WO2023101421A1

WO2023101421A1 - Composition for preventing or treating hearing loss or tinnitus

Info

Publication number: WO2023101421A1
Application number: PCT/KR2022/019216
Authority: WO
Inventors: 홍빛나
Original assignee: (주)인비보텍
Priority date: 2021-12-03
Filing date: 2022-11-30
Publication date: 2023-06-08
Also published as: KR20230084418A

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating hearing loss or tinnitus, comprising: a 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid; a pharmaceutically acceptable salt thereof; a solvate; and a tautomer or a hydrate.

Description

Composition for preventing or treating hearing loss or tinnitus

The present invention relates to a composition for preventing or treating hearing loss or tinnitus, more preferably containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid. It relates to a composition for preventing or treating hearing loss or tinnitus.

In modern society, due to the increase in noise exposure and the aging of the population, problems related to hearing loss and tinnitus caused by cell or nerve damage are emerging more than inflammation-based ear-related diseases.

Hearing loss and tinnitus are so common that most people can distinguish the difference between ear-related diseases caused by inflammation, such as bacterial otitis externa, malignant otitis media, fungal otitis externa, otomycosis, otitis media, or otitis media, and hearing loss and tinnitus. It is one of the most common and widely known diseases.

For the treatment of hearing loss, many specialists and medical practitioners still aim to treat the above diseases with conventional antibiotics or anti-inflammatory drugs based treatments, but these cannot be used as suitable treatments for hearing loss. The use of existing treatments as described above is, firstly, because there is no known treatment for hearing loss, and secondly, because many specialists and people in the pharmaceutical industry are not clearly aware of a treatment for hearing loss. Due to these problems, the problem of not properly performing the treatment of hearing loss continues to occur.

In particular, the use of antibiotics presents a major problem due to ototoxicity. For example, aminoglycoside antibiotics have side effects of ototoxicity and renal toxicity that cause hearing and equilibrium dysfunction in the inner ear, which can occur not only with overdose but also with long-term use in therapeutic doses. Sometimes this happens. Ototoxicity of aminoglycoside antibiotics causes vestibular dysfunction in about 15% of users, hearing loss in 10-30%, and occurs in both ears in the form of sudden severe hearing loss, mainly at high frequencies of 4000 Hz or higher.

Tinnitus is also commonly referred to as tinnitus (the perception of sound in the absence of an external source of acoustic signals). Tinnitus, tinnitus, or tinnitus is the perception of sound in the human ear when there is no corresponding external sound. To put it simply, sounds that do not originate from the outside are heard from the inside. Statistically, about 15 to 20% of adults experience tinnitus of various kinds, of which 4% experience severe tinnitus. In addition, it is said that 70-80% of people with hearing loss experience tinnitus.

Regarding the treatment of tinnitus, most treatments are focused on relieving tinnitus through rehabilitation. For example, a tinnitus masking method in which a sound similar to the patient's tinnitus is heard at a louder volume than the tinnitus from the outside through a device resembling a hearing aid, and a tinnitus masking method that makes the tinnitus inaudible, and a sound that is smaller than the actual tinnitus continuously over a wide frequency range There is a tinnitus retraining therapy that treats tinnitus without accompanying hearing loss by listening to it. To date, there is no treatment for tinnitus approved by the US Food and Drug Administration (FDA).

Under this background, preclinical studies on various drugs have been reported as studies to find substances effective for the prevention and treatment of hearing loss and/or tinnitus, but it has been confirmed that there are limitations to proceeding with clinical trials. In addition, there are currently no drugs approved for the prevention and treatment of hearing loss and/or tinnitus. Moreover, there are few drugs developed for the treatment of hearing loss and/or tinnitus that can be used without toxicity or risk to the human body. That is, unlike ear-related diseases caused by inflammation, a suitable treatment for hearing loss and/or tinnitus has not been developed at all.

An object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, its pharmaceutically acceptable salts, solvates, tautomers Or to provide a pharmaceutical composition for the prevention or treatment of hearing loss or tinnitus containing hydrate.

Another object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a pharmaceutically acceptable salt, solvate or tautomer thereof It is to provide a method for preventing or treating hearing loss or tinnitus by administering a tautomer or hydrate to a subject in need thereof.

Another object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid for preparing a medicament for the prevention or treatment of hearing loss or tinnitus, It is to provide the use of a pharmaceutically acceptable salt, solvate, tautomer or hydrate thereof.

Another object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid for use in the prevention or treatment of hearing loss or tinnitus, a pharmaceutical thereof It is to provide a composition comprising an acceptable salt, solvate, tautomer or hydrate.

Another object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a food chemically acceptable salt, solvate, tautomer thereof To provide a food composition for preventing or improving hearing loss or tinnitus containing (tautomer) or hydrate.

Another object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a food chemically acceptable salt, solvate, tautomer thereof To provide a health functional food for preventing or improving hearing loss or tinnitus containing tautomer or hydrate.

Another object of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, its food chemically acceptable salts, solvates, To provide a feed composition for preventing or improving hearing loss or tinnitus containing a tautomer or hydrate.

A detailed description of this is as follows. Meanwhile, each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application is not to be construed as being limited by the specific descriptions described below.

2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산을 포함하는 난청 또는 이명의 예방 또는 치료용 약학 조성물Pharmaceutical composition for preventing or treating hearing loss or tinnitus containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid

In order to solve the above problems, one aspect of the present invention is 2- [4- (4-chlorophenyl) -2-phenyl-1,3-thiazol-5-yl] acetic acid, a pharmaceutically acceptable thereof Provided is a pharmaceutical composition for preventing or treating hearing loss or tinnitus comprising a salt, solvate, tautomer or hydrate.

In the present invention, 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid may be a compound represented by Formula 1 below.

