WO2023091550A1

WO2023091550A1 - Methods of treating estrogen receptor-associated diseases

Info

Publication number: WO2023091550A1
Application number: PCT/US2022/050213
Authority: WO
Inventors: Leslie Hodges GALLAGHER; Cyrus L. Harmon; Peter J. Kushner
Original assignee: Olema Pharmaceuticals, Inc.
Priority date: 2021-11-18
Filing date: 2022-11-17
Publication date: 2023-05-25

Abstract

The present disclosure provides methods of treating certain diseases, disorders, or conditions, including estrogen receptor (ER)-associated metastatic breast cancer, or methods of preventing metastatic spread of cancer to liver, lungs, brain, bones, or other organs or tissues in a subject comprising administering to the subject a composition comprising a compound of Formula (I) or a pharmaceutically acceptable salt thereof, in some embodiments, the subject has previously been treated with a selective estrogen receptor modulator.

Description

METHODS OF TREATING ESTROGEN RECEPTOR-ASSOCIATED DISEASES

RELATED APPLICATIONS

[0001] This application claims priority to and benefit of U.S. Application No. 63/280,860, filed November 18, 2021, the entire contents of which is hereby incorporated by reference.

BACKGROUND

[0002] The estrogen receptor (ER) plays important roles in various cancers, including breast cancers. Metastatic breast cancer is associated with particularly poor prognoses, with the lungs and liver among the most common metastatic sites. At the time of diagnosis, 61.1% of patients with lung and/or liver metastases have hormone -receptor positive disease, e.g., ER-positive breast cancer. Xiao et al. Cancer Manag. Res. 2018; 10: 5329-5338. For patients with hormone receptor positive disease, e.g., ER-positive breast cancer, the median survival time after the development of lung metastases is 16-17 months. Chen et al. PeerJ. 2019; 7:e8298. The median survival time after the development of liver metastases is 7 months for patients with ER-positive breast cancer. Wyld et al. Br. J. Cancer 2003; 89(2): 284-290.

SUMMARY

[0003] The present disclosure provides new insights regarding compounds and/or regimens useful for the treatment of estrogen receptor (ER)-associated diseases, disorders, and conditions (e.g., cancer cells), including, for example for cancers that have metastasized to the liver, lungs, brain, bones, or other organs or tissues.

[0004] Compound 1 has been demonstrated to be particularly effective in the treatment of estrogen-receptor mediated diseases, including breast cancer and metastatic breast cancer.

Compound 1 [0005] For example, such effectiveness of Compound 1, as a monotherapy as well as in combination with certain secondary anti-cancer agents is reported in U.S. Pat. No. 10,292,971, U.S. Pat. No. 10,624,878, and PCT. App. Pub. No. WO2021/178846, each of which is incorporated by reference in its entirety.

[0006] The present disclosure encompasses, among other things, the surprising discovery that certain synergies are achieved when treating metastatic breast cancer (e.g., breast cancer that has metastasized to the brain, bone, liver, or lungs) with a compound of Formula I and certain anti- cancer agents, e.g., mTOR inhibitors, CDK4/6 inhibitors, PI3K inhibitors, and the like.

[0007] In some embodiments, the present disclosure provides technologies for treatment of estrogen receptor (ER) -associated diseases, disorders, and conditions (e.g., cancer cells) in subjects who have or are suspected of having metastatic cancer (e.g., metastatic breast cancer). For example, in some embodiments, the present disclosure teaches that a compound of Formula I:

I or a pharmaceutically acceptable salt thereof, is particularly useful for treatment, inhibition, or prevention of metastatic breast cancer in the liver, lungs, brain, bones, or other organs or tissues, alone or in combination with certain secondary anti-cancer agents, and wherein R^a, R¹, R², R³, R⁴, R⁶, R⁷, R⁸, X, and Y are as described generally in classes and subclasses herein.

[0008] Compounds of Formula I are characterized by their ability to act as complete estrogen receptor antagonists (CERANs). Such CERANs are characterized by their ability to (1) inhibit both activating function 1 (AF1) and activating function 2 (AF2), as complete anti-estrogen activity requires inactivation of both AF1 and AF2; (2) promote ER degradation; and (3) avoid partial ER agonist activity. An example of a complete estrogen receptor antagonist of Formula I that is particularly useful is Compound 1:

Compound 1 or a pharmaceutically acceptable salt thereof.

[0009] The present disclosure provides insights relating to certain complete estrogen receptor antagonists that are orally bioavailable, and in particular, certain synergies achieved when CERANs described herein are administered in combination with an anti-cancer agent. Such a combination provides improved tumor management relative to use of certain CERANs and anti- cancer agents when administered as monotherapies. The present disclosure, therefore, provides methods of using certain complete estrogen receptor antagonists that are orally bioavailable, alone or in combination with certain anti-cancer agents, specifically to treat breast cancer that has metastasized to the brain, liver, lungs, bone, or other organs or tissues. In some embodiments, the present disclosure provides such methods with respect to an ER-associated disease, disorder or condition (e.g., an ER-associated cancer). In some embodiments, a provided method comprises a step of: administering to a subject suffering from an ER-associated cancer a composition that comprises and/or delivers to the subject's brain, bone, liver, and lung (e.g., upon oral administration) a complete estrogen receptor antagonist and an anti-cancer agent, wherein the subject has been determined to have or is suspected of having metastatic breast cancer (e.g., breast cancer that has metastasized to the liver, lungs, brain, bones, or other organs or tissues).

BRIEF DESCRIPTION OF THE DRAWING

[0010] FIG. 1 is a series of images illustrating tumor growth in mice at 74 days post- treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0011] FIG. 2A is a dose-response plot measuring the total flux on the right and left sides for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after cell injection to establish breast cancer tumors. [0012] FIG. 2B is a dose-response plot measuring the total flux in the belly for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after cell injection to establish breast cancer tumors.

[0013] FIG. 3 is a plot illustrating the total flux on the right and left sides at 74 days post- treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0014] FIG. 4 is a chart illustrating the tumor weight for mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

[0015] FIG. 5A is a series of images illustrating tumor growth at 31 days post-treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0016] FIG. 5B is a dose-response plot measuring the total flux on the right and left sides for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0017] FIG. 5C is a dose-response plot measuring the total flux in the belly for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0018] FIG. 6A is a dose-response plot measuring the total flux on the right and left sides for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0019] FIG. 6B is a dose-response plot measuring the total flux in the belly for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0020] FIG. 7 is a plot illustrating the total flux on the right and left sides at 45 days post- treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0021] FIG. 8 is a series of images illustrating the growth of liver metastases in mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

[0022] FIG. 9A is a series of images illustrating the growth of lung metastases in mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

[0023] FIG. 9B is a chart illustrating the percent total organ area affected by lung metastases for mice treated with vehicle, fulvestrant, and varying doses of Compound 1. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

Definitions

[0024] About or approximately: As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In general, those skilled in the art, familiar within the context, will appreciate the relevant degree of variance encompassed by "about" or "approximately" in that context. For example, in some embodiments, the term "approximately" or "about" may encompass a range of values that are within (i.e., ±) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.

[0025] Administering: As used herein, the term "administering" or "administration" typically refers to the administration of a composition to a subject to achieve delivery of an agent that is, or is included in, a composition to a target site or a site to be treated. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may be parenteral. In some embodiments, administration may be oral. In some particular embodiments, administration may be intravenous. In some particular embodiments, administration may be subcutaneous. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and/or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time. In some embodiments, administration may comprise a prime- and-boost protocol. A prime-and-boost protocol can include administration of a first dose of a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) followed by, after an interval of time, administration of a second or subsequent dose of a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine). In the case of an immunogenic composition, a prime-and-boost protocol can result in an increased immune response in a patient. [0026] Aliphatic: The term “aliphatic” refers to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “cycloaliphatic”), that has a single point or more than one points of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-12 aliphatic carbon atoms. As used herein, it is understood that an aliphatic group can also be bivalent (e.g., encompass a bivalent hydrocarbon chain that is saturated or contains one or more units of unsaturation, such as, for example, -CH₂-, -CH₂-CH₂-, -CH₂-CH₂-CH₂-, and so on). In some embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms (e.g., C_1-6). In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms (e.g., C_1-5). In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms (e.g., C_1-4). In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms (e.g., C_1-3), and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms (e.g., C_1-2). In some embodiments, “cycloaliphatic” refers to a monocyclic C_3-8 hydrocarbon or a bicyclic C_7-10 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point or more than one points of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, or alkynyl groups and hybrids thereof. A preferred aliphatic group is C1-6 alkyl. [0027] Alkyl: The term “alkyl”, used alone or as part of a larger moiety, refers to a saturated, optionally substituted straight or branched chain hydrocarbon group having (unless otherwise specified) 1-12, 1-10, 1-8, 1-6, 1-4, 1-3, or 1-2 carbon atoms (e.g., C1-12, C1-10, C1-8, C1-6, C1-4, C1- ₃, or C_1-2). Exemplary alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, and heptyl. [0028] Alkenyl: The term “alkenyl”, used alone or as part of a larger moiety, refers to an optionally substituted straight or branched chain or cyclic hydrocarbon group having at least one double bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms(e.g., C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, or C_2-3). Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and heptenyl. The term “cycloalkenyl” refers to an optionally substituted non-aromatic monocyclic or multicyclic ring system containing at least one carbon-carbon double bond and having about 3 to about 10 carbon atoms. Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenyl, and cycloheptenyl. [0029] Alkynyl: The term “alkynyl”, used alone or as part of a larger moiety, refers to an optionally substituted straight or branched chain hydrocarbon group having at least one triple bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, or C_2-3). Exemplary alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, hexynyl, and heptynyl. [0030] Analog: As used herein, the term “analog” refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an “analog” shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g., by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance. [0031] Aryl: The term “aryl” refers to monocyclic and bicyclic ring systems having a total of five to fourteen ring members (e.g., C₅-C₁₄), wherein at least one ring in the system is aromatic and wherein each ring in the system contains three to seven ring members. In some embodiments, an “aryl” group contains between six and twelve total ring members (e.g., C6-C12). The term “aryl” may be used interchangeably with the term “aryl ring”. In certain embodiments of the present invention, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Unless otherwise specified, “aryl” groups are hydrocarbons. In some embodiments, an “aryl” ring system is an aromatic ring (e.g., phenyl) that is fused to a non-aromatic ring (e.g., cycloalkyl). Examples of aryl rings include that are fused include

,

, and

. [0032] Associated: Two events or entities are “associated” with one another, as that term is used herein, if the presence, level and/or form of one is correlated with that of the other. For example, a particular entity (e.g., polypeptide, genetic signature, metabolite, microbe, etc) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and/or form correlates with incidence of and/or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and/or remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.

[0033] Biological sample: As used herein, the term “biological sample” typically refers to a sample obtained or derived from a biological source (e.g., a tissue or organism or cell culture) of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample is or comprises biological tissue or fluid. In some embodiments, a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids (e.g., sperm, sweat, tears), secretions, and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, obtained cells are or include cells from an individual from whom the sample is obtained. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a “processed sample” may comprise, for example, nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.

[0034] Carrier: As used herein, the term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a composition is administered. In some exemplary embodiments, carriers can include sterile liquids, such as, for example, water and oils, including oils of petroleum, animal, vegetable or synthetic origin, such as, for example, peanut oil, soybean oil, mineral oil, sesame oil and the like. In some embodiments, carriers are or include one or more solid components.

[0035] Combination therapy: As used herein, the term “combination therapy” refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents or modality(ies)). In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all “doses” of a first regimen are administered prior to administration of any doses of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, “administration” of combination therapy may involve administration of one or more agent(s) or modality(ies) to a subject receiving the other agent(s) or modality(ies) in the combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily at the same time), although in some embodiments, two or more agents, or active moieties thereof, may be administered together in a combination composition, or even in a combination compound (e.g., as part of a single chemical complex or covalent entity).

