WO2023097236A1

WO2023097236A1 - Compositions and methods for generating immunoglobulin knock-in mice

Info

Publication number: WO2023097236A1
Application number: PCT/US2022/080360
Authority: WO
Inventors: Michel Nussenzweig; Amelia ESCOLANO
Original assignee: The Rockefeller University
Priority date: 2021-11-24
Filing date: 2022-11-22
Publication date: 2023-06-01

Abstract

Provided are compositions and methods that concurrently generate DNA insertions at two different genomic loci. The compositions and methods include a modified Adeno Associated Virus that contains two sequences configured for insertion into two separate mammalian chromosome loci. The method includes electroporation ribonucleoproteins that contain a Cas enzyme and guide RNAs that coordinate the insertion. The method provide for producing concurrent knock-in insertions that replace endogenous coding sequences, and can be used for producing antibodies.

Description

COMPOSITIONS AND METHODS FOR GENERATING IMMUNOGLOBULIN KNOCK-IN MICE

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. provisional patent application no. 63/282,784, filed November 24, 2021, the entire disclosure of which is incorporated herein by reference.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in .xml format and is hereby incorporated by reference in its entirety. Said .xml file is named “076091_00135_ST26.xml”, was created on November 21, 2022, and is 8,291 bytes in size.

RELATED INFORMATION

The use of animal models has been essential to biomedical research. Mice and nonhuman primates (NHPs) have been extensively used by the scientific community to address a variety of basic science questions as well as to design and evaluate preventative and therapeutic interventions against human disease. The use of mice and NHPs has been especially valuable for studies aiming to elucidate the mechanisms explaining the immune responses to infection, vaccination, autoimmunity or cancer.

However, none of the currently available animal models faithfully recapitulates the complexity and individualities of the human immune system. Significant differences exist between the antibody systems of mice, NHPs and humans. The mouse antibody system is characterized by shorter Ig genes, which results in antibodies with shorter heavy chain complementarity determining region 3 (CDR3)s. Moreover, mice have lower numbers of circulating B cells compared to humans, resulting in a much less diverse B cell repertoire available for antigen recognition. The Ig repertoire of NHPs has a greater homology with the human repertoire in terms of Ig gene diversity and length, bringing NHPs to the top of the list of preferred animal models to predict human antibody responses; however, the reduced availability of NHPs and the high maintenance costs significantly limit their use. New affordable animal models that closely reproduce the settings of a human immune response are highly desirable.

Humanized mice, designed to recapitulate different aspects of the human humoral and/or cellular immune response, arise as a good alternative to NHPs. In particular, human Ig knock-in mice (Ig KI mice) have been especially useful for vaccine development and drug discovery.

Current methods to produce Ig KI mice use the state-of-the-art CRISPR/Cas9 technology to genetically engineer mouse zygotes, however, these methods show important weaknesses, as they are inefficient, labor-intensive and require the special equipment and expertise to perform zygote microinjections. Moreover, reported methods involve two independent events of genetic modification to engineer the Ig heavy chain and light chain loci, therefore requiring long periods of subsequent mouse breeding to obtain the final Ig KI mouse. More efficient methodologies that simplify the production of Ig KI mice are needed. The present disclosure is pertinent to this need.

BRIEF SUMMARY

This disclosure provides compositions and methods that concurrently generate DNA insertions at two different genomic loci. The disclosure is illustrated by introducing coding sequences for heavy and light chains of antibodies at two different loci, but other protein coding sequences can be used. In one embodiment, the disclosure demonstrates producing Ig KI mice using mouse zygote electroporation instead of microinjection. Regarding the DNA templates for homology directed repair, previously reported methods used single stranded DNA (ssDNA) or plasmid DNA molecules, with ssDNA sequences usually providing higher repair efficiencies. Production of ssDNA templates is relatively easy and low cost; however, the resulting molecules show heterogeneous quality and length, which negatively impacts KI efficiency. In addition, in order to simultaneously KI the heavy chain and light chain Ig loci, two ssDNA molecules or two plasmids must be simultaneously provided to the mouse zygote. These approaches result in low efficiencies of double KI. In contrast, this disclosure provides a one-step strategy to generate Ig KI mice using Adeno Associated Virus (AAV) to provide DNA repair templates. The AAV genome is a linear ssDNA molecule, which is used as a repair template upon delivery into mouse zygotes and therefore induce high repair efficiencies. The AAV vector is designed to contain the desired heavy chain and light chain Ig genes (or other genes) and to induce Ig gene insertion in the corresponding mouse heavy chain and light chain loci, thus producing Ig KI mice in one step. Single guide RNAs that facilitate the simultaneous knock-in are provided and are electroporated into cells as a ribonucleoprotein (RNP) complex.

