WO2023090884A1 - Pharmaceutical composition comprising prrx1 inhibitor for prevention or treatment of cancer - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for prevention or treatment of cancer, the composition comprising a PRRX1 inhibitor that attenuates or inhibits the expression or activity of PRRX1 overexpressed in cancer tissues, particularly cancer-associated fibroblasts. Containing a PRRX1 inhibitor as an active ingredient, the pharmaceutical composition for prevention or treatment of cancer according to the present invention can inhibit the proliferation or activity of cancer tissues, especially, cancer-associated fibroblasts and facilitate the penetration of a cancer therapeutic agent into cancer tissues, with the resultant apoptotic promotion of cancer tissues, whereby the composition can effectively treat various PRRX1-expressing cancers.

Description

Pharmaceutical composition for preventing or treating cancer containing a PRRX1 inhibitor

The present invention relates to a pharmaceutical composition for preventing or treating cancer comprising a PRRX1 inhibitor that attenuates or inhibits the expression or activity of PRRX1 overexpressed in cancer tissues, particularly cancer-associated fibroblasts.

The tumor microenvironment is the environment surrounding cancer, including fibroblasts, blood and lymph vessels, immune cells, extracellular matrix (ECM), and adipocytes that exist inside or around tumors or cancer tissues. As a result, it regulates the growth or proliferation of cancer cells through various interactions, greatly affecting cancer progression or metastasis, cancer treatment response and effectiveness. Fibroblasts are one of the main cell types that make and maintain the stroma of cancer tissue. In particular, fibroblasts present in cancer tissue have the ability to strongly promote cancer progression through long-term interactions with cancer cells. They are separately called cancer-associated fibroblasts (CAFs).

CAF is a key cell that helps cancer cells grow and proliferate. It is reprogrammed by various substances including cytokines secreted in the tumor microenvironment, and is a cell made from normal fibroblasts, which creates a thick and dense extracellular matrix of cancer. It is known to not only interfere with the penetration of drugs or immunotherapeutic agents into cancer tissue, but also secrete various cytokines to help the formation of blood vessels around cancer, drug resistance, and suppression of immunity.

Therefore, in recent cancer treatment, new therapies targeting not only cancer cells but also the tumor microenvironment regulating the growth of cancer cells are being considered. However, research on the tumor microenvironment is still in its infancy, and there is no commercially available cancer treatment that targets CAF and has been recognized for its effectiveness.

[Prior art literature]

[Patent Literature]

Korean Patent Registration No. 10-1585947

Korean Patent Publication No. 10-2020-0062154

An object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer containing a substance that attenuates or inhibits the expression or activity of PRRX1, which is overexpressed in cancer tissues, particularly cancer-associated fibroblasts.

One aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer comprising a PRRX1 inhibitor as an active ingredient.

PRRX1 (Paired mesoderm homeobox protein 1) is a generic term for the PRRX1 gene and the PRRX1 protein encoded by the PRRX1 gene, and there are isoforms of PRRX1a and PRRX1b forms. PRRX1 protein plays a role as a transcription coactivator and forms various mesodermal muscles through the regulation of muscle creatine kinase. It is mainly expressed in the mesodermal layer during embryonic development and is In case of deletion of both PRRX1 and PRRX2, which are expressed in mesenchymal tissue, it is known that severe defects in differentiation of mesenchymal cells in the craniofacial region occur.

The present inventors are colorectal cancer, lung cancer, ovarian cancer, squamous cell carcinoma. By confirming that PRRX1 is overexpressed in cancer-associated fibroblasts constituting various cancer tissues such as gastric cancer, pancreatic cancer, esophageal cancer, and breast cancer, and acts as a master transcription factor (mTF) that determines cell gene regulation and cell specificity. PRRX1 has been proposed as a target for cancer treatment.

According to one embodiment of the present invention, the PRRX1 inhibitor may inhibit the expression or activity of the PRRX1 gene or protein.

More specifically, the PRRX1 inhibitor may be at least one selected from the group consisting of antisense oligonucleotides, siRNA, shRNA, ribozymes, antibodies, antigen-binding fragments thereof, compounds, peptides, peptide mimetics, and aptamers.

According to one embodiment of the present invention, the expression inhibitor of the PRRX1 gene is from the group consisting of an antisense oligonucleotide, siRNA, shRNA, and ribozyme that bind complementary to the mRNA of the PRRX1 gene or the gene promoting the expression of PRRX1, respectively. It may be one or more selected species.

According to one embodiment of the present invention, the expression inhibitor of the PRRX1 gene may complementarily bind to mRNA containing the nucleotide sequence represented by SEQ ID NO: 1 or 2.

The nucleotide sequence represented by SEQ ID NO: 1 is the mRNA sequence (GenBank Accession: NM_006902.5) of PRRX1 (transcript variant pmx-1a), and the nucleotide sequence represented by SEQ ID NO: 2 is the mRNA sequence of PRRX1 (transcript variant pmx-1b). mRNA sequence (Genbank Accession: NM_022716.4).

The antisense oligonucleotide is a DNA or RNA sequence capable of binding to PRRX1 mRNA, and may inhibit translation, cytoplasmic translocation, maturation, or other essential activities for overall biological functions of PRRX1 mRNA. The length of the antisense nucleic acid is 6 to 100 bases, preferably 8 to 60 bases, more preferably 10 to 40 bases. Such antisense oligonucleotides may be modified at one or more bases, sugars or backbone positions to enhance efficacy.

The siRNA (small interference RNA) refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing, and since it can suppress the expression of a target gene, it is provided as an efficient gene knockdown method or gene therapy method. The siRNA molecule may have a double-stranded structure in which the sense strand and the antisense strand are located opposite to each other, or may have a single-stranded structure having self-complementary sense and antisense strands. As used herein, the term complementary is meant to encompass incomplete complementarity as well as 100% complementarity. The siRNA in the present invention may have a sequence complementary to a portion of mRNA encoding the PRRX1 protein.

The shRNA (small hairpin RNA or short hairpin RNA) represents an RNA sequence that makes a strong hairpin turn, which can be used to suppress or silence gene expression through RNA interference. The shRNA in the present invention may have a sequence complementary to a portion of mRNA encoding the PRRX1 protein, and preferably may include the nucleotide sequence represented by SEQ ID NO: 3 or 4.

