WO2023072076A1

WO2023072076A1 - Reagent and method for diagnosis of nasopharyngeal carcinoma

Info

Publication number: WO2023072076A1
Application number: PCT/CN2022/127393
Authority: WO
Inventors: 王纯婷; 马璐; 隋亚鑫; 皮潇特; 马昕怡; 刘刚; 贾卫华; 郑小辉; 李锡照; 周婷; 吕宁; 陈一友
Original assignee: 杭州诺辉健康科技有限公司
Priority date: 2021-10-25
Filing date: 2022-10-25
Publication date: 2023-05-04
Also published as: CN118510895A; CN115521996A; TW202340478A

Abstract

An application of a reagent for EB virus methylation site typing and EB virus-related miRNA detection in the preparation of a nasopharyngeal carcinoma diagnostic kit. An EB virus methylation site and/or an EB virus-related miRNA can serve as a nasopharyngeal carcinoma diagnostic marker, which has the advantages of high sensitivity and high specificity in a nasopharyngeal brush or nasopharyngeal swab (nasopharynx blind detection) sample that does not rely on a clinician and a nasopharyngoscope.

Description

Reagents and methods for diagnosis of nasopharyngeal carcinoma

technical field

The present invention relates to the technical field of diagnosis of nasopharyngeal carcinoma, in particular, to reagents and methods for diagnosis of nasopharyngeal carcinoma, and related biomarkers.

Background technique

Nasopharyngeal carcinoma refers to malignant tumors that occur in the posterior wall of the nasopharynx and pharyngeal recesses. It is one of the most frequently occurring malignant tumors in China, and its incidence rate is the first among malignant tumors of the ear, nose and throat. The five-year survival rate of early nasopharyngeal carcinoma after treatment can reach more than 90%, while the five-year survival rate of middle and advanced nasopharyngeal carcinoma is less than 50%. The disease has progressed to the middle and late stage when the first visit to the doctor, so promoting early screening and early diagnosis and treatment of nasopharyngeal carcinoma is the key to improving the prognosis of nasopharyngeal carcinoma.

Sufficient studies have shown that Epstein-Barr virus (Epstein-Barr virus) infection plays an important role in the pathogenesis of nasopharyngeal carcinoma. In nasopharyngeal carcinoma endemic areas, almost 100% of undifferentiated nasopharyngeal carcinoma (WHO type III) lesions can detect the presence of EBV genome; in addition, nasopharyngeal squamous cell carcinoma (WHO type I) and non-angular The occurrence of nasopharyngeal carcinoma (WHO type II) is also closely related to EBV infection. It can be said that EBV infection of nasopharyngeal epithelial cells is an important feature of nasopharyngeal carcinoma.

The gold standard for clinical diagnosis of nasopharyngeal carcinoma is tissue biopsy under nasopharyngoscope, followed by pathological diagnosis by pathologists. Due to the relatively traumatic nature of the specimens, the small size of the specimens, and the need to observe with the naked eye under a microscope, about 10% of the patients failed to be diagnosed when the specimens were first drawn. Delayed illness. In addition, nasopharyngeal biopsy strictly relies on the clinical experience of clinicians and medical devices such as nasopharyngeal electronic mirrors, making it difficult to carry out extensive screening of nasopharyngeal carcinoma in high-incidence sites and early diagnosis in primary medical units. The detection of EBV markers based on blood samples also relies on clinical nurses to take blood samples, which limits its promotion and detection of the whole population in high-incidence sites of nasopharyngeal carcinoma, and the lack of accuracy also reduces the compliance of the public. Therefore, it is still of great significance to develop sampling techniques that are easy to promote and apply in high-occurrence sites and efficient diagnostic molecular markers.

Since nasopharyngeal carcinoma originates from the nasopharynx, the non-invasive and efficient sampling of nasopharynx and the detection of corresponding molecular markers can more directly reflect the condition of the lesion, and theoretically, early primary or recurrent nasopharynx can be detected in time cancer patients. The pathological biopsy sampling of the nasopharynx is traumatic, but it is a feasible technical solution to take nasopharyngeal samples by nasopharyngeal brush or nasopharyngeal swab. It has been used in Hong Kong, Taiwan, Indonesia, Canada and other countries or Corresponding research has been carried out in the region, that is, under the guidance of an electronic nasopharyngoscope, use a nasopharyngeal brush or a nasopharyngeal swab to brush and sample suspicious parts of the nasopharynx, and then perform q-PCR detection of the EB virus DNA load. To determine whether there is nasopharyngeal carcinoma. Because the nasopharyngeal brush is a method that can directly obtain samples of nasopharyngeal lesions, it not only has the advantages of painlessness and non-invasiveness, but also the obtained exfoliated cells can directly reflect the characteristics of nasopharyngeal tumors.