BRIEF DESCRIPTION OF FIGURES

Figure 1. Images showing transduction of fertilized mouse eggs with AAV6-GFP. Fertilized mouse eggs were incubated for 6 hours with an AAV carrying the Green Fluorescent Protein (GFP) gene at three increasing multiplicities of infection (MOIs) (Condition 1 < Condition 2 < Condition 3). Representative images show transduced mouse zygotes expressing GFP at 48 h after transduction.

Figure 2. Table showing the frequencies of live mouse embryos at different developmental stages upon transduction in the presence of different numbers of AAV6 Genomic Units (GCs). Figure 3. Diagram showing the design of the AAV6-lgH/lgL vector. Ab: antibody; HC; heavy chain VDJ; LC: Light chain VJ.

Figure 4. Genotyping of edited mouse zygotes. Representative image showing results of PCR amplifications using genomic DNA from individual edited zygotes. The zygotes were edited through transduction with a control AAV6 followed by administration of sgRNA/Cas9 complexes by microinjection (M) or electroporation (E). 4 of 16 zygotes edited via microinjection showed a PCR band corresponding to the insert, while 17 of 24 zygotes were positive for the insert in the case of electroporation. The results of the PCR were confirmed by sequencing of the purified PCR bands.

Figure 5. Flow cytometry plots showing RC1 -binding B cells from newly generated Ig KI mice. RC1 : HIV-1 Envelope-based protein; Ab: antibody; NHP: Non-human primate;

MUR: murine.

DETAILED DESCRIPTION

Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.

The disclosure includes all polynucleotide and amino acid sequences described herein. Each RNA sequence includes its DNA equivalent, and each DNA sequence includes its RNA equivalent. Complementary and anti-parallel polynucleotide sequences are included. Every DNA and RNA sequence encoding polypeptides disclosed herein is encompassed by this disclosure. Amino acids of all protein sequences and all polynucleotide sequences encoding them are also included, including but not limited to sequences included by way of sequence alignments. Sequences of from 80.00%-99.99% identical to any sequence (amino acids and nucleotide sequences) of this disclosure are included.

The disclosure includes all polynucleotide and all amino acid sequences that are identified herein by way of a database entry. Such sequences are incorporated herein as they exist in the database on the effective filing date of this application or patent.

The present disclosure provides compositions and methods for making modified mammalian cells, and modified mammals that comprise the modified cells. The modified cells can be modified by simultaneous insertion of two (or more) cargo coding sequences comprised by a single repair template. The cargo coding sequences are thus inserted into two different loci using one ssDNA repair template. In embodiments, the modified cells are non-human mammalian cells, although modification of human cells is not necessarily excluded by the disclosure. In embodiments, the modified cells are from and/or are present in any member of the order Rodentia including but not limited to mice, rats and rabbits. In embodiments, the modified mammals are Mus musculus, referred to herein in the singular as mouse and in the plural as mice.

In embodiments, the modified cells are embryonic stem cells. In embodiments, the disclosure includes modified blastocysts and modified embryos. In embodiments, the disclosure provides modified zygotes. In embodiments, the zygotes are allowed to divide into two cells which are implanted into pseudopregnant non-human mammals.

Modified non-human mammals made according to the described methods are included in the disclosure. Progeny produced by such modified mammals are also included. The disclosure includes protein products made by the modified mammals, wherein the protein products are encoded by inserted cargo sequences. The disclosure includes all cells that are used to make the modified mammals.