The shRNA represented by SEQ ID NO: 3 recognizes PRRX1a mRNA, and the shRNA represented by SEQ ID NO: 4 recognizes both PRRX1a and PRRX1b mRNAs and can block PRRX1 gene expression.

The ribozyme refers to RNA having an enzyme function that catalyzes biochemical reactions such as RNA splicing, tRNA synthesis, and protein synthesis, and has a unique secondary structure such as a hairpin structure.

According to one embodiment of the present invention, the activity inhibitor of the PRRX1 protein is an antibody that specifically binds to the PRRX1 protein or a protein that stimulates the activation of PRRX1, an antigen-binding fragment thereof, a compound, a peptide, a peptide mimetics, and an aptase. It may be one or more selected from the group consisting of mer.

According to one embodiment of the present invention, the PRRX1 protein activity inhibitor may specifically bind to the protein expressed by the mRNA of SEQ ID NO: 1 or 2.

As used in the present invention, "specifically binding" means that the binding ability to plagiarism material is superior to other materials.

The antibody refers to a specific protein molecule directed against an antigenic site. In the present invention, it means an antibody that specifically binds to PRRX1 as a target substance, and includes all of monoclonal antibodies, polyclonal antibodies and recombinant antibodies. In addition, the antibody includes functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab')2, Fv, or the like.

The peptide mimetics are small protein molecules having a chain structure designed to mimic peptides, and chemical structures are partially modified in commonly existing peptides to more advantageously control molecular properties such as stability and biological activity. it means.

The aptamer is a nucleic acid or peptide capable of binding specifically and friendly to a target substance. In the present invention, it refers to a peptide that specifically and strongly binds to PRRX1, and has higher specificity and affinity than antibodies There are advantages to having

In the present invention, the PRRX1 inhibitor is preferably a siRNA, shRNA or miRNA (microRNA) that binds complementary to the mRNA of PRRX1, or an antibody or compound that specifically binds to the PRRX1 protein, and inhibits PRRX1 expression or activity at the gene level. Most preferably, it is siRNA or shRNA to block. Since siRNA or shRNA has a low degradation rate and a high turnover rate in the introduced cells, it has the advantage of being able to achieve a desired goal more effectively.

According to one embodiment of the present invention, the PRRX1 inhibitor may inhibit the proliferation or activity of cancer-associated fibroblasts (CAF).

In one embodiment of the present invention, as a result of examining the effect of PRRX1 expressed in human gastric cancer-associated fibroblasts (SCAF36) on CAF survival, SCAF36 treated with shRNA (shPRRX1) for PRRX1 was compared to the case where shPRRX1 was not treated. It was confirmed that apoptosis significantly increased by about 2 times.

Further, according to one embodiment of the present invention, the PRRX1 inhibitor may inhibit extracellular matrix contraction of cancer-associated fibroblasts.

In one embodiment of the present invention, as a result of examining the effect of PRRX1 on extracellular matrix (ECM) remodeling of human gastric normal fibroblasts (SNF32) and human colorectal cancer-associated fibroblasts (colon CAF), when PRRX1 is expressed in SNF32, CAF As shown in , it was confirmed that the ECM contractile activity was significantly increased and the ECM was remodeled, whereas when CAF was treated with shPRRX1, the ECM contractile ability of CAF was lost.

A pharmaceutical composition for preventing or treating cancer containing such a PRRX1 inhibitor changes the characteristics of cancer-associated fibroblasts, inhibits cell proliferation or activity, and facilitates the penetration of cancer therapeutic agents into cancer tissues, thereby promoting the death of cancer tissues. This can increase the effectiveness of cancer treatment.

As used herein, “cancer” refers to cells with aggressive cells that divide and grow beyond normal growth limits, invasive cells that infiltrate surrounding tissues, and metastatic cells that spread to other parts of the body. It means a general term for diseases caused by Here, cancer is also used in the same sense as malignant tumor.

According to one embodiment of the present invention, the cancer is leukemia, lymphoma, Hodgkin's disease, hematopoietic malignancy, cervical cancer, sarcoma, testicular cancer (testicular cancer), malignant melanoma, endocrine cancer, bone cancer, prostate cancer, uterus cancer, breast cancer, bladder cancer , renal cell carcinoma, central nervous system tumor, brain cancer, liver cancer, stomach cancer, pancreatic cancer, skin cancer, squamous cell carcinoma In the group consisting of squamous cell carcinoma lung cancer, larynx cancer, head and neck cancer, esophageal cancer, colorectal cancer and ovarian cancer It may be one or more selected species.

As used herein, “prevention or treatment of cancer” means suppressing the growth or proliferation of cancer cells or delaying the progression of cancer, and improving or ameliorating the symptoms of cancer.

The "pharmaceutical composition for preventing or treating cancer" as used in the present invention refers to a substance used for the purpose of treating, mitigating, treating or preventing cancer in animals, including humans.

The pharmaceutical composition may be formulated and used in various forms according to conventional methods. For example, it can be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions and syrups, and can be formulated and used in the form of external preparations, suppositories and sterile injection solutions. In addition, the pharmaceutical composition may further include a pharmaceutically acceptable carrier. The carrier is commonly used in preparation, and includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, and polyvinylpyrrolidone. , cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, but are not limited thereto. The pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, in addition to the above components.

The dosage of the pharmaceutical composition may vary depending on the formulation method, administration method, administration time and/or route of administration of the pharmaceutical composition, and the type and degree of response to be achieved by administration of the pharmaceutical composition, and the subject of administration The type of subject to be treated, age, weight, general health condition, symptoms or severity of disease, sex, diet, excretion, drugs used concurrently or concurrently with the subject, and other factors of composition and other factors well known in the field of medicine. It may vary according to known similar factors, and those skilled in the art can easily determine and prescribe an effective dosage for the desired treatment. For example, it may be 0.001 to 1,000 mg/kg, 0.01 mg/kg to 100 mg/kg, or 0.1 mg/kg to 10 mg/kg per day, but is not limited thereto.

