WO2023097226A2 - Double-stranded dna deaminases - Google Patents

Double-stranded dna deaminases Download PDF

Info

Publication number
WO2023097226A2
WO2023097226A2 PCT/US2022/080345 US2022080345W WO2023097226A2 WO 2023097226 A2 WO2023097226 A2 WO 2023097226A2 US 2022080345 W US2022080345 W US 2022080345W WO 2023097226 A2 WO2023097226 A2 WO 2023097226A2
Authority
WO
WIPO (PCT)
Prior art keywords
double
stranded dna
seq
deaminase
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/080345
Other languages
English (en)
French (fr)
Other versions
WO2023097226A3 (en
Inventor
Romualdas Vaisvila
Sean R. JOHNSON
Zhiyi Sun
Thomas C. Evans
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New England Biolabs Inc
Original Assignee
New England Biolabs Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New England Biolabs Inc filed Critical New England Biolabs Inc
Priority to CA3236352A priority Critical patent/CA3236352A1/en
Priority to CN202280089704.3A priority patent/CN118574929A/zh
Priority to AU2022396419A priority patent/AU2022396419A1/en
Priority to EP22843953.5A priority patent/EP4437093A2/en
Priority to KR1020247020503A priority patent/KR20240107347A/ko
Priority to JP2024531071A priority patent/JP2024543137A/ja
Publication of WO2023097226A2 publication Critical patent/WO2023097226A2/en
Publication of WO2023097226A3 publication Critical patent/WO2023097226A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04001Cytosine deaminase (3.5.4.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04005Cytidine deaminase (3.5.4.5)