In embodiments, a single repair template is used to introduce a polynucleotide comprising a sequence encoding a first cargo, and a sequence encoding a second cargo. In embodiments, the first and second cargo are different from one another. In general, the repair template comprises a sufficient length such that the first and second cargo are encoded, and have sequences that are homologous with the sites of insertion. The repair template therefore comprises a set of two left and right homology arms for each cargo sequence, used for homologous recombination at each of the two separate loci One left and right homology arms flank a first cargo coding sequence. The second left and right homology arms flank a second cargo coding sequence. By flank it is meant that one homology arm is 5’ to a first coding sequence, and a second homology arm is 3’ to that coding sequence. The sequence of the homology arms are not particularly limited, provided they have a length that is adequate for homologous recombination to occur when nuclease-mediated cleavage of selected locations occurs. As used herein, “first” and “second” mean that there are two of the described components, but is not intended to specify importance or order. As discussed above, the type of cargo encoded is not particularly limited. The disclosure is illustrated by a first and second cargos that are a heavy chain and a light chain of an antibody, wherein the coding sequence for the heavy chain and the coding sequence for the light chain are introduced into two separate loci. A representative depiction of a construct used in embodiments of this disclosure showing homology arms flanking a sequence encoding an antibody heavy chain (“Ab HC”) and antibody light chain (“Ab LC”) is provided by Figure 3. Any suitable promoter that is operable in the cells into which the described construct can be included to drive expression of the first and second cargos. In embodiments, a first and second promoter is included to drive expression of the Ab HC and the Ab LC. The antibody, once produced by the modified mammal, may be of any isotype and thus can undergo class switching. In embodiments, the entire variable sequences of the heavy and light chain, or at least the CDRs of the heavy and light chain may be designed, or be obtained from naturally occurring B-cells, and may be from or derived from any species. In one embodiment, the heavy and light chain are human antibody sequences.

The repair template may include other components, such as one or more promoters, enhancers, secretion signals, intracellular trafficking signals, and the like. In embodiments, the cargo protein may be a peptide that can be translated and which may be, for example, from several to 50 amino acids in length, whereas longer sequences are considered proteins. In alternative embodiments, a cargo protein may encode a protein that comprises a cellular localization signal, or a secretion signal. In embodiments, cargo protein may comprise a transmembrane domain, and thus may be trafficked to, and anchored in a cell membrane, and may further comprise an extracellular domain. In embodiments, the cargo comprises a nuclear localization signal, and thus may be trafficked to and function in the nucleus. In embodiments, the cargo protein comprises one or more glycosylation sites. In embodiments, the cargo protein may comprise an enzyme; a structural protein; a signaling protein, a regulatory protein; or a storage protein. In embodiments, the cargo protein may comprise a peptide hormone. In embodiments, the cargo protein comprises a protein that is involved in a metabolic pathway. In embodiments, the cargo protein comprises a component of blood. In embodiments, the cargo protein is a therapeutic protein that is intended to treat any of a variety of disorders, including but not necessarily limited to cancer and autoimmune disorders. In embodiments, the cargo comprises a catalytically active RNA, or an RNA that can participate in an RNAi-mediated process.

The repair template and the Cas enzyme and guide RNA(s)) are inserted into mammalian cells, illustrated using mouse zygotes, without using microinjection. In one embodiment, and using an antibody as an example, by using a single stranded polynucleotide encoding a paired Ig heavy chain and light chain and an RNP comprising a Cas nuclease that is electroporated into cells, the disclosure provides for making the modified mammalian cells in a single step, e.g., the coding sequences for the heavy chain and light chain are inserted concurrently. In certain implementations, Ig heavy and light chain genes are inserted into the IgH and kappa-lgL loci, respectively, in cells of mouse zygotes. The genomic sequences of the IgH and kappa-lgL loci in the mouse genome are known in the art.

In embodiments, the expression vector that is used to introduce the repair template comprises a modified viral polynucleotide, such as from an adenovirus, but the disclosure does not necessarily exclude other types of vectors. In embodiments, a recombinant adeno- associated virus (rAAV) vector may be used. In embodiments, a helper virus may be used to produce rAAV particles. In certain embodiments, the expression vector is a self- complementary adeno-associated virus (scAAV). The disclosure includes any AAV serotype. In embodiments, AAV6 or AAV1 is used.