However, compared with nasopharyngeal biopsy, nasopharyngeal brush examination has the advantages of non-invasive and repeatable sampling, but in order to improve the accuracy of sampling, previous studies still rely on clinicians and nasopharyngoscope guidance, which hinders This technical solution is widely used in the screening of nasopharyngeal carcinoma in the field. Therefore, nasopharyngeal brush or nasopharyngeal swab detection (referred to as nasopharyngeal blind inspection) that does not rely on clinicians and nasopharyngoscope guidance has natural advantages that are conducive to popularization. However, the current disadvantage of nasopharyngeal blind inspection is the sampling accuracy. Therefore, it is of great significance to develop molecular markers and their detection systems suitable for nasopharyngeal blind brush sampling system.

overview

One aspect of the present invention provides a kit for detecting Epstein-Barr virus, characterized in that, the kit includes nucleic acid methylation detection reagents, miRNA detection reagents, miRNA extraction reagents, and/or sample preservation One or more reagents of the liquid.

One aspect of the present invention provides a kit for nasopharyngeal carcinoma detection, characterized in that, the kit includes nucleic acid methylation detection reagents, miRNA detection reagents, miRNA extraction reagents, and/or samples One or more reagents of the preservation solution.

In some embodiments, the kit includes a nucleic acid methylation detection reagent, which can perform methylation detection for methylation sites in the Epstein-Barr virus genome. In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) (NCBI Reference Sequence: NC_007605.1; ACCESSION 10717bp, 11029bp, 14015bp, 14566bp, 45850bp , 57946bp, 662 27bp and 128103bp sites. In some embodiments, the methylation sites in the Epstein-Barr virus genome comprise sites corresponding to 10717bp, 11029bp, and 14015bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: 11029bp and 45850bp of the Epstein-Barr virus genome DNA sequence corresponding to GenBank LOCUS NC_007605 (SEQ ID NO: 94) , 57946bp, 66227bp and 128103bp sites. In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: 11029 bp and 57946 bp of the Epstein-Barr virus genome DNA sequence corresponding to GenBank LOCUS NC_007605 (SEQ ID NO: 94) , and the 66227bp site. In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 11029 bp of the Epstein-Barr virus genome DNA sequence in GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 10717 bp of the Epstein-Barr virus genome DNA sequence in GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 14015 bp of the Epstein-Barr virus genome DNA sequence in GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 14566 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 45850 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 57946 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 66227 bp of the Epstein-Barr virus genome DNA sequence in GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 128103 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).

In some embodiments, the kit includes the miRNA detection reagent, and the miRNA detection reagent can detect the content of one or more miRNAs from Epstein-Barr virus. In some embodiments, the miRNA comprises one or more of the following miRNAs: EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR-BART6-3p, EBV-miR-BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p. In some embodiments, all six of said miRNAs are included. In some embodiments, the miRNAs comprise EBV-miR-BART1-5p and EBV-miR-BART7-3p. In some embodiments, the miRNA comprises EBV-miR-BART1-5p. In some embodiments, the miRNA comprises EBV-miR-BART2-5p. In some embodiments, the miRNA comprises EBV-miR-BART6-3p. In some embodiments, the miRNA comprises EBV-miR-BART7-3p. In some embodiments, the miRNA comprises EBV-miR-BART13-3p. In some embodiments, the miRNA comprises EBV-miR-BART17-5p.

In some embodiments, the kit includes the sample preservation solution, and the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and/or trisodium phosphate one or more components. In some embodiments, the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.

One aspect of the present invention provides a kit for preserving biological samples containing nucleic acid, which is characterized in that it includes a sample preservation solution, and the sample preservation solution includes EDTA, NaCl, absolute ethanol, sodium citrate, NP40, gluten Glutathione, and Trisodium Phosphate.