Definitions

  • cytosine in the genome can be covalently modified to, for example, 5- methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC).
  • 5mC 5- methylcytosine
  • 5hmC 5-hydroxymethylcytosine
  • DNA may be deaminated chemically (using, e.g., bisulfite; see Frommer et al PNAS 199289: 1827-1831) or enzymatically using a DNA deaminase (e.g., APOBEC3A, see, e.g., Sun et al, Genome Res. 2021 31: 291-300 and Vaisvila et al Genome Res. 202131: 1280-1289).
  • APOBEC3A DNA deaminase
  • both of these approaches require a single-stranded substrate.
  • current workflows for analyzing modified cytosines typically involve a denaturation step. It would be desirable to eliminate the denaturation step from current workflow.
  • the present disclosure relates, in some embodiments, to deaminases having one or more desirable properties including, for example, cytosine deaminases that are active on double-stranded DNA substrates.
  • cytosine deaminases that are active on double-stranded DNA substrates.
  • These enzymes may deaminate cytosines in a double-stranded DNA substrate (e.g., without denaturing the DNA).
  • Double-stranded DNA deaminases may deaminate cytosines in single- stranded DNA, in addition to deaminating cytosines in double-stranded DNA.
  • Double-stranded DNA deaminase compositions may comprise a deaminase and, optionally, a buffer, one or more enzymes that alter the deamination susceptibility of one or more modified cytosines (e.g., a TET methylcytosine dioxygenase and/or a DNA beta-glucosyltransferase).
  • modified cytosines e.g., a TET methylcytosine dioxygenase and/or a DNA beta-glucosyltransferase.
  • deaminating a double-stranded DNA may comprise contacting the double-stranded DNA substrate and a double-stranded DNA deaminase to deaminate cytosines in the double-stranded substrate, for example, without denaturing the substrate or otherwise using any agents that unwind or otherwise separate the strands of the substrate (e.g., a gyrase or a helicase), to produce deamination products.
  • a double-stranded DNA may comprise contacting the double-stranded DNA substrate and a double-stranded DNA deaminase to deaminate cytosines in the double-stranded substrate, for example, without denaturing the substrate or otherwise using any agents that unwind or otherwise separate the strands of the substrate (e.g., a gyrase or a helicase), to produce deamination products.
  • methods may include sequencing at least one strand of the product of a deamination reaction (which is a deaminated double-stranded DNA molecule referred to herein as a "deamination product") to produce sequence reads.
  • a method may include amplifying a deamination product to produce an amplification product and then sequencing the amplification product to produce sequence reads.
  • Disclosed cytosine deaminases may deaminate cytosines without deaminating modified cytosines (e.g., 5mC, 5hmC, 5fC, 5caC, 5ghmC, N4mC) also present in a DNA substrate or may both deaminate cytosines and deaminate one or more modified cytosines in a substrate. Accordingly, the positions of modified cytosines (e.g., 5mC or 5hmC) in a double-stranded DNA substrate can be identified by analysis of sequence reads.
  • modified cytosines e.g., 5mC or 5hmC
  • Some of the double- stranded DNA deaminases do not deaminate N4mC, but can deaminate other modified cytosines, others do not deaminate 5mC, and 5hmC, others do not deaminate 5hmC but can deaminate 5mC, others do not deaminate 5ghmC but can deaminate 5mC and/or 5hmC, and others that do not deaminate 5fC and 5caC but can deaminate 5mC and 5hmC.
  • the positions of one or more modified cytosines may be determined in a double-stranded substrate by contacting the substrate with a deaminase having a selected specificity and, optionally, pre-treating the substrate with one or more enzymes that alter the deamination susceptibility of one or more modified cytosines.
  • a method may include pre- treating the double-stranded DNA substrate with: (a) a TET methylcytosine dioxygenase and DNA beta- glucosyltransferase or (b) a TET methylcytosine dioxygenase but not DNA beta-glucosyltransferase.
  • a method may include contacting a double-stranded DNA deaminase with a double-stranded nucleic acid not contacted (previously or concurrently) with a TET methylcytosine dioxygenase or a DNA beta-glucosyltransferase, for example, where the double-stranded DNA deaminase does not deaminate 5mC and/ or 5hmC.
  • the double-stranded DNA substrate may comprise at least one N4mC or pyrrolo-dC.
  • N4mC is found in prokaryotes and archaea.
  • a double- stranded DNA substrate may be prokaryotic or archaeal.
  • a double-stranded DNA substrate may be made by ligating a hairpin adapter to a double-stranded fragment of DNA to produce a ligation product, enzymatically generating a free 3' end in a double-stranded region of the hairpin adapter in the ligation product, and extending the free 3' end in a dCTP-free reaction mix that comprises a strand-displacing or nick-translating polymerase, dGTP, dATP, dTTP and modified dCTP.
  • the modified dCTP is incorporated into the new strand, to produce a double-stranded nucleic acid that has modified Cs.
  • Enzymes and kits for performing the method are also provided including, for example, a double- stranded DNA deaminase and a reaction buffer.
  • FIGURE 1 shows the topology of a maximum likelihood phylogenetic tree of cytosine deaminases surrounded by illustrative activity data arranged in concentric rings, with each phylogenetic tree terminus, enzyme name, and set of activity results aligned along a radial axis.
  • the enzymatic activity results for various substrates shown in these rings were measured by an in vitro screening assay with an Illumina short-read sequencing-based detection method (Example 3). Total area of the circles corresponds to total activity and the relative sizes of colored sectors show relative activity on the indicated substrates.
  • the inner-most ring shows relative deamination activity on unmodified cytosines in double-stranded DNA (blue sectors) compared to single-stranded DNA (red sectors).
  • FIGURES 2A-C show enzymatic activity for cytosine deaminases assayed in accordance with the screening method of Example 3. Activities are expressed as deaminated fraction of total cytosines in the sample.
  • FIGURE 2A shows activity results for example deaminases on double stranded DNA vs. single stranded DNA.
  • FIGURE 2B shows activity results for example deaminases on unmodified cytosine in the CG context vs the CH (combination of CA, CC, and CT) context.
  • FIGURE 2C shows activity results for example deaminases on cytosine vs. 5-methylcytosine in all sequence contexts.
  • FIGURES 3A-3D shows example workflows for identifying the positions of modified cytosines in a DNA.
  • FIGURE 3A shows an example workflow of APOBEC3A deamination of ssDNA while FIGURES 3B, 3C, and 3D show example workflows in which APOBEC3Ais substituted by a cytosine deaminase that deaminates dsDNA.
  • FIGURE 3B shows an example single pot workflow in which use of a dsDNA deaminase that is active on ssDNA and dsDNA eliminates a DNA denaturation step.
  • FIGURE 3C shows an example workflow in which the substrate is contacted with a deaminase that does not deaminate 5fC or 5caC without requiring or including pre-treatment with BGT.
  • FIGURE 3D shows an example methylome analysis workflow in which the substrate is contacted with a single enzyme - a dsDNA deaminase.
  • FIGURES 4A-4C show example results of a workflow to detect 5mC and 5hmC that, like FIGURE 3C, does not require or include a BGT glycosyltransferase pretreatment and the dsDNA deaminase used, CseDa01, does not deaminate 5caC and 5fC.
  • FIGURE 4A shows that CseDa01 DNA deaminase efficiently deaminates cytosine C, 5mC, 5hmC and 5ghmC in both single-stranded and double-stranded substrates.
  • FIGURE 4B shows that CseDa01 DNA deaminase exhibits no sequence bias and the deamination efficiencies were greater than 95% for both the CpG and CpH contexts in E.coli genome for both ssDNA and dsDNA substrates.
  • FIGURE 4C shows that CseDa01 DNA deaminase does not deaminate 5caC and 5fC and may be useful to detect 5mC and 5hmC without a BGT glucosylation step.
  • FIGURES 5A-5B show example results of using CseDa01 and TET2 to perform single tube oxidation of 5mC.
  • the X-axis labels show serial dilutions of the deaminase, with 1x being the most concentrated enzyme, and 32x being a dilution by a factor of 32 compared to 1x.
  • FIGURE 5A shows results illustrating efficient deamination of a single-stranded substrate.
  • FIGURE 5B shows results illustrating efficient deamination of a double-stranded substrate.
  • FIGURES 6A-6B show example results of using MGYPDa20, a modification-sensitive deaminase to efficiently deaminate cytosines to uracil. However, it does not deaminate 5-methylcytosine and 5- hydroxymethylcytosine in dsDNA and ssDNA. This deaminase may be used to detect 5mC and 5hmC without the protection of these modified bases.
  • FIGURE 6A shows that MGYPDa20 DNA deaminase efficiently deaminates cytosine C but not 5mC, 5hmC or 5ghmC.
  • FIGURES 7A-7B show example results of using another modification-sensitive dsDNA deaminase, NsDa01, which may be used to detect 5mC and 5hmC without the protection of modified bases.
  • FIGURE 7A shows that NsDa01 DNA deaminase efficiently deaminates cytosine C but not 5mC, 5hmC or 5ghmC.
  • FIGURES 8A-8B show example results of using a CpG-specific modification-sensitive dsDNA deaminase, RhDa01, which may be used to detect 5mC and 5hmC in the CpG context with or without the protection of modified bases.
  • FIGURE 8A shows that RhDa01 DNA deaminase efficiently deaminates cytosine C in CpG context but not 5mC, 5hmC or 5ghmC.
  • FIGURES 9A-B shows example results of using a CpG-specific modification-sensitive dsDNA deaminase, MmgDa02, which may be used to detect 5mC and 5hmC in the CpG context with or without the protection of modified bases.
  • FIGURE 9A shows that MmgDa02 DNA deaminase efficiently deaminates cytosine C in CpG context but not 5mC, 5hmC or 5ghmC.
  • FIGURE 10 shows example results of using a one-tube-one-enzyme EM-seq method to map 5mC in human using a modification-sensitive dsDNA deaminase, MGYPDa20. It shows that 5mC and 5hmC in the human GM12878 genome may be correctly detected using a modification-sensitive DNA deaminase MGYPDa20. Two types of adapters were used in these experiments, - all Cs were replaced by 5mC or Pyrrolo-dC. In both cases the overall methylation level in the human GM 12878 genome was identified correctly.
  • FIGURE 11 shows example results of using sequence logos of not deaminated sites by the CseDa01 deaminase from the N4mC-containing substrates of different genomes with different methyltransferase sequence specificities, namely Paenibacillus species J DR-2 (CCGG target sequence) and Salmonella enterica FDAARGOS_312 (CACCGT target sequence).
  • Eukaryotic deaminase family of AP0BEC3A deaminates N4mC, but bacterial deaminases do not, therefore, the newly characterized bacterial deaminases may be used to detect N4mC modifications.
  • FIGURE 11A shows that the detected N4mC motif matches the expected CCGG methyltransferase motif in Paenibacillus species JDR-2.
  • FIGURE 11B shows that the detected N4mC motif matches CACCGT from Salmonella enterica FDAARGOS_312.
  • the present disclosure provides double-stranded DNA deaminases, variants, ancestors, fusions, compositions, systems, apparatus, methods, and workflows for deaminating double-stranded DNA (in duplex form, without denaturation).
  • Applications of these deaminases include, for example, EM-seq, methyl-SNP-seq, and N4mC detection, among others.
  • Sources of commonly understood terms and symbols may include: standard treatises and texts such as Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Singleton, et al., Dictionary of Microbiology and Molecular biology, 2d ed., John Wiley and Sons, New York (1994), and Hale & Markham, the Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) and the like.