In addition, the pharmaceutical composition may be administered to mammals such as rats, mice, livestock, and humans through various routes. The administration route and administration method of the pharmaceutical composition may be independent, respectively, and are not particularly limited in the method, and may follow any administration route and administration method as long as the pharmaceutical composition can reach the target site. there is. The pharmaceutical composition may be administered orally or parenterally. The parenteral administration method includes, for example, intravenous administration, intraperitoneal administration, intramuscular administration, transdermal administration or subcutaneous administration, etc., and a method of applying, spraying, or inhaling the pharmaceutical composition to the diseased area can also be used. may, but is not limited thereto.

The pharmaceutical composition for preventing or treating cancer according to the present invention contains a PRRX1 inhibitor as an active ingredient, thereby suppressing the proliferation or activity of cancer tissues, particularly cancer-associated fibroblasts, and facilitating the penetration of cancer therapeutics into cancer tissues, resulting in cancer tissue By promoting the apoptosis of PRRX1, various cancers expressing PRRX1 can be effectively treated.

Figure 1 shows cancer-associated fibroblast-specific mTFs identified using large-scale single cell RNA sequencing (scRNA-seq) datasets for colorectal cancer, lung cancer, ovarian cancer, squamous cell carcinoma, gastric cancer and pancreatic cancer, A is scRNA-seq It is a flowchart of data analysis, and B is a graph comparing PRRX1 gene expression levels in normal fibroblasts and cancer-associated fibroblasts (Wilcoxon rank-sum test, *** p < 2e-16).

Figure 2 confirms the level of PRRX1 protein expression in cancer tissues, A is the ratio of PRRX1 protein expressed in CAFs of pancreatic cancer, ovarian cancer, lung cancer, HNSCC, gastric cancer, SCC and colorectal cancer (SMC and KUL), and B is B cells , PRRX1 protein expression in CAFs, CD4 T cells, CD8 T cells, endothelial cells, macrophages, monocytes, neutrophils, NK cells and T cells.

Figure 3 shows the correlation between cancer tissue and PRRX1 protein expression, A is the PRRX1 protein expression level of colorectal cancer, gastric cancer, lung cancer, esophageal cancer and breast cancer using immunohistochemistry, and B is Kaplan-Meier (KM) survival rate analysis It is a graph of survival rate according to PRRX1 protein expression in CAFs of colorectal cancer, gastric cancer and esophageal cancer.

Figure 4 confirms the ability of PRRX1 to reprogram normal fibroblasts. A is NSG in human gastric cancer cells (MKN28) alone or in combination with human gastric normal fibroblasts SNF32-FLAG, PRRX1a-overexpressing SNF32, or PRRX1b-overexpressing SNF32. It is a schematic diagram of subcutaneous co-implantation in a mouse, B is a primary tumor volume graph and a tumor photograph of each group, and C is a H&E representative image of each group.

Figure 5 confirms the promotion of cancer metastasis by PRRX1, A is human gastric cancer cells (MKN28) alone, or human gastric normal fibroblasts SNF32-FLAG, PRRX1a-overexpressing SNF32, or PRRX1b-overexpressing SNF32 mixed with NSG mice subcutaneously The incidence of lung metastasis in each group after co-transplantation, and B is the H&E representative image of metastasized lung cancer cells in each group.

Figure 6 confirms the effect of PRRX1 in fibroblasts on tumorigenicity. A is a fibroblast-specific CAS9-expressing mouse (FSP1 ^cre ; CAS9 ^EGFP ) was created to delete PRRX1 in fibroblasts and injected LLC1-Luc-GFP. B is a schematic diagram of FSP1 ^cre ;CAS9 ^EGFP mice with a comparison of tumor size changes by PRRX1 deletion and tumor genetic values.

Figure 7 is a schematic diagram of single cell RNA-seq analysis of human CAFs and CAFs classified according to the expression level of PRRX1 (high expression: H, low expression: L) using scRNA-seq data as a heatmap. show

Figure 8 is a schematic diagram of bulk RNA-seq analysis obtained from mouse fibroblasts (mouse embryonic fibroblasts, skin wound healing fibroblasts and MMTV-CAF) and GSVA for ex vivo fibroblasts of PRRX1 WT or PRRX1 KO The analysis results are shown as a heat map.

9 shows apoptosis of fibroblasts dependent on the expression of PRRX1.

10 shows the ECM contractile activity of fibroblasts dependent on the expression of PRRX1.

11 is a schematic diagram of the construction of a transgenic mouse model in which fibroblast-specific PRRX1 depletion was induced by administering sgRNA (sgPrrx1) to PRRX1 before skin excision, and is a representative image of a wounded tissue 10 days after skin excision.

12 shows representative images of wound sites at 0, 3, 8, 10, 12, 15, and 18 days after wounding in fibroblast-specific PRRX1 knockdown (sgPrrx1) and control (sgNS) mice.

Figure 13 is a schematic diagram of the construction of a tumor mouse model in which LLC1-Luc-GFP cancer cells were transplanted into a transgenic mouse (FSP1 ^cre ; CAS9 ^EGFP ).

Figure 14 is a table (A) and a graph (B) showing the tumor response to each treatment drug.

15 is a representative image of tumor volume monitored by MRI for 10 weeks after each drug treatment.

16 is a representative image confirming long-term overall remission of tumors by MRI in the sgPrrx1 or sgPrrx1 and cisplatin treatment group.

Hereinafter, the present invention will be described in more detail. However, these descriptions are merely presented as examples to aid understanding of the present invention, and the scope of the present invention is not limited by these exemplary descriptions.

1. Materials and Methods

1-1. Cell lines and reagents

Human stomach cancer cell line MKN28 was purchased from the Korean Cell Line Bank and subcultured for less than 6 months before use. Lewis Lung carcinoma cell line LLC1 was purchased from ATCC. All cells were cultured in DMEM medium supplemented with 10% FBS and 1% antibiotics.