[Formula 1].

The 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid is also referred to as Fentiazac, and is used as an anti-inflammatory for the treatment of joint and muscle pain is known as

The present inventors have found that a pharmaceutical composition containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid can effectively reduce hearing threshold and hair cell damage caused by hearing loss. It was confirmed that it had an excellent therapeutic effect on hearing loss by suppressing it.

In addition, it was confirmed that the death of auditory cells was prevented and the cells were protected from damage. In addition, it was confirmed that the GABA synthetase expression promoting effect and GABA production promoting effect were exhibited, and thus, there was an excellent efficacy against hearing loss diseases by increasing the expression level of GABA.

In the present invention, "hearing loss" means any condition in which hearing is reduced or lost. Hearing loss may include, but is not limited to, conductive hearing loss and sensorineural hearing loss.

The conductive hearing loss is hearing loss caused by an ear disease, and is a hearing loss caused by problems in organs such as the eardrum and ossicles, which are organs that transmit sound. The hearing loss may be due to several causes, such as infections, injuries, inflammation, tumors, and adverse reactions to drugs or other chemicals.

The sensorineural hearing loss is a hearing loss caused by problems in the cochlea, which is an organ that detects sound, the auditory nerve, which transmits sound with electrical energy, and the brain responsible for hearing, which plays a comprehensive role in discriminating and understanding sound. The cause of sensorineural hearing loss may be hearing loss caused by noise, drugs, aging, trauma, or the like, and may be, for example, ototoxic hearing loss. The ototoxic hearing loss is caused by ototoxic drugs such as gentamicin, streptomycin, kanamycin, neomycin, amikacin, tobramycin, netylmycin ( Administration of one or more drugs selected from the group consisting of netilmicin), dibekacin, sisomycin, ribodomycin, cisplatin, carboplatin, and oxaliplatin It may be due to hearing loss.

In addition, the hearing loss may include noise-induced hearing loss, presbyopia, sudden hearing loss, acoustic neuropathy due to diabetes, ototoxic hearing loss, traumatic hearing loss, viral hearing loss, and the like.

If hearing is reduced or lost, it is not limited to the scope of the hearing loss of the present invention and may be included in the range of diseases.

In addition, the present inventors found that the pharmaceutical composition containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid reduced abnormal behavior and hearing amplitude caused by tinnitus. It was confirmed that it had an excellent therapeutic effect on tinnitus by having the effect of returning to normal.

In addition, the pharmaceutical composition containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid of the present invention prevents the death of auditory cells and protects them from damage. confirmed protection. In addition, it was confirmed that there is an excellent effect on tinnitus disease by increasing the expression level of GABA by exhibiting the effect of promoting the expression of GABA synthetase and the effect of promoting GABA production.

Furthermore, the pharmaceutical composition containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid of the present invention has an effect of reducing the content of glutamate. Glutamate is a negatively charged amino acid that is an excitatory synaptic messenger within the nervous system. Extracellular concentrations of glutamate are kept at low levels to prevent neurotoxicity, but when glutamate is present in high concentrations, it can be neurotoxic. In general, excessive synaptic release of glutamate, an important neurotransmitter in the auditory nervous system, and cytotoxicity that can affect the auditory nerve are called cochlear excitotoxicity or excitotoxicity. Excitotoxicity induced by glutamate activates postsynaptic glutamate receptors, resulting in depolarization and neuronal excitation. Excitotoxicity may be caused by exposure to excessive noise, such as acute or repetitive acoustic trauma, sudden deafness or anoxia/ischemia, or treatment with certain ototoxic drugs. In addition, excessive release of glutamate can be induced by excessive sound pressure flowing into the cochlea in the case of acoustic trauma or by reduced blood inflow to the glutamate control system in the case of anoxic/ischemic sudden hearing loss, and excitotoxicity is synaptic Tinnitus may be induced during the course of rupture of the posterior structure.

In the present invention, “tinnitus” refers to the perception of sound in the absence of an external source of sound signals, and may include objective tinnitus, subjective tinnitus, peripheral tinnitus, and central tinnitus, but is not limited thereto. Specifically, it may include subjective tinnitus caused by various causes such as noise, drugs, aging, trauma, and viruses, but is not limited thereto.

The objective tinnitus (or objective tinnitus) is tinnitus that can be heard from the outside, and the subjective tinnitus (or subjective tinnitus) means tinnitus that is heard only by the tinnitus patient and cannot be heard from the outside. Tinnitus can also be classified into peripheral tinnitus and central tinnitus based on differences in how it is perceived by affected individuals. Peripheral (or cochlear) tinnitus is presumed to originate from the peripheral nervous system and cochlea, and central tinnitus is presumed to originate from the auditory cortex.

However, if it corresponds to tinnitus, it is not limited to the scope of the tinnitus of the present invention and may be included in the range of diseases.

In addition, the inventors of the present invention found that 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid maintains the survival of auditory cells while preventing death, It was confirmed that the cells were protected from damage. In particular, it was confirmed that there is an excellent effect on auditory nerve-related diseases such as tinnitus or hearing loss by increasing the expression level of GABA by showing the effect of promoting GABA synthetase expression and GABA production.

According to one embodiment of the present invention, the drug according to the present invention may activate functions of GABAergic neurons in the auditory pathway. For example, it may be to promote the secretion of γaminobutyric acid (GABA), which is called "GABA", and may increase the expression of GABA synthetase, which is related to the production of GABA.

As used herein, the term "GABA synthase" refers to GAD (Glutamate decarboxylase) synthesizing the GABA, and GAD in humans exists in two types of enzymes, each having a size of 67 kDa and 65 kDa, GAD67 and GAD65 , also known as GAD1 and GAD2, respectively. In particular, GAD67 activity is a major determinant of GABA expression and secretion, and GAD67 is encoded by the GAD1 gene. Thus, the expression of GAD1 and GAD67 affects the expression of GABA.

