WO2023073695A1

WO2023073695A1 - Soybean with improved nutritional value as food and with special quality traits

Info

Publication number: WO2023073695A1
Application number: PCT/IL2022/051124
Authority: WO
Inventors: Menachem Sklarz; Sigal Meirovitch; Ari Efrati; Oswald Crasta; Avinoam LERER; Inna OSMOLOVSKY; Yoav SHOSHAN
Original assignee: Equi-Nom Ltd.
Priority date: 2021-10-25
Filing date: 2022-10-25
Publication date: 2023-05-04

Abstract

Soybean plants and parts thereof are provided, which provide higher food nutrition and quality attributes such as protein content and composition than current varieties. Phenotypic and genotypic analyses of many soybean varieties were performed to derive markers for high protein and other protein-related phenotypic traits, and a breeding simulation was used to identify the most common and most stable markers associated with these traits. Following verification of trait stability over several generations, markers and marker cassettes were defined as being uniquely present in the developed soybean lines. The resulting high protein soybean lines can be used to increase the content and/or quality of protein in soybean crops for their various uses.

Description

SOYBEAN WITH IMPROVED NUTRITIONAL VALUE AS FOOD AND WITH SPECIAL QUALITY TRAITS

BACKGROUND OF THE INVENTION

1. TECHNICAL FIELD

[0001] The present invention relates to the field of soybean genetics and breeding, and more particularly, to quantitative trait loci (QTLs, or QTL) associated with improved nutritional value as food and with special quality traits including protein content and protein composition traits of soybean, and methods for introgressing the QTL into germplasm in a breeding program for soybean with improved nutritional value and improved quality attributes and/or processing attributes such as higher protein content and/or different protein type combinations than current varieties.

2. DISCUSSION OF RELATED ART

[0002] Soybean (Glycine max) is a widely grown crop that provides an important source of protein in human nutrition and in animal feeds. Soybeans may be consumed as unfermented food (e.g., as tofu), in various fermented forms, as well as multiple plant-based food applications, such as vegetable protein as an alternative to meat and dairy products. There is continuous need to combine agronomic traits and plant quality traits in new ways in order to improve and optimize field performance, as well as the nutritional value and processing efficiency of the grains.

[0003] Texturized vegetable proteins (TVP) and texturized soy protein concentrates (TSPC) are made of soy flour and soy protein concentrate (SPC), respectively. In recent years, the demand for alcohol-extracted soy protein concentrate for TSPC in meat alternatives has been constantly growing, over the relatively inferior soy-flour-based TVP. Although TVP is much cheaper to produce, it is used mainly in highly seasoned inexpensive food products such as chili dishes, taco meat, burritos, empanadas, meatballs, and some meat analogues due to its inferior texture and taste, while TSPC is being used in expensive high-quality meat and meat analogues products, thanks to its chewy meat-like texture and better taste.

[0004] Protein composition is one of the most important factors affecting protein functionality in TVP. Protein composition and its effect on product quality have been the subject of many investigations (Kinsella 1979; Nakamura 1984). It was determined that there is a relationship between the textural property of legume curds and the constituents of their proteins (Cai and McCurdy A. 2002). SUMMARY OF THE INVENTION

[0005] The following is a simplified summary providing an initial understanding of the invention. The summary does not necessarily identify key elements nor limit the scope of the invention, but merely serves as an introduction to the following description.

[0006] One aspect of the present invention provides a soybean plant with enhanced food nutrition and quality attributes such as protein content and composition, progeny thereof and/or part(s) thereof, the soybean plant comprising a plurality of quantitative trait loci (QTLs) having a corresponding plurality of nucleic acid genetic markers that are associated with phenotypic traits of the soybean plant, including a plurality of agronomic traits, nutrient content traits and protein- related traits, wherein the QTLs are combined in the soybean plant from a plurality of soybean varieties by computationally supported breeding, wherein the QTLs comprise QTL 1 with corresponding markers set forth in SEQ ID NOs: 1 or 2, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 1, and/or QTL 11 with corresponding markers set forth in SEQ ID NOs: 21 or 22, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 21.

[0007] One aspect of the present invention provides soybean flour comprising grounded soybean seeds from the disclosed soybean plants, and comprising any of the disclosed genetic markers.

[0008] These, additional, and/or other aspects and/or advantages of the present invention are set forth in the detailed description which follows; possibly inferable from the detailed description; and/or learnable by practice of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] For a better understanding of embodiments of the invention and to show how the same may be carried into effect, reference will now be made, purely by way of example, to the accompanying drawings in which like numerals designate corresponding elements or sections throughout. In the accompanying drawings:

[0010] Figure 1 is a high-level schematic illustration of several soybean chromosomes with indications of trait locations and the relevant QTL markers, according to some embodiments of the invention.

[0011] Figure 2 is a high-level schematic illustration of a computationally supported breeding method, according to some embodiments of the invention. [0012] It will be appreciated that for simplicity and clarity of illustration, elements shown in the figures have not necessarily been drawn to scale. For example, the dimensions of some of the elements may be exaggerated relative to other elements for clarity. Further, where considered appropriate, reference numerals may be repeated among the figures to indicate corresponding or analogous elements.

DETAILED DESCRIPTION OF THE INVENTION

[0013] In the following description, various aspects of the present invention are described. For purposes of explanation, specific configurations and details are set forth in order to provide a thorough understanding of the present invention. However, it will also be apparent to one skilled in the art that the present invention may be practiced without the specific details presented herein. Furthermore, well known features may have been omitted or simplified in order not to obscure the present invention. With specific reference to the drawings, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0014] Before at least one embodiment of the invention is explained in detail, it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following description or illustrated in the drawings. The invention is applicable to other embodiments that may be practiced or carried out in various ways, as well as to combinations of the disclosed embodiments. Also, it is to be understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting.

[0015] Unless specifically stated otherwise, as apparent from the following discussions, it is appreciated that throughout the specification discussions utilizing terms such as "processing", "computing", "calculating", "determining", “enhancing”, "deriving" or the like, refer to the action and/or processes of a computer or computing system, or similar electronic computing device, that manipulates and/or transforms data represented as physical, such as electronic, quantities within the computing system's registers and/or memories into other data similarly represented as physical quantities within the computing system's memories, registers or other such information storage, transmission or display devices.

[0016] Soybean plants and parts thereof are provided, which provide better food nutrition, quality or improved processing attributes such as higher protein content and/or different protein type combinations than current varieties. Phenotypic and genotypic analyses of many soybean varieties were performed to derive markers for high protein and other protein-related phenotypic traits, and a breeding simulation was used to identify the most common and most stable markers associated with these traits. Following verification of trait stability over several generations, markers and marker cassettes were defined as being uniquely present in the developed soybean lines. The resulting high protein soybean lines can be used to increase the content and/or quality of protein in soybean crops for their various uses.

[0017] For example, disclosed varieties may have high protein content (e.g., >42%, ?44%>46%, >48% of the dry weight, or having intermediate or higher values) which may be used to improve the percentage of protein in soy flour (e.g., by increasing the protein content in the soy flour from current 50-55% to 60-65%) and simplify its preparation procedures (e.g., eliminate the need for aqueous alcohol wash to remove soluble sugars, used in current protein concentration processes). Moreover, the reduction in soluble sugars may contribute financially to the production of other soybean products such as functional soy protein concentrate (FSPC) and soy protein isolates (SPI). [0018] Finally, disclosed varieties may have specific combinations of highly functional proteins that improve further the quality of TVP prepared from soy flour made with the disclosed varieties. Different disclosed varieties may be used to modify the density and/or texture of resulting products as explained below. For example, meat analogues combine granular and flake-shape texturized TSPC to mimic real meat texture. The higher the density of texturized protein, the firmer the texture and the lower the water holding capacity. TVP usually has softer texture compared to TSPC. For example, gels prepared from 1 IS globulin were reported to be firmer than those from 7S proteins (Saio and Watanabe 1978; Kinsella 1979). It is noted that the 11 S globulin (glycinin) and the 7S globulin (P-conglycinin) are the main soybean proteins. Glycinin typically comprises basic polypeptides (denoted Bl, B2, etc.) and acidic polypeptides (denoted Al, A2, etc.). P-conglycinin is a trimeric glycoprotein that comprises a', a and P subunits. [0019] Disclosed varieties may be used to modify these properties to improve the quality of resulting products. Briefly, Samples were prepared by mixing 6 pL of sample (1g of flour from grounded seeds/ 40 ml NaOH, 3mM) with 34 pL of sample buffer solution (24 pl of distilled water, 9 pl of 4X Laemmli sample buffer and 1 pl of 0-mer captoethanol). Samples were boiled for 5 min at 100°C and then 10 pL of each sample were loaded on a 12% Criterion ™ TGX ™ Precast Gel (Bio-Rad Laboratories, Inc. Hercules, USA) and separated at 110 Volt for 90 min. Afterwards it was stained with InstantBlue ® Coomassie Protein Stain (Abeam) and rinsed with distilled water. Protein detection, analysis and documentation was performed by imaging system (gel Doc ™EZ Imager, Bio-Rad).