The base sequences of shRNA and gRNA used in the experiment are shown in Table 1 below.

designation	Base sequence (5'-3')	sequence number
shRNA targeting PRRX1-1	CCGGGTCCCTCCCAAGATGTTGTTTCTCGAGAAACAACATCTTGGGAGGGACTTTTTG	3
shRNA targeting PRRX1-2	CCGGGCAGGCTTTGGAGCGTGTCTTCTCGAGAAGACACGCTCCAAAGCCTGCTTTTTG	4
shScrbl control for PRRX1		CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG	5
gRNA scaffold for shRNA		GAGCGGCAACCGGCGCTGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	6

1-2. mouse model

All studies and procedures involving animals were approved by the Animal Experiment Management Committee of the Laboratory Animal Research Center of the Samsung Biotechnology Research Institute.

1-2-1. Co-injection model fabrication

Referring to FIG. 4A , human gastric cancer cells MKN28 1x10 ⁶ were subcutaneously injected into both flanks of each NSG (NOD/SCID/IL-2Rnnull) mouse (n = 6 mice/group). And as indicated, MKN28 1x10 ⁶ cells were mixed with primary human stomach normal fibroblasts SNF32 overexpression-FLAG (control), SNF32 overexpression-PRRX1a or SNF32 overexpression-PRRX1b prior to injection. Tumor growth was measured with a caliper, and tumor volume was calculated with the following formula: Tumor volume = length x width x width x 1/2.

1-2-2. Construction of FSP1 ^cre ;CAS9 ^EGFP transgenic mice

FSP1-Cre-expressing mice (Stock No: 012641, Yeo et al., 2018) and Rosa26-LSL-Cas9 knockin mice (Stock No: 024857) were supplied by Jackson Laboratory. Mice were crossed on a C57BL/6 background, and all sexes were used with an age range of 1 to 4 months.

1-2-3. LCC1 subcutaneous injection into FSP1 ^cre ;CAS9 ^EGFP transgenic mice

Referring to Figure 6A, before injecting cancer cells into FSP1 ^cre ;CAS9 ^EGFP transgenic mice, sgRNA against PRRX1 was used to deplete PRRX1 in fibroblasts. sgNS was used as a control. 5x10 ⁴ LLC1-Luc-GFP cancer cells were subcutaneously injected into the flank of each mouse. LLC1 primary tumor growth was monitored by bioluminescence imaging in each group of mice at 7, 14, 21 and 35 days after injection of LLC1 Luc-GFP. For in vivo bioluminescence imaging, mice were injected with 75 mg/kg of D-luciferin (potassium salt, Biosynth L-8820).

1-2-4. Skin wound healing in FSP1 ^cre ;CAS9 ^EGFP transgenic mice

Referring to FIG. 11A, adult FSP1 ^cre ; CAS9 ^EGFP transgenic mice were used . There are skin wounds on the back of the mouse with four 12 mm biopsy punches, and the wounds are covered with a transparent semi-occlusive dressing (Tegaderm, 3M) to prevent drying, and the wounds are observed until the experiment is terminated or the mouse dies. . Excisional wounds were captured with a camera on days 0, 3, 8, 10, 12 and 18. Wound area was measured by histological analysis and wound healing and contraction analysis methods.

1-2-5. In vivo experimental strategies for therapeutic evaluation

Referring to FIG. 13, 8-week-old FSP1 ^cre ;CAS9 ^EGFP mice were transplanted with 1x10 ⁶ LLC1-Luc-GFP cells. Cisplatin is a type of anticancer drug, and administration of cisplatin was started at a dose of 10.5 mg/kg ip twice a week when the tumor volume reached about 30 mm ³ . sgPrrx1 was administered at an MOI of 0.01 twice a week for 32 weeks, and tumor tissues from mice were collected for follow-up studies, fixed with 10% normal buffered formalin, and embedded in paraffin. Tumor size was measured weekly using magnetic resonance imaging (MRI), and volume was calculated using Paravision software version 6.0 (Bruker-Biospin).

1-2-6. MR imaging and data analysis

All in vivo MR imaging was performed with a 7T/20 MR system (Bruker-Biospin, Ettlingen) equipped with a 20 cm gradient set capable of supplying up to 400 mT/m with a 100 μs rise time. .

A square volume coil (35 mm id) was used for excitation and signal reception. To acquire MR images from each mouse, a fast spin-echo T2-weighted MRI sequence was used with respiratory gating and the following conditions: repetition time (TR). )/echo time (TE) = 2500/45 ms; number of experiments (NEX) = 3; echo train length = 6; plane resolution = 130 x 130 μm ² ; slice thickness = 1 mm.

To quantify the tumor volume in the MR image, Paravision software version 6.0 (Bruker-Biospin) was used to determine the tumor region in each slice of the image and draw regions of interest (ROIs) around the tumor volume.

1-4. Tissue samples and immunohistochemistry

Tissue samples were approved by the institutional review board of Samsung Seoul Hospital (Seoul, Korea) (approval number SMC 2021-02-048) for colorectal cancer (n=185) and gastric cancer (n=178). , 5 cancer tissues for lung cancer (n=80), esophageal cancer (n=168) and breast cancer (n=80) were obtained from patients. Immunostaining for PRRX1 protein was performed using an anti-PRRX1 monoclonal antibody (LS-bio LS-C336798). Samples used for tissue microarray (TMA) were age, sex, tumor size, depth of invasion (T), nodal status (N), metastasis (M), overall survival (OS), and disease-free survival. Clinical data including disease-free survival (DFS) are available. Staging according to the TNM classification was applied according to the guidelines of the 2010 American Joint Committee on Cancer staging manual.

Immunohistochemical staining was performed according to a conventionally known method. Briefly, tissue sections were deparaffinized with xylene, dehydrated with alcohol, and finally treated with methanol containing hydrogen peroxide. Then, sections were treated with TE buffer (containing 10 mM Tris and 1 mM EDTA, pH 9.0) for antigen retrieval. To block non-specific staining, each section was treated with PBST containing 4% skim milk (PBS containing 0.1% Tween 20) for 30 minutes and then PBST containing 4% skim milk. was reacted with the primary antibody for 60 minutes at room temperature. Primary antibodies were: anti-PRRX1 (Origene TA803116, 1:400), anti-PRRX1 (LS-bio LS-C336798, 1:500), anti-aSMA (DAKO M0851, 1:200), anti- PCNA (Abcam ab29, 1:1000) and anti-PDGFRa (Cell signaling 3164, 1:100). The sections were then washed three times with PBS buffer and reacted with an anti-mouse/rabbit protein kit (Envision Plus) at room temperature. 3-amino-9-ethylcarbazole (AEC, SK-4205) was used as a coloring agent. Sections were counterstained with hematoxylin, and virtual slide images were generated using an Aperio® AT2 virtual slide scanner (Leica). Immunohistochemistry scores were determined semi-quantitatively. In summary, the intensity and percentage of staining-positive cells were determined as follows: [score 1], if less than 50% of stromal cells had weak staining or less than 20% had moderate staining; [2 points], when 50% or more is weak staining, 20 to 50% is medium staining, or less than 20% is strong staining; [3 points], if 50% or more is medium dyeing or 20% or more is strong dyeing.