[0036] Comparable: As used herein, the term “comparable” refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison therebetween so that one skilled in the art will appreciate that conclusions may reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc. to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.

[0037] Composition: Those skilled in the art will appreciate that the term “composition” may be used to refer to a discrete physical entity that comprises one or more specified components. In general, unless otherwise specified, a composition may be of any form - e.g., gas, gel, liquid, solid, etc.

[0038] Cycloaliphatic: As used herein, the term “cycloaliphatic” refers to a monocyclic C3-8 hydrocarbon or a bicyclic C_7-10 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point or more than one points of attachment to the rest of the molecule.

[0039] Cycloalkyl: As used herein, the term “cycloalkyl” refers to an optionally substituted saturated ring monocyclic or polycyclic system of about 3 to about 10 ring carbon atoms. Exemplary monocyclic cycloalkyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0040] Dosage form or unit dosage form: Those skilled in the art will appreciate that the term “dosage form” may be used to refer to a physically discrete unit of an active agent (e.g., a therapeutic or diagnostic agent) for administration to a subject. Typically, each such unit contains a predetermined quantity of active agent. In some embodiments, such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen). Those of ordinary skill in the art appreciate that the total amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.

[0041] Dosing regimen or therapeutic regimen: Those skilled in the art will appreciate that the terms “dosing regimen” and “therapeutic regimen” may be used to refer to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which is separated in time from other doses. In some embodiments, individual doses are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount. In some embodiments, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).

[0042] Excipient: As used herein, the term “excipient” refers to a non-therapeutic agent that may be included in a pharmaceutical composition, for example, to provide or contribute to a desired consistency or stabilizing effect. Suitable pharmaceutical excipients include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.

[0043] Heteroaliphatic. The term “hetero aliphatic” or “heteroaliphatic group”, as used herein, denotes an optionally substituted hydrocarbon moiety having, in addition to carbon atoms, from one to five heteroatoms, that may be straight-chain (i.e., unbranched), branched, or cyclic (“heterocyclic”) and may be completely saturated or may contain one or more units of unsaturation, but which is not aromatic. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quatemized form of a basic nitrogen. The term “nitrogen” also includes a substituted nitrogen. Unless otherwise specified, heteroaliphatic groups contain 1-10 carbon atoms wherein 1-3 carbon atoms are optionally and independently replaced with heteroatoms selected from oxygen, nitrogen, and sulfur. In some embodiments, heteroaliphatic groups contain 1-4 carbon atoms, wherein 1-2 carbon atoms are optionally and independently replaced with heteroatoms selected from oxygen, nitrogen, and sulfur. In yet other embodiments, heteroaliphatic groups contain 1-3 carbon atoms, wherein 1 carbon atom is optionally and independently replaced with a heteroatom selected from oxygen, nitrogen, and sulfur. Suitable heteroaliphatic groups include, but are not limited to, linear or branched, heteroalkyl, heteroalkenyl, and heteroalkynyl groups. For example, a 1- to 10-atom heteroaliphatic group includes the following exemplary groups: -O-CH3, -CH₂-O-CH3, -O-CH₂- CH₂-O-CH₂-CH₂-O-CH₃, and the like.

[0044] Heteroaryl: The terms “heteroaryl” and “heteroar-”, used alone or as part of a larger moiety, e.g., “heteroaralkyl”, or “heteroaralkoxy”, refer to monocyclic or bicyclic ring groups having 5 to 12 ring atoms (e.g., 5- to 6- membered monocyclic heteroaryl or 9- to 12-membered bicyclic heteroaryl); having 6, 10, or 14 π-electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quatemized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, imidazo[l,2-a]pyrimidinyl, imidazo[l,2-a]pyridyl, imidazo[4,5-b]pyridyl, imidazo[4,5-c]pyridyl, pyrrolopyridyl, pyrrolopyrazinyl, thienopyrimidinyl, triazolopyridyl, and benzoisoxazolyl. The terms “heteroaryl” and “heteroar-”, as used herein, also include groups in which a hetero aromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring (i.e., a bicyclic heteroaryl ring having 1 to 3 heteroatoms). Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzotriazolyl, benzothiazolyl, benzothiadiazolyl, benzoxazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4/7-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, pyrido[2,3-b]-1,4-oxazin-3(4H)-one, 4H- thieno[3,2-b]pyrrole, and benzoisoxazolyl. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring”, “heteroaryl group”, or “heteroaromatic”, any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0045] Heteroatom: The term “heteroatom” as used herein refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quatemized form of a basic nitrogen.

[0046] Heterocycle: As used herein, the terms “heterocycle”, “heterocyclyl”, “heterocyclic radical”, and “heterocyclic ring” are used interchangeably and refer to a stable 3- to 8-membered monocyclic, a 7- to 12-membered bicyclic, or a 10- to 16-membered polycyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, such as one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR⁺ (as in N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, azetidinyl, oxetanyl, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and thiamorpholinyl. A heterocyclyl group may be mono-, bi-, tri-, or polycyclic, preferably mono-, bi-, or tricyclic, more preferably mono- or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted. A bicyclic heterocyclic ring also includes groups in which the heterocyclic ring is fused to one or more aryl rings. Exemplary bicyclic heterocyclic ggrroouuppss include indolinyl, isoindolinyl, benzodioxolyl, 1,3- dihydroisobenzofuranyl, 2,3-dihydrobenzofuranyl, tetrahydroquinolinyl,

,

, and

, A bicyclic heterocyclic ring can also be a spirocyclic ring system (e.g., 7- to 11-membered spirocyclic fused heterocyclic ring having, in addition to carbon atoms, one or more heteroatoms as defined above (e.g., one, two, three or four heteroatoms)). A bicyclic heterocyclic ring can also be a bridged ring system (e.g., 7- to 11 -membered bridged heterocyclic ring having one, two, or three bridging atoms.

[0047] Oral: The phrases “oral administration” and “administered orally” as used herein have their art-understood meaning referring to administration by mouth of a compound or composition. [0048] Parenteral: The phrases “parenteral administration” and “administered parenterally” as used herein have their art-understood meaning referring to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0049] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond between ring atoms. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aromatic (e.g., aryl or heteroaryl) moieties, as herein defined.

[0050] Patient or subject: As used herein, the term “patient” or “subject” refers to any organism to which a provided composition is or may be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and/or therapeutic purposes. Typical patients or subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and/or humans). In some embodiments, a patient is a human. In some embodiments, a patient or a subject is suffering from or susceptible to one or more disorders or conditions. In some embodiments, a patient or subject displays one or more symptoms of a disorder or condition. In some embodiments, a patient or subject has been diagnosed with one or more disorders or conditions. In some embodiments, a patient or a subject is receiving or has received certain therapy to diagnose and/or to treat a disease, disorder, or condition.

[0051] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in unit dose amount appropriate for administration in a therapeutic or dosing regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0052] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0053] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non- toxic compatible substances employed in pharmaceutical formulations.

[0054] Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2- hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate.

[0055] Polycyclic: As used herein, the term “polycyclic” refers to a saturated or unsaturated ring system having two or more rings (for example, heterocyclyl rings, heteroaryl rings, cycloalkyl rings, or aryl rings), having between 7 and 20 atoms, in which one or more carbon atoms are common to two adjacent rings. For example, in some embodiments, a polycyclic ring system refers to a saturated or unsaturated ring system having three or more rings (for example, heterocyclyl rings, heteroaryl rings, cycloalkyl rings, or aryl rings), having between 14 and 20 atoms, in which one or more carbon atoms are common to two adjacent rings. The rings in a polycyclic ring system may be fused (i.e., bicyclic or tricyclic), spirocyclic, or a combination thereof.

[0056] Polypeptide: The term “polypeptide”, as used herein, typically has its art-recognized meaning of a polymer of at least three amino acids or more. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional, biologically active, or characteristic fragments, portions or domains (e.g. , fragments, portions, or domains retaining at least one activity) of such complete polypeptides. In some embodiments, polypeptides may contain L-amino acids, D-amino acids, or both and/or may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, polypeptides may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof (e.g., may be or comprise peptidomimetics).

[0057] Prevent or prevention: As used herein, the terms “prevent” or “prevention”, when used in connection with the occurrence of a disease, disorder, and/or condition, refer to reducing the risk of developing the disease, disorder and/or condition and/or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.

[0058] Reference: As used herein describes a standard or control relative to which a comparison is performed. For example, in some embodiments, an agent, animal, individual, population, sample, sequence or value of interest is compared with a reference or control agent, animal, individual, population, sample, sequence or value. In some embodiments, a reference or control is tested and/or determined substantially simultaneously with the testing or determination of interest. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference or control is determined or characterized under comparable conditions or circumstances to those under assessment. Those skilled in the art will appreciate when sufficient similarities are present to justify reliance on and/or comparison to a particular possible reference or control.

[0059] Sample: As used herein, the term “sample” typically refers to an aliquot of material obtained or derived from a source of interest. In some embodiments, a source of interest is a biological or environmental source. In some embodiments, a source of interest may be or comprise a cell, tissue, or organism, such as a microbe, a plant, or an animal (e.g., a human). In some embodiments, a source of interest is or comprises biological tissue or fluid. In some embodiments, a source of interest may be or comprise a preparation generated in a production run. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample.

[0060] Substituted or optionally substituted: As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. “Substituted” applies to one or more hydrogens that are either explicit or implicit from the structure (e.g.,

refers to at least

; and

refers to at least

or

). Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes provided herein. Groups described as being “substituted” preferably have between 1 and 4 substituents, more preferably 1 or 2 substituents. Groups described as being “optionally substituted” may be unsubstituted or be “substituted” as described above.