[0020] Figure 1 is a high-level schematic illustration of several soybean chromosomes with indications of the trait locations listed in Tables 1 and 2, according to some embodiments of the invention. The marker locations on the soybean chromosomes are provided according to version 2 of Williams 82 genome (Schmutz et al. 2010, Genome sequence of the palaeopolyploid soybean, Nature 463(7278):178-183, NCBI deposition project PRJNA19861, https://www.ncbi.nlm.nih.gOv/assembly/GCF_000004515.4, each of which is incorporated herein by reference in its entirety). From the trait markers, the range of varieties was analyzed with respect to the known world varieties, and specific trait loci were identified, as QTLs include only nonworld varieties.

[0021] Tables 1 and 2 list the phenotypic traits that were measured on the plants, the respective measurement methods and the marker locations (see also Figure 1) that were detected to affect the respective phenotypic traits. Table 1 lists the markers with respect to the traits and their measurement method, while Table 2 lists the traits with respect to the markers, including the QTLs. Traits that are listed in Table 2 as being associated with respective QTL markers are those that had a p-value smaller than 0.05 and a PVE (% variance explained by the marker) larger than 6%.

Table 1: Quantified phenotypic traits, methods of measuring the traits and respective marker locations.

Table 2: Phenotypic trait markers and their positions

[0022] Following analysis of the phenotypical trait markers using a classification algorithm, the QTLs and their cassettes were derived to exclude known (world) varieties. Table 3 provides the derived QTLs with their respective genetic markers and marker phases, as well as the resulting marker cassettes, according to some embodiments of the invention. It is noted that all QTLs are on the + strand of the genome. Table 3: QTL markers and cassetes with the respective genetic markers and phases.

Table 3, continued.

[0023] Table 4 relates some of the QTL marker cassettes to some of the traits, which are influenced significantly by the respective cassette. The table entries provide the increase (in %) in the respective trait in plants having the respective cassette with respect to control plants lacking the respective cassettes

Table 4: Cassettes’ significant influence on traits (increases, in %, rounded).

[0024] The following lists the QTLs, locations, alleles, cassettes as well as the respective sequences.

[0025] QTL 1, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 40339928 on soybean chromosome 2. The two alleles of the genetic marker at QTL 1 have the SNP bases “C” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 1 and 2. In cassettes 1 and 2, QTL 1 is homozygous for allele “C” (SEQ ID NO 1).

SEQ ID NO 1 (SNP base spaced and bold):

TTCCTCACCCCATAAAACTCAACAAGGATTGGTTTGAATTTAATTTTTTAAATCCATC TCTTTTAAACTAAACTCGAGTTCGTCATGCATTTTATTGGGA C GAGGATAAAGAAA ATCAAATCCACCATCGATCCACCCCATTGTTATGCATACATACAACTAAATGACCTA CTTTTGGCTTGCTACTTTCACTTTCACAAG

SEQ ID NO 2 (SNP base spaced and bold):

TTCCTCACCCCATAAAACTCAACAAGGATTGGTTTGAATTTAATTTTTTAAATCCATC TCTTTTAAACTAAACTCGAGTTCGTCATGCATTTTATTGGGA A GAGGATAAAGAAA ATCAAATCCACCATCGATCCACCCCATTGTTATGCATACATACAACTAAATGACCTA CTTTTGGCTTGCTACTTTCACTTTCACAAG

[0026] QTL 2, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 18970072 on soybean chromosome 6. The two alleles of the genetic marker at QTL 2 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 3 and 4. In cassette 2, QTL 2 is homozygous for allele “C” (SEQ ID NO 3) or heterozygous (includes both SEQ ID NOs 3 and 4).

SEQ ID NO 3 (SNP base spaced and bold):

CACTTAAGCAAGCTTGACTTTATCATTCATTTTCAAGGTTCCTCTCGCTCAAGCATTG AGGAAGGGTTGCTTAAGTGAGGCATGTCAGTGTATCCTTCAA C TGGTTTTGACGTG GTTTACTTAAGCGCACAACAAGCCATGCTTAAGCGAGCATATCTCAACTTGTGTTTCT GACTCAATTTCCTATAAACCTTTCACAAA

SEQ ID NO 4 (SNP base spaced and bold):

CACTTAAGCAAGCTTGACTTTATCATTCATTTTCAAGGTTCCTCTCGCTCAAGCATTG AGGAAGGGTTGCTTAAGTGAGGCATGTCAGTGTATCCTTCAA T TGGTTTTGACGTG GTTTACTTAAGCGCACAACAAGCCATGCTTAAGCGAGCATATCTCAACTTGTGTTTCT GACTCAATTTCCTATAAACCTTTCACAAA

[0027] QTL 3, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 23423070 on soybean chromosome 6. The two alleles of the genetic marker at QTL 3 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 5 and 6. In cassette 2, QTL 3 is homozygous for allele “C” (SEQ ID NO 5) or heterozygous (includes both SEQ ID NOs 5 and 6).

SEQ ID NO 5 (SNP base spaced and bold):

ATAACCAAATTCTGTCATAATCAAAGCCAAAATACGAAGCCAAAAAATAAGTACAG AAATGCAGAAAATAAAACATAAGTAACTGAAATCTATGAATCCA C TGGAGGATCA AAGCAACAACGGATGAAACTCATGTCGTCTTCAAGCTGCATGATGCGTGTGTCCATC CCTGCAAAGCGTGGATAAAAGGAATTGAAGCGC

SEQ ID NO 6 (SNP base spaced and bold):

ATAACCAAATTCTGTCATAATCAAAGCCAAAATACGAAGCCAAAAAATAAGTACAG AAATGCAGAAAATAAAACATAAGTAACTGAAATCTATGAATCCA T TGGAGGATCA AAGCAACAACGGATGAAACTCATGTCGTCTTCAAGCTGCATGATGCGTGTGTCCATC CCTGCAAAGCGTGGATAAAAGGAATTGAAGCGC

[0028] QTL 4, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 48464349 on soybean chromosome 6. The two alleles of the genetic marker at QTL 4 have the SNP bases “G” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 7 and 8. In cassette 2, QTL 4 is homozygous for allele “G” (SEQ ID NO 7) or heterozygous (includes both SEQ ID NOs 7 and 8).

SEQ ID NO 7 (SNP base spaced and bold):

TCATGTTTGGTTCAAAATGAAGCGAAGCCGAAGGTTATACGGATGGAAATATCATCA GATCCCCCAAACACAACTTTGTAATATATTGCCTGAATGCCTG G GTAGTGTACTACT GGAATTGGATAGAATAGTTTGTTTTGTAGTACTACATCGGAATTAGCTTTTAACAAGT ACTCATGTGGTTCTTTGCTTTTAACTAGT

SEQ ID NO 8 (SNP base spaced and bold):

TCATGTTTGGTTCAAAATGAAGCGAAGCCGAAGGTTATACGGATGGAAATATCATCA GATCCCCCAAACACAACTTTGTAATATATTGCCTGAATGCCTG T GTAGTGTACTACT GGAATTGGATAGAATAGTTTGTTTTGTAGTACTACATCGGAATTAGCTTTTAACAAGT ACTCATGTGGTTCTTTGCTTTTAACTAGT

[0029] QTL 5, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 25967601 on soybean chromosome 11. The two alleles of the genetic marker at QTL 5 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 9 and 10. In cassette 2, QTL 5 is homozygous for allele “G” (SEQ ID NO 9) or heterozygous (includes both SEQ ID NOs 9 and 10).

SEQ ID NO 9 (SNP base spaced and bold):

TCTTCCTTCACGCAGATGATCTTCTTCCTTAAGAAACACCGTCTGAGTTTGTGGAGTG TCAATTGGGTGCGGGCGTAAGGGGACACATAGAACTGCACTC G CCAATTAGGGGA GCAGTCGTCGCTGCCTATCACGCGGTTAAGGTGCTCGCCGATGTGGAGGTCCTGGGC CATGCCTTGAGCGGTTGATTGTGGTCAGGTA

SEQ ID NO 10 (SNP base spaced and bold):

TCTTCCTTCACGCAGATGATCTTCTTCCTTAAGAAACACCGTCTGAGTTTGTGGAGTG TCAATTGGGTGCGGGCGTAAGGGGACACATAGAACTGCACTC A CCAATTAGGGGA GCAGTCGTCGCTGCCTATCACGCGGTTAAGGTGCTCGCCGATGTGGAGGTCCTGGGC CATGCCTTGAGCGGTTGATTGTGGTCAGGTA

[0030] QTL 6, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 22578609 on soybean chromosome 8. The two alleles of the genetic marker at QTL 6 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 11 and 12. In cassette 1, QTL 6 is homozygous for allele “A” (SEQ ID NO 11) or heterozygous (includes both SEQ ID NOs 11 and 12).

SEQ ID NO 11 (SNP base spaced and bold):

TATTCAAGATTTCCTTCTTCAATCACACATATAATCTAATCAGAAAAAAAGATTAAG CTATGTTGACCCACAAAAATGCCAAATACATGATACTGGAAAG A CTTTAACTCTCC TTCTCTGGTTCTATTGTTTGTTGCGTCATAGTTCTTGTTGGTGTATGCAGATAATACTT TTGGGTCATCCTCCCAAAAATTCCTATTT

SEQ ID NO 12 (SNP base spaced and bold):

TATTCAAGATTTCCTTCTTCAATCACACATATAATCTAATCAGAAAAAAAGATTAAG CTATGTTGACCCACAAAAATGCCAAATACATGATACTGGAAAG G CTTTAACTCTCC TTCTCTGGTTCTATTGTTTGTTGCGTCATAGTTCTTGTTGGTGTATGCAGATAATACTT TTGGGTCATCCTCCCAAAAATTCCTATTT

[0031] QTL 7, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 2574461 on soybean chromosome 7. The two alleles of the genetic marker at QTL 7 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 13 and 14. In cassette 1, QTL 7 is homozygous for allele “C” (SEQ ID NO 13) or heterozygous (includes both SEQ ID NOs 13 and 14).