Image visualization processing steps and detailed protocols were performed according to conventional methods (Yeo, S. Y., et al. 2017 Oncotarget 8, 65265-65280). Visualization was performed by converting coregistered images to pseudo-color images using Image J Fiji software. In Image J Fiji, color deconvolution and hematoxylin staining signals for Plugin, DAB/AEC separation were processed.

1-5. Wound healing and contraction assay

To estimate the wound healing rate and contraction rate (%), wound images were acquired on the day of wounding (day 0) and 3, 8, 10, 12, 15, and 18 days after wounding. Wound contraction and healing rates were quantified according to methods known in the art (Sung, C. O., et al. 2011 The American journal of pathology 179, 1827-1838; Lee, K. W., et al. 2015 Cancer research 75, 73-85 ).

Wound Healing Rate (%) = (1 - (Current Wound Area/Original Wound Area)) x 100%

Wound contraction rate (%) = (1 - (current wound area epithelialized area/original wound area)) x 100%

1-6. Apoptosis assay

Apoptosis assay was performed according to the manual of the BD Annexin V-APC Apoptosis Detection Kit (Cat. 550474, BD Biosciences). CAFs were separated, washed twice with PBS, and then resuspended in an annexin binding buffer (1xAnnexin binding Buffer). These CAFs were stained with Annexin V coupled to APC for 15-20 minutes in the dark at room temperature. After culturing, the cells were washed twice with an annexin binding buffer and resuspended in an annexin binding buffer containing propidium iodide, and the stained cells were immediately detected by flow cytometry.

1-7. Gel shrinkage assay

Gel contraction analysis was performed for extracellular matrix contraction analysis, using a cell contraction assay kit (Cat: CBA-201, Cell Biolabs) according to the manufacturer's instructions. CAFs were obtained by trypsinization, washed twice with PBS, and then resuspended in a complete medium (10 μl) containing collagen and 5xDMEM to make a total volume of 500 μl. 500 μl of this cell-collagen mixture was dispensed into a 24-well plate (for collagen polymerization) and incubated at 37° C. for 2 hours. Gel shrinkage was initiated as the gel fell off the side of the well, and a change in the size of the collagen gel was observed. The complete medium was replaced every other day.

1-8. Analysis of single cell RNA sequencing data

1-8-1. scRNA-seq data collection

Referring to A of FIG. 1, for human colorectal cancer, lung cancer, ovarian cancer, squamous cell carcinoma, stomach cancer and pancreatic cancer Six published single cell RNA-Sequencing (scRNA-seq) datasets were used, and the list of the datasets is shown in Table 2 below.

	cancer	database	Approval number	source
I	colorectal cancer	Gene Expression Omnibus	GSE132465; GSE144735	Lee et. al. 2020
Ⅱ	lung cancer	ArrayExpress	E-MTAB-6149; E-MTAB-6653	Lambrechts et. al. 2018
III	ovarian cancer	ArrayExpress	E-MTAB-8107	Qian et. al. 2020
IV	squamous cell carcinoma	Gene Expression Omnibus	GSE144240	Ji et. al. 2020
V	stomach cancer	database of Genotypes and Phenotypes	phs001818.v1.p.1	Sathe et. al. 2020
VI	pancreatic cancer	Genome Sequence Archive	CRA001160	Peng et. al. 2019

1-8-2. scRNA-seq data preprocessing

scRNA-seq was performed on wound tissue from 10-day-old mice using 10X Chromium 3' v2 chemistry. The collected original scRNA-seq reads were aligned to the mouse ( Mus musculus ) reference genome using the cellranger v3.1.0 pipeline of 10X genomics. For initial quality control, cells with less than 200 detected genes and genes expressed in less than 3 cells were removed. In addition, apoptotic cells in which mitochondrial transcripts were expressed at 5% or more were regarded as low-quality cells and discarded. 2,519 filtered cells were used for further analysis. For each cell (100,000), log normalization was performed by calculating the total number of constant reads per cell and performing log transformation. For visualization, principal component analysis (PCA) was performed using 2,000 highly variable genes for dimensionality reduction, and T-distributed stochastic neighbor embedding (tSNE) was performed to reduce the PCA scale to 2D space. and UMAP (Uniform Manifold Approximation and Projection) were performed. All analyzes were performed using the Seurat v4.0.0 package in R (v 3.6.3).

1-8-3. Stochastic single cell annotation

Using the markers used in previous studies (Costa, A., et al. 2018 Cancer cell 33, 463-479), the probability that each cell belongs to a cell type is calculated through the hierarchical statistical framework CellAssign (version 0.99.16) did A list of genes used for single cell annotation is shown in Table 3 below. Then, the size factor for each cell in the R package was calculated by the expression of the function found in the scarn package (version 1.12.1).