In the present invention, 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid may exist in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed with a pharmaceutically acceptable free acid is useful. As used herein, "pharmaceutically acceptable salt" is a concentration that has an effective effect that is relatively non-toxic and harmless to patients, and the side effects attributable to the salt are 2-[4-(4-chlorophenyl)-2- phenyl-1,3-thiazol-5-yl] any organic or inorganic addition salt which does not diminish the beneficial effects of acetic acid.

At this time, as an addition salt, inorganic acids such as hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. may be used, and organic acids include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, Benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid etc. can be used, but is not limited thereto.

In addition, a pharmaceutically acceptable metal salt may be prepared using a base. The alkali metal salt or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is particularly suitable for preparing sodium, potassium, calcium, magnesium salts or mixed salts thereof, but is not limited thereto.

As used herein, the term "solvate", unless otherwise indicated, refers to a solvate formed from association of one or more solvent molecules in a compound provided herein. The term "solvate" includes hydrates (eg, monohydrate, dihydrate, trihydrate, tetrahydrate, etc.).

The term "tautomer" is a type of structural isomers that have the same chemical formula or molecular formula but differ in the way the members are connected, such as a keto-eno structure, which continuously shuttles between both isomers. means change. In addition, tautomerization may occur from imidic acid related to the amide group (CONH) to amide.

The term "hydrate" refers to a compound of the present invention that contains a stoichiometric or non-stoichiometric amount of water bound by non-covalent intermolecular forces. or a salt thereof.

The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier, and may be prepared according to conventional methods, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations, suppositories, and the like. It can be formulated in the form of a sterile injectable solution.

The pharmaceutically acceptable carrier includes those commonly used in the art, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. In addition, the pharmaceutical composition of the present invention may include diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, and other pharmaceutically acceptable additives, but is not limited thereto.

When the pharmaceutical composition of the present invention is formulated into oral solid preparations, it includes tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient such as starch, calcium carbonate, It may include sucrose or lactose, gelatin, and the like, and include, but are not limited to, lubricants such as magnesium stearate and talc.

When the pharmaceutical composition of the present invention is formulated in liquid form for oral use, it includes suspensions, internal solutions, emulsions, syrups, etc., and diluents such as water and liquid paraffin, wetting agents, sweeteners, aromatics, preservatives, etc., but are not limited thereto.

When the pharmaceutical composition of the present invention is formulated for parenteral use, it includes a sterilized aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized preparation, and a suppository, and the non-aqueous solvent and suspension include propylene glycol, polyethylene glycol, and olive vegetable oils such as oils, injectable esters such as ethyl oleate, and the like, but are not limited thereto. As a base material for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin paper, glycerogelatin, etc. may be used, but are not limited thereto.

The composition may be administered singly or in multiple doses in a pharmaceutically effective amount. The term "pharmaceutically effective amount" of the present invention means an amount sufficient to prevent or treat a disease with a reasonable benefit / risk ratio applicable to medical prevention or treatment, and the effective dose level is the severity of the disease, the activity of the drug, Age, weight, health, sex of the patient, sensitivity to the drug of the patient, administration time of the composition of the present invention used, route of administration and excretion rate, treatment period, including drugs used in combination or simultaneous use with the composition of the present invention used factors and other factors well known in the medical field. For example, 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid is 0.0001 to 100 mg/kg per day, preferably 0.01 to 50 mg. It can be administered in a dose of / kg, and the administration can be administered once a day or divided into several times.

The pharmaceutical composition of the present invention is administered to mammals such as rats, mice, livestock, and humans by various routes, for example, oral administration, inner ear, abdominal cavity or intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection. It can be.

The pharmaceutical composition of the present invention contains 0.01 to 95% by weight of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid based on the total weight of the composition, preferably 1 to 80% by weight.

The pharmaceutical composition for preventing or treating hearing loss or tinnitus of the present invention has an excellent therapeutic effect on hearing loss or tinnitus by reducing abnormal behavior caused by hearing loss or tinnitus.

As used herein, the term "prevention" refers to any action that suppresses hearing loss or tinnitus or delays the onset of hearing loss by administration of the pharmaceutical composition according to the present invention.

As used herein, the term "treatment" refers to all activities that improve or beneficially change symptoms of hearing loss or tinnitus by administration of the pharmaceutical composition according to the present invention.

2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산을 이를 필요로하는 개체에 투여하는 단계를 포함하는 난청 또는 이명의 예방 또는 치료 방법, 및 2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산의 용도A method for preventing or treating hearing loss or tinnitus comprising administering 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid to a subject in need thereof, and Uses of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid

Another aspect of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a pharmaceutically acceptable salt, solvate or tautomer thereof It provides a method for preventing or treating hearing loss or tinnitus, comprising administering a tautomer or hydrate to a subject in need thereof.

In the present invention, the terms "2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid", "hearing loss" or "tinnitus" are as described above.

As used herein, the term "individual" means any animal that has or may develop hearing loss or tinnitus, and is typically 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazole-5 It may be an animal that can exhibit beneficial effects by treatment with -yl]acetic acid, a pharmaceutically acceptable salt, solvate, tautomer or hydrate thereof, but has symptoms of hearing loss or tinnitus, or is likely to have such symptoms. If there is an object, it is included without limitation. As described above, the hearing loss or tinnitus can be effectively prevented or treated by administering the pharmaceutical composition of the present invention to a subject. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent, or in combination with an existing therapeutic agent for hearing loss or tinnitus, and may be administered sequentially or simultaneously with conventional therapeutic agents.