SEQ ID NO 13 (SNP base spaced and bold):

GTAATTTTGGAAATAACAAAAAATATTGGGTGTACAAGAAAAAAGTTGGGTGCGCA AAGTAATTGTCAATCGTAAGGCTTTAAGGGTGCGGAAGGAAGCC C GGCCCATTATT CCTAAATGAAGAAAAAGTAGGCACAGATTCTGATGGAAACTGCCGGTGGTGGGCTA TGAGGATTTACGACTTAGCAAGGTCATGGCCCT

SEQ ID NO 14 (SNP base spaced and bold):

GTAATTTTGGAAATAACAAAAAATATTGGGTGTACAAGAAAAAAGTTGGGTGCGCA AAGTAATTGTCAATCGTAAGGCTTTAAGGGTGCGGAAGGAAGCC T GGCCCATTATT CCTAAATGAAGAAAAAGTAGGCACAGATTCTGATGGAAACTGCCGGTGGTGGGCTA TGAGGATTTACGACTTAGCAAGGTCATGGCCCT

[0032] QTL 8, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 36760650 on soybean chromosome 15. The two alleles of the genetic marker at QTL 8 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 15 and 16. In cassette 1 , QTL 8 is homozygous for allele “C” (SEQ ID NO 15) or heterozygous (includes both SEQ ID NOs 15 and 16).

SEQ ID NO 15 (SNP base spaced and bold):

GAAGGTTTTTCTTCCAACTAGAGAGCATCACATAGGGGCTTTTAATGCTATAATCAA TGTTTCGACCACACCTGTCTCACAAAACTTTTGTTGTCCCAAC C GGTACCAACATGA AAACATGAGAGTGTACCCTTGCATGCTGGCACATGCCCCTTTTAAACTGCATATAAG CTTCCACCCCATGTTCATCATATATTATTT

SEQ ID NO 16 (SNP base spaced and bold):

GAAGGTTTTTCTTCCAACTAGAGAGCATCACATAGGGGCTTTTAATGCTATAATCAA TGTTTCGACCACACCTGTCTCACAAAACTTTTGTTGTCCCAAC T GGTACCAACATGA AAACATGAGAGTGTACCCTTGCATGCTGGCACATGCCCCTTTTAAACTGCATATAAG CTTCCACCCCATGTTCATCATATATTATTT

[0033] QTL 9, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 9098060 on soybean chromosome 7. The two alleles of the genetic marker at QTL 9 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 17 and 18. In cassette 1, QTL 9 is homozygous for allele “G” (SEQ ID NO 17) or heterozygous (includes both SEQ ID NOs 17 and 18).

SEQ ID NO 17 (SNP base spaced and bold):

TATTACTTGACGACATCAAAATTCACAGTCAATTGTCCTTATGAAATTTCAACCAACC TGTATTAATCAAACTTTGCACCTTGTGTTTCGAGGCCATATA G TGCTCAACGGAATG CCCCGGAGCTCCCCCGTGATAAGCACATGTCACATTCGAGTTGTATCCTTGGGGAAA TGGAGGTTGAGGAATCTTTGTTGGGTTTA

SEQ ID NO 18 (SNP base spaced and bold):

TATTACTTGACGACATCAAAATTCACAGTCAATTGTCCTTATGAAATTTCAACCAACC TGTATTAATCAAACTTTGCACCTTGTGTTTCGAGGCCATATA A TGCTCAACGGAATG CCCCGGAGCTCCCCCGTGATAAGCACATGTCACATTCGAGTTGTATCCTTGGGGAAA TGGAGGTTGAGGAATCTTTGTTGGGTTTA

[0034] QTL 10, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 14423899 on soybean chromosome 14. The two alleles of the genetic marker at QTL 10 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 19 and 20. In cassette 1, QTL 10 is homozygous for allele “G” (SEQ ID NO 19) or heterozygous (includes both SEQ ID NOs 19 and 20).

SEQ ID NO 19 (SNP base spaced and bold):

GTGTATTCTTTTATGTCAATGGCGAGATCACCCGCAATTCAAGTGGAAACACAGTTTT CACCAGTGACAACACAAAATCTATGTTGTTGTATGCAACAAT G ATGATGGCTGACA TAACCAGTGTAATACAATCATCAATTATAGATGTTGATGTTTCGTCTACAATTACTTT AATTTGGTATCATTGTCCTATACATGAAA

SEQ ID NO 20 (SNP base spaced and bold):

GTGTATTCTTTTATGTCAATGGCGAGATCACCCGCAATTCAAGTGGAAACACAGTTTT CACCAGTGACAACACAAAATCTATGTTGTTGTATGCAACAAT A ATGATGGCTGACA TAACCAGTGTAATACAATCATCAATTATAGATGTTGATGTTTCGTCTACAATTACTTT AATTTGGTATCATTGTCCTATACATGAAA

[0035] QTL 11 , as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 20019602 on soybean chromosome 6. The two alleles of the genetic marker at QTL 11 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 21 and 22. In cassettes 3-11, QTL 11 is homozygous for allele “A” (SEQ ID NO 21).

SEQ ID NO 21 (SNP base spaced and bold):

CGTCCCTTCAGGAAGAAGGGTACCATCACCCTCACCACATACCTCAGAACCTACCAC GTTGACGATTATGTCAACGTACATCCACAAGGTTAACGGCGTC A TCCACAAGGGAA TTGCACACAAGTTATACCATGGCTGCACCGGTCGCGTTTGGAATGCCACCAAACATG CTGTTGGGGTCGAAGTCAATAAGCAGGTCTC

SEQ ID NO 22 (SNP base spaced and bold):

CGTCCCTTCAGGAAGAAGGGTACCATCACCCTCACCACATACCTCAGAACCTACCAC GTTGACGATTATGTCAACGTACATCCACAAGGTTAACGGCGTC G TCCACAAGGGAA TTGCACACAAGTTATACCATGGCTGCACCGGTCGCGTTTGGAATGCCACCAAACATG CTGTTGGGGTCGAAGTCAATAAGCAGGTCTC [0036] QTL 12, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 15249709 on soybean chromosome 17. The two alleles of the genetic marker at QTL 12 have the SNP bases “T” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 23 and 24. In cassettes 3-5, QTL 12 is homozygous for allele “T” (SEQ ID NO 23), while in cassettes 6 and 7, QTL 12 is homozygous for allele “A” (SEQ ID NO 24) or heterozygous (includes both SEQ ID NOs 23 and 24).

SEQ ID NO 23 (SNP base spaced and bold):

TTGTTTTTGTACTTGCACACTAATTGTTCCTTTACAATACAAGTTTTGTGCGTGCCCTC TTGCAGTTTCTTGCTTCAACTGTACAAGTAAATTGTGCAGA T CTGAAGCCTAAACAA GGTTACCAAATTGATATTTGAATCATGAATCACTTCTAATTTTTGAATTGTGAATCAT AATTTGTATTGAATCGTAAGATAAAGG

SEQ ID NO 24 (SNP base spaced and bold):

TTGTTTTTGTACTTGCACACTAATTGTTCCTTTACAATACAAGTTTTGTGCGTGCCCTC TTGCAGTTTCTTGCTTCAACTGTACAAGTAAATTGTGCAGA A CTGAAGCCTAAACAA GGTTACCAAATTGATATTTGAATCATGAATCACTTCTAATTTTTGAATTGTGAATCAT AATTTGTATTGAATCGTAAGATAAAGG

[0037] QTL 13, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 9941295 on soybean chromosome 11. The two alleles of the genetic marker at QTL 13 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 25 and 26. In cassettes 3-7, QTL 13 is homozygous for allele “C” (SEQ ID NO 25) or heterozygous (includes both SEQ ID NOs 25 and 26).

SEQ ID NO 25 (SNP base spaced and bold):

TATATAACAAGTGTTTGCAATTTAGCGCTTGTACTTAGGTGATTGCCTATATTTGTCT AACTTTTGCAACCATTCTTCATGTGAGAAAGGAGGGAGAGTA C CAGTGAATTTCTA ATCAGTCGTTGAAAGACCAGATCGACTGAGTCTTGTTAAAACCCTAAGCACCACCAT GTTGAACACCTATGTCACTAACCCAACGAG

SEQ ID NO 26 (SNP base spaced and bold):

TATATAACAAGTGTTTGCAATTTAGCGCTTGTACTTAGGTGATTGCCTATATTTGTCT AACTTTTGCAACCATTCTTCATGTGAGAAAGGAGGGAGAGTA T CAGTGAATTTCTA ATCAGTCGTTGAAAGACCAGATCGACTGAGTCTTGTTAAAACCCTAAGCACCACCAT GTTGAACACCTATGTCACTAACCCAACGAG [0038] QTL 14, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 38670505 on soybean chromosome 20. The two alleles of the genetic marker at QTL 14 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 27 and 28. In cassette 3, QTL 14 is homozygous for allele “C” (SEQ ID NO 27) or heterozygous (includes both SEQ ID NOs 27 and 28), while in cassettes 4 and 5, QTL 14 is homozygous for allele “T” (SEQ ID NO 28).