	cell type	marker
One	B cells	BANK1, CD79A, CD79B, FCER2, FCRL2, FCRL5, MS4A1, PAX5, POU2AF1, STAP1 TCL1A
2	cancer-associated fibroblasts	Twist1, PDGFRA, TNC, ACTA2
3	fibroblasts	ADAM33, CLDN11, COL1A1, COL3A1 ,COL14A1 ,CRISPLD2, CXCL14, DPT, F3, FBLN1, ISLR, LUM, MEG3, MFAP5, PRELP, PTGIS, SFRP2, SFRP4, SYNPO2, TMEM119
4	CD4 T cells	ANKRD55, DGKA, FOXP3, NT4, IL2RA, MDS2, RCAN3, TBC1D4, TRAT1
5	CD8 T cells	CD8B, HAUS3, JAKMIP1, NAA16, TSPYL1
6	endothelial cells	CDH5, CLDN5, CLEC14A, CXorf36, ECSCR, F2RL3, FLT1, FLT4, GPR4, GPR182, KDR, MMRN1, MMRN2, MYCT1, PTPRB, RHOJ, SLCO2A1, SOX18, STAB2, VWF
7	macrophage	APOC1, C1QC, CD14, CD163, CD300C, CD300E, CSF1R, F13A1, FPR3, HAMP, IL1B, LILRB4, MS4A6A, MSR1, SIGLEC1, VSIG4
8	monocyte	CD33, CD300C, CD300E, CECR1, CLEC6A, CPVL, EGR2, EREG, MS4A6A, NAGA, SLC37A2
9	neutrophil	CEACAM3, CNTNAP3, CXCR1, CYP4F3, FFAR2, HIST1H2BC, HIST1H3D, KY, MMP25, PGLYRP1, SLC12A1, TAS2R40
10	NK cells	CD160, CLIC3, FGFBP2, GNLY, GNPTAB, KLRF1, NCR1, NMUR1, S1PR5, SH2D1B
11	T cell	BCL11B, CD5, CD28, IL7R, ITK, THEMIS, UBASH3A

1-8-4. Transcription factors of activated CAF

The annotation results of scRNA-seq were used to find transcription factors (TFs) highly correlated with activated CAFs. First, a differentially expressed gene (DEG) between normal fibroblast (NF) and cancer-associated fibroblast (CAF) was identified using the 'FindAllMarkers' function with default parameters. Then, only 6 TFs among the DEGs were selected. Then, the Pearson Correlation Coefficient (PCC) between the expression levels of the six TFs and the activated fibroblast score was calculated. Finally, the TF with the highest PCC was selected.

1-8-5. Preparation of scRNA-seq isolated from mouse wound tissue

Adult wild type mice (Balb/c) were used for scRNA-seq. A 12 mm biopsy punch skin wound was made on the back of the mouse, and 10 days later, tissue at the wound site was incised. Tissues were finely cut and minced with a scalpel, and separated using DMEM/F-12 serum medium containing collagenase I at 37° C. for 12 hours on a shaker.

Cells from the wound tissue were transferred to a 50 ml tube and dead cells were removed via ficoll separation. For scRNA sequencing and processing, 3' single cell RNA sequencing was performed using single cell A chip kit, Single Cell 3' Library and Gel Bead Kit V2, and i7 Multiplex Kit (10x Genomics) according to the manufacturer's instructions. Libraries were sequenced on the Illumina HiSeq2500 platform.

1-8-6. Calculating module scores for scRNA-seq data using Seurat's addmodulescore function

The module score of single cell RNA seq data was calculated using Seurat's 'Add ModuleScore' function (Stuart T, etal. Cell 2019;177(7):1888-902). The modulus score is the average expression level of a gene associated with a particular feature in a particular single cell minus the average expression level of a randomly selected control gene. A high module score indicates that a gene of a particular characteristic is expressed more than expected in a particular single cell. The fibroblast activation score was calculated using a gene set related to fibroblast activation, and the ECM organization score was calculated using the gene of GO_EXTRACELLULAR_MATRIX in the Molecular Signatures Database (MSigDB), and the myofibroblast like score (Myofibroblast like score) was obtained using the gene of GO_REGULATION_OF_SUPRAMOLECULAR_FIBER_ORGANIZATION. ) was calculated.

1-8-7. Establishment of a cell-cell interaction network between CAFs isolated from cancer tissues and cancer cells

To identify ligands activated between sender cells (PRRX1-high- and PRRX1-low-expressing CAFs) and receiver cells (various cancer cells), NicheNet was used to detect activated ligands from scRNA-seq data. Ligand was predicted. To identify only activated ligands, NickeNet used a knowledge-based prior model of potential ligand-target regulatory networks. Then, the effect of each ligand on the expression of the recipient cells was predicted. To run NicheNet, we first screened the DEG between activated and inactivated cells in the receiving cell type (cancer cells isolated from various cancer tissues) using Seurat's FindMarker function with default parameters. Then, NicheNet's predict_ligand_activity function was used with the identified DEGs to predict ligand binding to recipient cells.

1-9. qPCR

Total RNA was extracted using the RNeasy kit (#74104, Qiagen) and cDNA was synthesized from 2 g of total RNA using the High Capacity cDNA Reverse Transcription Kit (#4368813, Applied Biosystems). In the PCR reaction, SYBR Green PCR master mix (Applied Biosystems) was used together with each primer set in Table 4, and the reaction was performed using an ABI 7900 HT Fast Real PCR system (Applied Biosystems). GAPDH was used as an internal control. The qPCR amplification conditions were as follows: 1 step at 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The fold-change (FC) in each gene expression was analyzed using the ΔΔ Ct method. Three repetitions were performed each.

Primer name	Primer sequence (5'-3')	sequence number
Mouse PRRX1-F		GAGCGTGTCTTTGAGCGGA	7
Mouse PRRX1-R		CATGTGGCAGAATAAGTAGCCAT	8
Mouse GAPDH-F		AATGGATTTGGACGCATTGGT	9
Mouse GAPDH-R		TTTGCACTGGTACGTGTTGAT	10

1-9. Optimal Cutoff of PRRX1 Expression Values for Overall Survival Analysis

The optimal cutoff for PRRX1 expression values was determined using the rank statistic maximally selected in the 'maxstat' R package. This value was chosen as the cut-point value most significantly associated with survival for a possible cut-off point. Possible cutoff points were used ranging from the 20th to the 80th of PRRX1 expression values.

1-10. statistical analysis

The Wilcoxon rank sum test or t-test was used to evaluate differences between groups for continuous variables. Chi-square test or Fisher exact test was used to evaluate the association between groups for categorical variables. Overall survival (OS) was defined as the time interval between the date of curative surgery and the date of death, and disease-free survival (DFS) was defined as the time interval between the date of curative surgery and the date of tumor recurrence or death. OS and DFS rates were estimated using the Kaplan-Meier method and survival distributions between the two groups were compared using the log-rank test. All tests were two-tailed, and P-values less than 0.05 were considered statistically significant. Statistical analysis was performed using SPSS statistical software (SPSS Inc).

