlling expression in a host cell and (ii) a nucleic acid sequence encoding a glycosyl transferase, can be prepared in accordance with the present disclosure.
  • host cells are grown to multiply and to express a chimeric nucleic acid. Expression of the chimeric nucleic acid results in the biosynthetic production in the host cell of a glycosyl transferase.
  • Growth media and growth conditions can vary depending on the host cell that is selected, as will be readily appreciated to those of ordinary skill in the art. Growth media typically contain a carbon source, one or several nitrogen sources, essential salts including salts of potassium, sodium, magnesium, phosphate and sulphate, trace metals, water soluble vitamins, and process aids including but not limited to antifoam agents, protease inhibitors, stabilizers, ligands and inducers.
  • Example carbon sources are e.g., mono- or disaccharides.
  • Example nitrogen sources are, e.g., ammonia, urea, amino acids, yeast extract, corn steep liquor and fully or partially hydrolyzed proteins.
  • Example trace metals are e.g., Fe, Zn, Mn, Cu, Mo and H3BO3.
  • Example water soluble vitamins are e.g., biotin, pantothenate, niacin, thiamine, p- aminobenzoic acid, choline, pyridoxine, folic acid, riboflavin and ascorbic acid.
  • specific example media include liquid culture media for the growth of yeast cells and bacterial cells including, Luria-Bertani (LB) broth for bacterial cell cultivation, and yeast extract peptone dextrose (YEPD or YPD), for yeast cell cultivation.
  • LB Luria-Bertani
  • YEPD yeast extract peptone dextrose
  • the cells are provided with a hydroxy-containing mescaline derivative.
  • host cells may be contacted with a hydroxy-containing mescaline derivative.
  • the hydroxy-containing mescaline can be exogenously supplied, for example, by including a hydroxy-containing mescaline derivative in the growth medium of the host cells and growing the host cells in a medium including the hydroxy-containing mescaline derivative.
  • the glycosylated mescaline derivative compounds may be extracted from the host cell suspension and separated from other constituents within the host cell suspension, such as media constituents and cellular debris. Separation techniques will be known to those of skill in the art and include, for example, solvent extraction (e.g., butane, chloroform, ethanol), column chromatographybased techniques, high-performance liquid chromatography (HPLC), for example, and/or countercurrent separation (CCS) based systems.
  • solvent extraction e.g., butane, chloroform, ethanol
  • HPLC high-performance liquid chromatography
  • CCS countercurrent separation
  • the recovered glycosylated mescaline derivative compounds may be obtained in a more or less pure form, for example, a preparation of glycosylated mescaline derivative compounds of at least about 60% (w/v), about 70% (w/v), about 80% (w/v), about 90% (w/v), about 95% (w/v) or about 99% (w/v) purity may be obtained.
  • a preparation of glycosylated mescaline derivative compounds of at least about 60% (w/v), about 70% (w/v), about 80% (w/v), about 90% (w/v), about 95% (w/v) or about 99% (w/v) purity may be obtained.
  • glycosylated mescaline derivatives in more or less pure form may be prepared.
  • glycosylated mescaline derivatives are disclosed herein, as well as methods of making glycosylated mescaline derivatives.
  • the glycosylated mescaline compounds may be formulated for use as a pharmaceutical drug or recreational drug.
  • SEQ.ID NO: 1 sets forth a Nicotiana benthamiana nucleic acid sequence encoding a glycosyl transferase.
  • SEQ.ID NO: 2 sets forth a deduced amino acid sequence of a Nicotiana benthamiana glycosyl transferase polypeptide.
  • SEQ.ID NO: 3 sets forth a Nicotiana benthamiana nucleic acid sequence encoding a glycosyl transferase.
  • SEQ.ID NO: 4 sets forth a deduced amino acid sequence of a Nicotiana benthamiana glycosyl transferase polypeptide.
  • SEQ.ID NO: 5 sets forth a Nicotiana benthamiana nucleic acid sequence encoding a glycosyl transferase.
  • SEQ.ID NO: 6 sets forth a deduced amino acid sequence of a Nicotiana benthamiana glycosyl transferase polypeptide.