In some embodiments, in the sample preservation solution: the content range of the EDTA is 0.7%-1.5% (w/w); the content range of the NaCl is 0.01%-0.1% (w/w); The concentration range of the dehydrated alcohol is 15%-35% (w/w); the content range of the sodium citrate is 0.1%-1.0% (w/w); the concentration range of the NP40 is 0.01%-0.1 % (v/v); said glutathione content ranges from 0.07% to 0.7% (w/w); and/or said trisodium phosphate content ranges from 0.07% to 0.4% (w/w) . In some embodiments, in the sample preservation solution: the content of the EDTA is about 1.05% (w/w); the content of the NaCl is about 0.035% (w/w); the concentration of the absolute ethanol is about 27.6% (w/w); the content of the sodium citrate is about 0.21% (w/w); the concentration of the NP40 is about 0.035% (v/v); the content of the glutathione is about 0.21% (w/w); and/or said trisodium phosphate is present in an amount of about 0.14% (w/w). In some embodiments, the sample preservation solution comprises antibiotics. In some embodiments, the antibiotic comprises double penicillin-streptomycin. In some embodiments, the pH value of the sample preservation solution is 7.6-8.0. In some embodiments, the pH value of the sample preservation solution is 7.8. In some embodiments, the sample preservation solution has a better preservation effect on DNA, miRNA, and/or DNA methylation than the control sample preservation solution.

In some embodiments, the DNA is derived from Epstein-Barr virus, the miRNA is derived from Epstein-Barr virus, and/or the DNA methylation is methylation of Epstein-Barr virus DNA.

In some embodiments, the kit comprises the miRNA extraction reagent, and the miRNA extraction reagent comprises a lysis solution, a binding solution, a washing solution 1, and/or a washing solution 2.

One aspect of the present invention provides a kit comprising miRNA extraction reagents, characterized in that the miRNA extraction reagents comprise a lysing solution, a binding solution, a washing solution 1, and/or a washing solution 2.

In some embodiments, the miRNA extraction reagent comprises the lysate comprising one or more components selected from guanidine thiocyanate, citric acid, Triton-100, and/or EDTA . In some embodiments, the miRNA extraction reagent comprises the lysate comprising guanidine thiocyanate, citric acid, Triton-100, and EDTA. In some embodiments, in the lysate: the content range of the guanidine thiocyanate is 28%-40% (w/w); the content range of the citric acid is 1.8%-2.6% (w/w ); the content range of the Triton-100 is 0.8%-1.6% (w/w); the content range of the EDTA is 0.5%-0.9% (w/w); and/or the lysate The pH range is 3.8-4.2. In some embodiments, in the lysate: the content of the guanidine thiocyanate is about 32% (w/w); the content of the citric acid is about 2.2% (w/w); The content of Tong-100 is about 1.1% (w/w); the content of the EDTA is about 0.7% (w/w); and/or the pH value of the lysate is about 4.0.

In some embodiments, the miRNA extraction reagent comprises the binding solution, which comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, lauryl sarcosine Sodium, and/or one or more components of isopropanol. In some embodiments, the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, sodium sarcosine, and isopropanol. In some embodiments, in the combined solution: the content range of the magnesium chloride is 0.1%-0.4% (w/w); the content range of the disodium edetate is 0.5%-1.0% (w/w). /w); the content range of the sodium bicarbonate is 0.6%-1.0% (w/w); the content range of the guanidine thiocyanate is 13%-16% (w/w); the dodecane The content range of sodium sarcosinate is 1.0%-1.4% (w/w); the content range of the isopropanol is 60%-80% (w/w); and/or the pH value of the combination solution The range is 4.8-5.2. In some embodiments, in the combined solution: the magnesium chloride content is about 0.24% (w/w); the disodium edetate content is about 0.71% (w/w); the The content of sodium bicarbonate is about 0.83% (w/w); The content of said guanidine thiocyanate is about 14.9% (w/w); The content of said sodium lauryl sarcosinate is about 1.2% ( w/w); the content of the isopropanol is about 70% (w/w); and/or the pH value of the combination solution is about 5.0.

In some embodiments, the miRNA extraction reagent comprises the washing solution 1, and the washing solution 1 comprises disodium edetate, sodium bicarbonate, guanidinium thiocyanate, and/or dodecyl One or more components of sodium sarcosinate. In some embodiments, the miRNA extraction reagent comprises the rinse solution 1 comprising disodium edetate, sodium bicarbonate, guanidinium thiocyanate, and sodium lauryl sarcosinate . In some embodiments, in the rinse liquid 1: the content range of the disodium edetate is 0.4%-0.9% (w/w); the content range of the sodium bicarbonate is 0.5%-0.9% % (w/w); The content scope of described guanidinium thiocyanate is 50%-55% (w/w); The content scope of described sodium lauryl sarcosinate is 0.8%-1.2% (w/ w); and/or the pH range of the rinse solution 1 is 6.2-6.6. In some embodiments, in the rinse solution 1: the disodium edetate content is about 0.5% (w/w); the sodium bicarbonate content is about 0.6% (w/w) the content of the guanidine thiocyanate is about 53% (w/w); the content of the sodium lauryl sarcosinate is about 0.9% (w/w); and/or the rinse solution 1 The pH is about 6.4.