  • a protein refers to one or more proteins, i.e., a single protein and multiple proteins.
  • Optional elements may be expressly excluded where exclusive terminology is used, such as “solely,” “only”, in connection with the recitation of the optional elements or when a negative limitation is specified.
  • Numeric ranges are inclusive of the numbers defining the range. All numbers should be understood to encompass the midpoint of the integer above and below the integer i.e., the number 2 encompasses 1.5-2.5. The number 2.5 encompasses 2.45-2.55 etc. When sample numerical values are provided, each alone may represent an intermediate value in a range of values and together may represent the extremes of a range unless specified.
  • buffer and “buffering agent” refer to a chemical entity or composition that itself resists and, when present in a solution, allows such solution to resist changes in pH when such solution is contacted with a chemical entity or composition having a higher or lower pH (e.g., an acid or alkali).
  • suitable non-naturally occurring buffering agents include HEPES, MES, MOPS, TAPS, tricine, and Tris.
  • buffering agents include ACES, ADA, BES, Bicine, CAPS, carbonic acid/bicarbonic acid, CHES, citric acid, DIPSO, EPPS, histidine, MOPSO, phosphoric acid, PIPES, POPSO, TAPS, TAPSO, and triethanolamine.
  • deaminase substrate refers to a polynucleotide (e.g., a DNA) molecule that optionally may be exclusively double-stranded, partially double-stranded and partially single-stranded, or exclusively single-stranded.
  • a deaminase substrate may comprise one or more cytosines, one or more modified cytosines, one or more adenines, one or more modified adenines, or combinations thereof.
  • a DNA substrate may comprise one or more adapters.
  • double-stranded DNA deaminase refers to a hydrolyase that deaminates cytosines in double-stranded DNA to uracils and/or deaminates adenines in double-stranded DNA to hypoxanthines.
  • a double-stranded DNA deaminase may deaminate cytosines and/or adenines in double-stranded DNA as well as or better than it deaminates cytosines and/or adenines, respectively, in single-stranded DNA.
  • a double-stranded DNA deaminase may deaminate cytosines double-stranded DNA, but not deaminate cytosines in single-stranded DNA.
  • a double-stranded DNA may be modification sensitive.
  • a double-stranded DNA deaminase may deaminate an unmodified cytosine or adenine in double-stranded DNA, but not deaminate one or more corresponding modified cytosines or adenines.
  • duplex and double stranded refer to any conformation of a polynucleotide in which two polynucleotide strands (e.g., separate molecules or spatially separated portions of a single molecule) are arranged anti parallel to one another in a helix with complementary bases of each strand paired with one another (e.g., in Watson-Crick base pairs). Paired bases may be stacked relative to one another to permit pi electrons of the bases to be shared.
  • Duplex stability in part, may be related to the ratio of complementary bases to mismatches (if any) in the two strands, ratio of pairs with three hydrogen bonds (e.g., G:C) to pairs with two hydrogen bonds (e.g., A:T, A:U) in the duplex, and the length of the strands with higher ratios and longer strands generally associated with higher stability.
  • Duplex stability in part, may be related to ambient conditions including, for example, temperature, pH, salinity, and/or the presence, concentration and identity of any buffer(s), denaturant(s) (e.g., formamide), crowding agent(s) (e.g., PEG), detergent(s) (e.g., SDS), surfactant(s), polysaccharide(s) (e.g., dextran sulfate), chelator(s) (e.g., EDTA), and nucleic acid(s) (e.g., salmon sperm DNA).
  • a duplex polynucleotide may comprise one or more unpaired bases including, for example, a mismatched base, a hairpin loop, a single-stranded (5' and/or 3') end.
  • Duplex polynucleotides may have any desired length.
  • a duplex polynucleotide may have a length of ⁇ 50 nucleotides, 10-200 nucleotides, 80-400 nucleotides, 50-500 nucleotides, ⁇ 500 nucleotides, ⁇ 1 kb, ⁇ 2 kb, ⁇ 5 kb or ⁇ 10 kb.
  • Duplex polynucleotides may have any desired number of mismatched or unpaired nucleotides, for example, ⁇ 1 per 100 nucleotides, ⁇ 2 per 100 nucleotides, ⁇ 3 per 100 nucleotides, ⁇ 5 per 100 nucleotides, or ⁇ 10 per 100 nucleotides.
  • fusion protein refers to a protein composed of two or more polypeptide components that are un-joined in their native state. Fusion proteins may be a combination of two, three or four or more different proteins.
  • a fusion protein may comprise two naturally occurring polypeptides that are not joined in their respective native states.
  • a fusion protein may comprise two polypeptides, one of which is naturally occurring and the other of which is non-naturally occurring.
  • the term polypeptide is not intended to be limited to a fusion of two heterologous amino acid sequences.
  • a fusion protein may have one or more heterologous domains added to the N-terminus, C-terminus, and or the middle portion of the protein.
  • fusion proteins include proteins comprising a double-stranded DNA deaminase fused to another enzyme (e.g., an endonuclease), an antibody, a binding domain suitable for immobilization such as maltose binding domain (MBP), a histidine tag ("His-tag”), a chitin binding domain, an alpha mating factor or a SNAP- Tag® (New England Biolabs, Ipswich, MA (see for example US patents 7,939,284 and 7,888,090)), a DNA- binding domain, and/or albumin with the deaminase optionally positioned closer to the N-terminus or closer to the C-terminus than the other component(s).
  • a binding peptide may be used to improve solubility or yield of the deaminase during the production of the protein reagent.
  • Other examples of fusion proteins include fusions of a deaminase and a heterologous targeting sequence, a linker, an epitope tag, a detectable fusion partner, such as a fluorescent protein, p-galactosidase, luciferase and/or functionally similar peptides.
  • Components of a fusion protein may be joined by one or more peptide bonds, disulfide linkages, and/or other covalent bonds.
  • modified cytosine refers to any covalent modification of cytosine including naturally occurring and non-naturally occurring modifications.
  • Modified cytosines include, for example, 1-methylcytosine (lmC), 2-O-methylcytosine (m2C), 3-ethylcytosine (e3C), 3,N 4 - ethylenocytosine ( ⁇ C), 3-methylcytosine (3mC), 4-methylcytosine (4mC), 5-carboxylcytosine (5CaC), 5- formylcytosine (5fC), 5-hydroxymethylcytosine (5hmC), 5-methylcytosine (5mC), N 4 -methylcytosine (N4mC), and pyrrolo-cytosine (pyrrolo-C). Additional examples of modified nucleotides may be found at https://dnamod.hoffmanlab.org.
  • non-naturally occurring refers to a polynucleotide, polypeptide, carbohydrate, lipid, or composition that does not exist in nature.
  • a polynucleotide, polypeptide, carbohydrate, lipid, or composition may differ from naturally occurring polynucleotides polypeptides, carbohydrates, lipids, or compositions in one or more respects.
  • a polymer e.g., a polynucleotide, polypeptide, or carbohydrate
  • the component building blocks e.g., nucleotide sequence, amino acid sequence, or sugar molecules.
  • a polymer may differ from a naturally occurring polymer with respect to the molecule(s) to which it is linked.
  • a "non-naturally occurring" protein may differ from naturally occurring proteins in its secondary, tertiary, or quaternary structure, by having a chemical bond (e.g., a covalent bond including a peptide bond, a phosphate bond, a disulfide bond, an ester bond, and ether bond, and others) to a polypeptide (e.g., a fusion protein), a lipid, a carbohydrate, or any other molecule.
  • a chemical bond e.g., a covalent bond including a peptide bond, a phosphate bond, a disulfide bond, an ester bond, and ether bond, and others
  • a "non-naturally occurring" polynucleotide or nucleic acid may contain one or more other modifications (e.g., an added label or other moiety) to the 5'- end, the 3' end, and/or between the 5'- and 3' -ends (e.g., methylation) of the nucleic acid.
  • modifications e.g., an added label or other moiety
  • a "non-naturally occurring" composition may differ from naturally occurring compositions in one or more of the following respects: (a) having components that are not combined in nature; (b) having components in concentrations not found in nature; (c) omitting one or components otherwise found in naturally occurring compositions; (d) having a form not found in nature, e.g., dried, freeze dried, crystalline, aqueous; and (e) having one or more additional components beyond those found in nature (e.g., buffering agents, a detergent, a dye, a solvent or a preservative).
  • buffering agents e.g., a detergent, a dye, a solvent or a preservative
  • position refers to the place such amino acid occupies in the primary sequence of a peptide or polypeptide numbered from its amino terminus to its carboxy terminus.
  • a position in one primary sequence may correspond to a position in a second primary sequence, for example, where the two positions are opposite one another when the two primary sequences are aligned using an alignment algorithm (e.g., BLAST (Journal of Molecular Biology. 215 (3): 403-410) using default parameters (e.g., expect threshold 0.05, word size 3, max matches in a query range 0, matrix BLOSUM62, Gap existence 11 extension 1, and conditional compositional score matrix adjustment) or custom parameters).
  • an alignment algorithm e.g., BLAST (Journal of Molecular Biology. 215 (3): 403-410) using default parameters (e.g., expect threshold 0.05, word size 3, max matches in a query range 0, matrix BLOSUM62, Gap existence 11 extension 1, and conditional compositional score matrix adjustment) or custom parameters).
  • An amino acid position in one sequence may correspond to a position within a functionally equivalent motif or structural motif that can be identified within one or more other sequence(s) in a database by alignment of the motifs.
  • "position" refers to the place such nucleotide occupies in the nucleotide sequence of an oligonucleotide or polynucleotide numbered from its 5' end to its 3' end.
  • a non-naturally occurring double-stranded DNA deaminase may relate to, but differ from, a naturally occurring protein.
  • Naturally-occurring proteins often include a deaminase as a single domain of a larger, multi-domain structure with the deaminase domain positioned at the most C-terminal end.
  • Non-naturally occurring double-stranded DNA deaminases may constitute truncated versions of a naturally-occurring protein, in which cases, the non-naturally occurring double-stranded DNA deaminases may have a high degree of identity to a portion of a naturally-occurring sequence, but lack, for example, structural and/or functional domains or sub-units of the corresponding naturally- occurring proteins.
  • a non-naturally occurring double-stranded DNA deaminase may have any number of insertions, deletions, or substitutions relative to a naturally occurring enzyme.
  • a non-naturally occurring double-stranded DNA deaminase may have less than 100% identity, less than 99% identity, less than 98% identity, less than 90% identity, less than 85% identity, less than 80% identity, less than 70% identity, less than 60% identity, less than 50% identity, less than 40% identity, less than 30% identity, or less than 20% identity to a naturally occurring enzyme.
  • Non-naturally occurring double- stranded DNA deaminases may include expression and/or purification tags.
  • Non-naturally occurring double-stranded DNA deaminase disclosed herein may have an amino acid sequence that is at least 80% identical (e.g., at least 90% identical, at least 95% identical or at least 98% identical or at least 99% identical to) the C-terminal deaminase domain of a naturally-occurring protein, wherein the double- stranded DNA deaminase possesses a double-stranded DNA deaminase activity and does not comprise the N-terminus of the corresponding naturally-occurring protein (if any).