In embodiments, a mammalian genome as described herein may be modified using any designer nuclease. In embodiments, the nuclease is a RNA-guided CRISPR nuclease. A variety of suitable CRISPR nucleases (e.g., Cas nucleases) are known in the art. In specific and non-limiting embodiments, the Cas comprises a Cas9, such as Streptococcus pyogenes (SpCas9). Derivatives of Cas9 are known in the art and may also be used. Such derivatives may be, for example, smaller enzymes than Cas9, and/or have different proto adjacent motif (PAM) requirements. In a non-limiting embodiments, the Cas enzyme may be Cas12a, also known as Cpf 1 , or SpCas9-HF1 , or HypaCas9. In embodiments, any protein required to participate in the described process may be modified such that it includes a nuclear localization signal. In embodiments, a protein may be administered directly to the cells. For example, a Cas protein and the guide RNA(s) may be administered to the cells as ribonucleoproteins (RNPs) using any suitable technique. Alternatively, the Cas protein may be introduced into the cells separately from the guide RNAs. In one embodiment, the repair template also encodes guide RNAs.

In embodiments, for concurrent modification of two separate loci, the disclosure provides for use of four guide RNAs, two of which target a segment of a chromosome for insertion of the first cargo coding sequence, and the other two of which target a segment of the same or a different chromosome for insertion of the second cargo coding sequence. Representative and non-limiting examples of guide RNA sequences are used in the examples below.

With respect to producing modified mammals in which cells have been modified to produce antibodies, any antibody heavy and light can be encoded by the inserted DNA. In embodiments, the antibody binds with specificity to an antigen expressed by a pathogen, including but not limited to any virus, pathogenic bacteria, pathogenic fungi, or a parasite. In non-limiting embodiments, the antibody binds with specificity to a viral antigen, such as an HIV or SARS-CoV-2 antigen. In alternative embodiments, the antibody binds with specificity to a tumor antigen. In embodiments, the antibody comprises a bi-specific antibody.

In embodiments, the disclosure comprises promoting allelic exclusion by modifying a mammal as described herein, and selectively breeding mice that include the modified mice. In certain approaches, mice carrying IgHa and human kappa-lgL alleles (IgHa/IgKh mice) can be used. The heavy chain genes of the Ig KI mice will reside on an IgHb allele from the C57BL/6 or other suitable strain, and the light chain genes will have a mouse kappa constant region (IgKm). When crossing the Ig KI mice (IgHb/IgKm) with IgHa/IgKh mice, expression of the KI genes from the IgHb and IgKm alleles in the Ig KI mouse should allelically exclude the IgHa and IgKh alleles; consequently, most B cells in the Ig KI mice should express IgM and IgK. While the disclosure is illustrated using KI mice that produce antibodies, it is expected that the approach can be adapted to simultaneously engineer any two mouse or other mammalian genomic loci, thus, facilitating the production of modified mammals that do not require more than one engineering event to modify two separate loci.

In an aspect the disclosure provides for immunizing mice using an antigen that is immunogenic with respect to the Ig that the mice have been modified to produce. In one approach, the immunization comprises sequential immunization with the antigen, such as by using sequential immunization with a vaccine that comprises the antigen. The disclosure includes isolating antibodies or other proteins expressed from the insertions from the mice, compositions comprising the antibodies or other said proteins, and using the antibodies or other said proteins for prophylactic and therapeutic approaches.

The following Examples are intended to illustrate but not limit the disclosure. The Examples support at least the following embodiments of the disclosure: Conditions for AAV transduction of mouse zygotes ex vivo; 2)The ability of AAV vectors to provide DNA repair templates in mouse zygotes; 3) AAV-based repair template which simultaneously knocks in Ig V(D)J genes in the mouse IgH and kappa-lgL loci; and 4) conditions for electroporation of ribonucleoproteins into mouse zygotes.

EXAMPLE 1

This Example includes a non-limiting description of making modified mouse zygotes and mice according to the invention, whereby modified mice produce heavy and light chains of antibodies. Suitable variations of specific described parameters will be apparent to those skilled in the art when given the benefit of the present disclosure.