[0061] Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen; -(CH₂)_0-4R°; -((CH₂)_0-4OR°; -O(CH₂)_0-4R°, -O- (CH₂)_0-4C(O)OR°; -(CH₂)(MCH(OR°)₂; -(CH₂)_0-4SR°; -(CH₂)_0-4Ph. which may be substituted with R°; -(CH₂)_0-4O(CH₂)_0-1Ph which may be substituted with R°; -CH=CHPh, which may be substituted with R°; –(CH₂)_0–4O(CH₂)_0–1-pyridyl which may be substituted with R°; –NO₂; –CN; –N₃; (CH₂)_0–4N(R°)2; –(CH₂)_0–4N(R°)C(O)R°; –N(R°)C(S)R°; –(CH₂)_0–4N(R°)C(O)NR°₂; N(R°)C(S)NR°₂; –(CH₂)_0–4N(R°)C(O)OR°; -N(R°)N(R°)C(O)R°; N(R°)N(R°)C(O)NR°₂; N(R°)N(R°)C(O)OR°; –(CH₂)_0–4C(O)R°; C(S)R°; –(CH₂)_0–4C(O)OR°; –(CH₂)_0–4C(O)SR°; (CH₂)_0–4C(O)OSiR°₃; –(CH₂)_0–4OC(O)R°; –OC(O)(CH₂)_0–4SR°; –(CH₂)_0–4SC(O)R°; –(CH₂)_0– ₄C(O)NR°₂; –C(S)NR°₂; –C(S)SR°; –SC(S)SR°, (CH₂)_0–4OC(O)NR°₂; C(O)N(OR°)R°; – C(O)C(O)R°; –C(O)CH₂C(O)R°; –C(NOR°)R°; (CH₂)_0–4SSR°; –(CH₂)_0–4S(O)₂R°; –(CH₂)_0– ₄S(O)₂OR°; –(CH₂)_0–4OS(O)₂R°; –S(O)₂NR°₂; (CH₂)_0–4S(O)R°; N(R°)S(O)₂NR°₂; – N(R°)S(O)₂R°; –N(OR°)R°; –C(NH)NR°₂; –P(O)₂R°; P(O)R°₂; OP(O)R°₂; –OP(O)(OR°)2; SiR°3; –(C_1–4 straight or branched alkylene)O–N(R°)₂; or –(C_1–4 straight or branched alkylene)C(O)O– N(R°)2, wherein each R° may be substituted as defined below and is independently hydrogen, C1– ₆ aliphatic, –CH₂Ph, –O(CH₂)_0–1Ph, -CH₂-(5- to 6-membered heteroaryl ring), or a 3- to 6- membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3- to 12- membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below. [0062] Suitable monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen, –(CH₂)_0–2R^●, –(haloR^●), –(CH₂)_0–2OH, –(CH₂)_0–2OR^●, –(CH₂)_0–2CH(OR^●)₂, O(haloR^●), –CN, –N₃, –(CH₂)_0– ₂C(O)R^●, –(CH₂)_0–2C(O)OH, –(CH₂)_0–2C(O)OR^{^}, –(CH₂)_0–2SR^●, –(CH₂)_0–2SH, –(CH₂)_0–2NH₂, – (CH₂)0–2NHR^●, –(CH₂)0–2NR^●2, –NO2, –SiR^●3, –OSiR^●3, C(O)SR^●, –(C1–4 straight or branched alkylene)C(O)OR^●, or –SSR^● wherein each R^{^} is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently selected from C_1–4 aliphatic, – CH₂Ph, –O(CH₂)0–1Ph, or a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =O and =S. [0063] Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =O (“oxo”), =S, =NNR^* ₂, =NNHC(O)R^*, =NNHC(O)OR^*, =NNHS(O)₂R^*, =NR^*, =NOR^*, –O(C(R^*2))2–3O–, or –S(C(R^*2))2–3S–, wherein each independent occurrence of R^* is selected from hydrogen, C1–6 aliphatic which may be substituted as defined below, or an unsubstituted 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: –O(CR^* ₂)_2–3O–, wherein each independent occurrence of R^* is selected from hydrogen, C_1–6 aliphatic which may be substituted as defined below, or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. [0064] Suitable substituents on the aliphatic group of R^* include halogen, –R^●, (haloR^●), OH, –OR^●, –O(haloR^●), –CN, –C(O)OH, –C(O)OR^●, –NH2, –NHR^●, –NR^●2, or –NO2, wherein each R^● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C_1–4 aliphatic, –CH₂Ph, –O(CH₂)_0–1Ph, or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. [0065] Suitable substituents on a substitutable nitrogen of an “optionally substituted” group include –R^†, –NR^† ₂, –C(O)R^†, –C(O)OR^†, –C(O)C(O)R^†, –C(O)CH₂C(O)R^†, S(O)₂R^†, S(O)₂NR^† ₂, –C(S)NR^†2, –C(NH)NR^†2, or –N(R^†)S(O)₂R^†; wherein each R^† is independently hydrogen, C1–6 aliphatic which may be substituted as defined below, unsubstituted –OPh, or an unsubstituted 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R^†, taken together with their intervening atom(s) form an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. [0066] Suitable substituents on the aliphatic group of R^† are independently halogen, –R^●, (haloR^●), –OH, –OR^●, –O(haloR^●), –CN, –C(O)OH, –C(O)OR^●, –NH₂, –NHR^●, –NR^● ₂, or NO₂, wherein each R^● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1–4 aliphatic, –CH₂Ph, –O(CH₂)0–1Ph, or a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. [0067] Small molecule: As used herein, the term “small molecule” means a low molecular weight organic and/or inorganic compound. In general, a “small molecule” is a molecule that is less than about 5 kilodaltons (kD) in size. In some embodiments, a small molecule is less than about 4 kD, 3 kD, about 2 kD, or about 1 kD. In some embodiments, the small molecule is less than about 800 daltons (D), about 600 D, about 500 D, about 400 D, about 300 D, about 200 D, or about 100 D. In some embodiments, a small molecule is less than about 2000 g/mol, less than about 1500 g/mol, less than about 1000 g/mol, less than about 800 g/mol, or less than about 500 g/mol. In some embodiments, a small molecule is not a polymer.

[0068] Those of ordinary skill in the art, reading the present disclosure, will appreciate that certain small molecule compounds described herein, including, for example, oligosaccharide compounds described herein, may be provided and/or utilized in any of a variety of forms such as, for example, crystal forms (e.g., polymorphs, solvates, etc), salt forms, protected forms, pro-drug forms, ester forms, isomeric forms (e.g., optical and/or structural isomers), isotopic forms, etc.

[0069] Those of ordinary skill in the art will appreciate that certain small molecule compounds (e.g., oligosaccharide compounds described herein) have structures that can exist in one or more steroisomeric forms. In some embodiments, such a small molecule may be utilized in accordance with the present disclosure in the form of an individual enantiomer, diastereomer or geometric isomer, or may be in the form of a mixture of stereoisomers; in some embodiments, such a small molecule may be utilized in accordance with the present disclosure in a racemic mixture form.

[0070] Those of skill in the art will appreciate that certain small molecule compounds (e.g., oligosaccharide compounds described herein) have structures that can exist in one or more tautomeric forms. In some embodiments, such a small molecule may be utilized in accordance with the present disclosure in the form of an individual tautomer, or in a form that interconverts between tautomeric forms.

[0071] Those of skill in the art will appreciate that certain small molecule compounds (e.g., oligosaccharide compounds described herein) have structures that permit isotopic substitution (e.g., ²H or ³H for H; ⁿC, ¹³C or ¹⁴C for ¹²C; ¹³N or ¹⁵N for ¹⁴N; ¹⁷O or ¹⁸O for ¹⁶O; ³⁶C1 for ³⁵C1 or ³⁷C1; ¹⁸F for ¹⁹F; ¹³¹I for ¹²⁷I; etc.). In some embodiments, such a small molecule may be utilized in accordance with the present disclosure in one or more isotopically modified forms, or mixtures thereof. [0072] In some embodiments, reference to a particular small molecule compound (e.g., oligosaccharide compounds described herein) may relate to a specific form of that compound. In some embodiments, a particular small molecule compound may be provided and/or utilized in a salt form (e.g., in an acid-addition or base-addition salt form, depending on the compound); in some such embodiments, the salt form may be a pharmaceutically acceptable salt form.

[0073] In some embodiments, where a small molecule compound is one that exists or is found in nature, that compound may be provided and/or utilized in accordance in the present disclosure in a form different from that in which it exists or is found in nature. Those of ordinary skill in the art will appreciate that, in some embodiments, a preparation of a particular small molecule compound (e.g., an oligosaccharide compound described herein) that contains an absolute or relative amount of the compound, or of a particular form thereof, that is different from the absolute or relative (with respect to another component of the preparation including, for example, another form of the compound) amount of the compound or form that is present in a reference preparation of interest (e.g., in a primary sample from a source of interest such as a biological or environmental source) is distinct from the compound as it exists in the reference preparation or source. Thus, in some embodiments, for example, a preparation of a single stereoisomer of a small molecule compound may be considered to be a different form of the compound than a racemic mixture of the compound; a particular salt of a small molecule compound may be considered to be a different form from another salt form of the compound; a preparation that contains only a form of the compound that contains one conformational isomer ((Z) or (E)) of a double bond may be considered to be a different form of the compound from one that contains the other conformational isomer ((E) or (Z)) of the double bond; a preparation in which one or more atoms is a different isotope than is present in a reference preparation may be considered to be a different form; etc.

[0074] Those skilled in the art will further appreciate that, in small molecule structures, the symbol , as used herein, refers to a point of attachment between two atoms.

[0075] Therapeutic agent: As used herein, the phrase “therapeutic agent” in general refers to any agent that elicits a desired pharmacological effect when administered to an organism. In some embodiments, an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population. In some embodiments, the appropriate population may be a population of model organisms. In some embodiments, an appropriate population may be defined by various criteria, such as a certain age group, gender, genetic background, preexisting clinical conditions, etc. In some embodiments, a therapeutic agent is a substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition. In some embodiments, a “therapeutic agent” is an agent that has been or is required to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a “therapeutic agent” is an agent for which a medical prescription is required for administration to humans.

[0076] Treat: As used herein, the terms “treat,” “treatment,” or “treating” refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and/or condition, for example, for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

Complete Estrogen Receptor Antagonists

[0077] The present disclosure teaches particular usefulness of compound(s) that are complete estrogen receptor antagonists (CERANs) in the treatment of ER+ breast cancers, including, for example, metastatic breast cancer (e.g., breast cancer that has metastasized to the liver, lungs, brain, bones, or other organs or tissues), alone or in combination with anti-cancer agents.

[0078] Previous work reported in WO 2021/178846 demonstrates particular effectiveness of complete estrogen receptor antagonists for the treatment of certain metastatic breast cancers, for example, breast cancer that has metastasized to the brain. The present disclosure encompasses, among other things, an insight that CERANs achieve certain beneficial synergies when used with other anti-cancer agents in the treatment of certain ER+ breast cancers, including metastatic breast cancer of, for example, the brain, bone, lungs, and liver.

[0079] In some embodiments, a “complete estrogen receptor antagonist” (a “CERAN”), as that term is used herein, is characterized by complete antagonism of the estrogen receptor without residual estrogen receptor agonist activity. For example, it is understood that a complete estrogen antagonist is an agent (e.g., a small molecule compound) that shows ER antagonism and no ER agonism in one or more of ERa protein level assays, MCF-7 cell line assays, Ishikawa cell line assays (measuring wild type ER and certain mutants including mutants lacking AF1 and/or AF2 domains), and rodent uterine weight gain assays. See, generally, WO 2017/059139 and U.S. 9,018,244. Alternatively or additionally, in some embodiments, a complete estrogen receptor antagonist has three characteristics: it (1) inhibits both activating function 1 (AF1) and activating function 2 (AF2), as complete anti-estrogen activity requires inactivation of both AF1 and AF2; (2) promotes ER degradation; and (3) lacks the partial ER agonist activity observed with certain other agents. Without being bound by theory, it is understood that complete inhibition of both AF1 and AF2 is required for complete estrogen receptor activity, activating mutations in the gene that codes for estrogen receptor 1 allows for activation of both AF1 and AF2 even in the absence of estrogen.

[0080] Currently, fulvestrant is the only approved therapy that has each characteristic of a complete estrogen receptor antagonist. But, fulvestrant suffers from numerous shortcomings, including poor oral bioavailability.

[0081] The present disclosure encompasses the insight that certain orally bioavailable compounds that are capable of completely antagonizing the estrogen receptor (i.e., that are complete estrogen receptor antagonists) are suitable for treatment of breast cancer metastases (e.g., breast cancer that has metastasized to the liver, lungs, brain, bones, or other organs or tissues) related to ER-associated diseases or disorders. Suitable complete estrogen receptor antagonists include those reported in WO 2012/084711, WO 2014/191726, WO 2016/097072, WO 2017/059139, WO 2019/245974, and WO 2021/178846, each of which is incorporated herein by reference. In some embodiments, a complete estrogen receptor antagonist is a compound of Formula I:

I or a pharmaceutically acceptable salt thereof, wherein:

X is -NH-, -CH₂-, or -O-;

Y is

or ;

R^a is hydrogen or halogen;

R¹, R², R³, and R⁴ are each independently selected from hydrogen and halogen;

R⁵ is hydrogen or an optionally substituted group selected from C₁-C₆ aliphatic and optionally substituted 2- to 6-membered heteroaliphatic;

R⁶ is hydrogen or an optionally substituted group selected from C₁-C₆ aliphatic and C₁-C₆ haloalkyl; and

R⁷ and R⁸ are each independently selected from hydrogen and optionally substituted C₁-C₆ aliphatic.