The term "administration" of the present invention means introducing a predetermined substance into a patient by an appropriate method, and the administration route of the composition may be administered through any general route as long as it can reach the target tissue. In addition, the pharmaceutical composition of the present invention may be administered by any device capable of transporting an active substance to a target tissue. For example, oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, rectal administration, inner ear administration may be used, but is not limited thereto. does not Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.

Administration of the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. Considering all of the above factors, it can be administered in an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.

Another aspect of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid for preparing a medicament for the prevention or treatment of hearing loss or tinnitus, A pharmaceutically acceptable salt, solvate, tautomer or hydrate thereof is provided.

Another aspect of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid for use in the prevention or treatment of hearing loss or tinnitus, and its pharmaceutical Provided are compositions comprising a generally acceptable salt, solvate, tautomer or hydrate.

2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산을 포함하는 식품 조성물, 건강기능식품 및 사료 조성물Food composition, health functional food and feed composition containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid

Another aspect of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a food chemically acceptable salt, solvate, or tautomer thereof It provides a food composition for preventing or improving hearing loss or tinnitus containing (tautomer) or hydrate.

Another aspect of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a food chemically acceptable salt, solvate, or tautomer thereof Provides a health functional food for preventing or improving hearing loss or tinnitus containing tautomer or hydrate.

In the present invention, the terms "2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid", "solvate", "tautomer", "hydrate", " Hearing loss" or "tinnitus" are as described above.

In the present invention, 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid may exist in the form of a food-acceptable salt. As the salt, an acid addition salt formed by a free acid that is acceptable in food science is useful. As used herein, "food acceptable salt" is a concentration that has an effective effect that is relatively non-toxic and harmless to patients, and the side effects caused by this salt are 2-[4-(4-chlorophenyl)-2- phenyl-1,3-thiazol-5-yl] any organic or inorganic addition salt which does not diminish the beneficial effects of acetic acid. Here, the salt is as described above in the pharmaceutical composition.

The term "improvement" as used herein refers to all activities in which hearing loss or tinnitus is improved or advantageously changed by administration of the composition of the present invention.

The food composition of the present invention may include conventional food additives, and the suitability as the "food additive" is determined according to the general rules of the food additive code approved by the Ministry of Food and Drug Safety and general test methods, etc., unless otherwise specified. It is judged according to the specifications and standards for the item.

Items listed in the "Food Additive Code" include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid, natural additives such as dark pigment, licorice extract, crystalline cellulose, goyang pigment, guar gum, and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations.

In addition, the food composition of the present invention can be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing and/or improving hearing loss or tinnitus.

The food composition of the present invention can be used as a health functional food. The term “health functional food” refers to food manufactured and processed using raw materials or ingredients having useful functionalities for the human body in accordance with the Health Functional Food Act, and “functional” refers to food that is not related to the structure and function of the human body. It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological functions.

Another aspect of the present invention is 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, a food chemically acceptable salt, solvate, or It provides a feed composition for preventing or improving hearing loss or tinnitus containing a tautomer or hydrate.

In the present invention, the feed may be fish, bird, or mammal feed, and preferably, the wild habits defined in Article 2, Subparagraph 1 of the Livestock Act and each subparagraph of the Enforcement Rule of the same Act are purified and suitable for breeding. It can be feed for livestock or aquatic organisms that can contribute to farm household income increase. The livestock may be cattle, horses, mules, donkeys, goats, goats, sheep, deer, pigs, rabbits, poultry, etc., and poultry may be chickens, turkeys, ducks, ostriches, geese, quails, etc., preferably chickens, It is not limited thereto as long as it is suitable for breeding and obtaining livestock products. The above "livestock products" are meat, milk, eggs, honey and their processed products, hides (including raw fur), raw wool, and other livestock products produced from livestock, which are defined in Article 2, Subparagraph 3 of the Livestock Act, as determined by the Ordinance of the Ministry of Agriculture and Forestry. means that In addition, it may be a dog, cat, etc., including companion animals, but is not limited thereto.

The term "feed" in the present invention means any natural or artificial diet, meal, etc. or component of said meal, intended for or suitable for eating, ingestion and digestion by an animal. In one aspect, the composition for feed containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid of the present invention includes concentrated feed, forage and/or special feed may be included.

Concentrated feed includes seed fruits including grains such as wheat, oats, and corn, bran including rice bran, wheat bran, and barley bran as by-products obtained after refining grains, soybeans, fluids, sesame seeds, linseed, and coco palm oil. Fish meal, which is a by-product obtained by extracting starch from sweet potatoes and potatoes, and residual starch, which is the main component of starch residues, fish meal, fish residue, and fish soluble, meat meal, which are concentrated fresh liquids obtained from fish. , animal feed such as blood meal, feather meal, skim milk powder, dried whey obtained by drying whey, which is the balance when cheese is produced from milk and casein is produced from skim milk, yeast, chlorella, and seaweed.

Forage, raw grass feed such as wild grass, grass, and green cutting, turnip for feed, beet for feed, root vegetables such as Lutherbearer, a type of turnip, raw grass, green cut crops, grain, etc. are put into silos. There are silage (silage), which is a stored feed filled and fermented with lactic acid, grass, hay cut and dried, straw from breeding crops, and leaves of leguminous plants. Special feeds include mineral feeds such as oyster shells and rock salt, urea feeds such as urea or its derivative, diureide isobutane, and supplements for ingredients that tend to be insufficient when only natural feed ingredients are mixed, or formulated feeds to improve the storage life of feeds. There are feed additives, which are substances added in small amounts.

2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid according to the present invention, a pharmaceutically acceptable salt, solvate, tautomer thereof or A composition containing hydrate can effectively suppress the damage to hair cells caused by the use of antibiotics as well as the hearing loss caused by hearing loss, suppress behaviors caused by tinnitus, and increase the expression of GABA to prevent hearing disorders and diseases. It can be usefully used for prevention, treatment, or improvement of related hearing loss or tinnitus.