1- Embryo harvesting

Obtain fertilized mouse oocytes. Methods for obtaining fertilized mouse oocytes are known in the art and can be adapted for use with the described methods. Two specific and non-limiting approaches for embryo harvesting include the following:

• Natural fertilization through mating: For this procedure, superovulation is induced in 3-4-week-old (sexually immature) female mice via intraperitoneal (i.p.) injection with Pregnant Mare Serum Gonadotropin (PMSG) (5IU/0.1 ml per female) two days prior to mating, and with Human Chorionic Gonadotropin (HCG) (5IU/0.1 ml per female) on the day of mating. Promptly after HCG injection, females are mated with the appropriate stud male for fertilization. Ovulation occurs approximately 12 hours after HCG injection, at which time fertilized oocytes will be collected. To collect fertilized oocytes, females with a visible copulating plug are euthanized by cervical dislocation. The abdomen cavity is opened, the oviducts are dissected and the oocytes are flushed from the dissected tissue. Females are sacrificed by cervical dislocation because the presence of drugs in the blood, or blood acidification may lower the quality of the embryos, and negatively impact the subsequent embryo implantation.

• In vitro fertilization (IVF): Alternatively, IVF can be used to obtain fertilized mouse oocytes. Superovulated females (as explained above) are sacrificed by cervical dislocation. Female mice are used to obtain oocytes from the oviducts after euthanasia as explained above. Oocytes are kept in KSOM culture medium until the time of contact with mouse sperm. To obtain mouse sperm, a male mouse is sacrificed by cervical dislocation. The presence of drugs in the blood or blood acidification can lower the quality of the sperm for IVF. The cauda epididymides is removed avoiding fat, blood and tissue fluid. The duct is excised and the surface of the cauda is pressed to release the sperm in a plate containing KSOM culture medium. The sperm suspension is then incubated for 60 minutes at 37°C and 5% CO2 to allow recovery before IVF. For IVF, 10pL of the most motile sperm is added on top of the oocytes. After 3 hours at 37°C/5% CO2, oocytes are washed 3 times with modified human tubal fluid (mHTF) and cultured over night at 37°C/5% CO2. - Selection of fertilized eggs: After IVF, mouse oocytes are screened under a stereoscope to identify fertilized mouse eggs. Fertilized mouse eggs will have an evident pronucleous. - Transduction of fertilized mouse oocytes with Adeno Associated Viruses (AAVs) carrying Ig genes as DNA templates for homology directed repair (HDR) Fertilized mouse oocytes (embryos) are washed using M2 medium or other suitable media. Embryos (such as 15-25 embryos) are then incubated in a droplet of KSOM media (20 pl)*³ containing ~2x10^A9*⁵ Genomic Units (GCs) of an AAV carrying the described DNA template for HDR. Embryos are incubated for 6 h at 37°C. Any batch of AAV may be titrated to determine a suitable amount to use in order to control for embryo mortality due to AAV-related toxicity. - Preparation of Cas9/single guide (sg) RNA complexes: Cas9/sgRNA complexes are prepared at 1 :1 .5 Cas9: sgRNA molar ratio for a final concentration of complex of 8 pM. This concentration is related to the Examples below. Modifications can be made based on the particular components. In embodiments, the selected molar ratio is maintained regardless of the number of sgRNAs used in the mix. For example, if four sgRNAs are used, the mix can include lower amounts of each sgRNA compared to a mix only requiring 2 sgRNAs in order to maintain the 8 pM concentration. Cas9 and sgRNAs are mixed in a final volume of 1 Opl (but lower or higher volumes can be used without affecting the outcome) using the following representative buffers: 20 mM HEPES pH 7.5 (SIGMA, H3375), 150 mM KCI (SIGMA, P9333), 1 mM MgCI₂ (SIGMA, M8266) and 10% glycerol (THERMO FISHER, BP229). Other suitable buffers that are compatible with Cas9 function are known and may be substituted.

The Cas9/sgRNA mix is incubated for 10 min at 37°C before using in embryos.

5- Preparation of mouse embryos for electroporation: Embryos are transferred and washed in OptiMEM or other suitable medium. The 10 pl of Cas9/sgRNA complexes are mixed with 10pl of OptiMEM and added to the electroporation plate of an electroporator suitable for embryo electroporation. Suitable electroporation devices are commercially available and may be adapted for use with the described methods. Representative electroporation devices are sold by BEX Co. LTD. In one approach, at least one embryo is added to the medium on a suitable electroporation plate. The number of embryos used can be determined by those skilled in the art using known parameters, such as the length of the electroporation plate. In one embodiment, twenty embryos are added to the medium on the electroporation plate and electroporated using the following parameters.