  • a non- naturally occurring double-stranded DNA deaminase lacks at least 10, at least 20, at least 50 or at least 100 of the N-terminal amino acids of the corresponding naturally-occurring protein.
  • a double-stranded DNA deaminase is no more than 300 amino acids in length, e.g., no more than 200 amino acids in length or no more than 150 amino acids in length.
  • a double-stranded DNA deaminase may comprise an amino acid sequence having at least 80%, at least 85%, at least 88% identical, at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of SEQ ID NOS: 1-152.
  • a double-stranded DNA deaminase may be encoded by a nucleic acid sequence that, when transcribed, translated, and/or processed, results in an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of SEQ.
  • a double-stranded DNA deaminase may have an amino acid sequence at least 90% (e.g., at least 95%, at least 98%, at least 99%) identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, 99.
  • a non-naturally occurring double-stranded DNA deaminase lacks the N-terminus of its corresponding naturally-occurring protein, for example, at least 10, at least 20, at least 50 or at least 100 of the N-terminal amino acids.
  • Variants can be designed using sequence alignments and structural information.
  • a double-stranded DNA deaminase may contain a fragment of a wild type protein, where the fragment contains a deaminase domain, but lacks other domains of the wild type protein that may be C-terminal and/or N-terminal to the deaminase domain.
  • Examples of non- naturally-occurring double-stranded DNA deaminases include SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, 99.
  • a double-stranded DNA deaminase may be a fusion protein.
  • a double-stranded DNA deaminase may have a purification tag (e.g., a His tag or the like) at either end.
  • a double-stranded DNA deaminase may be fused to a DNA binding protein (e.g., the DNA binding domain of a transcription factor) or the protein component of a nucleic acid-guided endonuclease (e.g., a catalytically dead Cas9 (dCas9) or a Cas9 nickase (nCas9) or TALEN (transcription activator-like effector nucleases)) so that the fusion protein can affect site-specific C to T substitutions in a genome.
  • a DNA binding protein e.g., the DNA binding domain of a transcription factor
  • a nucleic acid-guided endonuclease e.g., a catalytically dead Cas9 (dCas9) or a Cas9 nickase
  • a double-stranded DNA deaminase optionally may deaminate cytosine, but not adenine ( a "dsDNA cytosine deaminase"), deaminate adenine, but not cytosine ( a "dsDNA adenine deaminase”), or deaminase both adenine and cytosine (appreciating that one may be a better substrate than the other under otherwise equivalent conditions).
  • a double-stranded DNA deaminase may be modification sensitive. For example, a double-stranded DNA deaminase may deaminate cytosine, but not deaminate one or more modified cytosines in double stranded DNA.
  • a double-stranded DNA deaminase may deaminate cytosine, but not deaminate 5mC or N4mC or it may deaminate C and 5mC, but not 5hmC, 5ghmC or N4mC.
  • deaminase compositions including, for example, reaction mixtures.
  • deaminase compositions may comprise (a) a double-stranded DNA deaminase and (b) a double-stranded DNA.
  • a deaminase composition may comprise, for example, a deaminase variant (e.g., having an amino acid sequence at least 80% identical to one or more of SEQ. ID NOS:1-152).
  • a double-stranded DNA deaminase composition may be free of one or more other catalytic activities.
  • a double-stranded DNA deaminase composition may be free of nucleases that cleave dsDNA, free of nucleases that cleave ssDNA, free of polymerase activity, free of DNA modification activity, and/or free of protease activity, in each case, under desired test conditions (e.g., conditions of time, temperature, pH, salinity, model substrate and/or others), for example, conditions intended to replicate conditions of a specific use of the double-stranded DNA deaminase composition or intended to represent conditions for a range of uses.
  • desired test conditions e.g., conditions of time, temperature, pH, salinity, model substrate and/or others
  • double-stranded DNA deaminases and compositions comprising one or more double-stranded DNA deaminase may have any desirable form including, for example, a liquid, a gel, a film, a powder, a cake, and/or any dried or lyophilized form.
  • a double-stranded DNA deaminase composition may comprise a double-stranded DNA deaminase and a support or matrix, for example, a film, gel, fabric, or bead comprising, for example, a magnetic material, agarose, polystyrene, polyacrylamide, and/or chitin.
  • a reaction mix may comprise: a double-stranded DNA substrate that comprises cytosines and a double-stranded DNA deaminase.
  • a double-stranded DNA substrate may comprise cytosines and at least one modified cytosine, e.g., a 5fC, 5CaC, 5mC, 5hmC, N4mC or pyrrolo-C.
  • a double-stranded DNA substrate may be eukaryotic DNA (e.g., plant or animal) or bacterial.
  • the double-stranded DNA substrate may be mammalian, e.g., from a human.
  • the double-stranded DNA substrate may be human cfDNA.
  • the reaction mix may additionally comprise one or more of a TET methylcytosine dioxygenase (e.g., TET2) and a DNA beta- glucosyltransferase, as described herein and/or a ligase, a polymerase, a proteinase K, and/or a thermolabile proteinase K.
  • a reaction mix may be free of unwinding agents (e.g., gyrases, topoisomerases, single-stranded DNA binding proteins, or helicases) and/or free of denaturants.
  • a method may comprise providing a double-stranded DNA substrate of any desired length.
  • a double-stranded DNA substrate may have a length of ⁇ 50 nucleotides, 10-200 nucleotides, 80-400 nucleotides, 50-500 nucleotides, ⁇ 500 nucleotides, ⁇ 1 kb, ⁇ 2 kb, ⁇ 5 kb or ⁇ 10 kb.
  • a double-stranded DNA substrate may be a fragment of genomic DNA, organelle DNA, cDNA, or other DNAs of interest and can be or arise from any desired source (e.g., human, non-human mammal, plants, insects, microbial, viral, or synthetic DNA).
  • a DNA substrate may be prepared, in some embodiments by extracting (e.g., genomic DNA) from a biological sample and, optionally, fragmenting it.
  • fragmenting DNA may comprise mechanically fragmenting the DNA (e.g., by sonication, nebulization, or shearing) or enzymatically fragmenting the DNA (e.g., using a double stranded DNA "dsDNA" fragmentation mix.
  • DNA for deamination may already be fragmented (e.g., as is the case for FFPE samples and circulating cell-free DNA (cfDNA)).
  • a method may include polishing DNA ends (e.g., the ends of fragmented DNA).
  • DNA ends may be contacted with (a) a proofreading polymerase to excise 3' overhanging nucleotides, if any, (b) a proofreading and/or non-proofreading polymerase to fill in 5' overhangs, if any, and/or (c) a polynucleotide kinase (PNK) to phosphorylate unphosphorylated 5' ends, if any.
  • PNK polynucleotide kinase
  • a method may comprise contacting DNA ends (e.g., blunt ends) with a non-proofreading polymerase to add an untemplated A-tail (e.g., a single base overhang comprising adenine) to the 3' end.
  • Methods may include, according to some embodiments, ligating one or more adapters to DNA ends.
  • Adapters may comprise one or more sample tags, unique molecular identifiers (UMIs), modified nucleotides, primer sequences (e.g., for sequencing).
  • UMIs unique molecular identifiers
  • adapters may comprise cytosines (or adenines) that are not substrates for the deaminase to be used. If desired, polishing products and/or ligation products may be cleaned up, for example, to separate polishing products or ligation products, as applicable, from enzymes, unreacted nucleotides and/or adapters.
  • a method may comprise contacting (a) a deaminase substrate and (b) a glucosyltransferase (e.g., T4-BGT) and/or Ten-eleven translocation (TET) dioxygenase to produce a modified deaminase substrate.
  • BGT may glucosylate 5hmC to form 5ghmC.
  • TET may oxidize 5mC to 5caC.
  • APOBEC3A Apolipoprotein B mRNA editing enzyme subunit 3A
  • all Cs except 5ghmC in the modified deaminase substrate would be deaminated.
  • Deaminases disclosed herein may obviate the need to denature the DNA prior to deamination (e.g., with APOBEC3A) and may provide methylation sensitivities.
  • a method may comprise contacting a double-stranded DNA substrate that comprises cytosines and a double-stranded DNA deaminase to produce a deamination product that comprises deaminated cytosines.
  • a double-stranded DNA substrate may further comprise one or more modified cytosines, e.g., one or more modified cytosines selected from 5fC, 5CaC, 5mC, 5hmC, N4mC and pyrrolo-C, 4mC, ⁇ C, 3mC, e3C, m2C, and lmC.
  • a double-stranded DNA deaminase substrate does not need to be denatured before or during deamination.
  • deamination methods may comprise contacting a double-stranded DNA substrate comprising cytosines and a double-stranded DNA deaminase to produce a reaction mix to produce a deamination product comprising deaminated cytosines.
  • Deamination methods may further comprise amplifying the deamination product to produce an amplification product, thereby copying any deaminated Cs in the original strand to Ts in the amplification product.
  • Deamination methods may further comprise ligating an asymmetric (or "Y") adapter, e.g., an Illumina P5/P7 adapter, onto the deamination product and amplifying the deaminated product using primers complementary to sequences in the adapter.
  • a method may comprise sequencing a deamination product, or amplifying a deamination product to produce amplification products and sequencing the amplification products, in each case, to produce sequence reads.
  • Deamination products and/or amplification products may be sequenced using any suitable system including Illumina's reversible terminator method (see, e.g., Shendure et al, Science 2005 309: 1728).
  • a deaminated product may be sequenced directly, without amplification, for example, by nanopore or PacBio sequencing.
  • a sequencing step may result in at least 10,000, at least 100,000, at least 500,000, at least 1M, at least 10M, at least 100M, at least IB or at least 10B sequence reads per reaction.
  • the reads may be paired-end reads.
  • a method may comprise analyzing sequence reads to identify a modified cytosine in the double-stranded DNA substrate, where a modified cytosine can be identified as a "C" because it is deaminase-resistant.
  • Double-stranded DNA deaminases that are "blocked" by or do not deaminate modified cytosines (e.g., 5mC, 5hmC, 5ghmC, N4mC) may be used in a variety of "EM-seq"-like workflows for the analysis of modified cytosines.
  • Current implementations of EM-seq employ a deaminase that has a preference for single-stranded substrates.
  • the current EM-seq workflow has a denaturation step (see, e.g., FIGURE 3A, Sun et al Genome Res. 2021 31: 291-300 and Vaisvila et al Genome Res. 2021 31: 1280-1289).
  • the denaturation step can be eliminated, thereby making EM-seq workflow faster and more efficient.
  • a double-stranded DNA substrate may be prepared by pre-treating a double-stranded DNA with a TET methylcytosine dioxygenase (e.g., TET2) and DNA beta-glucosyltransferase to convert the 5mC and 5hmC in the starting DNA to forms resistant to double-stranded DNA deaminases, e.g., the MGYPDa829, MGYPDaO6, CrDa01, AvDa02, CsDa01, LbsDa01, FIDa01, MGYPDa26, MGYPDa23, chimera_10 and AncDaO4.
  • TET2 methylcytosine dioxygenase
  • Double-stranded DNA deaminases useful in the illustrated workflow may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of MGYPDa829 (SEQ ID NO:96), MGYPDaO6 (SEQ ID NO: 4), CrDa01 (SEQ ID NO: 12), AvDa02 (SEQ ID NO: 21), CsDa01 (SEQ ID NO: 9), LbsDa01 (SEQ ID NO: 10), FIDa01 (SEQ ID NO: 8), MGYPDa26 (SEQ ID NO: 7), MGYPDa23 (SEQ ID NO: 6), chimera_10 (SEQ ID NO: 97) and AncDaO4 (SEQ ID NO: 95) double-stranded DNA deaminases. As illustrated, the double-stranded DNA deaminase can be added to the reaction without any clean-up, denaturation or addition of unwinding agents.