  • SEQUENCE LISTING SEQ.ID NO: 1 [00303] ATGGGTCAGCTCCATATTTTCTTCTTCCCTATGATGGCTCATGGCCACATGATTCCTAC ACTAGACATGGCGAAGCTCTTTGCTTCACGTGGTGTTAAAGCCACTATAATCACAACGCCACTCAATGAAT CCGTTTTCTCCAAAGCTATTCAAAGAAACAAGCATTTGGGTATCGAAATCGAAATTCGTTTGATCAAATTC CCAGCTGTTGAAAACGACTTACCTGAAGAATGCGAACGCCTCGATCAAATCCCTTCAGATGAGAAGCTCCC AAATTTCTTCAAAGCTGTAGCTATGATGCAAGAACCACTAGAGAAGCTTATTCAAGAATGCCGCCCTAATT GTCTTGTTTCTGATATGTTCCTTCCTTGGACTACTGATTCTGCAGCCAAATTTAACATCCC
  • PrestoBlue assays were first performed.
  • the PrestoBlue assay measures cell viable activity based on the metabolic reduction of the redox indicator resazurin and is a preferred method for routine cell viability assays (Terrasso et al., 2017, J Pharmacol. Toxicol. Methods 83: 72).
  • Results of these assays were conducted using both control ligands (e.g., 2C-B (4-bromo-2,5-dimethoxyphenethylamine), MDMA, mescaline, etc.) and novel derivative, in part as a pre-screen for any remarkable toxic effects on cell cultures up to concentrations of 1 mM.
  • HepG2 is a human hepatoma that is most commonly used in drug metabolism and hepatotoxicity studies (Donato et al., 2015, Methods Mol Biol 1250: 77).
  • HepG2 cells were cultured using standard procedures using the manufacture’s protocols (ATCC, HB-8065). Briefly, cells were cultured in Eagle’s minimum essential medium supplemented with 10% fetal bovine serum and grown at 37°C in the presence of 5% CO2. To test the various compounds with the cell line, cells were seeded in a clear 96-well culture plate at 20,000 cells per well. After allowing cells to attach and grow for 24 hours, compounds were added at 1 mM, 10 mM, 100 mM, and 1 mM. Methanol was used as vehicle, at concentrations 0.001 , 0.01 , 0.1 , and 1 %.
  • Triton X-100 concentrations used were 0.0001 , 0.001 , 0.01 and 0.1 %.
  • Cells were incubated with compounds for 48 hours before assessing cell viability with the PrestoBlue assay following the manufacture’s protocol (ThermoFisher Scientific, P50200).
  • PrestoBlue reagent was added to cells and allowed to incubate for 1 hour before reading.
  • Absorbance readings were performed at 570 nm with the reference at 600 nm on a SpectraMax iD3 plate reader. Non-treated cells were assigned 100% viability.
  • 17A (i) and 17A (ii) show results for phenylalkylamine compounds 2C-B (4-bromo-2,5- dimethoxyphenethylamine) (panel A), MDMA (panel B), mescaline (panel C), and the toxic control compound Triton X100 (panel E).
  • Data acquired for the derivative having chemical formula (IV) is displayed as “(IV)” on the x-axis in FIG. 17A (ii) (panel D).
  • 2C-B (4-bromo-2,5- dimethoxyphenethylamine) and 5-MeO-MiPT (/ ⁇ /-[2-(5-methoxy-1 /7-indol-3- yl)ethyl]-/V-methylpropan-2-amine) were used as positive controls since they are known binders at this receptor (2C-B, Rickli et al., 2015, Neuropharmacology 99: 546; 5-MeO-MiPT, Ray, PLoS ONE 5: e9019, 2010).
  • Escaline was included in this study for comparative purposes, for although its 5-HT 1A receptor binding mode is understudied it is an established mescaline-type hallucinogen with therapeutic potential (Shulgin and Shulgin, 1990. PIHKAL: A Chemical Love Story. 1 st ed., Transform Press). Results showing specific binding above 50% are expected for positive controls. Results showing specific binding between 20% and 50% are indicative of moderate effects, and are recommended for further study to ascertain mode and strength of receptor engagement. Results showing specific binding lower than 20% are not considered significant and results are mostly likely attributable to variability of the signal around the negative control level.
  • the competition binding results for compound with formula (V), designated “Compound (V)” in TABLE 1 reveals binding at 10 pM ligand concentrations.
  • mixtures of 10 pg of membrane containing HTIA receptor was pre-coupled to 1 mg of SPA beads at room temperature in a tube rotator for 1 hour in binding buffer (50 mM Tris-HCI pH 7.4, 10 mM MgSO4, 0.5 mM EDTA, 3.7% glycerol, 1 mM ascorbic acid, 10 pM pargyline HCI).
  • binding buffer 50 mM Tris-HCI pH 7.4, 10 mM MgSO4, 0.5 mM EDTA, 3.7% glycerol, 1 mM ascorbic acid, 10 pM pargyline HCI.
  • the beads and membrane were aliquoted in an isoplate-96 microplate with increasing amounts of 8-hydroxy-DPAT [propyl-2,3- ring-1 ,2,3- 3 H] (0.1525 nM to 5 nM) and incubated for two hours at room temperature in the dark with shaking.