[0082] In some embodiments, as described generally above, X is -NH-, -CH₂-, or -O-. In some embodiments, X is -NH- or -O-. In some embodiments, X is -CH₂- or -O-. In some embodiments, X is -NH- or -CH₂-. In some embodiments, X is -NH-. In some embodiments, X is -CH₂-. In some embodiments, X is -O-.

[0083] In some embodiments, as described generally above, R^a is hydrogen or halogen. In some embodiments, R^ais hydrogen. In some embodiments, R^a is halogen. In some embodiments, R^a is fluoro, bromo, or chloro. In some embodiments, R^a is fluoro.

[0084] In some embodiments, as described generally above, R¹, R², R³, and R⁴ are each independently selected from hydrogen and halogen. In some embodiments, R¹, R², R³, and R⁴ are each hydrogen. In some embodiments, R¹, R², and R³ are each hydrogen and R⁴ is halogen. In some embodiments, R¹, R², and R³ are each hydrogen and R⁴ is fluoro. In some embodiments, R², R³, and R⁴ are each hydrogen and R¹ is halogen. In some embodiments, R², R³, and R⁴ are each hydrogen and R¹ is fluoro. In some embodiments, R¹, R³, and R⁴ are each hydrogen and R² is halogen. In some embodiments, R¹, R³, and R⁴ are each hydrogen and R² is fluoro. In some embodiments, R¹, R², and R⁴ are each hydrogen and R³ is halogen. In some embodiments, R¹, R², and R⁴ are each hydrogen and R³ is fluoro. In some embodiment, R¹ and R² are each hydrogen and R³ and R⁴ are each halogen. In some embodiment, R¹ and R² are each hydrogen and R³ and R⁴ are each fluoro. In some embodiment, R³ and R⁴ are hydrogen and R¹ and R² are halogen. In some embodiment, R³ and R⁴ are hydrogen and R¹ and R² are fluoro. [0085] In some embodiments, R¹ and R² are each hydrogen, and R³ and R⁴ are each hydrogen or halogen, and when one of R³ or R⁴ is halogen, the other of R³ or R⁴ is hydrogen. In some embodiments, R¹ and R² are each hydrogen, and R³ and R⁴ are each hydrogen or fluoro, and when one of R³ or R⁴ is fluoro, the other of R³ or R⁴ is hydrogen. [0086] In some embodiments, as described generally above, Y is

or

. In some embodiments, Y is . In some embodiments, Y is

. [0087] In some embodiments, as described generally above, R⁵ is hydrogen or an optionally substituted group selected from C₁-C₆ aliphatic and 2- to 6-membered heteroaliphatic. In some embodiments, R⁵ is an optionally substituted C₁-C₆ aliphatic or 2- to 6-membered heteroaliphatic. In some embodiments, R⁵ is an optionally substituted C₁-C₆ aliphatic. In some embodiments, R⁵ is optionally substituted C₁-C₆ alkyl. In some embodiments, R⁵ is unsubstituted C₁-C₆ alkyl. In some embodiments, R⁵ is methyl, ethyl, propyl, butyl, pentyl, or hexyl. In some embodiments, R⁵ is methyl, ethyl, n-propyl, n-butyl, n-pentyl, or n-hexyl. In some embodiments, R⁵ is n-propyl. [0088] In some embodiments, R⁵ is C₁-C₆ aliphatic substituted with one or more halo. In some embodiments, R⁵ is C₁-C₆ alkyl substituted with one or more halo. In some embodiments R⁵ is – CH₂-halo, -CH₂-CH₂-halo, –CH₂-CH₂-CH₂-halo, or -CH₂-CH₂-CH₂-CH₂-halo. In some embodiments, R⁵ is –CH₂-fluoro, -CH₂-CH₂-fluoro, -CH₂-CH₂-CH₂-fluoro, or -CH₂-CH₂-CH₂- CH₂-fluoro. In some embodiments, R⁵ is –CH₂-F or –CH₂-CH₂-CH₂-F. In some embodiments, R⁵ is –CH₂-F. In some embodiments, R⁵ is –CH₂-CH₂-CH₂-F. [0089] In some embodiments, Y is

, wherein R⁵ is C₁-C₆ alkyl. In some embodiments, Y is

. In some embodiments, Y is

, wherein R⁵ is C₁-C₆ alkyl substituted with one or more halo. In some embodiments is

. [0090] In some embodiments, Y is , wherein R⁵ is C₁-C₆ alkyl substituted

with one or more halo. In some embodiments, Y is . [0091] In some embodiments, as described ge

hydrogen or optionally substituted C₁-C₆ aliphatic. In some embodiments, R⁶ is hydrogen. In some embodiments, R⁶ is optionally substituted C₁-C₆ aliphatic. In some embodiments, R⁶ is C₁-C₆ aliphatic optionally substituted with one or more of halogen or –(CH₂)_0–4OR°. [0092] In some embodiments, R⁶ is optionally substituted C1-C6 alkyl. In some embodiments R⁶ is C₁-C₆ alkyl substituted with one or more groups selected from halogen and –(CH₂)_0–4OR°. In some embodiments, R⁶ is C1-C6 alkyl substituted with one or more groups selected from halogen and -OR°. In some embodiments, R⁶ is C₁-C₆ alkyl substituted with one or more groups selected from halogen and -OH. In some embodiments, R⁶ is . [0093] In some embodiments, R⁶is C

1-C₆ alkyl substituted with one or more halogen. In some embodiments, R⁶ is -CH₂-C(CH₃)₂-F or –CH₂-CF₃. [0094] In some embodiments, as described generally above, R⁷ and R⁸ are each independently selected from hydrogen and optionally substituted C₁-C₆ aliphatic. In some embodiments, one of R⁷ and R⁸ is hydrogen and the other of R⁷ and R⁸ is C₁-C₆ aliphatic. In some embodiments, one of R⁷ and R⁸ is hydrogen and the other of R⁷ and R⁸ is methyl. In some embodiments, R⁷ is hydrogen and R⁸ is R-methyl (i.e., methyl having a stereochemical orientation designated as R). In some embodiments, R⁷ is hydrogen and R⁸ is S-methyl (i.e., methyl having a stereochemical orientation designated as S). [0095] Accordingly, in some embodiments, a complete estrogen receptor antagonist is a compound of Formula I, wherein the complete estrogen receptor antagonist is selected from:

Compound 1 Compound 2 Compound 3

Compound 4 Compound 5 or a pharmaceutically acceptable salt thereof.

[0096] In some embodiments, a complete estrogen receptor antagonist is Compound 1

Compound 1 or a pharmaceutically acceptable salt thereof.

[0097] In some embodiments, a complete estrogen receptor antagonist is a free base form of

Compound 1

Compound 1 [0098] In some embodiments, a complete estrogen receptor antagonist is Compound 2

Compound 2 or a pharmaceutically acceptable salt thereof.

[0099] In some embodiments, a complete estrogen receptor antagonist is Compound 3

or a pharmaceutically acceptable salt thereof.

[0100] In some embodiments, a complete estrogen receptor antagonist is Compound 4

Compound 4 or a pharmaceutically acceptable salt thereof.

[0101] In some embodiments, a complete estrogen receptor antagonist is Compound 5

Compound 5 or a pharmaceutically acceptable salt thereof.

[0102] In some embodiments, a complete estrogen receptor antagonist is Compound 5a:

Compound 5a.

[0103] In some embodiments, a complete estrogen receptor antagonist is Compound 5b:

Compound 5b.

[0104] In some embodiments, a complete estrogen receptor antagonist is a compound selected from:

(1R,3R)-2-(2-fluoro-2-methylpropyl)-3-methyl-1-(4-((1-propylazetidin-3-yl)oxy)phenyl)- 2,3,4,9,-tetrahydro-1H-pyrido[3,4-b]indole;

(1R,3R)-1-(2,6-difluoro-4-((1-propylazetidin-3-yl)oxy)phenyl)-2-(2-fluoro-2-methylpropyl)-3- methyl-2, 3, 4, 9, -tetrahydro- 1H-pyrido[3,4-b]indole;

(1R,3R)-1-(2,6-difluoro-4-(2-(3-(fluoromethyl)azetidin-l-yl)ethoxy)phenyl)-2-(2-fluoro-2- methylpropyl)-3-methyl-2,3,4,9,-tetrahydro-1H-pyrido[3,4-b]indole; (1R,3R)-1-(2,6-difluoro-4-((1-(3-fluoropropyl)azetidin-3-yl)oxy)phenyl)-2-(2-fluoro-2-methylpropyl)-3-methyl-2,3,4,9,-tetrahydro-1H-pyrido[3,4-b]indole; and 3-((1R,3R)-1-(2,6-difluoro-4-((1-(3-fluoropropyl)azetidin-3-yl)amino)phenyl)-3-methyl-1,3,4,9,- tetrahydro-2H-pyrido[3,4-b]indol-2-yl)-2,2-difluoropropan-1-ol.

Anti- Cancer Agents

[0105] The present disclosure encompasses the recognition that a compound of Formula I, when administered in combination with certain anti-cancer agents can beneficially be used to treat estrogen receptor positive (ER+) cancers, e.g., breast cancer, including metastatic breast cancer (e.g., breast cancer that has metastasized to the brain, bone, liver, lungs, or other organs or tissues,). Accordingly, in some embodiments, the present disclosure provides a method of treating a subject suffering from an ER-associated disorder (e.g., a cancer or breast cancer) comprising administering Compound 1 and an anti-cancer agent. For example, in some embodiments, the anti-cancer agent is a CDK 4/6 inhibitor, a PI3KCA inhibitor, or an mTOR inhibitor.

[0106] In some embodiments, the present disclosure provides a method of treating a patient or subject suffering from a cancer, the method comprising administering Compound 1 and an anti- cancer agent, wherein an anti-cancer agent is a CDK4/6 inhibitor (i.e., inhibits one or both of CDK4 and CDK6). In some embodiments, an anti-cancer agent is a CDK4/6 inhibitor selected from palbociclib, ribociclib, abemaciclib, lerociclib, trilaciclib, and SHR6390. In some embodiments, the CDK 4/6 inhibitor is palbociclib. In some embodiments, the CDK4/6 inhibitor is ribociclib. In some embodiments, the CDK4/6 inhibitor is abemaciclib. In some embodiments, the CDK4/6 inhibitor is lerociclib. In some embodiments, the CDK4/6 inhibitor is trilaciclib. In some embodiments, the CDK 4/6 inhibitor is SHR6390.

[0107] In some embodiments, the present disclosure provides a method of treating a patient or subject suffering from a cancer, the method comprising administering Compound 1 and an anti- cancer agent, wherein an anti-cancer agent is a PIK3CA inhibitor. In some embodiments, the PIK3CA inhibitor is selected from alpelisib, taselisib, and LY3023414. In some embodiments, the PIK3CA inhibitor is alpelisib. In some embodiments, the PIK3CA inhibitor is taselisib. In some embodiments, the PIK3CA inhibitor is LY3023414.

[0108] In some embodiments, the present disclosure provides a method of treating a patient or subject suffering from a cancer, the method comprising Compound 1 and an anti-cancer agent, wherein an anti-cancer agent is an mTOR inhibitor. In some embodiments, the mTOR inhibitor is selected from sirolimus, temsirolimus, everolimus, and LY3023414. In some embodiments, the mTOR inhibitor is sirolimus. In some embodiments, the mTOR inhibitor is temsirolimus. In some embodiments, the mTOR inhibitor is everolimus. In some embodiments, the mTOR inhibitor is LY3023414.

[0109] It is understood that compounds of Formula I and an anti-cancer agent described herein can be administered simultaneously or separately. For example, in some embodiments, a compound of Formula I and an anti-cancer agent are administered simultaneously. In some embodiments, an anti-cancer agent is administered prior to administration of a compound of Formula I. In some embodiments, an anti-cancer agent is administered after administration of a compound of Formula I.