In some embodiments, the miRNA extraction reagent comprises the rinsing solution 2, and the rinsing solution 2 comprises tris (Tris) or sodium chloride. In some embodiments, the miRNA extraction reagent comprises the rinse solution 2 comprising tris (Tris) and sodium chloride. In some embodiments, in the rinse liquid 2: the content range of the tris (Tris) is 0.5%-0.7% (w/w); the content range of the sodium chloride is 0.6% -1.8% (w/w); and/or the pH value of the rinse solution 2 is in the range of 6.6-7.0. In some embodiments, in the rinse solution 2: the content of the tris (Tris) is about 0.6% (w/w); the content of the sodium chloride is about 1.2% (w/ w); and/or the pH value of the rinse solution 2 is about 6.8.

In some embodiments, the miRNA extraction reagent comprises RNA-adsorbing magnetic beads. In some embodiments, the magnetic core of the magnetic beads is ferric hydroxide, coated with silicon dioxide, and embedded with hydroxyl groups on the surface. In some embodiments, the particle diameter of the magnetic beads is 50-100 nm.

In some embodiments, the kit further comprises a nasopharyngeal brush or nasopharyngeal swab. In some embodiments, the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab that does not rely on the guidance of a clinician and a nasopharyngoscope.

In some embodiments, the kit further includes Epstein-Barr virus load detection reagents. In some embodiments, the Epstein-Barr virus load detection reagent comprises a detection reagent for the BamHI-W fragment in the Epstein-Barr virus genome and/or the LMP-2 gene. In some embodiments, the EB virus load detection reagent comprises a detection reagent for LMP-2 gene.

In some embodiments, the kit is a nasopharyngeal carcinoma screening kit. In some embodiments, the kit is a nasopharyngeal carcinoma diagnostic kit.

One aspect of the present invention provides a use of the kit described in the present invention in preparing products for screening nasopharyngeal carcinoma.

One aspect of the present invention provides a use of the kit described in the present invention in preparing products for nasopharyngeal carcinoma diagnosis.

One aspect of the present invention provides a method for detecting Epstein-Barr virus-related nucleic acids in a sample, characterized in that the method comprises the following steps:

(a) placing the sample in a sample preservation solution;

(b) Conduct one or more tests selected from the following:

(b-1) performing Epstein-Barr virus genomic nucleic acid methylation detection on the sample preservation solution containing the sample;

(b-2) detecting the content of Epstein-Barr virus-related miRNA in the sample preservation solution containing the sample; and/or

(b-3) Detection of Epstein-Barr virus nucleic acid load on the sample preservation solution containing the sample.

In some embodiments, in step (b-2), the miRNA is firstly extracted from the sample preservation solution, and then the content of the miRNA is detected.

In some embodiments, the method includes step (b-1), and the methylation site detected by the Epstein-Barr virus genome nucleic acid methylation comprises one or more of the following sites: equivalent to GenBank LOCUS The sites of 10717bp, 11029bp, 14015bp, 14566bp, 45850bp, 57946bp, 66227bp and 128103bp of the Epstein-Barr virus genome DNA sequence of NC_007605 (SEQ ID NO:94). In some embodiments, the methylation site comprises sites corresponding to 10717bp, 11029bp, and 14015bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 10717bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 11029 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 14015 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 14566 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 45850 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 57946 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 66227bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site comprises a site corresponding to 128103bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).

In some embodiments, the method comprises step (b-2), and the miRNA comprises one or more of the following miRNAs: EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR- BART6-3p, EBV-miR-BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p. In some embodiments, all six of said miRNAs are included. In some embodiments, the miRNAs comprise EBV-miR-BART1-5p and EBV-miR-BART7-3p. In some embodiments, the miRNA comprises EBV-miR-BART1-5p. In some embodiments, the miRNA comprises EBV-miR-BART2-5p. In some embodiments, the miRNA comprises EBV-miR-BART6-3p. In some embodiments, the miRNA comprises EBV-miR-BART7-3p. In some embodiments, the miRNA comprises EBV-miR-BART13-3p. In some embodiments, the miRNA comprises EBV-miR-BART17-5p.