2. Results

2-1. Identification of cancer-associated fibroblast-specific TFs

To identify mTFs that are highly expressed compared to normal fibroblasts and that are specific and functionally important for cancer-associated fibroblasts (CAFs), large-scale scRNA-seq data containing datasets from various cancer types were used in the CellAssign stochastic model ( Peng, J., et al. 2019 Cell Res 29, 777). As a result, as shown in A and B of FIG. 1 , PRRX1 was highly expressed only in CAFs of colorectal cancer, lung cancer, ovarian cancer, squamous cell carcinoma, gastric cancer and pancreatic cancer, and was functionally related to fibroblast activation. In addition, further analysis of multiple scRNA-seq data showed that PRRX1 was expressed in 30 to 90% of total CAFs depending on the cancer type, and was particularly restricted in CAFs, as shown in FIG. 2A and B.

PRRX1 expression on cancer tissues was investigated using immunohistochemistry. As a result, as shown in A and B of FIG. 3, PRRX1 protein was not significantly expressed in non-tumor fibroblasts or other cells, but in tissues of colon cancer, stomach cancer, lung cancer, esophageal cancer and breast cancer. All were highly expressed. And in colorectal, gastric, and esophageal cancers, patients expressing PRRX1 protein in CAF have a poor prognosis.

These results suggest that PRRX1 is highly expressed only in CAFs and has a strong association with poor survival across various cancer types.

2-2. Confirmation of the role of PRRX1 in vivo

To investigate the role of PRRX1 on the tumor promoting ability of CAFs in vivo , it was confirmed that PRRX1 could reprogram normal fibroblasts into CAFs.

First, gastric cancer cells (MKN28) and gastric normal fibroblasts (SNF32) were co-grafted and introduced into NSG mice. As a result, as shown in B and C of FIG. 4 , as expected, SNF32 suppressed tumor growth of MKN28 cells as normal fibroblasts. On the other hand, SNF32-PRRX1a and SNF32-PRRX1b, which express PRRX1a and PRRX1b isoforms, respectively, significantly increased the growth of co-implanted MKN28 tumors, and inhibited primitive stromal cells and stem cell-like cancer cells (stem cell). The formation of a micropapillary pattern characterized by a mixture of cell-like cancer cells was promoted.

Since micropapillary patterns are associated with increased cancer metastasis, it was confirmed whether SNF32 overexpressing PRRX1 promotes cancer metastasis. As a result, as shown in A and B of FIG. 5 , SNF32-PRRX1a and SNF32-PRRX1b markedly increased lung metastasis, and in particular, metastasized cancer cells appeared surrounded by fibroblasts and formed desmoplasia.

These results suggest that PRRX1 is essential for the tumorigenicity and metastasis-inducing ability of CAFs, and that only PRRX1 can reprogram tumor-suppressing normal fibroblasts into CAFs.

2-3. Confirmation of the effect of PRRX1 on the tumorigenicity of fibroblasts

To investigate the effect of PRRX1 deletion in fibroblasts on oncogenetic properties, mice conditionally deleting PRRX1 in fibroblasts were combined with fibroblast-specific CAS9-expressing mice (FSP1 ^cre ; CAS9 ^EGFP ) using CRISPR-CAS9 technology. model was made.

First, PRRX1 was deleted in fibroblasts by injecting single guide RNA (sgRNA) for PRRX1 into FSP1 ^cre ;CAS9 ^EGFP mice, and LLC1-Luc-GFP cancer cells were subcutaneously injected. As a result, as shown in B of FIG. 6, the tumorigenicity of LLC1 was reduced from 10/10 (control mice) to 2/10 (fibroblast-specific PRRX1 -deficient mice), which indicates that PRRX1 expression in fibroblasts is associated with tumorigenicity. indicates that it is essential for

3-4. Confirmation of myofibroblast-like functions of CAFs by PRRX1

To investigate how PRRX1 induces the tumor-promoting activity of CAFs, we analyzed large-scale scRNA-seq data using eight datasets from various cancers to systematically understand the function of PRRX1 in fibroblasts. As a result, as shown in FIG. 7, mRNA data related to CAFs expressing high or low PRRX1 were obtained from scRNA-seq data, and biological phenotypes were identified using Seurat's AddModuleScore function. These results were validated in another independent dataset, and mRNA levels were measured for mouse embryonic fibroblasts (MEF), skin wound-healing fibroblasts, and mouse fibroblasts from MMTV-CAF, respectively. Comparisons were made before and after PRRX1 knockdown. In mice, RNA-seq and gene set variation analysis (GSVA) were performed after PRRX1 was deleted using CAS9 technology. As a result, as shown in FIG. 8, in CAFs across all cancer types, myofibroblast-related functions such as ECM production and organization, contractile strength, angiogenesis, cell growth, and wound healing are best preserved of PRRX1 . It has been confirmed that this function has been

In addition, the validity of this potential function of PRRX1 in CAF was confirmed experimentally. First, human gastric CAF (stomach CAF, SCAF) was treated with shRNA (shPRRX1) against PRRX1 to confirm the effect of PRRX1 on CAF survival. As a result, as shown in FIG. 9, shPRRX1 significantly increased CAF apoptosis. Also, apoptosis occurred more frequently in fibroblasts expressing low levels of PRRX1. The PRRX1-high-expressing subpopulation sorted in SCAF containing the PRRX1 promoter-GFP reporter showed less apoptosis and stronger resistance to serum starvation-induced apoptosis than the PRRX1-low-expression subpopulation.

In addition, the effect of PRRX1 on the ECM remodeling ability of normal fibroblasts and CAFs was investigated. As a result, as shown in FIG. 10 , when the expression level of PRRX1 in SNF32 increased, ECM contractile activity was remarkably improved, whereas shRNA-mediated PRRX1 knockdown in CAF almost lost ECM contractile activity. Consistent with these results, PRRX1-high-expressing subpopulations sorted in SCAF showed higher ECM contraction than PRRX1-low expression subpopulations and lost the ability of ECM contraction in response to shRNA-mediated PRRX1 silencing.