Representative and non-limiting electroporation conditions are as follows: Pd V: 25V Pd A: 300mA Pd on: 3.00 ms Pd off: 97.0 ms Pd N: 3 Decay: 0% Decay Type: Log

6- Embryo recovery: Embryos are recovered in the same droplet of KSOM medium containing AAVs and are incubated overnight at 37°C. Embryos are transferred to a new droplet of KSOM without AAVs next day in the morning.

7- Embryo implantation in pseudopregnant females: Mouse embryos are implanted in the oviduct of pseudopregnant CD1 females or other suitable mouse strains at 0.5 dpc and for allowing complete gestation for 19-21 days.

Various modifications of the described process can be made. For example, with respect to electroporation, the disclosure includes the following ranges, which include the upper and lower values, and all numbers there between to the third decimal point or unit equivalent thereof: Pd V: 1-120V Pd A: 1-60A

Pd on: 100ns-10ms

Pd off: 50ms-30sec

AAV design

In order to produce Ig KI mice, an AAV6 or another suitable AAV vector is used. AAV6 used in this disclosure is designed to induce integration of the heavy chain (H) and light chain (L) Ig genes of an antibody in the corresponding mouse I g H and kappa-lgL genomic loci, as described above. The KI strategy facilitates deletion of the mouse J genes of the I g H and kappa-lgL loci, thus preventing rearrangements of endogenous mouse Ig genes. The disclosure provides identification of Cas9 target sites flanking the J genes of the mouse IgH and kappa-lgL loci, and designed sgRNAs to induce double stranded (ds) DNA breaks at those locations. The sgRNA sequences comprise the targeting sequences which target the mouse loci, as shown in Table A:

Guide RNA AE_Guide_8 and AE_Guide_7 are used to knock-in VDJ genes in the mouse H locus, and guides AE_Guide_3 and AE_Guide_4 to knock-in VJ genes in the mouse kappa IgL locus.

The targeting sequences used above are provided in the context of longer sgRNAs. The sgRNAs used in the Examples comprise the following sequences:

AE_Guide_7: GGAGCCGGCUGAGAGAAGUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:5)

AE_Guide_8: UCUCUACUUCCUCAUAGCUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:6)

AE_Guide_3:

CUGUGGUGGACGUUCGGUGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:7) AE_Guide_4: AAGACACAGGUUUUCAUGUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:8)

The guide RNAs may comprise modified nucleotides. In embodiments, the bold nucleotides are methylated.

The described AAV vector comprising the construct as depicted in Figure 3 is referred to as AAV6- IgH/lgL, and carries homology arms with the flanking regions of the cut sites, and the homology arms flank a promoter, a leader sequence and the pre-rearranged V(D)J Ig genes of an antibody of interest. Upon Cas9-mediated cut at the mouse IgH and kappa-lgL loci, the deleted genomic region is repaired by homology directed repair (HDR) using the AAV6- IgH/lgL construct as a template, thus inserting the desired Ig genes.

EXAMPLE 2

Mouse zygotes were harvested from superovulated females showing a copulating plug. In order to confirm zygote transduction by AAV6, AAV6 carrying the Green Fluorescent Protein (GFP) gene was used. Mouse zygotes, and Ramos B cells as controls, were incubated for 6 hours (h) in droplets of medium containing 4 different quantities of AAV6 Genomic Units (GCs) (None, Condition 1:1.96x10®, Condition 2: 9.8x10® and Condition 3: 1.96x10¹⁰), and were observed under a fluorescence microscope every day until blastocyst development. The results confirm that AAV6 can transduce mouse zygotes. A higher intensity of fluorescence was observed when using higher numbers of AAV GCs, while the frequency of infected zygotes remained comparable for the three conditions (Fig. 1). All fertilized eggs were transduced under the three AAV conditions, while no GFP expression was detectable in non-fertilized eggs (Fig. 1). We observed a few embryos which did not progress to the blastocyst stage and were arrested at the 2-cell or 4-cell stages of development, suggesting that AAV transduction may affect embryo development. Based on these observations we selected AAV6 for further experiments.

EXAMPLE 3

Using AAV6, we improved the transduction protocol to achieve higher transduction efficiencies while not affecting blastocyst development. To do this, we transduced mouse zygotes at three different multiplicities of infection (MOIs) and using two different times of incubation with the AAV: 6 h and overnight (Fig. 2). We observed that higher MOIs induced higher mortality rates and/or developmental arrest. Based on these results, we selected a dose of 2x10⁹ AAV GCs and a transduction time of 6 h, which resulted in 40-50% of viable blastocysts.