1 is a diagram showing the inhibitory effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid on hair cell damage caused by neomycin treatment. NOR is neomycin-untreated normal control group, neomycin is neomycin-only control group, and Fentiazac is 2-[4-(4-chlorophenyl)-2-phenyl-1,3 at a concentration of 0.1 μM. -thiazol-5-yl] represents an experimental group treated with acetic acid.

2 shows the results confirming the tinnitus suppression effect by treatment with 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid in a tinnitus zebrafish model induced by salicylic acid. is the diagram shown. NOR is a control group that does not induce tinnitus, salicylic acid is a control group that is exposed to 3 mM salicylic acid for 5 hours and tinnitus is induced, and Fentiazac is a 2-[ An experimental group exposed to 4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid for 17 hours is shown.

Figure 3 shows the expression level of GAD1, a GABAergic cell marker, according to 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid treatment through real-PCR analysis It shows the confirmed result. NOR is neomycin untreated control group, neomycin is neomycin only treatment control group, pentiazac 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazole at a concentration of 0.1 μM -5-yl] shows the experimental group treated with acetic acid and neomycin.

Figure 4 shows the expression level of GAD67, a GABAergic cell marker, according to 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid treatment through Western blot analysis. It shows the confirmed result. NOR is a neomycin untreated control group, neomycin is a control group treated only with neomycin, pentiazac 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid and The experimental group treated with neomycin is shown.

Figure 5 shows the results of HPLC analysis of glutamate (Glutamate) and GABA, 5 (a) is a control group for HPLC confirmation of each of Glutamate and GABA, Figure 5 (b) is a control group (NOR), a control group (neomycin ) and the experimental group (pentiazac), respectively, the presence of glutamate and GABA was confirmed through HPLC analysis.

6 is a result showing the total Glutamate/GABA ratio of hearing cell line HEI-OC1 cells. NOR is a neomycin untreated control group, neomycin is a control group treated only with neomycin, pentiazac 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid and The experimental group treated with neomycin is shown.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to illustrate the present invention, and the scope of the present invention is not limited thereto.

<실시예><Example>

실시예 1. 이독성 난청 제브라피시 모델에 대한 2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산의 효과Example 1. Effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid on ototoxic hearing loss zebrafish model

Zebrafish fry (larvae) 6 days after fertilization were placed in 24 wells, treated with neomycin at a concentration of 2 μM, and exposed for 1 hour to prepare an ototoxic hearing loss model. In addition, an untreated normal control group that was not treated with neomycin was prepared.

The prepared ototoxic deafness zebrafish model was treated with 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid at a concentration of 0.1 μM and exposed for 6 hours. As a comparison group, 0.03% sea salt solution was used. The normal control group and the ototoxic hearing loss model were treated with 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid and sea salt solutions, respectively. Fish fry were anesthetized with 0.02% tricaine, hair cells were stained with 0.1% YO-PRO for 30 minutes, and observed directly with the naked eye using a fluorescence microscope (Olympus 1Х70, Olympus, Japan). Specifically, the number of hair cells observed with the naked eye was counted and graphed, and a fluorescence image was taken and shown in FIG. 1 .

As shown in Figure 1, 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid was not treated in the ototoxic hearing loss induced zebrafish model compared to the normal control group. In the control group, the number of hair cells was significantly reduced, whereas 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl] In the experimental group treated with acetic acid, the number of hair cells was significantly increased. Through this, the treatment of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid reduces hair cell damage caused by ototoxic hearing loss and is therefore effective in preventing and treating hearing loss. It was confirmed that it worked.

실시예 2. 소음 노출 후 난청의 개선 효과 확인Example 2. Confirmation of improvement effect of hearing loss after exposure to noise

실시예 2-1. 광대역 자극음인 클릭(click)음을 이용한 청력역치 확인Example 2-1. Confirmation of hearing threshold using click sound, which is a broadband stimulus sound

To confirm the effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid on hearing threshold after noise exposure, a hearing threshold measurement experiment using audible evoked potential was conducted. performed. An auditory brainstem response (ABR) measurement method is a method of evaluating a response to sound by measuring the electrical energy when a sound stimulus is transmitted as an electrical signal from the auditory nerve. When sound reaches the auditory nerve via the outer ear, middle ear, and cochlea, the response reflects the condition of the outer ear, middle ear, and cochlea, which reflects the actual sound energy reaching the brain. Hearing threshold refers to the minimum sensory point of barely audible sound, and in the case of a normal mouse, a response is observed even to a small sound of 20 dB on average.

Specifically, mice to which 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid were administered and untreated control mice were evaluated separately.

Noise was exposed to 115 dB complex sound for 90 minutes, and 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid was administered at the same time every day after 24 hours of noise exposure. was orally administered.

Hearing threshold was evaluated before noise exposure and on day 1, day 10, and day 20 after exposure.

For the auditory evoked potential test, mice were anesthetized by intramuscular injection of ketamine (4.57 mg/kg) and xylazine (0.43 mg/kg), and then evaluated while maintaining body temperature at 37±0.5°C. In the auditory evoked potential test, the stimulus was evaluated by gradually lowering the sound by 5 dB from 80 dB with a click sound, which is a broadband stimulus sound, and the lowest sound that responded was set as the threshold.

실시예 2-2. 16 kHz TB 자극음을 이용한 청력역치 확인Example 2-2. Hearing Threshold Verification Using 16 kHz TB Stimulus

In the auditory evoked potential test, the stimulus sound was evaluated as a 16 kHz pure tone, gradually lowering the sound by 5 dB from 80 dB.