SEQ ID NO 27 (SNP base spaced and bold): GTGATCACGCGTTTAGCGCCAGATTCATTCTAATCGTGTCTTTGGGCTTCTTCGTGGG CTTTCTTCGCGCTAAATTTGGGATGACTGTTAGGCGAGGCGA C GCGCTGAGCCTATC TTGTGCGCTAAGCTAGCTATTCTAATCTTCAAGTTTTTCCATTAATTTTCCTTCAAAGC ACTTGTAATTTTCTTCTTTTGAATCCT

SEQ ID NO 28 (SNP base spaced and bold):

GTGATCACGCGTTTAGCGCCAGATTCATTCTAATCGTGTCTTTGGGCTTCTTCGTGGG CTTTCTTCGCGCTAAATTTGGGATGACTGTTAGGCGAGGCGA T GCGCTGAGCCTATC TTGTGCGCTAAGCTAGCTATTCTAATCTTCAAGTTTTTCCATTAATTTTCCTTCAAAGC ACTTGTAATTTTCTTCTTTTGAATCCT

[0039] QTL 15, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 43257796 on soybean chromosome 13. The two alleles of the genetic marker at QTL 15 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 29 and 30. In cassettes 3-5, QTL 15 is homozygous for allele “C” (SEQ ID NO 29) or heterozygous (includes both SEQ ID NOs 29 and 30).

SEQ ID NO 29 (SNP base spaced and bold):

GAGGACTCAATGCGAGATGGATATGGTAACTTATTCTTCTTTCTTCTGATATGCACAG TTGTATATCATCATGTGCATGTTGCTCGTGTTTGACCTTTAA C TGTATTCAAATTAAT GTGTCAAGCTGTGCAGGGAAAATTATCAATTTGAGACGATTGGATGAAGCAATATCT TCCATTAATAACTGGTACATGGAACGGG

SEQ ID NO 30 (SNP base spaced and bold):

GAGGACTCAATGCGAGATGGATATGGTAACTTATTCTTCTTTCTTCTGATATGCACAG TTGTATATCATCATGTGCATGTTGCTCGTGTTTGACCTTTAA T TGTATTCAAATTAAT GTGTCAAGCTGTGCAGGGAAAATTATCAATTTGAGACGATTGGATGAAGCAATATCT TCCATTAATAACTGGTACATGGAACGGG [0040] QTL 16, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 41649823 on soybean chromosome 10. The two alleles of the genetic marker at QTL 16 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 31 and 32. In cassette 6, QTL 16 is homozygous for allele “C” (SEQ ID NO 31), while in cassette 7, QTL 16 is homozygous for allele “T” (SEQ ID NO 32) or heterozygous (includes both SEQ ID NOs 31 and 32).

SEQ ID NO 31 (SNP base spaced and bold):

CTCTCACGGGCACCCAGAAACAATGGCCTGCTCAGACTGTCTTGTGTGGATTAACAT TCATGGTTTCTAAAAGCATAAATGAGAGAATCCACTAGATTAA C TAATTAACCTTC AAGACACGAGATTCATATATATGCAAGAAATCCAAACATTTATTAATTATGTTTGAC GTTGTTGATTGATAAATTAGTATATTACTCG

SEQ ID NO 32 (SNP base spaced and bold):

CTCTCACGGGCACCCAGAAACAATGGCCTGCTCAGACTGTCTTGTGTGGATTAACAT TCATGGTTTCTAAAAGCATAAATGAGAGAATCCACTAGATTAA T TAATTAACCTTC AAGACACGAGATTCATATATATGCAAGAAATCCAAACATTTATTAATTATGTTTGAC GTTGTTGATTGATAAATTAGTATATTACTCG

[0041] QTL 17, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 40349116 on soybean chromosome 9. The two alleles of the genetic marker at QTL 17 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 33 and 34. In cassette 4, QTL 17 is homozygous for allele “G” (SEQ ID NO 33) or heterozygous (includes both SEQ ID NOs 33 and 34), while n cassette 5, QTL 17 is homozygous for allele “A” (SEQ ID NO 34).

SEQ ID NO 33 (SNP base spaced and bold):

GTTTTTTTTTTCGGGTTTAGAGCGCATCAAAATGACATCGCACTTGAGCTTACAATTT TTCTTAACTTTCACAACCCAGTTTGGGTTTTAAAAACTGGTC G GGTCGAGTTTTCTC AAAACCAGTCGGGGTTGGTCGTGTCATCCTAGACAACATGCATAACCGGTCCAATAG TAAAATCGGTTTGGTTATGCCATCGAGTC

SEQ ID NO 34 (SNP base spaced and bold):

GTTTTTTTTTTCGGGTTTAGAGCGCATCAAAATGACATCGCACTTGAGCTTACAATTT TTCTTAACTTTCACAACCCAGTTTGGGTTTTAAAAACTGGTC A GGTCGAGTTTTCTC AAAACCAGTCGGGGTTGGTCGTGTCATCCTAGACAACATGCATAACCGGTCCAATAG TAAAATCGGTTTGGTTATGCCATCGAGTC

[0042] QTL 18, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 31122750 on soybean chromosome 13. The two alleles of the genetic marker at QTL 18 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 35 and 36. In cassette 7, QTL 18 is homozygous for allele “C” (SEQ ID NO 35).

SEQ ID NO 35 (SNP base spaced and bold):

CTTATTACTAGGTACTTCGTTTTACACTTTTTCTTTTGACCATTACTTCACTTTATACT AAATCACACATGTCAAACGTTCAACCAAAAACAAATCTCAA C CACTCTTTTACTAT CACGTGTCAAGTATAGCTCCCAGTGCAACGTCATATCTGCAATTCTGCATACTACTCA GTACTCAGTAAGTAAAAACTGATGTATG

SEQ ID NO 36 (SNP base spaced and bold):

CTTATTACTAGGTACTTCGTTTTACACTTTTTCTTTTGACCATTACTTCACTTTATACT AAATCACACATGTCAAACGTTCAACCAAAAACAAATCTCAA T CACTCTTTTACTATC ACGTGTCAAGTATAGCTCCCAGTGCAACGTCATATCTGCAATTCTGCATACTACTCA GTACTCAGTAAGTAAAAACTGATGTATG

[0043] QTL 19, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 49107132 on soybean chromosome 19. The two alleles of the genetic marker at QTL 19 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 37 and 38. In cassette 7, QTL 19 is homozygous for allele “C” (SEQ ID NO 37) or heterozygous (includes both SEQ ID NOs 37 and 38).

SEQ ID NO 37 (SNP base spaced and bold):

AGTGTGGAGAGGGTCCCATATGGTGTTTTTGTTTTTGCAGTATATCTGATATGATATC AGGCTCCTTCTGGCCCCACACACTTCTCTGCACAAAAACAGA C CCATTCATCTTTCA CTGTCACACACATCATGCCCATGTGCTCTTCTGCTTCACCTACACTAGGAACAAATGC TTACACGTGCACGCCTGCTCCCTTACTA

SEQ ID NO 38 (SNP base spaced and bold):

AGTGTGGAGAGGGTCCCATATGGTGTTTTTGTTTTTGCAGTATATCTGATATGATATC AGGCTCCTTCTGGCCCCACACACTTCTCTGCACAAAAACAGA T CCATTCATCTTTCA CTGTCACACACATCATGCCCATGTGCTCTTCTGCTTCACCTACACTAGGAACAAATGC TTACACGTGCACGCCTGCTCCCTTACTA [0044] QTL 20, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 45845534 on soybean chromosome 14. The two alleles of the genetic marker at QTL 20 have the SNP bases “T” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 39 and 40. In cassette 5, QTL 20 is homozygous for allele “T” (SEQ ID NO 39) or heterozygous (includes both SEQ ID NOs 39 and 40).

SEQ ID NO 39 (SNP base spaced and bold):

CCAATCTCACCCACCAAATTCAGCGGGAAAACCGCCATTGCTGAGTCAATGCTCAAT GCTTCTAAGTCTTCAATGCCGCAACAAGAAGCGCCACCACAAA T TACATAGTAACT CTTTTTC TC GAATC C AC AGAGTGAGAC TC ATC GTGTGAAC AAC GATAAC CGCATGTT TGAGCGTACTTGAAAAATTTGAGCGGCCATG

SEQ ID NO 40 (SNP base spaced and bold):

CCAATCTCACCCACCAAATTCAGCGGGAAAACCGCCATTGCTGAGTCAATGCTCAAT GCTTCTAAGTCTTCAATGCCGCAACAAGAAGCGCCACCACAAA G TACATAGTAACT CTTTTTC TC GAATC C AC AGAGTGAGAC TC ATC GTGTGAAC AAC GATAAC CGCATGTT TGAGCGTACTTGAAAAATTTGAGCGGCCATG

[0045] QTL 21, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 48349369 on soybean chromosome 10. The two alleles of the genetic marker at QTL 21 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 41 and 42. In cassette 11, QTL 21 is homozygous for allele “A” (SEQ ID NO 41), while in cassette 8, QTL 21 is homozygous for allele “A” (SEQ ID NO 41) or heterozygous (includes both SEQ ID NOs 41 and 42), while in cassettes 9 and 10, QTL 21 is homozygous for allele “G” (SEQ ID NO 42).