  • a double-stranded DNA substrate may be prepared by pre-treating a double-stranded DNA with a TET methylcytosine dioxygenase (e.g., TET2) but not DNA beta- glucosyltransferase to convert 5mC in the starting DNA to a form resistant to double-stranded DNA deaminases, e.g., the CseDa01 and LbDaO2.
  • TET2 methylcytosine dioxygenase
  • Double-stranded DNA deaminases useful in the illustrated workflow may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of CseDa01 (SEQ ID NO: 3) and LbDaO2 (SEQ ID NO: 1) double-stranded DNA deaminases.
  • the double-stranded DNA deaminase can be added to the reaction without any clean-up, denaturation or addition of unwinding agents.
  • a double-stranded nucleic acid may not be contacted with a TET methylcytosine dioxygenase nor a DNA beta-glucosyltransferase (nor any other enzyme that converts a modified cytosine to a form resistant to a selected double-stranded DNA deaminase) at any point in the workflow.
  • a selected double-stranded DNA deaminase may be blocked by 5- hydroxymethylcytosine and 5-methylcytosine.
  • Double-stranded DNA deaminases useful in the illustrated workflow may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of MGYPDa20 (SEQ. ID NO: 11), NsDa01 (SEQ ID NO: 27), and AshDa01 (SEQ ID NO: 40) double-stranded DNA deaminases.
  • a double-stranded DNA substrate may comprise at least one N4mC (N4- methyl-cytosine) which is a cytosine modification that is resistant to some double-stranded DNA deaminases.
  • Double-stranded DNA deaminases useful for detecting N4mC may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of SEQ ID NOS:l-28.
  • double-stranded DNA deaminases useful for detecting N4mC may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of CseDa01 (SEQ ID NO:3) and LbDa01 (SEQ ID NO:19) double-stranded DNA deaminases.
  • the double-stranded DNA substrate may be or comprise prokaryotic or archaeal DNA.
  • the double-stranded DNA deaminase may be used in a "methyl-SNP-seq" workflow (see, e.g., Yan et al, Genome Res. 2022; gr.277080.122).
  • a method may comprise; (a) ligating a hairpin adapter to a double-stranded fragment of DNA to produce a ligation product, (b) enzymatically generating a free 3' end in a double-stranded region of the hairpin adapter in the ligation product; and (c) extending the free 3' end in a dCTP-free reaction mix that comprises a strand-displacing or nick-translating polymerase, dGTP, dATP, dTTP and modified dCTP to produce the double-stranded DNA substrate, as described in US Provisional Application Serial No. 63/399,970, filed on August 22, 2022, which application is incorporated by reference herein.
  • modified dCTPs include 5mdCTP, pyrrolo-dCTP, and N4mdCTP among other modified dCTPs that can be incorporated by a polymerase.
  • Deaminases may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of MGYPDa20 (SEQ ID NO: 11), NsDa01 (SEQ ID NO: 27), AshDa01 (SEQ ID NO: 40).
  • a double-stranded DNA deaminase composition may comprise a double-stranded DNA deaminase and, optionally, any of (including one or more of) a buffering agent (e.g., a storage buffer, a reaction buffer), an excipient, a salt (e.g., NaCI, MgCl 2 , CaCl 2 ), a protein (e.g., albumin, an enzyme), a stabilizer, a detergent (for example, ionic, non-ionic, and/or zwitterionic detergents (e.g., octoxinol, polysorbate 20)), a polynucleotide, a cell (e.g., intact, digested, or any cell-free extract), a biological fluid or secretion (e.g., mucus, pus), an aptamer, a crowding agent, a sugar (e.g., a mono, di, tri, tetra,
  • Combinations may include for example, two or more of the listed components (e.g., a salt and a buffer) or a plurality of a single listed component (e.g., two different salts or two different sugars).
  • proteins that may be included in a double-stranded DNA deaminase composition include one or more enzymes that alter the deamination susceptibility of one or more modified cytosines (e.g., a TET methylcytosine dioxygenase and/or a DNA beta- glucosyltransferase).
  • a deaminase kit comprising a double- stranded DNA deaminase.
  • a kit may comprise any of the components described herein.
  • a double- stranded DNA deaminase composition or kit may include, for example, double-stranded DNA deaminase and, optionally, a storage buffer (e.g., comprising a buffering agent and comprising or lacking glycerol), and/or a reaction buffer.
  • a reaction buffer for a deaminase composition or a deaminase kit may be in concentrated form, and the buffer may include one or more additives (e.g., glycerol), one or more salts (e.g.
  • kits comprising dNTPs may include one, two, three of all four of dATP, dTTP, dGTP and dCTP.
  • a kit may further comprise one or more modified nucleotides.
  • kits may be included in one container for a single step reaction, or one or more components may be contained in one container, but separated from other components for sequential use or parallel use.
  • a kit may comprise two components in a single tube (e.g., a deaminase and a storage buffer) and all other components in separate, individual tubes, in each case, with the contents provided in any desired form (e.g., liquid, dried, lyophilized).
  • One tube in a kit may contain a mastermix, for example, for receiving and amplifying a DNA (e.g., a deaminated DNA).
  • a double-stranded DNA deaminase may be deposited in the cap of a tube while components for transcribing a template nucleic acid are deposited in the body of the tube.
  • the tube may be tapped, shaken, turned, spun, or otherwise moved to contact the deposited double-stranded DNA deaminase with the deamination reaction mixture.
  • a kit may include a double-stranded DNA deaminase and the reaction buffer in a single tube or in different tubes and, if included in a single tube, the double-stranded DNA deaminase and the buffer may be present in the same or separate locations in the tube.
  • kits may comprise a double-stranded DNA deaminase, as described above, and a reaction buffer (e.g., a 5x or lOx buffer).
  • a reaction buffer e.g., a 5x or lOx buffer
  • the contents of a kit may be formulated for use in a desired method or process.
  • the kit may further comprise (a) a TET methylcytosine dioxygenase (e.g., TET2) and a DNA beta-glucosyltransferase or (b) a TET methylcytosine dioxygenase and no DNA beta-glucosyltransferase.
  • kits does not contain either a TET methylcytosine dioxygenase or DNA beta- glucosyltransferase.
  • a kit further comprises a modified dCTP selected from 5hmdCTP, 5fdCTP, 5cadCTP, 5mdCTP, pyrrolo-dCTP and N4mdCTP and/or a strand-displacing or nick translating polymerase.
  • a kit may additionally comprise a ligase, a polymerase, a proteinase K, and/or a thermolabile proteinase K.
  • a double-stranded DNA deaminase may be lyophilized or in a buffered storage solution that contains glycerol.
  • a double-stranded DNA deaminase may be used in a variety of genome analysis methods, particularly methods whose goal is to identify the position and/or identity of one or more modified cytosines and/or determine the methylation status of a cytosine.
  • a double-stranded DNA deaminase can be a component of a fusion protein for based editing, i.e., generating site-specific C to T substitutions in a genome.
  • Embodiment 1 A polypeptide comprising at least 90% sequence identity with any of SEQ. ID NOs: 1-8, not including 100% identity to SEQ ID NO: 3.
  • Embodiment 2 The polypeptide according to embodiment 1, comprising at least 90% sequence identity with any of SEQ ID NOs: 1-3 not including 100% identity to SEQ ID NO: 3.
  • Embodiment 3. The polypeptide according to embodiment 1, comprising at least 90% sequence identity with any of SEQ. ID NOs: 1 or 2.
  • Embodiment 4 The polypeptide according to any of embodiments 1-3, capable of deaminating cytosine in double stranded DNA (dsDNA) with no sequence bias.
  • Embodiment 5 The polypeptide according to any of embodiments 1-3, capable of deaminating cytosine in single stranded DNA (ssDNA) with no sequence bias.
  • Embodiment 6 The polypeptide of any of embodiments 1-5, comprising a fusion protein.
  • Embodiment 7 The polypeptide of any of embodiments 1-6, wherein the polypeptide is lyophilized.
  • Embodiment 8 The polypeptide of any of embodiments 1-7, wherein the polypeptide is immobilized on a substrate.
  • Embodiment 9 The polypeptide of any of embodiments 1-8, wherein the polypeptide is combined with one or more reagents in a mixture wherein one or more reagents in the mixture comprises a second polypeptide.
  • Embodiment 10 The polypeptide of embodiment 9, wherein the second polypeptide is selected from the group consisting of a ligase, a polymerase, a methylcytosine (mC) dioxygenase, DNA glucosyltransferase, a Proteinase K, and a Thermolabile Proteinase K.
  • a ligase a polymerase
  • mC methylcytosine
  • Embodiment 11 The polypeptide of any of embodiments 9-10, wherein the one or more reagents in the mixture further comprises a reversible inhibitor of the deaminase.
  • Embodiment 12 The polypeptide of any of embodiments 1-11, wherein the mixture further comprises DNA.
  • Embodiment 13 A method for methylome analysis comprising
  • Embodiment 14 The method according to embodiment 13, wherein prior to (a) adding to the reaction mixture, a methylcytosine (mC) dioxygenase to the genomic DNA for converting mC to hydroxymethylcytosine (hmC).
  • mC methylcytosine
  • Embodiment 15 The method according to any of embodiments 13-14, wherein prior to (a) adding a hydroxymethylcytosine (hmC) modifying reagent to the reaction mixture.
  • Embodiment 16 The method according to any of embodiments 13-15, wherein (b) further comprises inactivating the DNA deaminase with a Proteinase K or Thermolabile Proteinase K.
  • Embodiment 17 The method according to any of embodiments 13-16, wherein (b) further comprises amplifying the DNA containing the converted cytosines.
  • Embodiment 18 The method according to any of embodiments 13-17, further comprising sequencing the amplified DNA.
  • Embodiment 19 The method according to any of embodiments 13-18, further comprising determining the location of methylcytosine (mC) in genomic DNA.
  • mC methylcytosine
  • Embodiment 20 A kit comprising a deaminase capable of deaminating cytosine in double stranded DNA (dsDNA) and optionally single stranded DNA (ssDNA) with no sequence bias.
  • dsDNA double stranded DNA
  • ssDNA single stranded DNA
  • Embodiment 21 The kit according to embodiment 20, further comprising a methyl dioxygenase in a separate container from the dixoygenase.
  • Embodiment 22 The kit according to embodiment 20 or 21, further comprising a hydroxymethylcytosine (hmC) modifying enzyme in the same container with the dioxygenase or in a different container.
  • hmC hydroxymethylcytosine
  • Candidate DNA deaminase genes first were codon-optimized and then flanking sequences were added to each end, specifically, sequences containing T7 promoter at 5' end and T7 terminator at 3' end. These sequences were ordered as liner gBIocks from Integrated DNA Technologies (Coralville, IA, USA). Template DNA for in vitro protein synthesis was generated with Phusion® Hot Start Flex DNA Polymerase using gBIocks as template and flanking primers. The PCR products were purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, MA, USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA).
  • Example 2 Deamination assay on single and double stranded substrates
  • LC-MS/MS analysis was performed by injecting digested DNAs on an Agilent 1290 Infinity II UHPLC equipped with a G7117A diode array detector and a 6495C triple quadrupole mass detector operating in the positive electrospray ionization mode (+ESI).
  • Each nucleoside was identified in the extracted chromatogram associated with its specific MS/MS transition: dC [M+H] + at m/z 228.1 ⁇ 112.1; dU [M+H] + at m/z 229.1 ⁇ 113.1; d m C [M+H] + at m/z 242.1 ⁇ 126.1; and dT [M+H] + at m/z 243.1 ⁇ 127.1.