  • Ki values were calculated from the competition displacement data using the competitive binding analysis from GraphPad PRISM software. 2C-B, MDMA and mescaline were used as positive controls since they are phenylalkylamine-type molecules with relatively strong (2C- B; Rickli et al., 2015, Neuropharmacology 99: 546) or more moderate (MDMA, Simmler et a/., 2013, British J. Pharmacol.
  • FIGS. 17B, 17C and 17D show the competition binding curves for 2C-B, MDMA and mescaline, respectively, as positive controls (binding).
  • FIGS. 17E and 17F show the competition binding curves for escaline and proscaline, respectively, for comparative purposes.
  • FIGS. 17G and 17H show the competition binding curves for DMSO and tryptophan, respectively, as negative controls (no binding).
  • the competition binding curve for compound with formula (IV), designated “(IV)” in FIG. 171 reveals binding at higher ligand concentrations.
  • mixtures of 10 ug of membrane containing 5-HT 2A receptor was precoupled to 1 mg of SPA beads at room temperature in a tube rotator for 1 hour in binding buffer (50 mM Tris-HCI pH7.4, 4 mM CaC , 1 mM ascorbic acid, 10 mM pargyline HCI).
  • binding buffer 50 mM Tris-HCI pH7.4, 4 mM CaC , 1 mM ascorbic acid, 10 mM pargyline HCI.
  • the beads and membrane were aliquoted in an isoplate-96 microplate with increasing amounts of [ 3 H]ketanserin (0.1525 nM to 5 nM) and incubated for two hours at room temperature in the dark with shaking. After incubation, the samples were read on a MicroBeta 2 Microplate Counter (Perkin Elmer).
  • 2C-B and MDMA were used as positive controls since they are phenylalkylamine-type molecules with relatively strong (Marcher-Rorsted et al., 2020, ACS Chem. Neurosci. 11 : 1238) or more moderate (Simmler et al., 2013, British J Pharmacol 168: 458) 5-HT 2A receptor binding activities, respectively.
  • Mescaline was included as an additional positive control with established binding activity at the 5-HT 2A receptor (Rickli et al., 2016, Eur Neuropsychopharm 26: 1327).
  • Escaline and proscaline were included in this study for comparative purposes, for although their 5-HT 2A receptor binding mode is understudied they are established mescaline-type hallucinogens known to induce head-twitch responses in mice (Halberstadt et al., J. Psychopharm. 33: 406). Mouse head-twitch response has been correlated with 5-HT 2A receptor engagement (Halberstadt, 2015, Behav. Brain Res. 277: 99). Specific binding in counts per minute (cpm) was calculated by subtracting non-specific binding from total binding. Specific binding (pmol/mg) was calculated from pmol of [ 3 H]ketanserin bound per mg of protein in the assay.
  • FIGS. 17J, 17K, and 17L show the competition binding curves for 2C-B, MDMA and mescaline, respectively, as positive controls (binding).
  • FIGS. 17M and 17N show the competition binding curves for escaline and proscaline, respectively, for comparative purposes.
  • FIG. 170 shows the competition binding curve for tryptophan as a negative control (no binding).
  • the competition binding curve for compound with formula (IV), designated “IV” in FIG. 17P reveals no significant binding to the 5-HT 2A , as evidenced by a value > 1000 pM.
  • Example 2 Preparation and pharmacological evaluation of a second glycosylated mescaline derivative.
  • FIG. 18B shows radioligand competition assay results for compound with formula (V), depicted on the x-axis as “(V)”. Results demonstrate receptor binding with increasing ligand concentrations.
  • FIG. 18C shows radioligand competition assay results for compound with formula (V), depicted on the x-axis as “(V)”. Results demonstrate no significant binding of the compound with formula (V), as evidenced by a Ki value > 1000 pM.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Neurology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Saccharide Compounds (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne de nouveaux composés dérivés de mécaline glycosylés qui présentent une liaison sélective au récepteur HT1A par rapport au récepteur de la sérotonine et des formulations pharmaceutiques et de drogues à usage récréatif les contenant. Les composés peuvent être produits par réaction d'un dérivé de mécaline hydroxylé avec un composé de glycosylation. Formules (IV) & (V)
PCT/CA2022/051792 2021-12-08 2022-12-08 Dérivés de mécaline glycosylés et leurs procédés d'utilisation WO2023102658A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163287315P 2021-12-08 2021-12-08
US63/287,315 2021-12-08