EXAMPLE 4

This Example describes a protocol to screen for Ig gene insertion in individual mouse blastocysts by PCR. This protocol involves the lysis of individual blastocysts with a lysis buffer containing yeast tRNA, an effective coprecipitant to aid in the recovery of small amounts of nucleic acids. The results show that AAV6 is able to introduce DNA repair templates into mouse zygotes. We detected Ig gene insertion in the mouse IgH loci of 4 out of 16 analyzed blastocysts.

EXAMPLE 5

This Example provides an example of an AAV6- IgH/lgL vector designed to knock in macaque Ig genes at the selected genomic sites. AAV6- IgH/lgL contains homology arms with the flanking regions of the cut sites, and the homology arms flank a promoter, a leader sequence and the pre-rearranged V(D)J macaque genes (illustrated in Figure 3). Upon Cas9-mediated cut at the mouse IgH and kappa-lgL loci, the deleted genomic region is repaired by homology directed repair using the AAV6- IgH/lgL construct as a template, thus inserting the macaque Ig genes. The disclosure includes cloning the AAV6- IgH/lgL construct and producing the AAV6 particles. Using AAV6- IgH/lgL and the most efficient and/or less toxic combination of sgRNAs provided with Cas9 by microinjection, the disclosure includes engineering mouse zygotes, allowing them develop in vitro, and assessing the KI efficiency by PCR. The designed protocol can be used to engineer mouse zygotes and evaluate their ability to develop to embryos in vivo. This can be achieved by engineering mouse zygotes and allowing them develop to 2-cell stage in vitro. 2-cell stage embryos are implanted into pseudopregnant females for gestation. Genotyping the mouse pups determines the KI efficiency. In this regard, we identified a combination of sgRNAs which efficiently induces cuts at the desired sites of the mouse IgH and kappa-lgL loci; the sgRNAs are described above. We have cloned an AAV6- IgH/lgL construct and produced AAV6- IgH/lgL particles. The disclosure provides a method that yields AAV6 preparations with titers of ~ 1x10¹²-1x10¹³ GC/ml, a titer that is sufficient for the described purposes.

EXAMPLE 6

To evaluate the use of electroporation to provide Cas9/sgRNA complexes into mouse zygotes and induce genetic modifications, the disclosure includes combining the technique described above with the use of 3 alternative types of DNA repair templates: AAV6, ssDNA and plasmid. This includes incubating mouse zygotes with the AAV6 for 6h, and subsequent electroporation with the Cas9/sgRNA complexes using pulsing predetermined parameters. For the electroporation, Cas9/sgRNA complexes are prepared in a HEPES-based buffer containing various salts and sugars to modulate conductivity and osmolality and support zygote viability. After electroporation, the embryos develop to blastocysts in vitro. The effect of the procedure in viability and embryo development as well as the KI efficiency is evaluated by PCR in individual blastocysts. The results of these experiments are compared to controls using microinjection. ssDNA or plasmid as repair templates, are incorporated into the solution containing the Cas9/sgRNA complexes, and are used with electroporation. The concentrations of ssDNA and plasmid are titrated to obtain high zygote viability and KI efficiencies. The AAV6 template described above is used with electroporation of Cas9/sgRNA complexes, the KI efficiency in blastocysts in vitro is determined and compared to the efficiencies obtained using microinjection. These electroporation-based approaches are evaluated in vivo by implanting engineered embryos at 2-cell stage of development in pseudopregnant females. Viability and KI efficiency is assessed. Using AAV6-based delivery of repair templates and zygote microinjection or electroporation indicates that electroporation results in higher KI efficiencies (Fig. 4). The disclosure thus provides improved methods, relative to use of non-AAV delivery of repair templates and microinjection techniques.

EXAMPLE 7

The disclosure includes the generation of Ig KI mice carrying anti HIV-1 antibodies isolated from vaccinated rhesus macaques and wild type mice (Figure 5). Three of these mice express antibodies isolated from rhesus macaques immunized with an HIV-1 envelope (Env)-based immunogen, RC1 (Escolano et al., Nature, 2019) (Ab_NHp874, Ab_NHp1004 and AbNHp996), and the other two mice express antibodies isolated from RC1 -immunized wild type mice (AbwuR275 and AbwuR289) (Escolano et al., Nature, 2019, and in preparation). The data indicate that 5 of the 5 new Ig KI mice have B cells that specifically recognize their specific antigen, RC1 (Figure 5).