In some embodiments, the step of extracting the Epstein-Barr virus-related miRNA includes: i) adding a lysate to the sample preservation solution; in some embodiments, proteinase K is also added; ii) adding a binding solution and a nucleic acid adsorption material ; iii) removing the liquid portion, adding a rinsing solution to the nucleic acid adsorption material for cleaning; and iv) removing the liquid portion, adding an eluent to the nucleic acid adsorption material, and adsorbing the nucleic acid and/or the miRNA from the nucleic acid material eluted.

One aspect of the present invention provides a method for extracting miRNA, comprising the following steps: i) adding a lysate to the sample preservation solution; in some embodiments, proteinase K is also added; ii) adding a binding solution and a nucleic acid adsorption material ; iii) removing the liquid portion, adding a rinsing solution to the nucleic acid adsorption material for cleaning; and iv) removing the liquid portion, adding an eluent to the nucleic acid adsorption material, and adsorbing the nucleic acid and/or the miRNA from the nucleic acid material eluted.

In some embodiments, the lysate comprises one or more components selected from guanidine thiocyanate, citric acid, Triton-100, and/or EDTA. In some embodiments, the lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA. In some embodiments, in the lysate: the content range of the guanidine thiocyanate is 28%-40% (w/w); the content range of the citric acid is 1.8%-2.6% (w/w ); the content range of the Triton-100 is 0.8%-1.6% (w/w); the content range of the EDTA is 0.5%-0.9% (w/w); and/or the lysate The pH range is 3.8-4.2. In some embodiments, in the lysate: the content of the guanidine thiocyanate is about 32% (w/w); the content of the citric acid is about 2.2% (w/w); The content of Tong-100 is about 1.1% (w/w); the content of the EDTA is about 0.7% (w/w); and/or the pH value of the lysate is about 4.0.

In some embodiments, the binding solution comprises one selected from magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, sodium lauryl sarcosine, and/or isopropanol or multiple components. In some embodiments, the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, sodium sarcosine, and isopropanol. In some embodiments, in the combined solution: the content range of the magnesium chloride is 0.1%-0.4% (w/w); the content range of the disodium edetate is 0.5%-1.0% (w/w). /w); the content range of the sodium bicarbonate is 0.6%-1.0% (w/w); the content range of the guanidine thiocyanate is 13%-16% (w/w); the dodecane The content range of sodium sarcosinate is 1.0%-1.4% (w/w); the content range of the isopropanol is 60%-80% (w/w); and/or the pH value of the combination solution The range is 4.8-5.2. In some embodiments, in the combined solution: the magnesium chloride content is about 0.24% (w/w); the disodium edetate content is about 0.71% (w/w); the The content of sodium bicarbonate is about 0.83% (w/w); The content of said guanidine thiocyanate is about 14.9% (w/w); The content of said sodium lauryl sarcosinate is about 1.2% ( w/w); the content of the isopropanol is about 70% (w/w); and/or the pH value of the combination solution is about 5.0.

In some embodiments, in step iii) of the method, rinse solution 1 and rinse solution 2 are sequentially added to the nucleic acid adsorption material for washing, and the liquid part is removed after each wash and then the next wash is performed. In some embodiments, the nucleic acid adsorption material is washed at least twice with the rinsing solution 2 .

In some embodiments, the rinse solution 1 comprises one or more components selected from disodium edetate, sodium bicarbonate, guanidine thiocyanate, and/or sodium lauryl sarcosine . In some embodiments, the rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidine thiocyanate, and sodium lauryl sarcosinate. In some embodiments, in the rinse liquid 1: the content range of the disodium edetate is 0.4%-0.9% (w/w); the content range of the sodium bicarbonate is 0.5%-0.9% % (w/w); The content scope of described guanidinium thiocyanate is 50%-55% (w/w); The content scope of described sodium lauryl sarcosinate is 0.8%-1.2% (w/ w); and/or the pH range of the rinse solution 1 is 6.2-6.6. In some embodiments, in the rinse solution 1: the disodium edetate content is about 0.5% (w/w); the sodium bicarbonate content is about 0.6% (w/w) the content of the guanidine thiocyanate is about 53% (w/w); the content of the sodium lauryl sarcosinate is about 0.9% (w/w); and/or the rinse solution 1 The pH is about 6.4.

In some embodiments, in the method, before contacting the nucleic acid adsorption material, ethanol is added to the rinsing solution 1, and the volume ratio of the rinsing solution 1:ethanol is 1:1-1:2. In some embodiments, the volume ratio is about 2:3.