Publications (1)

Publication Number Publication Date
WO2023102658A1 true WO2023102658A1 (fr) 2023-06-15

Family

ID=86729381

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2022/051792 WO2023102658A1 (fr) 2021-12-08 2022-12-08 Dérivés de mécaline glycosylés et leurs procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2023102658A1 (fr)

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BLAAZER AR ET AL.: "Structure-activity relationships of phenylalkylamines as agonist ligands for 5-HT2A receptors", CHEMMEDCHEM: CHEMISTRY ENABLING DRUG DISCOVERY, vol. 3, no. 9, 15 September 2008 (2008-09-15), pages 1299 - 309, XP055210385, DOI: 10.1002/cmdc.200800133 *
DATABASE PUBCHEM COMPOUND ANONYMOUS : "Dopamine glucuronide", XP093073491, retrieved from PUBCHEM *
KAMIŃSKA KATARZYNA, ŚWIT PAWEŁ, MALEK KAMILLA: "2-(4-Iodo-2,5-dimethoxyphenyl)- N -[(2-methoxyphenyl)methyl]ethanamine (25I-NBOME): A Harmful Hallucinogen Review", JOURNAL OF ANALYTICAL TOXICOLOGY, PRESTON PUBLICATIONS, INC., US, vol. 44, no. 9, 21 January 2021 (2021-01-21), US , pages 947 - 956, XP093073494, ISSN: 0146-4760, DOI: 10.1093/jat/bkaa022 *
KOLACZYNSKA KE ET AL.: "Receptor interaction profiles of 4-alkoxy-3, 5-dimethoxy- phenethylamines (mescaline derivatives) and related amphetamines", FRONTIERS IN PHARMACOLOGY, vol. 12, 9 February 2022 (2022-02-09), pages 3748, XP055966125, DOI: 10.3389/fphar.2021.794254 *
NICHOLS DE: "Structure-activity relationships of serotonin 5-IIT2A agonists", WILEY INTERDISCIPLINARY REVIEWS: MEMBRANE TRANSPORT AND SIGNALING, vol. 1, no. 5, September 2012 (2012-09-01), pages 559 - 79, XP055875065, DOI: 10.1002/wmts.42 *
PAPASEIT ESTHER, OLESTI EULALIA, PÉREZ-MAÑÁ CLARA, TORRENS MARTA, GRIFELL MARC, VENTURA MIREIA, POZO OSCAR J., DE SOUSA FERNANDES : "Acute Effects of 2C-E in Humans: An Observational Study", FRONTIERS IN PHARMACOLOGY, vol. 11, XP093073492, DOI: 10.3389/fphar.2020.00233 *

Similar Documents

Publication Publication Date Title
US11891360B2 (en) Glycosylated psilocybin derivatives and methods of using
US20230040398A1 (en) Nitrated psilocybin derivatives and methods of using
US20230043896A1 (en) Hydroxylated psilocybin derivatives and methods of using
US11752130B2 (en) Carboxylated psilocybin derivatives and methods of using
TW201022276A (en) Process for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-yl(1S,2R)-3-[[(4-aminophenyl)sulfonyl](isobutyl)amino]-1-benzyl-2-hydroxypropylcarbamate
US20240122950A1 (en) Multi-substituent psilocybin derivatives and methods of using
US11931338B2 (en) Nitrilated psilocybin derivatives and methods of using
JPWO2009113660A1 (ja) 環状化合物を生産する微生物
US11891359B2 (en) Prenylated psilocybin derivatives and methods of using
WO2023102658A1 (fr) Dérivés de mécaline glycosylés et leurs procédés d'utilisation
US20230044216A1 (en) Aldehyde and ketone derivatives of psilocybin and methods of using
WO2023044574A1 (fr) Dérivés de mescaline phosphorylés et sulfonés et leurs procédés d'utilisation
CA3218824A1 (fr) Peptides agrafes et utilisations associees
WO2023102659A1 (fr) Dérivés de mescaline d'isopropylamine glycosylés et leurs méthodes d'utilisation
AU2021337466A1 (en) Halogenated psilocybin derivatives and methods of using
US11858895B2 (en) Aminated psilocybin derivatives and methods of using
US11998557B2 (en) Halogenated psilocybin derivatives and methods of using
WO2023108296A1 (fr) Analogues d'isopropylamine de dérivés de mescaline phosphorylés et sulfonés
CN109265516A (zh) 一种杂合肽及其制备方法和应用
WO2018044986A1 (fr) Inhibiteurs chimiques de biogenèse de ribosomes eucaryotes à base de triazinoindole

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22902565

Country of ref document: EP

Kind code of ref document: A1