SEQ ID NO 41 (SNP base spaced and bold):

AAATTGCATGCTCTTGAATCAGAACTAACTAACATCCTAGTTTGCTTATTTAGAATAA TAATGTTTTGTAAACCCCCTAGTACGAAAGCTCGATTCCTAC A GATCAAAAAAAGA ATAAAAATGTTTTGTGGACACCAAATGCAAGTCTACGCCATGAAAGAGATAGACAC AAAATAGCGATGAGTGATAATGTGATAGGTG

SEQ ID NO 42 (SNP base spaced and bold): AAATTGCATGCTCTTGAATCAGAACTAACTAACATCCTAGTTTGCTTATTTAGAATAA TAATGTTTTGTAAACCCCCTAGTACGAAAGCTCGATTCCTAC G GATCAAAAAAAGA ATAAAAATGTTTTGTGGACACCAAATGCAAGTCTACGCCATGAAAGAGATAGACAC AAAATAGCGATGAGTGATAATGTGATAGGTG

[0046] QTL 22, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 21986774 on soybean chromosome 6. The two alleles of the genetic marker at QTL 22 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 43 and 44. In cassettes 10 and 11, QTL 22 is homozygous for allele “A” (SEQ ID NO 43). SEQ ID NO 43 (SNP base spaced and bold):

ACCATCATCATCGTCATCACCTTCCATATATGCAAAAACATAATTTATATTCCCGTTA TAATCATCTCCTTCGGCGCAAGCTGTGGGATCATAATGATAC A AAACACCGTCTTTC TTGTCACATGCATGCTTCTTGATTTCTGGGGTCATGGCCTTGGACATGGATGCCATAT AGCTTGGTCGACTTGATATTGAATAGGG

SEQ ID NO 44 (SNP base spaced and bold):

ACCATCATCATCGTCATCACCTTCCATATATGCAAAAACATAATTTATATTCCCGTTA TAATCATCTCCTTCGGCGCAAGCTGTGGGATCATAATGATAC G AAACACCGTCTTTC TTGTCACATGCATGCTTCTTGATTTCTGGGGTCATGGCCTTGGACATGGATGCCATAT AGCTTGGTCGACTTGATATTGAATAGGG

[0047] QTL 23, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 38701753 on soybean chromosome 9. The two alleles of the genetic marker at QTL 23 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 45 and 46. In cassettes 10 and 11, QTL 23 is homozygous for allele “A” (SEQ ID NO 45). SEQ ID NO 45 (SNP base spaced and bold):

AGAGAGAAAGAAACCAACTGTAGACAGCCTTCGGAGCACCAGCGACGACAACAAGC TTTGTGATGGGGTCAATGATAGCCAAGTGGGCCACAACAGCGTC A AGGATGTAAAG GGAAAACAACGACAATGAGGACCGAAAATAGCAATGGCGAGGGAGAGTGAAGAAA GAGACCCAAAGGAAAAAGGGGTTGAGAGTGACAG

SEQ ID NO 46 (SNP base spaced and bold):

AGAGAGAAAGAAACCAACTGTAGACAGCCTTCGGAGCACCAGCGACGACAACAAGC TTTGTGATGGGGTCAATGATAGCCAAGTGGGCCACAACAGCGTC G AGGATGTAAAG GGAAAACAACGACAATGAGGACCGAAAATAGCAATGGCGAGGGAGAGTGAAGAAA GAGACCCAAAGGAAAAAGGGGTTGAGAGTGACAG [0048] QTL 24, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 53111681 on soybean chromosome 18. The two alleles of the genetic marker at QTL 24 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 47 and 48. In cassettes 10 and 11, QTL 24 is homozygous for allele “T” (SEQ ID NO 47). SEQ ID NO 47 (SNP base spaced and bold): TGATAATTTGAAGGGTTAATACCAAACAAACTCGTACATTTTATATGATAAATAAAT GGACTAACATTATAAATGGCTACCCTAACCAGAGTGTGAACAG T TATAATAGTTTG TTCCCTAAACAACTCAACCCGAAAGTTTGGAAAAAGAAATAGAAGTTCCCAGGATTC ACTGAACTTGAGAAAAATCTGGTCTGGTATC

SEQ ID NO 48 (SNP base spaced and bold):

TGATAATTTGAAGGGTTAATACCAAACAAACTCGTACATTTTATATGATAAATAAAT GGACTAACATTATAAATGGCTACCCTAACCAGAGTGTGAACAG C TATAATAGTTTG TTCCCTAAACAACTCAACCCGAAAGTTTGGAAAAAGAAATAGAAGTTCCCAGGATTC ACTGAACTTGAGAAAAATCTGGTCTGGTATC

[0049] QTL 25, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 47232960 on soybean chromosome 19. The two alleles of the genetic marker at QTL 25 have the SNP bases “G” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 49 and 50. In cassettes 8 and 9, QTL 25 is homozygous for allele “G” (SEQ ID NO 49).

SEQ ID NO 49 (SNP base spaced and bold):

GTGGCAATATGGTCCTGTTCCCTTTGCTAAAGAATCTGGTGCTGGGCATATCTGCTGC ACAAGAAATGAAGATACCTCCAGTAAATCATTTCAAAGGAGT G CATGGGATTTCAA GTGTCTCCAGTGTTTCTGTGACTAAGCTTGGTTATAATCAGATTGAGATATGTTCAGT ACGTTCAGCTATTCACCCTTCTAATTGTG

SEQ ID NO 50 (SNP base spaced and bold):

GTGGCAATATGGTCCTGTTCCCTTTGCTAAAGAATCTGGTGCTGGGCATATCTGCTGC ACAAGAAATGAAGATACCTCCAGTAAATCATTTCAAAGGAGT T CATGGGATTTCAA GTGTCTCCAGTGTTTCTGTGACTAAGCTTGGTTATAATCAGATTGAGATATGTTCAGT ACGTTCAGCTATTCACCCTTCTAATTGTG

[0050] QTL 26, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 48030957 on soybean chromosome 19. The two alleles of the genetic marker at QTL 26 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 51 and 52. In cassettes 8 and 9, QTL 26 is homozygous for allele “G” (SEQ ID NO 51).

SEQ ID NO 51 (SNP base spaced and bold):

AAAAGCAATGAACGGTGACCTATGGAGGGCACCTATGGTGGCAGAAGCAACTGCGG TGAATGGTGATGGAGGAGGGCCTAGACTTTCAGACGGAGGTTCC G TGGTGGACAGC ATTGGAATATTCGAAAAATGGTGGACAGCATTGGAATATTCGAAATAGCAAGAAAT GAAGCACAGGAAGCAATTGCCCAAAATGTGTAC

SEQ ID NO 52 (SNP base spaced and bold):

AAAAGCAATGAACGGTGACCTATGGAGGGCACCTATGGTGGCAGAAGCAACTGCGG TGAATGGTGATGGAGGAGGGCCTAGACTTTCAGACGGAGGTTCC A TGGTGGACAGC ATTGGAATATTCGAAAAATGGTGGACAGCATTGGAATATTCGAAATAGCAAGAAAT GAAGCACAGGAAGCAATTGCCCAAAATGTGTAC

[0051] QTL 27, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 15558868 on soybean chromosome 15. The two alleles of the genetic marker at QTL 27 have the SNP bases “T” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 53 and 54. In cassettes 8 and 9, QTL 27 is homozygous for allele “T” (SEQ ID NO 53).

SEQ ID NO 53 (SNP base spaced and bold):

CAAAATAAAATTAAATAACGCAAATGGCAAATGTGAAAGAAATTGCAAAATCAAAG TTTCTGTAAACCCAAAACAAGTGTTTCTTGTTTGATTGAACGAA T GGTCCGAAAGAT GATTGGGTGAGATCGTTTATAATACAAAAGGGGGTCGTAGTATTTTTACCTGACGGG AAGTTTGTTGTTTTGTCGTTGGACTCAATTT

SEQ ID NO 54 (SNP base spaced and bold):

CAAAATAAAATTAAATAACGCAAATGGCAAATGTGAAAGAAATTGCAAAATCAAAG TTTCTGTAAACCCAAAACAAGTGTTTCTTGTTTGATTGAACGAA G GGTCCGAAAGA TGATTGGGTGAGATCGTTTATAATACAAAAGGGGGTCGTAGTATTTTTACCTGACGG GAAGTTTGTTGTTTTGTCGTTGGACTCAATTT

[0052] QTL 28, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 8139563 on soybean chromosome 19. The two alleles of the genetic marker at QTL 28 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 55 and 56. In cassette 11, QTL 28 is homozygous for allele “G” (SEQ ID NO 55).