In some embodiments, the rinse solution 2 includes tris (Tris) or sodium chloride. In some embodiments, the rinse solution 2 comprises tris (Tris) and sodium chloride. In some embodiments, in the rinse liquid 2: the content range of the tris (Tris) is 0.5%-0.7% (w/w); the content range of the sodium chloride is 0.6% -1.8% (w/w); and/or the pH value of the rinse solution 2 is in the range of 6.6-7.0. In some embodiments, in the rinse solution 2: the content of the tris (Tris) is about 0.6% (w/w); the content of the sodium chloride is about 1.2% (w/ w); and/or the pH value of the rinse solution 2 is about 6.8.

In some embodiments, before the method contacts the nucleic acid adsorption material, ethanol is added to the rinsing solution 2, and the volume ratio of the rinsing solution 2:ethanol is 1:1.6-1:3. In some embodiments, the volume ratio is about 1:2.3.

In some embodiments, the eluent of the method is DEPC water.

In some embodiments, the nucleic acid adsorption material is magnetic beads capable of adsorbing RNA. In some embodiments, the magnetic core of the magnetic beads is ferric hydroxide, coated with silicon dioxide, and embedded with hydroxyl groups on the surface. In some embodiments, the particle size of the magnetic beads is 50-100 nm.

In some embodiments, the sample preservation solution used in the method comprises one or more groups selected from EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and/or trisodium phosphate point. In some embodiments, the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.

One aspect of the present invention provides a method for preserving a nucleic acid-containing biological sample, characterized in that the sample is placed in a sample preservation solution, and the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.

In some embodiments, in the sample preservation solution of the method: the content range of the EDTA is 0.7%-1.5% (w/w); the content range of the NaCl is 0.01%-0.1% (w/w ); the concentration range of the dehydrated alcohol is 15%-35% (w/w); the content range of the sodium citrate is 0.1%-1.0% (w/w); the concentration range of the NP40 is 0.01 %-0.1% (v/v); said glutathione content range is 0.07%-0.7% (w/w); and/or said trisodium phosphate content range is 0.07%-0.4% (w /w). In some embodiments, in the sample preservation solution: the content of the EDTA is about 1.05% (w/w); the content of the NaCl is about 0.035% (w/w); the concentration of the absolute ethanol is about 27.6% (w/w); the content of the sodium citrate is about 0.21% (w/w); the concentration of the NP40 is about 0.035% (v/v); the content of the glutathione is about 0.21% (w/w); and/or said trisodium phosphate is present in an amount of about 0.14% (w/w). In some embodiments, the sample preservation solution comprises antibiotics. In some embodiments, the antibiotic comprises double penicillin-streptomycin. In some embodiments, the pH value of the sample preservation solution is 7.6-8.0. In some embodiments, the pH value of the sample preservation solution is 7.8. In some embodiments, the sample preservation solution has a better preservation effect on DNA, miRNA, and/or DNA methylation than the control sample preservation solution.

In some embodiments, the method includes step (b-3), and the detection of the Epstein-Barr virus load includes the detection of the BamHI-W fragment in the Epstein-Barr virus genome, and/or the LMP-2 gene. In some embodiments, the detection of the EB virus load comprises the detection of the LMP-2 gene.

In some embodiments, the method is used for screening for nasopharyngeal carcinoma. In some embodiments, the method is used for the diagnosis of nasopharyngeal carcinoma. In some embodiments, the sample is a nasopharyngeal sample.

In some embodiments, before step (a), the method further comprises using a nasopharyngeal brush and/or a nasopharyngeal swab to obtain the sample. In some embodiments, the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab that does not rely on the guidance of a clinician and a nasopharyngoscope.

One aspect of the present invention provides a method for treating nasopharyngeal carcinoma in an individual in need, comprising providing the individual with drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus therapy, wherein the individual's The sample was tested by the method of the present invention and judged to be positive for nasopharyngeal carcinoma.

One aspect of the present invention provides a method for treating nasopharyngeal carcinoma in an individual in need, comprising 1) performing detection according to the method of the present invention on a sample from the individual; 2) if the detection result shows that the nasal Pharyngeal cancer positive, provide nasopharyngeal cancer treatment. In some embodiments, the nasopharyngeal carcinoma is treated with drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus therapy.

Detailed description of the invention

The object of the present invention is to provide a nasopharyngeal carcinoma diagnostic marker in order to overcome the above-mentioned deficiencies of the prior art.

The first object of the present invention is to provide the use/application of a reagent for detecting Epstein-Barr virus methylation sites and/or Epstein-Barr virus-related miRNAs in the preparation of nasopharyngeal carcinoma screening and/or diagnostic kits.

The second object of the present invention is to provide a product for screening and/or diagnosing nasopharyngeal carcinoma.