Methods of Treatment

[0110] PCT App. Pub. No. WO 2021/ 178846 reports the effectiveness of certain complete estrogen receptor antagonists as described herein (e.g., a compound of Formula I) in treating ER- associated disorders (e.g., an ER-associated cancer, such as breast cancer, including metastatic breast cancer with metastases to the liver, lungs, brain, bones, or other organs or tissues). The present disclosure encompasses the surprising synergies achieved by the combination of certain CERANs (e.g., compounds of Formula I) and certain anti-cancer agents (e.g., inhibitors of mTOR, CDK4/6, PI3K, and the like).

[0111] In some embodiments, the present disclosure provides certain methods of treatment in a subject having an ER-associated disease, disorder, or condition. For example, in some embodiments, the present disclosure provides a method of treating an ER-associated disorder in a subject, wherein the subject has been determined or is suspected of having metastatic breast cancer. In some embodiments, a subject has a breast cancer that has metastasized to the brain, liver, lungs, bone, or other organs or tissues. In some embodiments, a subject has a breast cancer that has metastasized to the brain. In some embodiments, a subject has a breast cancer that has metastasized to the liver. In some embodiments, a subject has a breast cancer that has metastasized to the lungs. In some embodiments, a subject has a breast cancer that has metastasized to the bone.

[0112] In some embodiments, the present disclosure provides a method of treating a metastatic breast cancer (e.g., breast cancer that has metastasized to the liver, lungs, brain, bones, or other organs or tissues) in a subject comprising administering to the subject a complete estrogen receptor antagonist. In some embodiments, a method of treating metastatic breast cancer further comprises administering to the subject a complete estrogen receptor antagonist and an anti-cancer agent.

[0113] In some embodiments, a subject has previously been treated with a selective estrogen receptor modulator. In some embodiments, a selective estrogen receptor modulator is an estrogen receptor agonist or partial estrogen receptor agonist. In some embodiments, a selective estrogen receptor modulator is selected from tamoxifen, endoxifene, raloxifene, toremifene, lasofoxifene, and ospemifene.

[0114] In some embodiments, the present disclosure provides a method of treating a metastatic breast cancer (e.g., breast cancer that has metastasized to the liver, lungs, brain, bones, or other organs or tissues) in a subject comprising administering to the subject a complete estrogen receptor antagonist, wherein the subject has previously been treated with fulvestrant.

[0115] In some embodiments, the present disclosure provides in a method of treating cancer in a subject suffering from an ER-associated cancer, the improvement that comprises administering to the subject a composition that delivers a complete estrogen receptor antagonist, wherein the subject has been determined or is suspected of having metastatic breast cancer.

Estrogen Receptor-Associated Diseases and Disorders

[0116] The estrogen receptor (“ER”) is involved in a variety of biological processes, relating, for example, to development of the female reproductive system, maintenance of bone mass, protection of cardiovascular and/or central nervous system components, etc. (see, for example, Pearce & Jordan Crit. Rev. Onc/Hem 50:3, 2004; Heldring Phys. Rev. 87:905, 2007). The ER has been implicated in a variety of cancers. In many tumors that express the estrogen receptor (i.e., ER⁺ tumors), active ERa signaling has been demonstrated to drive cell proliferation (although ERP signaling has been reported to be able to achieve tumor suppressor effects; see, for example, Nilsson & Gustafson Clin. Pharmacol. Ther. 89:44, 2011). Typically, tumors (e.g., breast tumors) with as few as 1% of cells staining positive for ER are classified as “ER⁺”. Therapies targeting the ER are standard of care for many patients with ER⁺ tumors (see, for example, Cardoso et al Annals One. <doi.org/10.1093/announc/mdmx036> , 2017; Rugo et al. J. Clin. Oncol. 34:3069, 2016; Senkus et al Annal One. 26:v8, 2015; Sareddy & Vadlamudi Clin. J Nat. Med, 13:801, 2015). For early stage breast cancer patients, for example, recommended therapy typically involves tumor resection, followed by ER-targeted therapy (e.g., as described herein). For advanced breast cancer, including metastatic breast cancer, ER-targeted therapy is the mainstay.

[0117] Given the importance of ER signaling in many cancers, as well as in certain cardiovascular, inflammatory, and neurodegenerative diseases, significant effort has been invested in developing therapeutic agents and modalities that target the ER. There is some fluidity/flexibility in terminology that has been used to describe ER-targeting agents, but a variety of agents, with different mechanisms, have been developed and/or studied.

[0118] Some ER-targeting agents are designed and/or documented to reduce levels of estrogen (i.e., 17β estradiol) production.

[0119] Some ER-targeting agents are designed and/or documented to bind directly to the ER; in some cases, such agents compete with estrogen for binding to the ER and/or interfere with the allosteric changes that estrogen binding would naturally produce. Often, the term “antiestrogen” is used to refer to agents that bind to the ER, and sometimes is specifically used to indicate those agents that compete with estrogen for ER binding.

[0120] The term “selective estrogen receptor modulator, “SERM”, has been used to refer to compounds that are designed and/or documented to alter some aspect of ER activity. Some writings refer to “SERMs” as representing a particular type of anti-estrogens; other writings, however, use the term “SERM” more generally, to refer to a compound that specifically impacts some feature of ER (particularly ERa) expression and/or activity.

[0121] The term “selective estrogen receptor degrader” (“SERD”) has been used to refer to compounds that are designed and/or documented to trigger or enhance degradation of the ER. In many instances, if presence of a compound correlates with reduced level of ER, the compound may be referred to as a SERD. Some writings classify compounds either as SERMs or as SERDs; others refer to SERDs as a particular type, or species, of compounds that are SERMs.

[0122] Regardless of mechanism of action of a particular agent, clinical experience thus far has revealed that incomplete effects (e.g., within an individual patient and/or across patient populations) and/or development of resistance remain a problem.

[0123] Among other things, presence or development of certain ER mutations has been reported to impact effectiveness of various ER-targeted therapies (see, for example, Jeselsohn et al Nature Rev. Clin. One. 12, 573, 2015; Gelsomino et al. Breast Cancer Res. Treat 157:253, 2016; Toy et al. 2013). Some particularly problematic mutations are those that “activate” one or more aspects of ER expression and/or function; some activating mutations have been reported that can render the ER ligand-independent (i.e., constitutively active). For example, particular mutations in the ER ligand binding domain, including D538G and Y537S, have been demonstrated to constitutively activate the ER; other mutations including deletions and/or fusions that remove the ligand binding domain, can have similar effects (see, for example, Li et al. Cell Repts 4:1116, 2013; Veeraraghavan et al Breast Cancer Research and Treatment 158, 219-232, 2016; Veeraraghavan, et al. Nature Comms 5:4577, 2014). Some reports have indicated that as many as 50% of women with metastatic breast cancer may have activating ER mutations detectible in circulating tumor DNA.

[0124] The liver and lungs are among the most common sites for metastatic breast cancer, with liver and/or lung metastases present in 60-70% of cases in autopsy studies. Weigelt et al. Nat. Rev. Cancer 2005, 5: 591-602. For patients with hormone receptor positive disease, e.g., ER-positive breast cancer, the median survival time after the development of lung metastases is 16-17 months. Chen et al. PeerJ. 2019; 7:e8298. The median survival time after the development of liver metastases is 7 months for patients with ER-positive breast cancer. Wyld et al. Br. J. Cancer 2003; 89(2): 284-290. Hormone receptor-positive breast cancer with metastases to the liver and/or lungs is most commonly treated with endocrine therapies, either alone or in combination with an anti- cancer agent as described herein. Reinert et al. Ther. Adv. Med. Oncol. 2015, 7(6): 304-320. Surgery and/or techniques such as radiosurgery and/or radiofrequency ablation may also be used under certain circumstances, although these techniques are less commonly applied to treatment of metastatic breast cancer than endocrine therapies. Tosello et al. Cochrane Database Sy st. Rev. 2018, 2018(3): CD011276. Bale et al. Cancers 2019, 11(9): 1341.

Dosing

[0125] The present disclosure provides a method of treating a subject suffering from an ER- associated disorder, wherein the subject has developed or is suspected to have developed metastatic breast cancer (e.g., breast cancer that has metastasized to the liver, lungs, brain, bones, or other organs or tissues), the method comprising administering a composition comprising a complete estrogen receptor antagonist (e.g., a compound of Formula I). In some embodiments, the composition comprises a compound of Formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, carrier, or diluent. Said composition may be administered orally, parenterally, by inhalation or nasal spray, topically (e.g., as by powders, ointments, or drops), rectally, buccally, intravaginally, intraperitoneally, intracistemally or via an implanted reservoir, depending on the severity of the condition being treated. Preferably, the compositions are administered orally, intraperitoneally or intravenously. In certain embodiments, provided compounds are administered orally or parenterally at dosage levels of about 0.01 mg/kg to about 50 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect.

[0126] The present disclosure provides dosing regimens where a compound of Formula I is dosed at levels and/or according to regimens corresponding to those exemplified herein. That is, a dose (i.e., a composition optionally comprising additional pharmaceutically acceptable excipients) refers to a particular ratio of compound weight per kilogram of subject. For example, a dose of 3 mg/kg refers to a composition, optionally comprising pharmaceutically acceptable excipients, where the compound is administered to the subject in an amount that is 3 milligrams for every kilogram of subject weight. It is understood that a weight of a compound is determined according to the free base weight of a compound (e.g., if a compound is a salt, the corresponding free base weight of the compound is used to determine the amount of compound in the dose). Accordingly, in some embodiments, a human subject is provided a dose that corresponds to a 3 mg/kg to 30 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 3 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 5 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 10 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 15 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 20 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 25 mg/kg in a mouse. In some embodiments, a human subject is provided a dose that corresponds to greater than or equal to 30 mg/kg in a mouse.

[0127] In some embodiments, a composition comprising a compound of Formula I is administered as a unit dosage form. In some embodiments, a composition comprising a compound of Formula I is administered in the form of a capsule. In some embodiments, a composition comprising a compound of Formula I is administered in the form of a tablet. In some embodiments, a composition comprising a compound of Formula I is administered as a suspension. In some embodiments, a composition comprising a compound of Formula I is administered as a solution.

[0128] In some embodiments, a composition comprising a compound of Formula I is administered as a daily dose (QD). In some embodiments, a composition comprising a compound of Formula I is administered as a twice daily dose (BID). In some embodiments, a composition comprising a compound of Formula I is administered every other day (QOD). In some embodiments, a composition comprising a compound of Formula I is administered as a weekly dose (QW). In some embodiments, a composition comprising a compound of Formula I is administered as a monthly dose (Q4W).

[0129] In some embodiments, a compound of Formula I is Compound 1, and is administered in a dose amount as described herein. For example, in some embodiments, Compound 1 is administered a dose that corresponds to a 3 mg/kg to 30 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 3 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 5 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 10 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 15 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 20 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 25 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of Compound 1 that corresponds to greater than or equal to 30 mg/kg in a mouse.

[0130] In some embodiments, a dose of Compound 1 administered to a subject is about 15 mg to about 360 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is from about to 15 mg to about 360 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is from about 15 mg to about 100 mg. Compound 1 is administered to the subject in an amount that is about 15 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is about 30 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is about 120 mg, about 150 mg, about 210 mg, or about 300 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is about 30 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is about 60 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is about 90 mg. In some embodiments, Compound 1 is administered to the subject in an amount that is about 120 mg.