SEQ ID NO 55 (SNP base spaced and bold): AGTGTCACTTGGGGGATTCAAACCCATTACTAAATTACCTTGCTCTGATATTATTTGT AGGATTGAGAACTTACGACTAGGCCAAAAGCTTTAGCTGTTA G TGAGGCAAAACTT TTTTCTTAAAGAATGCCTAGAGCTGCATCTAGCTCAAGGGGTTGCACTCAATTATATG CGCCATGGGGGATGTTAAGACCATTGAAT

SEQ ID NO 56 (SNP base spaced and bold):

AGTGTCACTTGGGGGATTCAAACCCATTACTAAATTACCTTGCTCTGATATTATTTGT AGGATTGAGAACTTACGACTAGGCCAAAAGCTTTAGCTGTTA A TGAGGCAAAACTT TTTTCTTAAAGAATGCCTAGAGCTGCATCTAGCTCAAGGGGTTGCACTCAATTATATG CGCCATGGGGGATGTTAAGACCATTGAAT

[0053] QTL 29, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 25446555 on soybean chromosome 11. The two alleles of the genetic marker at QTL 29 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 57 and 58. In cassette 9, QTL 29 is homozygous for allele “T” (SEQ ID NO 57) or heterozygous (includes both SEQ ID NOs 57 and 58).

SEQ ID NO 57 (SNP base spaced and bold):

GCTGGGGTAAGGGTGTGTTTGGGGAAGGACTTGGCTTTGATGGAGATGAAGTCCGTT GTGCTTGCGTTGGTTCGGAGGTTTGATATTCGGGTCGTTCAAT T GGGCCAGGAGCCC CGGTTCGAGCCCGGTTTAACCGCTACTTTGAGAGGCGGGTTGCCGGTTCGGGTTCGG GTTTGTGAAAGGAAATGAATAGCAAGTATG

SEQ ID NO 58 (SNP base spaced and bold):

GCTGGGGTAAGGGTGTGTTTGGGGAAGGACTTGGCTTTGATGGAGATGAAGTCCGTT GTGCTTGCGTTGGTTCGGAGGTTTGATATTCGGGTCGTTCAAT C GGGCCAGGAGCCC CGGTTCGAGCCCGGTTTAACCGCTACTTTGAGAGGCGGGTTGCCGGTTCGGGTTCGG GTTTGTGAAAGGAAATGAATAGCAAGTATG

[0054] Soybean plants having seeds with enhanced food nutrition and quality attributes such as protein content and composition, progeny thereof and/or part(s) thereof, are provided. The soybean plant varieties comprise a plurality of QTLs having a corresponding plurality of nucleic acid genetic markers that are associated with phenotypic traits of the soybean plant including a plurality of agronomic traits, nutrient content traits and protein-related traits. The QTLs are combined in the soybean plant from a plurality of soybean varieties by a computationally supported breeding program described herein. For example, the enhanced food nutrition and/or quality attributes may comprise any of: a protein content larger than 42%, 44%, 46%, 48% or intermediate or higher values (dry weight percentage).

[0055] Certain embodiments comprise food ingredient(s) comprising grounded soybean seeds from the disclosed soybean plants, and comprising any of the disclosed genetic markers. For example, disclosed food ingredients may comprise any of soy flour, soy texturized vegetable protein (TVP), and/or textured soy protein concentrate (TSPC).

[0056] Certain embodiments comprise food product(s) comprising the disclosed food ingredient(s), comprising any of the disclosed genetic markers. For example, disclosed food products may comprise any of processed meat (e.g., beef, pork, chicken or turkey extenders), meat alternatives, cereals (e.g., extruded breakfast cereals), snacks (e.g., extruded snacks such as crisps, puffs or chews) and/or bars (e.g., cereal and sports nutrition bars) - comprising soy TVP or TSPC; and/or baked goods (e.g., yeast-raised dough products, muffins, cookies), paste, dairy alternatives (e.g., milks, ice cream, yogurt), beverages (e.g., ready to drink, ready to mix, fruit, vegetable, protein), snacks (e.g., crackers, cookies, chips), soups and/or sauces comprising soy flour.

[0057] In embodiments, the QTLs comprise QTL 1 with corresponding markers set forth in SEQ ID NOs: 1 or 2, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 1 (as exemplified, in a non-limiting manner, in cassettes 1 and 2 described herein).

[0058] In certain embodiments, the QTLs may further comprise: QTL 2 with corresponding markers set forth in SEQ ID NOs: 3 or 4, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 3 or heterozygous at QTL 2, QTL 3 with corresponding markers set forth in SEQ ID NOs: 5 or 6, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 5 or heterozygous at QTL 3, QTL 4 with corresponding markers set forth in SEQ ID NOs: 7 or 8, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 7 or heterozygous at QTL 4, and QTL 5 with corresponding markers set forth in SEQ ID NOs: 9 or 10, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 9 or heterozygous at QTL 5 (as exemplified, in a non-limiting manner, in cassette 2 described herein). In certain embodiments, the soybean plant or part thereof may be homozygous with respect to one, two, three or all four of QTLs 2, 3, 4 and 5 (with respect to the respective SEQ ID NOs: 3, 5, 7 and 9, respectively).

[0059] In certain embodiments, the QTLs may further comprise, in addition to QTL 1 : QTL 6 with corresponding markers set forth in SEQ ID NOs: 11 or 12, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 11 or heterozygous at QTL 6, QTL 7 with corresponding markers set forth in SEQ ID NOs: 13 or 14, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 13 or heterozygous at QTL 7, QTL 8 with corresponding markers set forth in SEQ ID NOs: 15 or 16, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 15 or heterozygous at QTL 8, QTL 9 with corresponding markers set forth in SEQ ID NOs: 17 or 18, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 17 or heterozygous at QTL 9, and QTL 10 with corresponding markers set forth in SEQ ID NOs: 19 or 20, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 19 or heterozygous at QTL 10 (as exemplified, in a non-limiting manner, in cassette 1 described herein). In certain embodiments, the soybean plant or part thereof may be homozygous with respect to one, two, three, four or all five QTLs 6, 7, 8, 9 and 10 (with respect to the respective SEQ ID NOs: 11, 13, 15, 17 and 19, respectively).

[0060] In embodiments, the QTLs comprise QTL 11 with corresponding markers set forth in SEQ ID NOs: 21 or 22, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 21 (as exemplified, in a non-limiting manner, in cassettes 3-11 described herein).

[0061] In certain embodiments, the QTLs may further comprise QTL 13 with corresponding markers set forth in SEQ ID NOs: 25 or 26, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 25 or heterozygous at QTL 13 (as exemplified, in a nonlimiting manner, in cassettes 3-7 described herein). In certain embodiments, the QTLs may further comprise QTL 12 with corresponding markers set forth in SEQ ID NOs: 23 or 24, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 23, and, optionally, QTL 15 with corresponding markers set forth in SEQ ID NOs: 29 or 30, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 29 or heterozygous at QTL 15 (as exemplified, in a non-limiting manner, in cassettes 3-5 described herein). In certain embodiments, the QTLs may further comprise QTL 14 with corresponding markers set forth in SEQ ID NOs: 27 or 28, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 27 or heterozygous at QTL 14 (as exemplified, in a non-limiting manner, in cassette 3 described herein) or with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 28 (as exemplified, in a non-limiting manner, in cassettes 4 and 5 described herein). In certain embodiments, the QTLs may further comprise QTL 17 with corresponding markers set forth in SEQ ID NOs: 33 or 34, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 33 or heterozygous at QTL 17 (as exemplified, in a non-limiting manner, in cassette 4 described herein) or with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 34, and QTL 20 with corresponding markers set forth in SEQ ID NOs: 39 or 40, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 39 or heterozygous at QTL 20 (as exemplified, in a non-limiting manner, in cassette 5 described herein). [0062] In certain embodiments, the QTLs may comprise QTL 12 with corresponding markers set forth in SEQ ID NOs: 23 or 24, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 24 or heterozygous at QTL 12 (as exemplified, in a non-limiting manner, in cassettes 6 and 7 described herein). In certain embodiments, the QTLs may further comprise QTL 16 with corresponding markers set forth in SEQ ID NOs: 31 or 32, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 31 (as exemplified, in a non-limiting manner, in cassette 6 described herein), or with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 32 or heterozygous at QTL 16, and further comprising QTL 18 with corresponding markers set forth in SEQ ID NOs: 35 or 36, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 35, and QTL 19 with corresponding markers set forth in SEQ ID NOs: 37 or 38, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 37 or heterozygous at QTL 19 (as exemplified, in a non-limiting manner, in cassette 7 described herein).

[0063] In certain embodiments, the QTLs may comprise QTL 11 as disclosed herein, and further comprise QTL 25 with corresponding markers set forth in SEQ ID NOs: 29 or 30, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 29, QTL 26 with corresponding markers set forth in SEQ ID NOs: 31 or 32, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 31, and QTL 27 with corresponding markers set forth in SEQ ID NOs: 33 or 34, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 33 (as exemplified, in a non-limiting manner, in cassettes 8 and 9 described herein). In certain embodiments, the QTLs may further comprise QTL 21 with corresponding markers set forth in SEQ ID NOs: 41 or 42, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 41 or heterozygous at QTL 29 (as exemplified, in a nonlimiting manner, in cassette 8 described herein), or with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 42, and QTL 29 with corresponding markers set forth in SEQ ID NOs: 57 or 58, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 57 or heterozygous at QTL 29 (as exemplified, in a non-limiting manner, in cassette 9 described herein).