  • External calibration curves with known amounts of the nucleosides were used to calculate their ratios within the samples analyzed.
  • DNA Prep Then the DNA was transferred to a Covaris microTUBE (Covaris, Woburn, MA, USA) and sheared to 300 bp using the Covaris S2 instrument. The 50 ⁇ l of sheared material was transferred to a PCR strip tube to begin library construction. NEBNext DNA Ultra II Reagents (New England Biolabs, Ipswich, MA, USA) were used according to the manufacturer's instructions for end repair, A-tailing, and adaptor ligation using an Illumina-compatible adapter. The ligated samples were mixed with 110 ⁇ l of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 17 ⁇ l of water. Deamination
  • the DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 ⁇ l of dsDNA deaminase synthesized as described above with an incubation time of 1 hour at 37°C. After deamination reaction, 1 ⁇ l of Thermolabile Proteinase K (New England Biolabs, Ipswich, MA) was added and incubated additional 30 min at 37°C. 5 ⁇ M of NEBNext Unique Dual Index Primers and 25 ⁇ l NEBNext Q.5U Master Mix (New England Biolabs, Ipswich, MA, USA) were added to the DNA and PCR amplified.
  • Thermolabile Proteinase K New England Biolabs, Ipswich, MA
  • the PCR reaction samples were mixed with 50 ⁇ l of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions.
  • the library was eluted in 15 ⁇ l of water.
  • the libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100.
  • the whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2 x 75 bp) was performed for all the sequencing runs. Base calling and demultiplexing were carried out with the standard Illumina pipeline. Results of CseDa01 are shown in FIGURE 4A and 4B.
  • Example 4 l-tube-3-enzyme EM-seq (dsDNA deaminase MGYPDa829+ TET2+ BGT)
  • DNA was oxidized in a 50 ⁇ l reaction volume containing 50 mM Tris HCI pH 8.0, 1 mM DTT, 5 mM Sodium-L-Ascorbate, 20 mM a-KG, 2 mM ATP, 50mM Ammonium Iron (II) sulfate hexahydrate, 0.04 mM UDG-glucose (NEB, Ipswich, MA), 16 ⁇ g mTET2, 10 U T4-BGT (NEB, Ipswich, MA).
  • the reaction was initiated by adding Fe (II) solution to a final reaction concentration of 40 ⁇ M and then incubated for lh at 37°C.
  • the DNA was then deaminated, using 1 ⁇ l of MGYPDa829 dsDNA deaminase with an incubation time of 3 hour at 37°C. After deamination reaction, 1 ⁇ l of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, MA) was added and incubated additional 30 min at 37°C and 15 min at 60°C. At the end of the incubation, DNA was purified using 70 ⁇ l of resuspended NEBNext Sample Purification Beads according to the manufacturer's protocol. The sample was eluted in 16 ⁇ l water and 15 ⁇ l was transferred to a new tube.
  • Thermolabile Proteinase K P8111S, New England Biolabs, Ipswich, MA
  • NEBNext Unique Dual Index Primers 1 ⁇ M were added to the DNA and PCR amplified.
  • the libraries were analyzed and quantified with an Agilent Bioanalyzer 2100 DNA analyzer. The whole-genome libraries were sequenced, and analyzed as described below.
  • Raw reads were first trimmed by the Trim Galore software to remove adapter sequences and low-quality bases from the 3' end. Unpaired reads due to adapter/quality trimming were also removed during this process.
  • the trimmed read sequences were C to T converted and were then mapped to a composite reference sequence including the human genome (GRCh38) and the complete sequences of lambda and pUC19 controls using the Bismark program with default Bowtie2 setting ⁇ Langmead and Salzberg 2012).
  • the aligned reads were then subjected to two post-processing QC steps: 1, alignment pairs that shared the same alignment start positions (5' ends) were regarded as PCR duplicates and were discarded; 2, reads that aligned to the human genome and contained excessive cytosines in non-CpG context (e.g., more than 3 in 75bp) were removed because they are likely resulted from conversion errors.
  • the numbers of T's (converted not methylated) and C's (unconverted modified) of each covered cytosine position were then calculated from the remaining good quality alignments using Bismark methylation extractor, and the methylation level was calculated as # of C/(# of C + # of T).
  • FIGURE 3C illustrates this workflow.
  • oligonucleotides ACACCCATCACATTTACAC(5caC)GGGAAAGAGTTGAATGTAGAGTTGG; SEQ. ID NO: 157) or ACACCCATCACATTTACAC(5fC)GGGAAAGAGTTGAATGTAGAGTTGG; SEQ. ID NO:158 with one modified cytosine (5caC or 5fC) were treated with CseDa01 DNA deaminase for 4 h in buffer containing 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100 and incubated for 1 h at 37°C.
  • the deaminated oligonucleotides were purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, MA, USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). 1500 ng of deaminated DNAs were digested to nucleosides with the Nucleoside Digestion Mix (New England Biolabs, Inc., Ipswich, MA, USA) following manufacturer's recommendations.
  • Example 6 l-tube-2-enzyme EM-seq using the dsDNA deaminase CseDa01 + TET2
  • DNA was prepared according to Example 3 and the library was eluted in 29 ⁇ l of water.
  • DNA was oxidized in a 50 ⁇ l reaction volume containing 50 mM Tris HCI pH 8.0, 1 mM DTT, 5 mM Sodium-L-Ascorbate, 20 mM a-KG, 2 mM ATP, 50mM Ammonium Iron (II) sulfate hexahydrate, and 16 pg mTET2.
  • the reaction was initiated by adding Fe (II) solution to a final reaction concentration of 40 ⁇ M and then incubated for 1 h at 37°C.
  • the DNA was then deaminated, using 1 ⁇ l of CseDa01 dsDNA deaminase with an incubation time of 3 hour at 37°C.
  • 1 ⁇ l of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, MA) was added and incubated additional 30 min at 37°C and 15 min at 60°C.
  • DNA was purified using 70 ⁇ l of resuspended NEBNext Sample Purification Beads according to the manufacturer's protocol.
  • the sample was eluted in 16 ⁇ l water and 15 ⁇ l was transferred to a new tube.
  • 1 ⁇ M of NEBNext Unique Dual Index Primers and 25 ⁇ l NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, MA) were added to the DNA and PCR amplified.
  • the libraries were analyzed and quantified with an Agilent Bioanalyzer 2100 DNA analyzer.
  • the whole-genome libraries were sequenced, and analyzed as described below. Raw reads were first trimmed by the Trim Galore software to remove adapter sequences and low-quality bases from the 3' end. Unpaired reads due to adapter/quality trimming were also removed during this process.
  • the trimmed read sequences were C to T converted and were then mapped to a composite reference sequence including the human genome (GRCh38) and the complete sequences of lambda and pUC19 controls using the Bismark program with default Bowtie2 setting (Langmead and Salzberg 2012).
  • the aligned reads were then subjected to two post-processing QC steps: 1, alignment pairs that shared the same alignment start positions (5' ends) were regarded as PCR duplicates and were discarded; 2, reads that aligned to the human genome and contained excessive cytosines in non-CpG context (e.g., more than 3 in 75bp) were removed because they are likely resulted from conversion errors.
  • T's (converted not methylated) and C's (unconverted modified) of each covered cytosine position were then calculated from the remaining good quality alignments using Bismark methylation extractor, and the methylation level was calculated as # of C/(# of C + # of T).
  • FIGURE 3C illustrates this workflow.
  • Example 7 DNA deaminase CseDa01 works very efficiently in the TET2 buffer allowing to perform single-tube 5mC oxidation and DNA deamination reactions
  • the deaminated ⁇ X174 DNA was purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, MA, USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). 150 ng of deaminated DNAs were digested to nucleosides with the Nucleoside Digestion Mix (New England Biolabs, Inc., Ipswich, MA, USA) following manufacturer's recommendations.
  • LC-MS/MS analysis was performed by injecting digested DNAs on an Agilent 1290 Infinity II UHPLC equipped with a G7117A diode array detector and a 6495C triple quadrupole mass detector operating in the positive electrospray ionization mode (+ESI).
  • UHPLC was carried out on a Waters XSelect HSS T3 XP column (2.1 x 100 mm, 2.5 ⁇ m) with a gradient mobile phase consisting of methanol and 10 mM aqueous ammonium acetate (pH 4.5).
  • MS data acquisition was performed in the dynamic multiple reaction monitoring (DMRM) mode.
  • DMRM dynamic multiple reaction monitoring
  • Each nucleoside was identified in the extracted chromatogram associated with its specific MS/MS transition: dC [M+H] + at m/z 228.1 ⁇ 112.1; dU [M+H] + at m/z 229.1 ⁇ 113.1; d m C [M+H] + at m/z 242.1 ⁇ 126.1; and dT [M+H] + at m/z 243.1 ⁇ 127.1.
  • External calibration curves with known amounts of the nucleosides were used to calculate their ratios within the samples analyzed. Results are shown in FIGURES 4A, 4B, 4C, 5A, and 5B.
  • Example 8 Modification-sensitive deaminases efficiently deaminate cytosines to uracil, however, do not deaminate 5-methylcytosine and 5-hydroxymethylcytosine in dsDNA and ssDNA
  • E. coli C2566 genomic DNA 50 ng of E. coli C2566 genomic DNA was combined with 2 ng unmethylated lambda, phage XP12 (all cytosines are 5-methylcytosines) and T4 phage DNA (all cytosines are 5-hydroxymethyl cytosines) control DNAs and made up to 50 ⁇ l with 10 mM Tris, pH 8.0. Then the DNA was prepared according to Example 3 with a sheared size of 240-290 bp and a library elution volume of 15 ⁇ l of water.
  • the DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 ⁇ l of a modification-sensitive dsDNA deaminase (e.g., MGYPDa20 or NsDa01) synthesized as described above with an incubation time of 1 hour at 37°C. After deamination reaction, 1 ⁇ l of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, MA) was added and incubated additional 30 min at 37°C.
  • a modification-sensitive dsDNA deaminase e.g., MGYPDa20 or NsDa01
  • NEBNext Unique Dual Index Primers 1 ⁇ M were added to the DNA and PCR amplified.
  • the PCR reaction samples were mixed with 50 ⁇ l of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions.
  • the library was eluted in 15 ⁇ l of water.
  • the libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100.
  • the whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2 x 75 bp) was performed for all the sequencing runs.
  • Base calling and demultiplexing were carried out with the standard Illumina pipeline.
  • Raw reads were first trimmed by the Trim Galore to remove adapter sequences and low-quality bases from the 3' end. Unpaired reads owing to adapter/quality trimming were also removed during this process.
  • the trimmed read sequences were C-to-T converted and were then mapped to a composite reference sequence including the E. coli C2566 genome and the complete sequences of lambda, phage XP12, and T4 controls using the Bismark program with the default Bowtie 2 setting.
  • the first 5bp at the 5' end of R2 reads were removed to reduce end-repair errors and aligned read pairs that shared the same alignment start positions (5' ends) were regarded as PCR duplicates and were discarded.
  • Next deamination events (C->T) were called by comparing the remaining good alignment sequences to the reference sequences using Bismark methylation extractor program.
  • Flanking sequences of each cytosine group were used to make sequence logo using WebLogo 3 to infer deamination sequence preference. Results are shown in FIGURES 6A and 6B for MGYPDa20, FIGURES 7A and 7B for NsDa01, FIGURES 8A and 8B for RhDa01_extN10, and FIGURES 9A and 9B for MmgDa02.
  • Example 9 Applying the 1-tube-l-enzyme EM-seq method to map 5mC in human using a modification- sensitive dsDNA deaminase MGYPDa20
  • DNA was prepared according to Example 3 and the library was eluted in 17 ⁇ l of molecular grade water. The DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 ⁇ l of MGYPDa20 dsDNA deaminase with an incubation time of 3 hours at 37°C.
  • the libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100.