[0131] In some embodiments, Compound 1 is administered to the subject in an amount that is about 15 mg to about 360 mg per day (QD). In some embodiments, Compound 1 is administered to the subject in an amount that is about 30 mg to about 360 mg per day (QD). In some embodiments, Compound 1 is administered to the subject in an amount that is about 30 mg to about 300 mg per day (QD). In some embodiments, Compound 1 is administered to the subject in an amount that is about 60 mg to about 120 mg per day (QD). In some embodiments, Compound 1 is administered to the subject in an amount that is from about 15 mg to about 100 mg QD. In some embodiments, Compound 1 is administered to the subject in an amount that is about 15 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg QD. In some embodiments, Compound 1 is administered to the subject in an amount that is about 120 mg, about 150 mg, about 210 mg, or about 300 mg QD. In some embodiments, Compound 1 is administered to the subject in an amount that is about 30 mg QD. In some embodiments, Compound 1 is administered to the subject in an amount that is about 60 mg QD. In some embodiments, Compound 1 is administered to the subject in an amount that is about 90 mg QD. In some embodiments, Compound 1 is administered to the subject in an amount that is about 120 mg QD.

[0132] In some embodiments, Compound 1 is administered to the subject in a unit dosage form. In some embodiments, unit dosage form is a capsule or tablet. In some embodiments, a unit dosage form comprises about 15 mg to about 120 mg of Compound 1. In some embodiments, a unit dosage form comprises about 15 mg to about 100 mg of Compound 1. In some embodiments, a unit dosage form comprises about 60 mg to about 120 mg of Compound 1. In some embodiments, a unit dosage form comprises about 15 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg of Compound 1. In some embodiments, a unit dosage form comprises about 15 mg of Compound 1. In some embodiments, a unit dosage form comprises about 30 mg of Compound 1. In some embodiments, a unit dosage form comprises about 60 mg of Compound 1. In some embodiments, a unit dosage form comprises about 90 mg of Compound 1. In some embodiments, a unit dosage form comprises about 120 mg of Compound 1. In some embodiments, a unit dosage form is a capsule. In some embodiments, a unit dosage form is a tablet.

[0133] In some embodiments, a total daily dose of Compound 1 administered to the subject is in an amount that is about 15 mg to about 360 mg per day (QD). In some embodiments, a total daily dose of Compound 1 administered to the subject is about 30 mg to about 360 mg. In some embodiments, a total daily dose of Compound 1 administered to the subject is about 30 mg to about 300 mg. In some embodiments, a total daily dose of Compound 1 administered to the subject is about 60 mg to about 120 mg. In some embodiments, a total daily dose of Compound 1 administered to the subject is in an amount that is from about 15 mg to about 100 mg QD. In some embodiments, a total daily dose of Compound 1 administered to the subject is in an amount that is about 15 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg QD. In some embodiments, a total daily dose of Compound 1 administered to the subject is about 120 mg, about 150 mg, about 210 mg, or about 300 mg. In some embodiments, a total daily dose of Compound 1 administered to the subject is in an amount that is about 30 mg QD. In some embodiments, a total daily dose of Compound 1 administered to the subject is about 60 mg. In some embodiments, a total daily dose of Compound 1 administered to the subject is about 90 mg. In some embodiments, a total daily dose of Compound 1 administered to the subject is about 120 mg.

[0134] In some embodiments, a compound of Formula I is administered in combination with an anti-cancer agent, as described herein. In some embodiments, a compound of Formula I is administered with an anti-cancer agent that is a CDK 4/6 inhibitor, a PI3KCA inhibitor, or an mTOR inhibitor. In some embodiments, a compound of Formula I is administered in combination with a CDK4/6 inhibitor. In some embodiments, a compound of Formula I is administered in combination with a CDK4/6 inhibitor selected from palbociclib, ribociclib, abemaciclib, lerociclib, trilaciclib, and SHR6390. [0135] In some embodiments, a compound of Formula I is administered in combination with a PI3KCA inhibitor. In some embodiments, a compound of Formula I is administered in combination with a PI3KCA inhibitor selected from alpelisib, taselisib, and LY302341.

[0136] In some embodiments, a compound of Formula I is administered in combination with an mTOR inhibitor. In some embodiments, a compound of Formula I is administered in combination with an mTOR inhibitor selected from sirolimus, temsirolimus, everolimus, and LY3023414.

[0137] In some embodiments, an anti-cancer agent is dosed in a dose amount as described herein. For example, in some embodiments, an anti-cancer agent is administered a dose that corresponds to a 1 mg/kg to 80 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of an anti-cancer agent that corresponds to 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of an anti-cancer agent that corresponds to greater than or equal to 70 or 75 mg/kg in a mouse. In some embodiments, a human subject is provided a dose of an anti-cancer agent at the maximum tolerated dose. In some embodiments, a human subject is provided a dose of an anti-cancer agent between about 1 mg/kg and the maximum tolerated dose.

[0138] Pharmaceutically acceptable compositions described herein may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added. [0139] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and/or i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents. The active compounds can also be in micro-encapsulated form with one or more excipients as noted above.

[0140] Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings (i.e. buffering agents) and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. [0141] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0142] Alternatively, pharmaceutically acceptable compositions described herein may be administered in the form of suppositories for rectal or vaginal administration. These can be prepared by mixing the compounds of the present application with suitable non-irritating excipients or carriers that are solid at room temperature but liquid at body (e.g. rectal or vaginal) temperature and therefore will melt in the rectum or vaginal cavity to release the active compound. Such materials include cocoa butter, a suppository wax (e.g., beeswax) and polyethylene glycols. [0143] A person of skill in the art would readily understand how a therapeutically effective dose determined for an animal can be converted to the corresponding human equivalent dose. Accordingly, a person of skill in the art would understand that certain provided data for an animal (e.g., a mouse) can be used to determine a suitable dose in a human, for example by using the table provided by Nair & Jacob, J. Basic Clin. Pharm., 7(2):27-31 (2016).

Exemplary Embodiments

Embodiment 1. A method of treating a subject suffering from an ER-associated cancer comprising administering to the subject a composition comprising Compound 1

Compound 1 or a pharmaceutically acceptable salt thereof, wherein the subject has been determined or is suspected of having breast cancer metastases in the brain, liver, lung, or bone.

Embodiment 2. A method of treating an ER-associated cancer by administering to a population of subjects suffering from metastatic breast cancer, a composition comprising a complete estrogen receptor antagonist, so that, on average, the brain, liver lung, or bone metastases are reduced or eliminated, wherein the complete estrogen receptor antagonist is Compound 1:

or a pharmaceutically acceptable salt thereof.

Embodiment 3. A method of preventing metastatic spread of cancer to brain, liver, lungs, or bone of a subject, the method comprising administering to the subject a composition comprising Compound 1 :

Compound 1 or a pharmaceutically acceptable salt thereof.

Embodiment 4. The method of any one of Embodiments 1-3, wherein the subject has previously been treated with a selective estrogen receptor modulator.

Embodiment 5. The method of Embodiment 4, wherein the selective estrogen receptor modulator is selected from tamoxifen, raloxifene, and toremifene.

Embodiment 6. The method of any one of Embodiments 1-5, wherein the subject has previously been treated with fulvestrant.

Embodiment 7. The method of any one of Embodiments 1-6, further comprising administering an anti-cancer agent.

Embodiment 8. The method of Embodiment 7, wherein the anti-cancer agent is a CDK 4/6 inhibitor, a PI3KCA inhibitor, or an mTOR inhibitor.

Embodiment 9. The method of Embodiments 7 or 8, wherein the anti-cancer agent is a CDK4/6 inhibitor. Embodiment 10. The method of any one of Embodiments 7-9, wherein the CDK4/6 inhibitor is selected from palbociclib, ribociclib, abemaciclib, lerociclib, and trilaciclib.

Embodiment 11. The method of any one of Embodiments 7-10, wherein the CDK4/6 inhibitor is selected from ribociclib, palbociclib, and abemaciclib.

Embodiment 12. The method of any one of Embodiments 7-11, wherein the CDK4/6 inhibitor is palbociclib.

Embodiment 13. The method of Embodiments 7 or 8, wherein the anti-cancer agent is a PIK3CA inhibitor.

Embodiment 14. The method of any one of Embodiments 7-8 or 13, wherein the PIK3CA inhibitor is selected from alpelisib and taselisib.

Embodiment 15. The method of Embodiments 7-8, wherein the anti-cancer agent is an mTOR inhibitor.

Embodiment 16. The method of any one of Embodiments 7-8 or 15, wherein the mTOR inhibitor is selected from sirolimus. temsirolimus, and everolimus.

Embodiment 17. The method of any one of Embodiments 1-16, wherein the amount of Compound 1 that is administered to the subject is an amount that corresponds to 30 mg/kg or less in a mouse model.

Embodiment 18. The method of any one of Embodiments 1-17, wherein the amount of Compound 1 that is administered to the subject is about 15 mg to about 360 mg.

Embodiment 19. The method of any one of Embodiments 1-18, wherein the composition is administered to the subject once daily. Embodiment 20. The method of any one of Embodiments 1-18, wherein the composition is administered to the subject once weekly.

Embodiment 21. The method of any one of Embodiments 1-18, wherein the composition is administered to the subject once monthly.

Embodiment 22. The method of any one of Embodiments 1-21, wherein the composition is in the form of a unit dosage form.

Embodiment 23. The method of any one of Embodiments 1-22, wherein the composition is in the form of a capsule.

Embodiment 24. The method of any one of Embodiments 1-22, wherein the composition is in the form of a tablet.

EXEMPLIFICATION

[0144] The Examples provided herein document and support certain aspects of the present disclosure but are not intended to limit the scope of any claim. Unless specifically presented in the past tense, inclusion in the Examples is not intended to imply that work described has been completed, or even performed. The following non-limiting examples are provided to further illustrate certain teachings provided by the present disclosure. Those of skill in the art, in light of the present application, will appreciate that various changes can be made in the specific embodiments that are illustrated in the present Examples without departing from the spirit and scope of the present teachings.

Example 1: Synthesis of Compound 1

[0145] The complete synthesis of Compound 1 is provided in PCT App. Pub. No. WO 2017/059139 (referred to as Compound B, or, (1R,3R)-2-(2-fluoro-2-methylpropyl)-3-methyl-1- (4-((l-propylazetidin-3-yl)oxy)phenyl)-2,3,4,9-tetrahydro-lH-pyrido[3,4-b]indole), which is incorporated herein by reference and provided below.

Preparation of 4-((1-propylazetidin-3-yl)oxy)benzaldehyde

Step 1: Preparation of l-propionylazetidin-3-one

[0146] The compound 3-azetidinone hydrochloride (10.000 g, 93.0 mmol, 1.0 equiv.), anhydrous 1,2-dichloroethane (200 mL) and diisopropylethylamine (38.9 mL, 223 mmol, 2.4 equiv.) were added to a round bottom flask (500 mL) to provide a light yellow suspension. The suspension was sonicated for 1 h and then cooled to -10 °C (dry-ice/MeOH) for 10 min. Propionyl chloride (9.8 mL, 112 mmol, 1.2 equiv.) was added dropwise to the cooled suspension to provide an orange solution. The reaction was removed from the bath and stirred at room temperature for 16 h. The solvent was removed to provide a semi-solid. The semi-solid was suspended into EA (300 mL) and the suspension was filtered. The solid was rinsed with EA (2 x 100 mL). TLC analysis (10% MeOH/DCM, KMnO₇ stain/Heat) indicated there were three spots: Rf: 0.2, 0.5, 0.7. TLC (50% EA/Hex, KMnO₇ stain/Heat) indicated there were two spots: Rf: 1, 0.3. The filtrate was concentrated, adsorbed onto silica gel (25 g) and chromatographed through silica gel (100 g cartridge) with DCM (5 min) then 0-10 % MeOH over 15 min. The product came off early from the column in DCM and continued to elute from the column with up to 10 % MeOH. TLC in both solvent systems was carried out to determine if any propionyl chloride was present in early fractions. Fractions containing product were pooled and concentrated to afford the title compound as a yellow liquid (11.610 g, 98.2%). ¹H NMR (300 MHz, CDC1₃) δ: 4.80 (d, J = 5.6 Hz, 4H), 2.29 (q, J = 7.5 Hz, 2H), 2.01 (s, 3H), 1.18 (t, 7 = 7.5 Hz, 3H). Step 2. Preparation of l-propylazetidin-3-ol

[0147] Lithium aluminum hydride (10.397 g, 273.9 mmol, 3.0 equiv.) was suspended into THF (200 mL) and cooled in an ice bath. A solution of l-propionylazetidin-3-one (11.610 g, 91.3 mmol, 1.0 equiv.) in THF (100 mL) was added dropwise to the reaction mixture via a pressure equalizing addition funnel over 30 min. The addition funnel was removed. The flask was then fitted with a condenser and the reaction was heated at reflux in an oil bath at 75 °C for 16 h. The reaction was cooled in an ice bath for 20 min and sodium sulfate decahydrate (Glauber's salt, 25 g) was added in small portions over 20 min. After complete addition, the mixture was stirred at room temperature for 2 h. The mixture was filtered through a bed of Celite® (2 cm) and the solids rinsed with EA (2 x 250 mL). The clear solution was concentrated to a pale yellow liquid (9.580 g, 91.1%). NMR indicated the presence of THF and EA. This material was used without further purification in the preparation of the compounds of the examples below. ¹H NMR (300 MHz, CDC1₃) δ: 4.39 (pent, J = 6 Hz, 1H), 3.62 - 3.56 (m, 2H), 2.90 - 2.85 (m, 2H), 2.41 (t, J = 7.5 Hz, 2H), 1.34 (hextet, J = 7.2 Hz, 2H), 0.87 (t, J = 7.8 Hz, 3H).