실시예 3. 달팽이관 유모세포의 보호 효과 평가Example 3. Evaluation of the protective effect of cochlear hair cells

It was conducted in the same manner as in Example 2-1, and the normal group with intact hair cells, the group with damaged hair cells due to exposure to noise (NIHL, Noise-induced hearing loss), and the 2-[4-(4 The group treated with -chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid (NIHL + Fentiazac) was evaluated.

After the end of the threshold evaluation experiment on day 20, the mouse cochlea was separated. The separated cochlea was stored in 4% paraformaldehyde at 4° C. for 12 hours, then treated with 0.1 M EDTA for 5 days, and the organ of Corti was microdissected under a microscope. To confirm hair cells, they were stained with 5 U/mL rhodamine phalloidin and confirmed under a microscope.

실시예 4. 살리실산으로 유발된 이명 제브라피시 모델에서 2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산의 이명 억제 평가Example 4. Evaluation of tinnitus suppression of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid in a zebrafish model of tinnitus induced by salicylic acid

The treatment effect on tinnitus was confirmed using a behavioral response test method that can evaluate tinnitus by inducing tinnitus in zebrafish without physical stress.

Specifically, 10 adult zebrafish were placed in a 1L tank and exposed to 0.03% sea salt solution for 5 hours, respectively, to control (NOR) that did not induce tinnitus, and to 3 mM salicylic acid for 5 hours to reduce tinnitus. Induced experimental group (Sodium Salicylate), immediately after exposure to 3 mM salicylic acid for 5 hours, followed by exposure to 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid for 17 hours It was divided into an experimental group (Fentiazac). At this time, the Fentiazac experimental group performed the experiment by exposing adult zebrafish to a concentration of 1 μM of a composition containing 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid. proceeded. All experiments use 0.03% sea salt solution as a basic solution, and all experimental groups were adapted to 0.03% sea salt solution for 1 hour immediately before measurement.

To confirm the effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, 2-[4-(4-chlorophenyl)-2-phenyl- Zebrafish exposed to a composition containing 1,3-thiazol-5-yl] acetic acid were placed in a water tank (75(W) x 45(D) x 45(H) cm) in a transparent tube (25 mm outer diameter, inner diameter). 21 mm, total length 60 cm) through each zebrafish, the passing time and the number of rotations in the transparent tube were analyzed. The water temperature was maintained at 28 ℃ by installing an underwater heater in the water tank. The analysis results are shown in FIG. 2 .

As shown in Figure 2, in the tinnitus zebrafish model induced by salicylic acid, the experimental group treated with 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid (Fentiazac ) showed that the time to pass through the tube and the number of rotations decreased compared to the experimental group without Fentiazac (Sodium Salicylate). Through this, it was confirmed that treatment with 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid (Fentiazac) is effective in preventing and treating tinnitus.

실시예 5. 살리실산으로 유발된 이명 랫트 모델에서 2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산의 스키너 행동반응 평가Example 5. Assessment of Skinner's behavioral response to 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid in a rat model of tinnitus induced by salicylic acid

When evaluating Skinner's behavioral response in trained rats, in the case of tinnitus-induced animals, the response to pressing the trigger when there is no cue tone tends to increase. At this time, the induction of tinnitus can be confirmed by the animal mistaking the tinnitus sound as a cue tone and showing the action of pressing the trigger. At this time, a true positive refers to the number of times the trigger is pressed to acquire food when a cue tone is provided, and a false positive refers to the number of times the trigger is pressed when there is no cue tone.

Using 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, tinnitus was not induced using a control group (NOR), tinnitus induced experimental group (SS), The experimental group (SS+Fentiazac) administered with 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid was divided into three groups of three animals each and evaluated.

In the experiment, the SS group and the Fentiazac group used salicylic acid, which is commonly used in tinnitus-induced animal models, to induce tinnitus, and 350 mg/kg was orally administered 3 hours before the test. In the SS group, only salicylic acid was administered orally, and in the SS+Fentiazac group, after inducing tinnitus, 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid was administered. It was administered orally 1 hour and 30 minutes before examination.

The experiment schedule consisted of 1 day of examination before administration (Base), 3 days of examination after concurrent administration with salicylic acid (1 to 3 Days), and 3 days of examination during the tinnitus recovery period (4 to 6 Days). In the case of the SS group, water was administered 1 hour and 30 minutes before the test after salicylic acid was administered 3 hours before the test on the 1st to 3rd days, and only water was administered orally 1 hour 30 minutes before the test on the 4th to 6th day. In the case of the SS+Fentiazac group, salicylic acid was administered 3 hours before the test on days 1 to 3, then Fentiazac was administered 1 hour and 30 minutes before the test, and Fentiazac was administered orally only on days 4 to 6, 1 hour and 30 minutes before the test.

For behavioral response analysis, Silence activity ratio (SA ratio) and False positive ratio (FP ratio) were used. The SA ratio is calculated by dividing the number of responses when there is no cue tone by the number of responses during the time when the cue tone is provided, and the FP ratio is calculated as a ratio of the number of responses when there is no cue tone to the total number of responses .

실시예 6. 이명 랫트 모델에서 2-[4-(4-클로로페닐)-2-페닐-1,3-티아졸-5-일]아세트산의 청력 진폭 확인Example 6. Confirmation of hearing amplitude of 2- [4- (4-chlorophenyl) -2-phenyl-1,3-thiazol-5-yl] acetic acid in a tinnitus rat model

To determine the effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid on the sense of presence or absence of sound by measuring hearing amplitude after tinnitus induction Hearing amplitude measurement experiments using auditory evoked potential were performed.