The foregoing results indicate that the described technology using mouse embryo electroporation and AAV-based templates for homology directed repair is highly efficient at editing two independent genomic loci simultaneously, demonstrated by the immunoglobulin heavy chain and light chain loci. Moreover, these results confirm that the AAV template carrying antibody genes are functional and that the selected single guide RNA sequences are efficient at inducing targeted DNA breaks at the desired genomic sites.

Claims

What is claimed is:

1. A method for concurrent modification of a first and second locus a genome of mammalian cells, the method comprising introducing into the cells an Adeno Associated Virus (AAV) comprising a single stranded (ss) DNA repair template sequence, wherein the ssDNA repair template comprises a set of two left and right homology arms for homologous recombination at each of the first and second locus, and wherein one of left and right homology arms flank a first cargo coding sequence, and the second left and right homology arms flank a second cargo coding sequence, the method further comprising electroporation into the cells ribonucleoproteins (RNPs) comprising a Cas nuclease and a combination of guide RNAs, wherein the Cas nuclease and the combination of guide RNAs participate in homologous recombination at the two different loci such that the first and second cargo coding sequences are inserted into the genome at the two different loci.

2. The method of claim 1, wherein the first cargo sequence encodes an antibody heavy chain and the second cargo sequence encodes an antibody light chain.

3. The method of claim 2, wherein the mammalian cells are mouse cells.

4. The method of claim 3, wherein the mouse cells are present in a mouse zygote.

5. The method of claim 4, wherein insertion of the first and second cargo coding sequences deletes mouse J genes of mouse IgH and kappa-lgL loci.

6. The method of claim 5, wherein the insertion of the first cargo coding sequence comprises VDJ genes and the second cargo coding sequence comprises VJ genes.

7. The method of any one of claims 1-6, wherein the Cas nuclease is a Cas9 nuclease.

8. The method of claim 7, wherein the combination of guide RNAs comprises: i) a first guide RNA comprising the sequence UCUCUACUUCCUCAUAGCUC (SEQ ID NO:1); ii) a second guide RNA comprising the sequence GGAGCCGGCUGAGAGAAGUU (SEQ ID NO:2); wherein the guide RNAs comprising SEQ ID NO:1 and SEQ ID NO:2 are used to knock-in the VDJ genes in the mouse IgH locus; iii) a third guide RNA comprising the sequence CUGUGGUGGACGUUCGGUGG (SEQ ID NO:3); and iv) a fourth guide RNA comprising the sequence AAGACACAGGUUUUCAUGUU (SEQ ID NO:4); wherein the guide RNAs comprising SEQ ID NO:3 and SEQ ID NO:4 are used to knock-in the VJ genes in the mouse kappa I g L locus.

9. A modified mouse produced using the method of claim 7.

10. Antibodies produced by a mouse of claim 9.

11. An expression vector encoding a guide RNA comprising encoding a sequence selected from UCUCUACUUCCUCAUAGCUC (SEQ ID NO:1);

GGAGCCGGCUGAGAGAAGUU (SEQ ID NO:2); UGGUGGACGUUCGGUGG (SEQ ID NO:3); or AAGACACAGGUUUUCAUGUU (SEQ ID NO:4).

12. A ribonucleoprotein comprising a Cas enzyme and a guide RNA comprising a sequence selected from the group of sequences comprising:

UCUCUACUUCCUCAUAGCUC (SEQ ID NO:1); GGAGCCGGCUGAGAGAAGUU (SEQ ID NO:2); UGGUGGACGUUCGGUGG (SEQ ID NO:3); or AAGACACAGGUUUUCAUGUU (SEQ ID NO:4).

13. The ribonucleoprotein of claim 12, wherein the Cas enzyme is a Cas9 enzyme.

14. The ribonucleoprotein of claim 13, wherein said ribonucleoprotein is present in a mammalian cell.

15. The ribonucleoprotein of claim 14, wherein the mammalian cells is present in a mouse zygote.