  • the whole-genome libraries were sequenced using the Illumina NextSeq platform and analyzed as described below.
  • Raw reads were first trimmed by the Trim Galore software to remove adapter sequences and low-quality bases from the 3' end. Unpaired reads due to adapter/quality trimming were also removed during this process.
  • the trimmed read sequences were C to T converted and were then mapped to a composite reference sequence including the human genome (GRCh38) and the complete sequences of lambda and pUC19 controls using the Bismark program with default Bowtie2 setting (Langmead and Salzberg 2012).
  • the aligned reads were then subjected to two post-processing QC steps: 1, alignment pairs that shared the same alignment start positions (5' ends) were regarded as PCR duplicates and were discarded; 2, reads that aligned to the human genome and contained excessive cytosines in non-CpG context (e.g., more than 3 in 75bp) were removed because they are likely resulted from conversion errors.
  • the numbers of T's (converted not methylated) and C's (unconverted modified) of each covered cytosine position were then calculated from the remaining good quality alignments using Bismark methylation extractor, and the methylation level was calculated as # of C/(# of C + # of T).
  • FIGURE 3D illustrates this workflow. Results are shown in FIGURE 10.
  • nick sites were created at the uracil positions in the hairpin adapters at both ends after being treated with UDG and EndoVII I.
  • the nick sites were translated towards 3' terminus by DNA polymerase I in the presence of dATP, dGTP, dTGP and 5-methyl-dCTP.
  • the nick translation causes double stranded DNA break when DNA polymerase I encounters the other nick on the opposite strand.
  • the resulting fragments have one end ligated to a hairpin adapter and blunt end on the other side.
  • the blunt end was dA-tailed and ligated with methylated Illumina adapter.
  • the ligated product was deaminated at 37°C for 3 h with double stranded DNA deaminase MGYPDa20.
  • the deaminated DNA product was amplified using NEBNext Q.5U Master Mix (NEB, M0597).
  • the resulting indexed library was used for Illumina sequencing.
  • the human Methyl-SNP-seq libraries were sequenced using an Illumina Novaseq 6000 sequencer for 100 bp paired end reads.
  • DNA was prepared according to Example 3 with a sheared size of240-290 bp and an elution volume of 15 ⁇ l of water.
  • the DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 ⁇ l of CseDa01 dsDNA deaminase synthesized as described above with an incubation time of 1 hour at 37°C. After deamination reaction, 1 ⁇ l of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, MA) was added and incubated additional 30 min at 37°C. 1 ⁇ M of NEBNext Unique Dual Index Primers and 25 ⁇ l NEBNext Q.5U Master Mix (M0597, New England Biolabs, Ipswich, MA) were added to the DNA and PCR amplified.
  • P8111S Thermolabile Proteinase K
  • NEBNext Unique Dual Index Primers 25 ⁇ l NEBNext Q.5U Master Mix
  • the PCR reaction samples were mixed with 50 ⁇ l of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions.
  • the library was eluted in 15 ⁇ l of water.
  • the libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100.
  • the whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2 x 75 bp) was performed for all the sequencing runs.
  • Raw reads were first trimmed by the Trim Galore to remove adapter sequences and low-quality bases from the 3' end. Unpaired reads owing to adapter/quality trimming were also removed during this process.
  • the trimmed read sequences were C-to-T converted and were then mapped to the reference sequence and the complete sequences of lambda and pUC19 controls using the Bismark program with the default Bowtie 2 setting.
  • the first 5bp at the 5' end of R2 reads were removed to reduce end-repair errors and aligned read pairs that shared the same alignment start positions (5' ends) were regarded as PCR duplicates and were discarded.
  • Next deamination events (C- >T) were called by comparing the remaining good alignment sequences to the reference sequences using Bismark methylation extractor program.
  • the flanking 20bp sequences of all the called N4mC sites were extracted and a sequence logo using WebLogo 3 was generated. Results are shown in FIGURES 11A and 11B.
  • Example 12 Detection of N4mC and 5mC modified DNA with CseDa01 dsDNA deaminase and MGYPDa20 dsDNA deaminase
  • Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, MA) was added and incubated additional 30 min at 37°C.
  • 1 ⁇ M of NEBNext Unique Dual Index Primers and 25 ⁇ l NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, MA) were added to the DNA and PCR amplified.
  • the PCR reaction samples were mixed with 50 ⁇ l of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions.
  • the library was eluted in 15 ⁇ l of water.
  • the libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100.
  • the whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2 x 75 bp) was performed for all the sequencing runs. Base calling and demultiplexing were carried out with the standard Illumina pipeline. Raw reads were first trimmed by the Trim Galore to remove adapter sequences and low-quality bases from the 3' end. Unpaired reads owing to adapter/quality trimming were also removed during this process.
  • the trimmed read sequences were C-to-T converted and were then mapped to a composite reference sequence including the NEB1569 Thermus species M and NEB 394 Acinetobacter species H and the complete sequences of lambda and pUC19 controls using the Bismark program with the default Bowtie 2 setting.
  • the first 5bp at the 5' end of R2 reads were removed to reduce end-repair errors and aligned read pairs that shared the same alignment start positions (5' ends) were regarded as PCR duplicates and were discarded.
  • Next deamination events (C->T) were called by comparing the remaining good alignment sequences to the reference sequences using Bismark methylation extractor program.
  • the N4mC modification is called from the CseDa01 deaminase-treated library.
  • 5mC modification detection a differential methylation analysis was conducted between the MGYPDa20 deaminase-treated library (detect both N4mC and 5mC) and the CseDa01 deaminase-treated library (detect only N4mC) of the same sample to identify modified sites (i.e., 5mC) that are only detected in the MGYPDa20 library.
  • the differentially methylated sites were called by a logistic regression method with SLIM corrected Q.
  • methyltransferase recognition sequences were extracted, including 4bp upstream and 4bp downstream of all the modified sites, and the unique 9bp sequences were clustered using a hierarchical linkage method based on the difference between each pair of sequences.
  • a sequence logo was generated using WebLogo 3 for each cluster representing a distinct methyltransferase recognition motif.
  • HMMER3 Eddy, S. R. Accelerated Profile HMM Searches. PLOS Comput. Biol. 7, el002195 (2011)
  • cytosine deaminase sequence profiles was curated. 29 profiles came from the CDA clan (CL0109) from the Pfam (Mistry, J. et al. Pfam: The protein families database in 2021. Nucleic Acids Res.
  • IMG/VR a database of cultured and uncultured DNA Viruses and retroviruses. Nucleic Acids Res. 45, gkwl030 (2017); Chen, I.- M. A. et al. The IMG/M data management and analysis system v.6.0: new tools and advanced capabilities. Nucleic Acids Res. 49, D751-D763 (2021); Singleton, C. M. et al. Connecting structure to function with the recovery of over 1000 high-quality metagenome-assembled genomes from activated sludge using long-read sequencing. Nat. Commun. 12, 2009 (2021); and Da, B. et al. GenBank. Nucleic Acids Res. 41, (2013)).
  • each screened sequence was given a short name.
  • the names are arbitrary, but relate somehow to the database or species of origin for the sequence.
  • Da deaminase
  • MGYP Mgnify protein
  • Hm hot metagenome
  • VR IMG/VR
  • WWTP waste water treatment plant
  • chimera chimeric sequence
  • Anc ancestral sequence reconstruction.
  • Other prefixes are mostly two or three letters drawn from the name of the source organism or the source environment of the metagenome data.
  • sequences also have prefixes or suffixes of the form extN#, extC#, d#, Cd#, which indicate, respectively, N-terminal extensions, C-terminal extensions, N-terminal deletions, and C-terminal deletions of the indicated number of residues, compared to the candidate with the un-affixed name.
  • Amino acid sequence alignments were all calculated using MAFFT (v7.490) (Katoh, K. & Standley, D. M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 30, 772-780 (2013)) using globalpair mode. Trees were generated using raxml- ng (v. l.l)(Kozlov, A. M., Darriba, D., Flouri, T., Morel, B. & Stamatakis, A. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35, 4453-4455 (2019)). Ancestral sequence reconstructions were built from phylogenetic trees using raxml-ng (v. 1.1).
  • Double-stranded DNA deaminases disclosed herein may be used in many methods, processes, and workflows including, for example, the applications shown in Table 2 below.
  • Deamination products may contain one or more modified cytosines, for example, where the substrate dsDNA included such modified cytosines and the operative deaminase does not or only poorly deaminases such modified cytosines.
  • Each of the listed methods/applications may further comprise (a)(i) sequencing the deamination products and/or (ii) amplifying (e.g., by PCR) the deamination products to produce amplification products and sequencing the amplification products, in each of (a)(i) and (a)(ii), to produce sequence reads, and (b) optionally determining the kind and/or position of modified cytosines in the dsDNA substrate from the sequence reads.
  • Screening results for over 100 deaminases are shown in Table 3 below, in which APOBEC3A (a single-stranded DNA deaminase) served as a negative control. Many were observed to have double- stranded DNA deaminase activity under the conditions tested.
  • FIGURE 1 shows that displayed limited or modest activity under the specific conditions tested may have higher activity under alternative or optimized conditions.
  • C:C_dsDNA fraction of unmodified cytosines deaminated in double-stranded DNA
  • C:C_ssDNA fraction of unmodified cytosines deaminated in single-stranded DNA
  • C:CG_dsDNA fraction of unmodified cytosines in CpG context, deaminated in double- stranded DNA
  • C:CH_dsDNA fraction of unmodified cytosines followed by an adenine, cytosine, or thymine, deaminated in double-stranded DNA
  • 5mC:C_dsDNA fraction of cytosines with the 5-methyl modification, deaminated in double-stranded DNA.
  • 5hmC:C_dsDNA fraction of cytosines with the 5-hydroxymethyl modification, deaminated in double-stranded DNA.
  • C:C_dsDNA fraction of unmodified cytosines deaminated in double-stranded DNA
  • C:C_ssDNA fraction of unmodified cytosines deaminated in single-stranded DNA
  • C:CG_dsDNA fraction of unmodified cytosines in CpG context, deaminated in double- stranded DNA
  • C:CH_dsDNA fraction of unmodified cytosines followed by an adenine, cytosine, or thymine, deaminated in double-stranded DNA
  • 5mC:C_dsDNA fraction of cytosines with the 5-methyl modification, deaminated in double-stranded DNA.
  • 5hmC:C_dsDNA fraction of cytosines with the 5-hydroxymethyl modification, deaminated in double-stranded DNA.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2022/080345 2021-11-24 2022-11-22 Double-stranded dna deaminases Ceased WO2023097226A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA3236352A CA3236352A1 (en) 2021-11-24 2022-11-22 Double-stranded dna deaminases
CN202280089704.3A CN118574929A (zh) 2021-11-24 2022-11-22 双链dna脱氨酶
AU2022396419A AU2022396419A1 (en) 2021-11-24 2022-11-22 Double-stranded dna deaminases
EP22843953.5A EP4437093A2 (en) 2021-11-24 2022-11-22 Double-stranded dna deaminases
KR1020247020503A KR20240107347A (ko) 2021-11-24 2022-11-22 이중 가닥 dna 데아미나제
JP2024531071A JP2024543137A (ja) 2021-11-24 2022-11-22 二本鎖dnaデアミナーゼ