An auditory brainstem response (ABR) measurement method is a method of evaluating a response to sound by measuring the electrical energy when a sound stimulus is transmitted as an electrical signal from the auditory nerve. When sound reaches the auditory nerve via the outer ear, middle ear, and cochlea, the response reflects the condition of the outer ear, middle ear, and cochlea, which reflects the actual sound energy reaching the brain. Hearing threshold refers to the minimum sensory point of barely audible sound, and in the case of a normal mouse, a response is observed even to a small sound of 20 dB on average.

When measuring hearing amplitude, five amplitudes are usually observed (unit: μV, Wave Ⅰ ~ Wave Ⅴ). Amplitudes 1 to 3 (Wave I to III) are formed by auditory branches extending from the 8th cranial nerve and lower nerves. Here, amplitude 1 is generated from the dendrite of the auditory nerve fiber, amplitude 2 is generated from the cochlear nucleus, and amplitude 3 represents the activity level of the superior olivary complex that receives auditory information from the cochlear nucleus. Also, amplitudes 4 and 5 (Wave IV ~ V) are formed from the upper brainstem and are related to the lateral lemniscus.

The schedule before the click stimulation test and the experimental group were the same as those of Example 5, and the 5th day of oral administration of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid A click stimulation test was performed and evaluated.

For the auditory evoked potential test, ketamine (11.43 mg/kg) and xylazine (1.08 mg/kg) were injected intramuscularly to anesthetize rats, and then the body temperature was maintained at 37±0.5°C. In the auditory evoked potential test, the stimulus was evaluated by gradually lowering the sound by 5 dB from 90 dB with a click sound, which is a broadband stimulus sound, and the lowest sound that responded was set as the threshold.

실시예 7. 청각세포주 HEI-OC1에서의 GAD1 mRNA 발현 평가Example 7. Assessment of GAD1 mRNA expression in auditory cell line HEI-OC1

Effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid on the expression of GAD1 (Glutamate decarboxylase 1), a GABA (gamma-aminobutyric acid) synthase To analyze, GAD1 mRNA expression was confirmed in the hearing cell line HEI-OC1 using real-time gene amplification analysis (PCR).

Specifically, the auditory cell line HEI-OC1 was cultured in a DMEM medium containing 10% serum and IFN-γ, and was supplied with 10% carbon dioxide and maintained at 33°C. After incubation, 1X10 ⁶ cells were seeded on a 60mm dish and stabilized for 24 hours. Then, 0.1 μM of Fentiazac was treated for 1 hour, and the experimental group (Fentiazac) and neomycin were treated with neomycin at the same concentration for 24 hours. A treated control group (neomycin) was formed, and after 24 hours, RNA was extracted using Trizol. The isolated RNA was quantified at 260 nm, synthesized into cDNA using a cDNA synthesis kit (ThermoFisher), and real-time PCR was performed using Power SYBR Green Master Mix (ThermoFisher). The primer reaction conditions were denaturation at 95°C for 5 minutes, and a total of 60 cycles were repeated at 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 20 seconds. The sequences of forward and reverse primers are shown in Table 1 below, and the results of GAD1 gene expression analysis are shown in FIG. 3 .

	ForwardForward	ReverseReverse
Beta-actinBeta-actin	GAAGAGCTATGAGCTGCCTGA (서열번호 1)GAAGAGCTATGAGCTGCCTGA (SEQ ID NO: 1)	TGATCCACATCTGCTGGAAGG (서열번호 2)TGATCCACATCTGCTGGAAGG (SEQ ID NO: 2)
Gad1Gad1	GTATCCCTACTGCAGTGTCC (서열번호 3)GTATCCCTACTGCAGTGTCC (SEQ ID NO: 3)	CCTAGCAGGGTACTAACAGG (서열번호 4)CCTAGCAGGGTACTAACAGG (SEQ ID NO: 4)

As shown in Figure 3, the expression level of the Gad1 gene increased when the Fentiazac of the present invention was treated.

실시예 8. 청각세포주 HEI-OC1에서의 GABA 신경세포의 마커인 GAD67 발현 평가Example 8. Evaluation of GAD67 expression, a marker of GABAergic neurons in auditory cell line HEI-OC1

The effect of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid on the expression of GAD67 (Glutamate decarboxylase 67), a GABA (gamma-aminobutyric acid) synthase For analysis, relative expression levels of protein markers were compared using Western blotting. The control group, comparison group, and experimental group were configured as in Example 7.

Hearing cell line HEI-OC1 was washed with phosphate buffered saline (PBS) and then RIPA (RadioImmunoPrecipitation) buffer containing protease inhibitor cocktail 20X, 50 μl and phosphatase inhibitor cocktail 100X, 10 ill It was put into 1 ml and homogenized. The homogenate was centrifuged at 15,000 rpm for 20 minutes, and the supernatant was used for Western blot analysis, and the amount of protein was measured using Bio-Rad protein assay (Bio-Rad, Hercules, CA USA). To separate 90 μg of protein per well, it was separated using sodium dodesyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), transferred to a nitrocellulose filter (Amersham, Arlington Heights, IL. USA) and incubated overnight at 4°C. GAD67 and B-actin antibodies were reacted. The next day, the filter was washed with a Tris buffered saline (TBS) solution, reacted with Goat Anti-Rabbit IgG H&L (abcam), and images were scanned with the LAS 4000 using an enhanced chemiluminescence detection system (ECL, Abfrontier). shown in Figure 4.

As shown in FIG. 4 , GAD67 expression was decreased when neomycin was treated, but GAD67 expression was significantly increased after treatment with the compound fentiazac. Through this, it was confirmed that fentiazac of the present invention can increase GABA production by increasing the expression of GAD, a GABA synthase.