The third object of the present invention is to provide a product and method for nucleic acid sample preservation.

The fourth object of the present invention is to provide a product and method for RNA extraction, especially miRNA extraction.

In some embodiments, the diagnosis is an auxiliary diagnosis. In some embodiments, the screening is early screening, that is, early screening or pre-onset screening of nasopharyngeal carcinoma. In some embodiments, the nasopharyngeal sample used is a nasopharyngeal brush and/or nasopharyngeal swab sample. In some embodiments, the nasopharyngeal brush and/or nasopharyngeal swab sample is a nasopharyngeal brush and/or nasopharyngeal swab sample that does not rely on the guidance of a clinician and a nasopharyngoscope.

In order to achieve the above object, the present invention is achieved through the following schemes:

The inventors disclosed that the Epstein-Barr virus DNA methylation sites and/or Epstein-Barr virus-related miRNAs in nasopharyngeal samples can be used as molecular markers for the diagnosis of nasopharyngeal carcinoma, and the methylation difference and/or miRNA content can be used for nasopharyngeal cancer. Cancer diagnosis and prognosis. When the samples are biopsy samples, or rely on clinicians and nasopharyngoscope-guided nasopharyngeal brush samples, the sensitivity and specificity of Epstein-Barr virus DNA methylation sites as molecular markers for the diagnosis of nasopharyngeal carcinoma are related to the Epstein-Barr virus DNA load Equivalent; diagnostic sensitivity of Epstein-Barr virus DNA load as a diagnostic molecular marker for nasopharyngeal carcinoma when the sample is a nasopharyngeal brush or nasopharyngeal swab (blind examination of the nasopharynx) guided by a clinician and nasopharyngoscope The sensitivity and specificity of Epstein-Barr virus methylation site diagnosis were significantly better than Epstein-Barr virus DNA load. Further, when the sample is a nasopharyngeal brush or nasopharyngeal swab (nasopharyngeal blind test) sample that does not rely on clinicians and nasopharyngoscope guidance, Epstein-Barr virus methylation sites and/or Epstein-Barr virus-related miRNAs can be better Applied to the prediction of nasopharyngeal carcinoma.

This solution has the characteristics of non-invasive, non-destructive and repeatable sampling, and does not rely on clinicians and medical devices such as nasopharyngoscopes. The accuracy of identifying nasopharyngeal carcinoma is above 90%, so the overall technical solution is very suitable for screening nasopharyngeal carcinoma among large-scale populations in high-incidence sites.

In some embodiments, the kit includes a nucleic acid methylation detection reagent, which can perform methylation detection for methylation sites in the Epstein-Barr virus genome.

In some embodiments, the kit comprises miRNA detection reagents. In some embodiments, the miRNA detection reagent can detect the content of one or more miRNAs from Epstein-Barr virus.

In some embodiments, the kit comprises a sample preservation solution.

In some embodiments, the kit comprises miRNA extraction reagents.

In some embodiments, the kit comprises Epstein-Barr viral load detection reagents.

(a) placing the sample in a sample preservation solution;

(b) Conduct one or more tests selected from the following:

(b-2) extract Epstein-Barr virus-related miRNA from described sample preservation solution and detect the content of described miRNA; And/or

In some embodiments, the method includes the step (b-1) of detecting methylation of Epstein-Barr virus genome nucleic acid in the sample preservation solution containing the sample.

In some embodiments, the method includes step (b-2) extracting Epstein-Barr virus-related miRNA from the sample preservation solution and detecting the content of the miRNA.

In some embodiments, the method includes step (b-3) performing detection of Epstein-Barr virus nucleic acid load on the sample preservation solution containing the sample.

In some embodiments, the method is for screening and/or diagnosis of nasopharyngeal carcinoma. In some embodiments, the sample is a nasopharyngeal sample. In some embodiments, before step (a), further comprising using a nasopharyngeal brush and/or a nasopharyngeal swab to obtain the sample. In some embodiments, the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab that does not rely on the guidance of a clinician and a nasopharyngoscope. In some embodiments, the process of obtaining a sample is independent of clinician and nasopharyngoscopy guidance.

As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerical value with or without about/approximately used in this application is meant to cover any normal fluctuations understood by those of ordinary skill in the relevant art. In some embodiments, the term "about" or "approximately" refers to a range of 10% in either direction (greater than or less than) of the stated reference value, unless otherwise stated or otherwise evident from the context (except for such numerical will exceed 100% of the possible value).