Step 3. Preparation of 4-((l-propylazetidin-3-yl)oxy)benzaldehyde

[0148] 4-Fluorobenzaldehyde (15.00 g, 120.9 mmol, 0.9 equiv.), l-propylazetidin-3-ol (15.00g, 130.2 mmol, 1.0 equiv.), cesium carbonate (88.40 g, 271.3 mmol, 2.1 equiv.) and N,N- dimethylformamide (284 mL) were mixed together with a Teflon™ stir bar in a 500 mL round bottomed flask. The flask was sealed and heated in a heat block at 95 °C for 6 h. The reaction was analyzed by LCMS to indicate the aldehyde was consumed. The suspension was filtered through a sintered glass funnel and the solid was washed with ethyl acetate (100 mL). The filtrate was concentrated to an orange suspension. The suspension was mixed with water (200 mL) and ethyl acetate (200 mL) and the organic layer was washed with water (3 x 200 mL), brine, dried over anhydrous magnesium sulfate, filtered and concentrated to an orange liquid (21.74 g, 76.1 %). The material was used without further purification.

¹HNMR (300 MHz, CDCI3), δ 9.87 (s, 1H), 7.82 (d, J = 9.0 Hz, 2H), 6.86 (d, J= 8.7 Hz, 2H), 4.86 (quintet, J = 5.7 Hz, 1H), 3.85 - 3.80 (m, 2H), 3.13 - 3.08 (m, 2H), 2.48 (t, J = 7.2 Hz, 2H), 1.46 - 1.34 (m, 2H), 0.91 (t, J = 7.2 Hz, 3H).

Preparation of (R)-1-(1H-indol-3-yl)-N-((R)-1-phenylethyl)propan-2-amine:

[0149] Indole-3-acetone (25.0 g, 144 mmol, 1.0 equiv.) was added to a solution of (R)-(+)-l- phenylethylamine (23.0 mL, 181 mmol, 1.3 equiv.) in dichloromethane (600 mL) under N2 at 25 °C and the mixture was allowed to stir for 1 hr. The reaction was cooled to 0-5 °C and sodium triacetoxyborohydride (100 g, 472 mmol, 3.3 equiv.) was added over 30 minutes via powder addition funnel to the ice cooled solution. The orange solution was stirred for 1 h at 0 °C and then was allowed to warm to RT. The reaction was stirred at RT for 19 h. At this time, ESI+ indicated that no indole starting material was present. Saturated NaHCO₃ solution (lOOmL) was added in 5 mL portions over 15 min at 10 °C with vigorous stirring. The solution was stirred for 15 min and sat. Na₂COs solution (200 mL) was added over 15 minutes. Solid K2CO₃ (9 g) was added in 3 g portions at which point the aqueous layer was pH 12 and bubbles had stopped forming. The layers were filtered and separated. The red organic layer was washed with sat. aq. NaHCO₃ (2 x 100 mL). The aqueous layers were combined and extracted with DCM (2 x 100 mL). The combined organic layers were dried over Na₂SO₄, filtered and concentrated to give the crude product (49 g). TLC (90:10 DCM:MeOH) showed four spots (Rf = 0.63, 0.50, 0.16, 0.26), two of which were the separated diastereomeric major products (Rf = 0.16 and 0.26). The crude was adsorbed onto silica gel and purified via flash chromatography (330 g cartridge, 0-100% EA:Hex). Fractions containing the R,R diastereomer were pooled and purified a second time with the same flash chromatography conditions to afford 24 g of product (~82% ee). Previous successful separation was achieved by a silica gel:crude ratio of 40:1, so the mixture was divided into 3 portions and separated on 3 x 330 g silica gel cartridges (0-40% EA/Hex for 20 min, isocratic 40% EA/Hex 40 min). All fractions containing the desired product were > 99 % diastereomerically pure. Pure _fractions were concentrated and pooled to yield (R)-l-(lH-indol-3-yl)-N-((R)-l-phenylethyl)- propan-2-amine as an orange semi-solid (11.91 g, 29.6 %).

[0150] ¹ H NMR (CDCI3, 300 MHz) R,R diastereomer: 8 0.96 (d, J = 6.6 Hz, 3H), 1.30 (d, J =

6.6 Hz, 3H), 2.68 (q, J = 7.2 Hz, 1H), 2.97 (m, 2H) 4.00 (q, J = 6.3 Hz, 1H), 7.43-6.97 (m, 10H), 7.96 (br s, 1H). R,S diastereomer: δ 1.11 (d, J = 5.7 Hz, 3H), 1.30 (d, J = 5.4 Hz, 3H) 2.80 (m, 3H), 3.92 (q, J= 6.9 Hz, 1H), 6.93-7.40 (m, 10H), 8.13 (br s, 1H); the aromatic region was difficult to distinguish from the R,R diastereomer due to lack of purity. LCMS: ES+ [M+H]+ 279.0.

Preparation of (2R)-l-(lH-indol-3-yl)propan-2-amine

[0151] The compound (R)-l-(lH-indol-3-yl)-A/-((R)-l-phenylethyl)propan-2-amine (11.91 g, 42.8 mmol, 1.0 equiv.) was dissolved in methanol (250 mL) and added to a 2 L Parr bottle and the solution was sparged with N₂ for 10 min. 20% Pd(OH)₂ on carbon wet with water (10.71 g, 76.3 mmol, 1.8 equiv.) was added and the bottle was pressurized with 50 psi of hydrogen and shaken in a Parr apparatus for 22 h, LCMS analysis indicated that the reaction was completed. The suspension was filtered through Celite® and concentrated to remove MeOH. The crude was dissolved into DCM and washed with saturated Na₂CO₃ solution (50 mL) and the aqueous layer was extracted with DCM (2 x 50 mL). The organic layers were combined, dried, and concentrated to yield (2R)-1-(1H-indol-3-yl)propan-2-aminc as a light brown solid that did not require further purification (6.68 g, 89.6 %).

[0152] ¹H NMR (CDCI3, 300 MHz) δ 1.17 (d, J = 6.6 Hz, 3H), 2.66 (dd, 7= 8.4, 14.7 Hz, 1H), 2.88 (dd, J = 5.4, 14.1 Hz, 1H), 3.27 (sextet, J = 1.5 Hz, 1H), 7.05-7.22 (m, 3H), 7.37 (d, J = 7.5 Hz, 1H), 7.62 (d, J = 8.7 Hz, 1H), 8.00 (br s, 1H). LCMS: ES+ [M+H]+ 174.9.

Preparation of 2-fluoro-2-methylpropanol

[0153] Methyl 2-fluoro-2-methylpropionate (5.01 g, 40.5 mmol, 1.0 equiv.) was added dropwise over 15 min to a stirred suspension of lithium aluminum hydride (2.50 g, 65.9 mmol, 1.6 equiv.) in anhydrous diethyl ether (100 mL) cooled in an ice bath. After 2 hours, 2.0 mL water, 2.0 mL 15% w/v NaOH, and 5.0 mL water were added sequentially dropwise. After 15 min, the white suspension was diluted with DCM, gravity filtered through Celite®, and the solids were washed with DCM. The filtrate was concentrated (200 mbar, 25 °C) to afford 2-fluoro-2- methylpropanol as a colorless oil (2.09 g, 56.1 %). ¹H NMR (300 MHz, CDCI3) δ 1.34 (d, J = 21.3 Hz, 6H), 1.95 (br t, 1H), 3.56 (dd, J = 6.6, 20.7 Hz, 2H).

Preparation of 2-fluoro-2-methylpropyl trifluoromethanesulfonate

[0154] Trifluoromethanesulfonic anhydride (5.0 mL, 29.7 mmol, 1.3 equiv.) was added dropwise to a 0 °C solution of 2-fluoro-2-methylpropanol (2.090 g, 22.7 mmol, 1.0 equiv.) and 2,6 lutidine (3.40 mL, 29.4 mmol, 1.3 equiv.) in DCM (25 mL) over 30 minutes. After 2 hours, the red solution had turned light brown. TLC (20:80 EA:Hex, KMnCL stain) indicated that the starting material was not present. The reaction mixture was washed with IM HC1 solution (2 x 20 mL) and sat. NaHCO₃ solution (2 x 20 mL). The aqueous layers were each back extracted with DCM (20 mL). The combined organic layers were dried with Na₂SO₄, filtered and concentrated under reduced pressure (150 mbar, 25 °C) to afford 2-fluoro-2-methylpropyl trifluoromethanesulfonate as a red oil (4.39 g, 86.3%). ¹H NMR (300 MHz, CDC1₃) δ 1.46 (d, J = 20.4 Hz, 6H), 4.41 (d, J = 18.6 Hz, 2H). ¹⁹F NMR (282 MHz, CDCI3) 6 -147.1, -74.5.

Preparation of (R)-N-(1-(1H-indol-3-yl)propan-2-yl)-2-fluoro-2-methylpropan-1-amine:

[0155] The compound 2-fluoro-2-methylpropyl trifluoromethanesulfonate (9.587 g, 42.8 mmol, 1.1 equiv.) (solution in DCM, 16% DCM by wt%, 11.4384 g) was added to a solution of (₂R)-l-(lH-indol-3-yl)propan-2-amine (6.680 g, 38.3 mmol, 1.0 equiv.), anhydrous 1,4-dioxanes (60.000 ml, 701.4 mmol, 18.3 equiv.), and freshly-distilled diisopropylethylamine (8.500 ml, 48.8 mmol, 1.3 equiv.). The dark brown solution was heated at 90 °C for 3 hours. After 3h, LCMS indicated that a small amount of indolamine starting material was still present. TLC (10% MeOH/DCM) indicated triflate (Rf = 0.54) had been used up. NMR of unused triflate SM (286- 30) indicated the triflate had not decomposed overnight, so another 0.1 equiv (0.9883 g, 13% DCM wt%, 0.8563 g triflate SM) was added and the reaction was heated for 2 h at 90 °C. LCMS indicated the reaction had completed and TLC (10% MeOH/DCM) showed one spot (Rf = 0.24) (TLC with 50% EA/Hex, 1 streaked spot Rf <= 0.12, another spot at Rf = 0). EtOAc (50 mL) was added and the solution was washed with NaHCO₃ (2 x 50 mL) and the combined aqueous layer was washed with EtOAc (50 mL). The combined organic extracts were dried over Na₂SO₄ and concentrated under reduced pressure. The crude (brown oil, 14.8 g) was purified via flash silica chromatography (240 g cartridge, 0-100% EA/Hex). The desired product eluted as a long tailing peak. Pure fractions were concentrated to yield (R)-N-(l-(lH-indol-3-yl)propan-2-yl)-2-fluoro-2- methylpropan- 1 -amine (4.211 g, 17.0 mmol) as a dark yellow oil. ¹H NMR (300 MHz, CDCl₃) 6 1.10 (d, J = 6.3 Hz, 3H), 1.34 (dd, J = 3.0, 21.9 Hz, 6H), 2.68-2.95 (m, 4H), 3.02 (sextet, J = 6.6 Hz, 1H), 7.05 (d, J = 2.4 Hz, 1H), 7.26-7.11 (m, 2H), 7.36 (d, J = 6.9 Hz, 1H), 7.62 (d, J = 7.5 Hz, 1H), 8.18 (br s, 1H). ¹⁹F NMR (282 MHz, CDCh) δ -144.2. m/z: ES+ [M+H]+ 249.0.