실시예 9. 청각 세포주 HEI-OC1에서의 총 γ-aminobutyric acid 및 Glutamate 수치 HPLC 분석Example 9. HPLC analysis of total γ-aminobutyric acid and Glutamate levels in hearing cell line HEI-OC1

The level of intracellular GABA was analyzed using HPLC, high-performance liquid chromatography (HPLC) was Shimadzu LC-20A HPLC instrument (Shimadzu, Japan), and the column was Shimadzu LC-20A HPLC instrument (Shimadzu, Japan), Shim-pack GIST C18 (250 L x 4.6, 5 μm), a UV detector (254 nm) was used as a detector. As the mobile phase, 1% acetic acid 75% and 1% acetic acid + 0.01% trimethylamine + 0.5% acetonitrile in methanol 21% were used, and HPLC analysis was performed at a flow rate of 0.7 ml/min. The control group, comparison group, and experimental group were configured as in Example 7.

Specifically, the auditory cell line HEI-OC1 was washed with phosphate buffered saline (PBS), then 100 ul PBS was added, and the cells were collected using a cell scraper, followed by centrifugation at 1000 rpm for 5 minutes. After cell lysis by sonication for 10 minutes, 20 ul methanol was added and left at 4° C. for 10 minutes to precipitate proteins. Thereafter, the supernatant was obtained by centrifugation at 16000 x g and 4° C. for 30 minutes, and 20 ul of the obtained supernatant was dried at 65° C. for 2 hours. Then, a 2:2:1 mixture of methanol:water:TEA was added, mixed, and dried at 65°C for 30 minutes. Then, a solution of 7:1:1:1 of methanol:water:TEA:PITC was added, mixed by vortexing for 5-10 seconds, and reacted at room temperature for 20 minutes. After drying at 65 ° C for 30 minutes, 200 ul of solvent of the same composition as the mobile phase was added to the remaining pellet, centrifuged at 11,000 Х g for 5 minutes, and the supernatant obtained was filtered through a 0.45 um PVDF membrane, and 10 ul of sample was injected at each to perform HPLC analysis. It was carried out, and the results are shown in Figures 5 and 6. Figure 5 (a) is a control for HPLC confirmation of each of Glutamate and GABA, Figure 5 (b) is a control group (NOR), control group (Neomycin) and experimental group (Fentiazac) of glutamate (Glutamate) and GABA in each It shows the result of confirming the presence through HPLC analysis.

As shown in Figures 5 and 6, the experimental group (Fentiazac), which is a group in which Fentiazac and neomycin were co-administered, showed a significant decrease in Glutamate / GABA ratio compared to the control group (neomycin). Through this, it was confirmed that the treatment of Fentiazac had the effect of reducing the Glutamate/GABA ratio increased by neomycin.

Claims

A pharmaceutical composition for preventing or treating hearing loss or tinnitus, comprising 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid, or a pharmaceutically acceptable salt thereof.
The pharmaceutical composition according to claim 1, wherein 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid is a compound represented by Formula 1:

[Formula 1]
The pharmaceutical composition according to claim 1, wherein the hearing loss is conductive hearing loss or sensorineural hearing loss.
The pharmaceutical composition according to claim 1, wherein the hearing loss is any one selected from the group consisting of noise-induced hearing loss, age-related hearing loss, sudden hearing loss, acoustic neuropathy due to diabetes, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.
The pharmaceutical composition according to claim 1, wherein the tinnitus is any one selected from the group consisting of objective tinnitus, subjective tinnitus, peripheral tinnitus and central tinnitus.
2- [4- (4-chlorophenyl) -2-phenyl-1,3-thiazol-5-yl] acetic acid, or a food composition for the prevention or improvement of hearing loss or tinnitus containing a food acceptable salt thereof.
The food composition according to claim 6, wherein the hearing loss is conductive hearing loss or sensorineural hearing loss.
The food composition according to claim 6, wherein the hearing loss is any one selected from the group consisting of noise-induced hearing loss, age-related hearing loss, sudden hearing loss, diabetic acoustic neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.
The food composition according to claim 6, wherein the tinnitus is any one selected from the group consisting of objective tinnitus, subjective tinnitus, peripheral tinnitus and central tinnitus.
Administering 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid or a pharmaceutically acceptable salt thereof to a subject in need thereof, How to treat hearing loss or tinnitus.
11. The method of claim 10, wherein the hearing loss is conductive hearing loss or sensorineural hearing loss.
The method of claim 10, wherein the hearing loss is any one selected from the group consisting of noise-induced hearing loss, age-related hearing loss, sudden hearing loss, diabetic acoustic neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.
The method of claim 10, wherein the tinnitus is any one selected from the group consisting of objective tinnitus, subjective tinnitus, peripheral tinnitus, and central tinnitus.
Use of 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of hearing loss or tinnitus .
15. The use according to claim 14, wherein the hearing loss is conductive hearing loss or sensorineural hearing loss.
The use according to claim 14, wherein the hearing loss is any one selected from the group consisting of noise-induced hearing loss, age-related hearing loss, sudden hearing loss, diabetic acoustic neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.
The use according to claim 14, wherein the tinnitus is any one selected from the group consisting of objective tinnitus, subjective tinnitus, peripheral tinnitus, and central tinnitus.
A composition comprising 2-[4-(4-chlorophenyl)-2-phenyl-1,3-thiazol-5-yl]acetic acid or a pharmaceutically acceptable salt thereof for use in the prevention or treatment of hearing loss or tinnitus .
The composition according to claim 18, wherein the hearing loss is conductive hearing loss or sensorineural hearing loss.
The composition according to claim 18, wherein the hearing loss is any one selected from the group consisting of noise-induced hearing loss, age-related hearing loss, sudden hearing loss, diabetic acoustic neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.
The composition according to claim 18, wherein the tinnitus is any one selected from the group consisting of objective tinnitus, subjective tinnitus, peripheral tinnitus, and central tinnitus.