3-5. Confirmation of regulation of myofibroblast activation of PRRX1 during wound healing in vivo

Because myofibroblasts are the first to be found in wound healing tissues and are well known to be involved in the wound healing process, wound healing is an optimal in vivo experimental platform to evaluate the effects of PRRX1 on myofibroblasts. Therefore, to confirm that PRRX1 is the master regulator of myofibroblasts in vivo, the total thickness of excised skin wounds was determined using skin punch biopsy in conditional PRRX1 knockout and PRRX1 expressing mice. measured, and the effect of PRRX1 on the wound healing process was investigated.

First, fibroblast-specific PRRX1 knockout (FS-PRRX1-KO) mice were constructed by injecting sgRNA for PRRX1 into FSP1 ^cre ;CAS9 ^EGFP mice, and the skin was cut through skin excision. As a result, as shown in B of FIG. 11, a notable abnormality observed in PRRX1-KO mice was a severe deficiency of myofibroblastic fibroblasts during wound healing, resulting in FS-PRRX1 Wound contraction was significantly reduced and wound closure was severely delayed in KO mice.

In addition, as shown in FIG. 12, as a result of microscopic examination of the wounded tissues of FS-PRRX1-KO mice 12 days after resection, the thickness of the epithelial layer and the dermal layer was significantly reduced, and the total number of fibroblasts compared to the control mice significantly decreased. In particular, the number of fibroblasts with myofibroblast phenotype (SMA + / TNC + / PDGFRa ⁺ ) was significantly reduced in FS-PRRX1-KO mice, and the number of PCNA ⁺ fibroblasts showing cell proliferation / survival was significantly reduced.

These results indicate that depletion of PRRX1 in fibroblasts leads to a reduction of the myofibroblast subpopulation, which is a key component of the wound healing process in vivo.

3-6. Confirmation of cancer treatment effect by PRRX1 deficiency in fibroblasts

Previous experiments have highlighted PRRX1 as a potential therapeutic target in the design of novel anticancer agents that selectively inhibit the myofibroblast CAF subpopulation. Therefore, we further investigated whether inhibition of PRRX1 in fibroblasts exerts an in vivo anticancer effect similar to that in clinical trials.

Tumor cells (LLC1) were injected into fibroblast-specific CAS9 expressing (FS-CAS9) mice and tumor growth was monitored using MRI scans (n = 10). When the tumor volume reached 30 mm ³ , therapeutic depletion of PRRX1 in fibroblasts was initiated by administering sgRNA against PRRX1 (sgPrrx1) to FS-CAS9 mice ( FIG. 13 ). As a result of comparing the untreated control group, cisplatin treatment, and cisplatin and sgPrrx1 combination treatment groups, as shown in A and B of FIG. 14, complete remission (CR) was induced in 8 out of 10 mice in the sgPrrx1 administration group. and partial remission (PR) was observed in the remaining two animals. In the control group (sgNS treatment), continuous progressive disease (PD) was observed in all 10 mice. Cisplatin has been reported to have a partial therapeutic effect on LLC1 in previous studies (Fournel, L., et al. 2019 Cancer Lett 464, 5-14; Kang, MJ, et al. 2019 Lab Anim Res 35, 17). , In this study, only 2 out of 10 mice had an effect of partially suppressing cancer progression, while cisplatin had no therapeutic effect in the remaining 8 mice. It was found that the tumors of these mice were resistant to cisplatin. In particular, total remission was induced in all 10 mice in the sgPrrx1 and cisplatin combination treatment group.

As a result of microscopic examination of tumor sites in all mice in which total remission was induced, as shown in FIG. 14 , no tumor cells remained. And as a result of follow-up observation of the mice in which total relief was induced up to 32 weeks, as shown in FIG. 15, it was confirmed that total relief was maintained during the entire period.

These results indicate that depletion of fibroblast-specific PRRX1 can maintain long-term overall remission of cisplatin-resistant cancer.

Taken together, PRRX1, which is highly expressed in cancer-associated fibroblasts, can be presented as a new anti-cancer treatment target, and suppresses the expression of PRRX1 gene or protein to reduce cancer cell growth and proliferation and induce apoptosis to achieve effective cancer treatment. It can be expected, and cancers that are resistant to conventional anticancer drugs such as cisplatin can also be treated. Therefore, the PRRX1 inhibitor can be applied as a novel pharmaceutical composition for preventing or treating cancer.

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

Claims (8)

1. A pharmaceutical composition for preventing or treating cancer comprising a PRRX1 inhibitor as an active ingredient.
2. The method of claim 1,

   The pharmaceutical composition wherein the PRRX1 inhibitor inhibits the expression or activity of the PRRX1 gene or protein.
3. The method of claim 1,

   Wherein the PRRX1 inhibitor is at least one selected from the group consisting of antisense oligonucleotides, siRNA, shRNA, ribozymes, antibodies, antigen-binding fragments thereof, compounds, peptides, peptide mimetics, and aptamers.
4. The method of claim 1,

   The pharmaceutical composition wherein the PRRX1 inhibitor complementarily binds to mRNA containing the nucleotide sequence represented by SEQ ID NO: 1 or 2, or specifically binds to a protein expressed therefrom.
5. The method of claim 1,

   The pharmaceutical composition wherein the PRRX1 inhibitor is shRNA comprising the nucleotide sequence represented by SEQ ID NO: 3 or 4.
6. The method of claim 1,

   The pharmaceutical composition wherein the PRRX1 inhibitor inhibits the proliferation or activity of cancer-associated fibroblasts.
7. The method of claim 1,

   The pharmaceutical composition wherein the PRRX1 inhibitor inhibits extracellular matrix contraction of cancer-associated fibroblasts.
8. The method of claim 1,

   The cancer is leukemia, lymphoma, Hodgkin's disease, hematopoietic malignancy, cervical cancer, sarcoma, testicular cancer, malignant melanoma ( malignant melanoma, endocrine cancer, bone cancer, prostate cancer, uterus cancer, breast cancer, bladder cancer, renal cell carcinoma, Central nervous system tumor, brain cancer, liver cancer, stomach cancer, pancreatic cancer, skin cancer, squamous cell carcinoma, lung cancer ( lung cancer), larynx cancer, head and neck cancer, esophageal cancer, colorectal cancer and ovarian cancer.

Images