[0064] In certain embodiments, the QTLs may comprise QTL 11 as disclosed herein, and further comprise QTL 22 with corresponding markers set forth in SEQ ID NOs: 43 or 44, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 43, QTL 23 with corresponding markers set forth in SEQ ID NOs: 45 or 46, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 45, and QTL 24 with corresponding markers set forth in SEQ ID NOs: 47 or 48, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 47 (as exemplified, in a non-limiting manner, in cassettes 10 and 11 described herein). In certain embodiments, the QTLs may further comprise QTL 21 with corresponding markers set forth in SEQ ID NOs: 41 or 42, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 42 (as exemplified, in a non-limiting manner, in cassette 10 described herein), or with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 41, and QTL 28 with corresponding markers set forth in SEQ ID NOs: 55 or 56, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 55 (as exemplified, in a non-limiting manner, in cassette 11 described herein).

[0065] The soybean plants, progeny thereof and/or part(s) thereof may have a protein content of at least 42%, 44%, 46%, or intermediate or higher values, as measured by NIR measurements (depending on the specific environment, season and year of crop).

[0066] The part(s) of the soybean plants and/or progeny thereof may comprise any of: a seed, an endosperm, an ovule, pollen, cell, cell culture, tissue culture, plant organ, protoplast, meristem, embryo, or a combination thereof.

[0067] Certain embodiments comprise food ingredient(s) comprising grounded soybean seeds from the disclosed soybean plants, and comprising any of the disclosed genetic markers. For example, disclosed food ingredients may comprise any of soy flour, soy texturized vegetable protein (TVP), and/or textured soy protein concentrate (TSPC).

[0068] Certain embodiments comprise food product(s) comprising the disclosed food ingredient(s), comprising any of the disclosed genetic markers. For example, disclosed food products may comprise any of processed meat (e.g., beef, pork, chicken or turkey extenders), meat alternatives, cereals (e.g., extruded breakfast cereals), snacks (e.g., extruded snacks such as crisps, puffs or chews) and/or bars (e.g., cereal and sports nutrition bars) - comprising soy TVP or TSPC; and/or baked goods (e.g., yeast-raised dough products, muffins, cookies), paste, dairy alternatives (e.g., milks, ice cream, yogurt), beverages (e.g., ready to drink, ready to mix, fruit, vegetable, protein), snacks (e.g., crackers, cookies, chips), soups and/or sauces comprising soy flour.

[0069] Figure 2 is a high-level schematic illustration of a breeding method that is supported computationally 200, according to some embodiments of the invention. Computationally supported breeding method 200 is used to detect and combine QTLs from a plurality of soybean varieties to develop disclosed soybean plants with enhanced food nutrition and quality attributes such as protein content and composition, which are different than any of the parent varieties by virtue of the achieved phenotypical and/or yield characteristics.

[0070] Computationally supported breeding method 200 comprises stages of trait discovery by growing and phenotyping a broad spectrum of varieties (stage 210), trait blending by developing hybridized lines through crossing the selected lines to mix and combine traits and selfing of the progeny in subsequent generations (stage 220), Target Product Genomic Code (TPGC) discovery by associating phenotypes and genotypes possibly by using derived linkage maps (stage 230), in silico selection to suggest candidate varieties (stage 240), breeding candidate varieties and selection of varieties based on best TPGC potential (stage 250) and genomic code (GC) discovery to identify the most stable QTLs in hybridized progeny generation(s) (stage 260), as explained in detail below. TPGC discovery 230, in silico validation 250 and GC discovery 260 are based on computational algorithms that cannot be performed manually and provide the computational support for the judicious selection of the varieties that are generated and further crossed during the development process to yield disclosed soybean plants with enhanced food nutrition and quality attributes such as protein content and composition.

[0071] In certain embodiments, soybean lines were bred to reach high protein levels by collecting various soybean lines worldwide, creating F2 linkage populations, applying intensive phenotyping and genotyping of thousands of soybean plants varieties, predicting of QTLs affecting the yield and protein level and protein components traits, and establishing unique marker combinations, termed “marker cassettes” herein, to characterize novel lines found by the methods described herein and not existing in commercial or natural lines.

[0072] The breeding methodology was based on algorithms for deriving the Target Product Genomic Code (TPGC) to associate (i) the Target Product (TP) being defined in advance based on market requirements and including a set of desired attributes (traits) that are available in natural genetic variations; and (ii) the Genomic Code (GC) comprising set(s) of genomic regions that include quantitative trait loci (QTLs) that affect and are linked to the TP traits. The algorithms may be configured to calculate multiple genomic interactions and to maximize the genomic potential of specific plants for the development of new varieties. The breeding program was constructed to derive the TPGC, and then by crossing and selfing to achieve a product which contains the specific GC that corresponds to the required TPs.

[0073] Certain embodiments of the breeding process of developing lines, through crossing and successive generations of selfing comprise stages such as: (i) Trait Discovery, in which a broad spectrum of varieties from different geographies and worldwide sources are grown and phenotyped in order to discover new traits that can potentially be combined to create new varieties; (ii) Trait Blend, in which a crossing cycle is carried out based on phenotypic assumption(s), in which the different traits are mixed and combined. Initial trait cycle(s) are followed by additional cycle(s) to create F2 (and possibly higher generations) population(s) that provide the basis for algorithmic analysis for constructing the TPGC; (iii) TPGC Discovery, in which the plant(s) are phenotyped and genotyped to produce linkage map(s), discovering the relevant QTLs and deriving the TPGC; (iv) initial variety selection and validation stages over several years in which soybean lines are selected and advanced based on in silico statistical calculations; (v) Trait TPGC Blend, in which accurate crossings are performed in order to reach the best TPGC. The crossings are performed after in silico statistical calculations on all possible combinations, and are based, at least in part on phenotype assumptions; and (vi) Consecutive algorithm-based GC discovery stage(s) applied to F2 (or higher generation) population(s) grown in additional cycle(s).

[0074] Defining the TP for high protein soybean varieties includes the development of high throughput methods for high protein level identification and/or identification of specified protein component compositions.

[0075] In the following non-limiting example of the process, Trait Discovery (i) was based on proprietary germplasm, including hundreds of elite varieties, other soybean lines that were obtained from public sources such as the Germplasm Resources Information Network (GRIN) and proprietary sources, yielding thousands of F2 individual plants. These lines were used for the Trait Blend stage (ii), with crosses executed based on the potential for enrichment of genomic diversity to create new complex(es) of traits for the high protein level as the initial step for the TP-directed breeding program for soybean lines with enhanced food nutrition and quality attributes such as protein content and composition. The resulting Fl hybrids were later self-crossed to create F2 linkage populations that showed phenotypic segregation. The F2 population were then planted in two different environments for discovering the TPGC (iii) that includes high protein and protein component traits. After screening and deep phenotyping of ca. 4000 individuals, a set of ca. 400 representatives were selected. The measurement results were summarized into the representative high protein level and protein composition traits.

[0076] TPGC Discovery (iii) included genotyping ca. 4000 selected individual plants from 10 populations. The analysis was performed with a panel of 1000 markers based on single nucleotide polymorphism (SNP) and directly designed based on the polymorphism found in the parental lines of the populations which were analyzed in depth using high throughput DNA sequencing technologies. The panel was designed to maximize the chance to have the largest number of common segregating SNPs in order to create highly similar linkage maps for all observed populations. The computation of linkage maps was executed on each linkage F2 population based on the genotyping results. Linkage maps were computed with ASMap software package, an interactive package for ordering multilocus genetic maps, and verification of maps based on resampling techniques. Discovery of QTLs that are related to high protein level was carried out with the r/qtl package, based on the linkage maps and the F2 population phenotype data, and using interval mapping (IM). The significance and co-occurrences of the high protein level and protein content markers were evaluated using an algorithm that related the genotype-phase of each marker to respective QTLs and traits in linkage maps of the 10 F2 populations (also called “linkage F2 populations” herein) in each population, for populations in different environments. QTL significance was computed with permutation, bootstrap tools and FDR (false discovery rate) for total analysis. The linkage maps of all 10 F2 populations and the information of the high protein level traits over all genotyped plants belonging to those populations were analyzed and used to predict the QTLs in a “one trait to one marker” model, in which for all markers that constructed the linkage maps, each trait was tested independently against each one of the markers. In the provided examples, altogether eighteen markers were found to be related to protein content and composition, as well as yield (see Tables 1-5 above). The occurrence of high protein level markers in two or more linkage maps of the F2 population (repetitive markers) strengthened its significance as representative for high protein level QTL. In general, the 10 linkage F2 populations presented different markers that related to high protein levels. However, subsets of common markers were found to be shared by multiple populations and are referred to herein as marker cassettes.

[0077] It is emphasized that the breeding process is explained using non-limiting examples from a specific part of the breeding program, and is not limited to the specific populations and varieties derived by this specific part of the breeding program. For example, different F2 population may be bred and used to derive additional varieties that are characterized by one or more of the disclosed QTLs.