Preparation of Compound 1

[0156] 4-((l-propylazetidin-3-yl)oxy)benzaldehyde (0.096 g, 0.4 mmol, 1.3 equiv.) was added to a solution of (R)-N-(l-(lH-indol-3-yl)propan-2-yl)-2-fluoro-2-methylpropan-l-amine (0.070 g, 0.3 mmol, 1.0 equiv.) in anhydrous toluene (1.50 mL) and glacial acetic acid (0.100 mL, 1.7 mmol, 6.2 equiv.). Molecular sieves were added and the solution was stirred under N2 in the dark at 80 °C for 8 hours. The reaction solution was diluted in DCM, filtered, and washed with saturated Na₂CCh solution. The aqueous layer was extracted with DCM and the combined organic layers were dried over Na₂SO₄. The solution was filtered and concentrated. The residue was dissolved into acetonitrile (2 mL) and filtered through a syringe filter before purification via prep LC (40 to 90% ACN:H₂O over 18 min, followed by isocratic 90% ACN for 7 min). Pure fractions were concentrated and dried to afford (1R,3R)-2-(2-fluoro-2-methylpropyl)-3-methyl-1-(4-((1- propylazetidin-3-yl)oxy)phenyl)-2,3,4,9,-tetrahydro-1H-pyrido[3,4-b]indole as a white powder. [0157] ¹H NMR (300 MHz, CDC1₃) δ 0.90 (t, J = 7.5 Hz, 3H), 1.09 (d, J = 7.2 Hz, 3H), 1.26- 1.50 (m, 8H), 2.45-2.77 (m, 6H), 3.01 (t, J = 7.2 Hz, 2H), 3.34 (m, 1H), 3.77 (m, 2H), 4.60 (quin, J = 5.7 Hz, 1H), 5.03 (s, 1H), 6.64 (d, J = 8.1 Hz, 2H), 7.10-7.21 (m, 5H), 7.54 (d, J = 7.5 Hz, 1H), 8.19 (br s, 1H). m/z: ES+ [M+H]⁺ 450.2.

Example 2: Biological Evaluation

Cell Culture

[0158] MCF7 WT and Y537S cells were transduced with luciferin and GFP (pFU-Fuc2-eGFP) vector via lentivirus at a MOI of 5. After labeling, the cells were cultured in DMEM with 5% FBS. Cells were grown in DMEM containing 5% FBS and genotyped prior to mammary intraductal injection. DNA was extracted with DNeasy Blood and Tissue Kit and sequenced with CCCCTTCTAGGGATTTCAGC, sequencing primer to verify the presence of the ER mutation.

Animal Study and Injection

[0159] Approximately 250,000 cells were injected in the mammary duct of the inguinal gland of 7-8 weeks old female NSG mice to establish breast cancer tumors. Three weeks after cell injection the mice were treated via gavage with Compound 1 at three different concentrations (3, 10 and 30 mg/kg, 5 days/week) for the dose response study, and 2 different concentrations for the combination study (3 or 10 mg/kg of Compound 1, and 70 mg/kg of palbociclib). For the dose response study Compound 1 was re-suspended in a 0.5% solution of carboxymethylcellulose in water. For the combination study Compound 1 and palbociclib were resuspended in 50 mM sodium lactate pH 4 and administered via gavage.

[0160] In both the dose-response study and the combination study, Faslodex (fulvestrant) (5 mg/mouse) was injected once a week via subcutaneous injection. Tumor growth was followed via imaging using an Xenogen IVIS instrument. Imaging was performed by injecting mice with 100 μl of 0.1 M XenoLight D-luciferin.

Tissue Processing and Analysis

[0161] At sacrifice, tissues were harvested, mammary glands were weighed, and tissues such as the lungs, liver, and glands were fixed in formalin. Lungs were stained with antiluciferase antibody to visualize tumor cells. IHC and H&E stained sections were scanned on a CRi Pannoramic Scan whole slide scanner (Integrated Light Microscopy core at University of Chicago). A Nikon Eclipse Ti2 microscope with a 10X objective was used to obtain high- resolution images. Liver metastases were analyzed with image J-FIJI software. Lung metastases were analyzed with NSI element software. An unpaired, two tailed T-test was used to determined p values.

Statistical analysis

[0162] All graphs were prepared and the statistical two-tail t-test and Anova test analysis were performed using GraphPrim 7 software, with p≤ 0.05 considered as statistically significant.

Results

[0163] The results of the present example are provided in the following figures:

[0164] FIG. 1 is a series of images illustrating tumor growth in mice at 74 days post- treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0165] FIG. 2A is a dose-response plot measuring the total flux on the right and left sides for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after cell injection to establish breast cancer tumors.

[0166] FIG. 2B is a dose-response plot measuring the total flux in the belly for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after cell injection to establish breast cancer tumors.

[0167] FIG. 3 is a plot illustrating the total flux on the right and left sides at 74 days post- treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0168] FIG. 4 is a chart illustrating the tumor weight for mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

[0169] FIG. 5A is a series of images illustrating tumor growth at 31 days post-treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0170] FIG. 5B is a dose-response plot measuring the total flux on the right and left sides for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0171] FIG. 5C is a dose-response plot measuring the total flux in the belly for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment. [0172] FIG. 6A is a dose-response plot measuring the total flux on the right and left sides for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0173] FIG. 6B is a dose-response plot measuring the total flux in the belly for mice treated with vehicle, fulvestrant, and varying doses of Compound 1 as a function of time after beginning treatment.

[0174] FIG. 7 is a plot illustrating the total flux on the right and left sides at 45 days post- treatment with vehicle, fulvestrant, and varying doses of Compound 1.

[0175] FIG. 8 is a series of images illustrating the growth of liver metastases in mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

[0176] FIG. 9A is a series of images illustrating the growth of lung metastases in mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

[0177] FIG. 9B is a chart illustrating the percent total organ area affected by lung metastases for mice treated with vehicle, fulvestrant, and varying doses of Compound 1.

Example 3: Prevention of Tumor Spread in a Model of Metastatic Mutant ERa+ Breast Cancer

[0178] MCF7 cells engineered to express the Y537S ERα mutation were labeled with luciferase and injected via the nipple (mammary intraductal MIND model) into NSG mice. Mice were treated with 3 and 10 mg/kg of Compound 1 alone or in combination with palbociclib at 70 mg/kg and tumor growth was monitored via a Xenogen IVIS imager. At study end point, mice were sacrificed and excised organs were imaged ex-vivo and further processed for immunohistology analysis. Compound 1 at both doses inhibited primary tumor growth as well as metastasis to the lung, liver, brain and bone, with greater effect at 10 mg/kg, and was significantly more effective than Faslodex. When combined with palbociclib at 70 mg/kg, an additional significant decrease in metastasis was observed compared to Compound 1 or palbociclib alone.

[0179] The foregoing has been a description of certain non-limiting embodiments of the subject matter described within. Accordingly, it is to be understood that the embodiments described in this specification are merely illustrative of the subject matter reported within. Reference to details of the illustrated embodiments is not intended to limit the scope of the claims, which themselves recite those features regarded as essential.

[0180] It is contemplated that systems and methods of the claimed subject matter encompass variations and adaptations developed using information from the embodiments described within. Adaptation, modification, or both, of the systems and methods described within may be performed by those of ordinary skill in the relevant art.

[0181] Throughout the description, where systems are described as having, including, or comprising specific components, or where methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are systems encompassed by the present subject matter that consist essentially of, or consist of, the recited components, and that there are methods encompassed by the present subject matter that consist essentially of, or consist of, the recited processing steps.

[0182] It should be understood that the order of steps or order for performing certain action is immaterial so long as any embodiment of the subject matter described within remains operable. Moreover, two or more steps or actions may be conducted simultaneously.

Claims

CLAIMS A method of treating a subject suffering from an ER-associated cancer comprising administering to the subject a composition comprising Compound 1

Compound 1 or a pharmaceutically acceptable salt thereof, wherein the subject has been determined or is suspected of having breast cancer metastases in the liver, lungs, brain, bones, or other organs or tissues.

A method of treating an ER-associated cancer, the method comprising administering to a population of subjects suffering from metastatic breast cancer, a composition comprising a complete estrogen receptor antagonist, so that, on average, the brain, liver lung, or bone metastases are reduced or eliminated, wherein the complete estrogen receptor antagonist is Compound 1:

Compound 1 or a pharmaceutically acceptable salt thereof. A method of preventing metastatic spread of cancer to liver, lungs, brain, bones, or other organs or tissues of a subject, the method comprising administering to the subject a composition comprising Compound 1:

Compound 1 or a pharmaceutically acceptable salt thereof. The method of any one of claims 1-3, wherein the subject has previously been treated with a selective estrogen receptor modulator. The method of claim 4, wherein the selective estrogen receptor modulator is selected from tamoxifen, raloxifene, and toremifene. The method of any one of claims 1-5, wherein the subject has previously been treated with fulvestrant. The method of any one of claims 1-6, further comprising administering an anti-cancer agent. The method of claim 7, wherein the anti-cancer agent is a CDK 4/6 inhibitor, a PI3KCA inhibitor, or an mTOR inhibitor. The method of claims 7 or 8, wherein the anti-cancer agent is a CDK4/6 inhibitor. The method of any one of claims 7-9, wherein the CDK4/6 inhibitor is selected from palbociclib, ribociclib, abemaciclib, lerociclib, and trilaciclib. The method of any one of claims 7-10, wherein the CDK4/6 inhibitor is selected from ribociclib, palbociclib, and abemaciclib. The method of any one of claims 7-11, wherein the CDK4/6 inhibitor is palbociclib. The method of claims 7 or 8, wherein the anti-cancer agent is a PIK3CA inhibitor. The method of any one of claims 7-8 or 13, wherein the PIK3CA inhibitor is selected from alpelisib and taselisib. The method of claims 7-8, wherein the anti-cancer agent is an mTOR inhibitor. The method of any one of claims 7-8 or 15, wherein the mTOR inhibitor is selected from sirolimus. temsirolimus, and everolimus. The method of any one of claims 1-16, wherein the amount of Compound 1 that is administered to the subject is an amount that corresponds to 30 mg/kg or less in a mouse model. The method of any one of claims 1-17, wherein the amount of Compound 1 that is administered to the subject is about 15 mg to about 360 mg.

The method of any one of claims 1-18, wherein the composition is administered to the subject once daily.

The method of any one of claims 1-18, wherein the composition is administered to the subject once weekly.

The method of any one of claims 1-18, wherein the composition is administered to the subject once monthly. The method of any one of claims 1-21, wherein the composition is in the form of a unit dosage form.

23. The method of any one of claims 1-22, wherein the composition is in the form of a capsule.

24. The method of any one of claims 1-22, wherein the composition is in the form of a tablet.