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163264513P 2021-11-24 2021-11-24
US63/264,513 2021-11-24
US18/058,115 2022-11-22
US18/058,115 US20230257730A1 (en) 2021-11-24 2022-11-22 Double-Stranded DNA Deaminases

Publications (2)

Publication Number Publication Date
WO2023097226A2 true WO2023097226A2 (en) 2023-06-01
WO2023097226A3 WO2023097226A3 (en) 2023-07-20

Family

ID=84981122

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2022/080345 Ceased WO2023097226A2 (en) 2021-11-24 2022-11-22 Double-stranded dna deaminases
PCT/US2023/067416 Ceased WO2024112441A1 (en) 2021-11-24 2023-05-24 Double-stranded dna deaminases and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2023/067416 Ceased WO2024112441A1 (en) 2021-11-24 2023-05-24 Double-stranded dna deaminases and uses thereof

Country Status (6)

Country Link
US (1) US20230257730A1 (cg-RX-API-DMAC7.html)
JP (1) JP2024543137A (cg-RX-API-DMAC7.html)
KR (1) KR20240107347A (cg-RX-API-DMAC7.html)
AU (1) AU2022396419A1 (cg-RX-API-DMAC7.html)
CA (1) CA3236352A1 (cg-RX-API-DMAC7.html)
WO (2) WO2023097226A2 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023245056A1 (en) 2022-06-14 2023-12-21 New England Biolabs, Inc. Methods and compositions for the simultaneous identification and mapping of dna methylation
WO2024112441A1 (en) * 2021-11-24 2024-05-30 New England Biolabs, Inc. Double-stranded dna deaminases and uses thereof
WO2024229433A1 (en) 2023-05-03 2024-11-07 Guardant Health, Inc. Methods for analysis of dna methylation
WO2025076551A1 (en) 2023-10-05 2025-04-10 New England Biolabs, Inc. Methyl cytosine-selective deaminases and uses thereof
WO2025137453A1 (en) 2023-12-20 2025-06-26 New England Biolabs, Inc. Compositions, methods, kits, and instruments for analyzing rna structure

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7888090B2 (en) 2004-03-02 2011-02-15 Ecole Polytechnique Federale De Lausanne Mutants of O6-alkylguanine-DNA alkyltransferase
US7939284B2 (en) 2001-04-10 2011-05-10 Ecole Polytechnique Federale De Lausanne Methods using O6-alkylguanine-DNA alkyltransferases

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same
US20250011748A1 (en) * 2020-01-28 2025-01-09 The Broad Institute, Inc. Base editors, compositions, and methods for modifying the mitochondrial genome
WO2022212584A1 (en) * 2021-04-01 2022-10-06 University Of Washington Bacterial dna cytosine deaminases for mapping dna methylation sites
WO2023097226A2 (en) * 2021-11-24 2023-06-01 New England Biolabs, Inc. Double-stranded dna deaminases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7939284B2 (en) 2001-04-10 2011-05-10 Ecole Polytechnique Federale De Lausanne Methods using O6-alkylguanine-DNA alkyltransferases
US7888090B2 (en) 2004-03-02 2011-02-15 Ecole Polytechnique Federale De Lausanne Mutants of O6-alkylguanine-DNA alkyltransferase

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"Oligonucleotide Synthesis: A Practical Approach", 1984, IRL PRESS
CHEN, I.-M. A ET AL.: "The IMG/M data management and analysis system v.6.0: new tools and advanced capabilities", NUCLEIC ACIDS RES., vol. 49, 2021, pages 570 - 578
DA, B ET AL.: "GenBank", NUCLEIC ACIDS RES., vol. 41, 2013
EDDY, S. R: "Accelerated Profile HMM Searches", PLOS COMPUT. BIOL, vol. 7, 2011, pages e1002195
FROMMER ET AL., PNAS, vol. 89, 1992, pages 1827 - 1831
HALEMARKHAM: "Oligonucleotides and Analogs: A Practical Approach", 1991, OXFORD UNIVERSITY PRESS
IYER ET AL., NUCLEIC ACIDS RES., vol. 39, 2011, pages 9473 - 9497
JOURNAL OF MOLECULAR BIOLOGY, vol. 215, no. 3, pages 403 - 410
JUMPER, J ET AL.: "Highly accurate protein structure prediction with AlphaFold", NATURE, vol. 533, 2021, pages 420 - 424
KATOH, KSTANDLEYD. M. MAFFT: "Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability", MOL. BIOL. EVOL, vol. 30, 2013, pages 772 - 780
KORNBERGBAKERW.H. FREEMAN: "DNA Replication", 1992
KOZLOV, A. M.DARRIBA, D.FLOURI, T.MOREL, BSTAMATAKISA. RAXML-NG: "a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference", BIOINFORMATICS, vol. 35, 2019, pages 4453 - 4455
LEHNINGER: "Biochemistry", 1975, WORTH PUBLISHERS
MISTRY, J ET AL.: "Pfam: The protein families database", NUCLEIC ACIDS RES., vol. 49, 2021, pages 412 - 419
MITCHELL, A. L ET AL.: "MGnify: the microbiome analysis resource", NUCLEIC ACIDS RES., vol. 48, 2020, pages 570 - 578
PAEZ-ESPINO, D ET AL.: "IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses", NUCLEIC ACIDS RES., vol. 45, 2017, pages 1030
SHENDURE ET AL., SCIENCE, vol. 309, 2005, pages 1728
SINGLETON ET AL.: "Dictionary of Microbiology and Molecular biology", 1994, JOHN WILEY AND SONS
SINGLETON, C. M ET AL.: "Connecting structure to function with the recovery of over 1000 high-quality metagenome-assembled genomes from activated sludge using long-read sequencing", NAT. COMMUN, vol. 12, 2009
STRACHANREAD: "Human Molecular Genetics", 1999, WILEY-LISS
VAISVILA ET AL., GENOME RES, vol. 202131, 2022, pages 1280 - 1289
VAISVILA ET AL., GENOME RES, vol. 31, 2021, pages 1280 - 1289
ZHANG ET AL., BIOL. DIRECT, vol. 7, 2012, pages 18
ZHANG ET AL.: "Others were selected from hmmsearch hits of the profiles described above against six different databases: UniProt, Mgnify, IMG/VR, IMG/M, wastewater treatment plant metagenomes, and GenBank (respectively, The UniProt Consortium. UniProt: the universal protein knowledgebase", NUCLEIC ACIDS RES., vol. 49, 2021, pages 480 - 489

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024112441A1 (en) * 2021-11-24 2024-05-30 New England Biolabs, Inc. Double-stranded dna deaminases and uses thereof
WO2023245056A1 (en) 2022-06-14 2023-12-21 New England Biolabs, Inc. Methods and compositions for the simultaneous identification and mapping of dna methylation
WO2024229433A1 (en) 2023-05-03 2024-11-07 Guardant Health, Inc. Methods for analysis of dna methylation
WO2025076551A1 (en) 2023-10-05 2025-04-10 New England Biolabs, Inc. Methyl cytosine-selective deaminases and uses thereof
WO2025137453A1 (en) 2023-12-20 2025-06-26 New England Biolabs, Inc. Compositions, methods, kits, and instruments for analyzing rna structure

Also Published As

Publication number Publication date
WO2023097226A3 (en) 2023-07-20
JP2024543137A (ja) 2024-11-19
US20230257730A1 (en) 2023-08-17
AU2022396419A1 (en) 2024-05-23
CA3236352A1 (en) 2023-06-01
WO2024112441A1 (en) 2024-05-30
KR20240107347A (ko) 2024-07-09

Similar Documents

Publication Publication Date Title
US20230257730A1 (en) Double-Stranded DNA Deaminases
US12595506B2 (en) Compositions and methods for analyzing modified nucleotides
US11124825B2 (en) Compositions and methods for analyzing modified nucleotides
CN102796728B (zh) 用于通过转座酶的dna片段化和标记的方法和组合物
JP2013514758A (ja) 修飾dnaを切断するための組成物、方法および関連する使用
CN114134205B (zh) 脱氨酶介导的dna中n4-甲基胞嘧啶的单碱基分辨率定位分析方法
Yang et al. A genome-phenome association study in native microbiomes identifies a mechanism for cytosine modification in DNA and RNA
US20250361553A1 (en) Methods and Compositions for the Simultaneous Identification and Mapping of DNA Methylation
US20230357838A1 (en) Double-Stranded DNA Deaminases and Uses Thereof
EP4437093A2 (en) Double-stranded dna deaminases
KR20260047611A (ko) 메틸화된 dna를 증폭하는 방법
EP4623076A1 (en) Double-stranded dna deaminases and uses thereof
WO2019099081A1 (en) Mapping the location, type and strand of damaged and/or mismatched nucleotides in double-stranded dna
US20250115953A1 (en) Methylcytosine-Selective Deaminases and Uses Thereof
US20250297301A1 (en) Single-stranded end preserving adaptors
WO2026093510A1 (en) Methods for nucleic acid analysis and for generating a library of tagged dna
Sérandour et al. Coupling exonuclease digestion with selective chemical labeling for base-resolution mapping of 5-hydroxymethylcytosine in genomic DNA
WO2026093508A1 (en) Methods for nucleic acid analysis
US20120219942A1 (en) Methods Employing McrA to Detect 5-Methyl Cytosine
Cohen-Karni The MspJI family of restriction endonucleases–Characterization, mechanism and application

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22843953

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 3236352

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2024531071

Country of ref document: JP

Kind code of ref document: A

Ref document number: 2022396419

Country of ref document: AU

Date of ref document: 20221122

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247020503

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020247020503

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2022843953

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022843953

Country of ref document: EP

Effective date: 20240624

WWE Wipo information: entry into national phase

Ref document number: 202280089704.3

Country of ref document: CN