[0078] Following TPGC Discovery (iii), an in-silico breeding program (iv) was established to measure the potential for each of the genotyped plants to acquire the high protein level in the right combination at the right phase. The analysis resulted in identifying ca. 400 F2 plants having the highest score for high protein level, which were thus chosen for the actual selfing and cross-selfing procedures. The F3 seeds from these selected F2 plants were sown in plots in the subsequent growing season. Under this procedure, QTLs from different populations were combined to yield F3 plants containing new and unique cassettes of QTLs and characterized by high protein levels. [0079] The high protein soybean lines were then validated as retaining the trait in the following generations by genotyping the F3 and some subsequent generation offspring to verify they maintained the identified marker cassettes. Specifically, the parental lines of linkage F2 populations together with ca. 300 different soybean cultivars (landraces and old commercial varieties) were genotyped based on high protein level and protein composition markers of all populations. The cassettes detailed in Table 4 were found to wholly differentiate the developed high protein lines from the rest of the soybean cultivars screened.

[0080] In the above description, an embodiment is an example or implementation of the invention. The various appearances of "one embodiment”, "an embodiment", "certain embodiments" or "some embodiments" do not necessarily all refer to the same embodiments. Although various features of the invention may be described in the context of a single embodiment, the features may also be provided separately or in any suitable combination. Conversely, although the invention may be described herein in the context of separate embodiments for clarity, the invention may also be implemented in a single embodiment. Certain embodiments of the invention may include features from different embodiments disclosed above, and certain embodiments may incorporate elements from other embodiments disclosed above. The disclosure of elements of the invention in the context of a specific embodiment is not to be taken as limiting their use in the specific embodiment alone. Furthermore, it is to be understood that the invention can be carried out or practiced in various ways and that the invention can be implemented in certain embodiments other than the ones outlined in the description above.

[0081] The invention is not limited to those diagrams or to the corresponding descriptions. For example, flow need not move through each illustrated box or state, or in exactly the same order as illustrated and described. Meanings of technical and scientific terms used herein are to be commonly understood as by one of ordinary skill in the art to which the invention belongs, unless otherwise defined. While the invention has been described with respect to a limited number of embodiments, these should not be construed as limitations on the scope of the invention, but rather as exemplifications of some of the embodiments. Other possible variations, modifications, and applications are also within the scope of the invention. Accordingly, the scope of the invention should not be limited by what has thus far been described, but by the appended claims and their legal equivalents.

Claims

What is claimed is:

1. A soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof, the soybean plant comprising: a plurality of quantitative trait loci (QTLs) having a corresponding plurality of nucleic acid genetic markers that are associated with phenotypic traits of the soybean plant including a plurality of agronomic traits, nutrient content traits and protein-related traits, wherein the QTLs are combined in the soybean plant from a plurality of soybean varieties by computationally supported breeding, wherein the QTLs comprise:

QTL 1 with corresponding markers set forth in SEQ ID NOs: 1 or 2, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 1.

2. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 1, wherein the QTLs further comprise:

QTL 2 with corresponding markers set forth in SEQ ID NOs: 3 or 4, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 3 or heterozygous at QTL

2,

QTL 3 with corresponding markers set forth in SEQ ID NOs: 5 or 6, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 5 or heterozygous at QTL

3,

QTL 4 with corresponding markers set forth in SEQ ID NOs: 7 or 8, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 7 or heterozygous at QTL

4, and

QTL 5 with corresponding markers set forth in SEQ ID NOs: 9 or 10, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 9 or heterozygous at QTL

5,

3. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 2, wherein the soybean plant or part thereof is homozygous with respect to at least two of the QTLs.

34 The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 3, wherein the soybean plant or part thereof is homozygous with respect to all four QTLs 2, 3, 4 and 5. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 1, wherein the QTLs further comprise:

QTL 6 with corresponding markers set forth in SEQ ID NOs: 11 or 12, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 11 or heterozygous at QTL

6,

QTL 7 with corresponding markers set forth in SEQ ID NOs: 13 or 14, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 13 or heterozygous at QTL

7,

QTL 8 with corresponding markers set forth in SEQ ID NOs: 15 or 16, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 15 or heterozygous at QTL

8,

QTL 9 with corresponding markers set forth in SEQ ID NOs: 17 or 18, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 17 or heterozygous at QTL

9, and

QTL 10 with corresponding markers set forth in SEQ ID NOs: 19 or 20, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 19 or heterozygous at QTL

10, The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 5, wherein the soybean plant or part thereof is homozygous with respect to at least two of the QTLs. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 7, wherein the soybean plant or part thereof is homozygous with respect to all five QTLs 6, 7, 8, 9 and 10. A soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof, the soybean plant comprising: a plurality of quantitative trait loci (QTLs) having a corresponding plurality of nucleic acid genetic markers that are associated with phenotypic traits of the soybean plant including a plurality of agronomic traits, nutrient content traits and protein-related traits, wherein the QTLs

35 are combined in the soybean plant from a plurality of soybean varieties by computationally supported breeding, wherein the QTLs comprise:

QTL 11 with corresponding markers set forth in SEQ ID NOs: 21 or 22, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 21. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 8, wherein the QTLs further comprise:

QTL 13 with corresponding markers set forth in SEQ ID NOs: 25 or 26, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 25 or heterozygous at QTL

13. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 8 or 9, wherein the QTLs further comprise:

QTL 12 with corresponding markers set forth in SEQ ID NOs: 23 or 24, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 23, and optionally, QTL 15 with corresponding markers set forth in SEQ ID NOs: 29 or 30, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 29 or heterozygous at QTL 15. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to any one of claims 8-10, wherein the QTLs further comprise:

QTL 14 with corresponding markers set forth in SEQ ID NOs: 27 or 28, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 27 or heterozygous at QTL

14. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to any one of claims 8-10, wherein the QTLs further comprise:

QTL 14 with corresponding markers set forth in SEQ ID NOs: 27 or 28, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 28. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 12, wherein the QTLs further comprise:

QTL 17 with corresponding markers set forth in SEQ ID NOs: 33 or 34, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 33 or heterozygous at QTL 17. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 12, wherein the QTLs further comprise:

QTL 17 with corresponding markers set forth in SEQ ID NOs: 33 or 34, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 34, and

QTL 20 with corresponding markers set forth in SEQ ID NOs: 39 or 40, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 39 or heterozygous at QTL 20. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 8 or 9, wherein the QTLs further comprise:

QTL 12 with corresponding markers set forth in SEQ ID NOs: 23 or 24, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 24 or heterozygous at QTL 12. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 15, wherein the QTLs further comprise:

QTL 16 with corresponding markers set forth in SEQ ID NOs: 31 or 32, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 31. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 15, wherein the QTLs further comprise:

QTL 16 with corresponding markers set forth in SEQ ID NOs: 31 or 32, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 32 or heterozygous at QTL 16,

QTL 18 with corresponding markers set forth in SEQ ID NOs: 35 or 36, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 35, and

QTL 19 with corresponding markers set forth in SEQ ID NOs: 37 or 38, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 37 or heterozygous at QTL 19. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 8, wherein the QTLs further comprise:

QTL 25 with corresponding markers set forth in SEQ ID NOs: 29 or 30, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 29, QTL 26 with corresponding markers set forth in SEQ ID NOs: 31 or 32, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 31, and

QTL 27 with corresponding markers set forth in SEQ ID NOs: 33 or 34, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 33. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 18, wherein the QTLs further comprise:

QTL 21 with corresponding markers set forth in SEQ ID NOs: 41 or 42, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 41 or heterozygous at QTL 29. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 18, wherein the QTLs further comprise:

QTL 21 with corresponding markers set forth in SEQ ID NOs: 41 or 42, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 42, and

QTL 29 with corresponding markers set forth in SEQ ID NOs: 57 or 58, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 57 or heterozygous at QTL 29. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 8, wherein the QTLs further comprise:

QTL 22 with corresponding markers set forth in SEQ ID NOs: 43 or 44, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 43,

QTL 23 with corresponding markers set forth in SEQ ID NOs: 45 or 46, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 45, and

QTL 24 with corresponding markers set forth in SEQ ID NOs: 47 or 48, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 47. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 21, wherein the QTLs further comprise:

QTL 21 with corresponding markers set forth in SEQ ID NOs: 41 or 42, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 42. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to claim 21, wherein the QTLs further comprise:

38 QTL 21 with corresponding markers set forth in SEQ ID NOs: 41 or 42, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 41, and

QTL 28 with corresponding markers set forth in SEQ ID NOs: 55 or 56, with the soybean plant or part thereof being homozygous with respect to SEQ ID NO: 55. The soybean plant having seeds with enhanced protein content, progeny thereof and/or part(s) thereof according to any one of claims 1-23, wherein the part(s) thereof comprise any of: a seed, an endosperm, an ovule, pollen, cell, cell culture, tissue culture, plant organ, protoplast, meristem, embryo, or a combination thereof. A food ingredient comprising grounded soybean seeds from the soybean plants of any one of claims 1-24. The food ingredient of claim 25, comprising at least one of soy flour, soy texturized vegetable protein (TVP), and/or textured soy protein concentrate (TSPC). A food product comprising the food ingredient of claim 26. The food product of claim 27, comprising at least one of: processed meat, meat alternatives, cereals, snacks and/or bars - comprising soy TVP or TSPC; and/or baked goods, paste, dairy alternatives, beverages, snacks, soups and/or sauces comprising soy flour.

39