Epstein-Barr virus genome methylation

In some embodiments, the methylation sites in the EBV genome include sites located in the C promoter region of the EBV genome. In some embodiments, the methylation sites in the EBV genome include sites in the w promoter region on the EBV genome.

In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) (NCBI Reference Sequence: NC_007605.1; ACCESSION : NC_007605; VERSION: NC_007605.1; 10717bp, 11029bp, 14015bp, 14566bp, 45850bp, 57946bp, 66227 of the Epstein-Barr virus genomic DNA sequence obtained from: https://www.ncbi.nlm.nih.gov/nuccore/NC_007605) bp and 128103bp sites. In some embodiments, the methylation sites in the Epstein-Barr virus genome include 1, 2, 3, 4, 5, 6, 7, or 8 of these sites. In some embodiments, the methylation sites in the Epstein-Barr virus genome comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, and at least 7 of these sites , or at least 8 sites. Preferably, the methylation site comprises sites corresponding to 10717bp, 11029bp, and 14015bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).

In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 10717 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).

In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 11029 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 14015 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 14566 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 45850 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 57946 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 66227 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94). In some embodiments, the methylation site in the Epstein-Barr virus genome comprises a site corresponding to 128103 bp of the Epstein-Barr virus genome DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).

In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: 10717bp, 11029bp of the Epstein-Barr virus genome DNA sequence equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) , 14015bp, 14566bp, 45850bp, 57946bp, 66227bp and 128103bp sites. In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: 11029bp and 45850bp of the Epstein-Barr virus genome DNA sequence equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) , 57946bp, 66227bp and 128103bp sites. In some embodiments, the methylation sites in the Epstein-Barr virus genome include one or more of the following sites: 11029bp and 57946bp of the Epstein-Barr virus genome DNA sequence equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) , and the 66227bp site.

miRNA

In some embodiments, the miRNA detected comprises one or more of the following miRNAs: EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR-BART6-3p, EBV-miR-BART7-3p , EBV-miR-BART13-3p, and EBV-miR-BART17-5p. In some embodiments, the miRNA comprises 1, 2, 3, 4, 5, or 6 selected from these miRNAs. In some embodiments, the miRNA comprises at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 miRNAs selected from these miRNAs. In some embodiments, the miRNAs comprise EBV-miR-BART1-5p and EBV-miR-BART7-3p. In some embodiments, the miRNAs comprise these six miRNAs.

In some embodiments, the miRNA comprises EBV-miR-BART1-5p. In some embodiments, the sequence of the EBV-miR-BART1-5p is UCUUAGUGGAAGUGACGUGCUGUG (SEQ ID NO: 39).

In some embodiments, the miRNA comprises EBV-miR-BART2-5p. In some embodiments, the sequence of the EBV-miR-BART2-5p is UAUUUUCUGCAUUCGCCCUUGC (SEQ ID NO: 40).

In some embodiments, the miRNA comprises EBV-miR-BART6-3p. In some embodiments, the sequence of the EBV-miR-BART6-3p: is CGGGGAUCGGACUAGCCUUAGA (SEQ ID NO: 41).

In some embodiments, the miRNA comprises EBV-miR-BART7-3p. In some embodiments, the sequence of the EBV-miR-BART7-3p is CAUCAUAGUCCAGUGUCCAGGG (SEQ ID NO: 42).

In some embodiments, the miRNA comprises EBV-miR-BART13-3p. In some embodiments, the sequence of the EBV-miR-BART13-3p is UGUAACUUGCCAGGGACGGCUGA (SEQ ID NO: 43).

In some embodiments, the miRNA comprises EBV-miR-BART17-5p. In some embodiments, the sequence of the EBV-miR-BART17-5p is UAAGAGGACGCAGGCAUACAAG (SEQ ID NO: 44).

Detection of nucleic acid methylation, miRNA, and viral load; primer and probe sets

In some embodiments, the detection reagents herein can detect the methylation of sites in the Epstein-Barr virus genome and perform methylation differential analysis. In some embodiments, the methylation difference analysis is to detect the Ct value after amplification of each site amplification primer and methylated probe and the Ct value after amplification of amplification primer and unmethylated probe Difference.

Specifically, the formula for calculating the methylation difference (Methylation Difference, MD) value of each site is:

MD= _CTm - _CTu ,

CT _m is the Ct value after amplification with the amplification primers and methylated probes at this site, and CT _u is the Ct value after amplification with the amplification primers and unmethylated probes at this site. Furthermore, the diagnosis of nasopharyngeal carcinoma can be carried out by using the MD value of each site to construct a model.

In some embodiments, the combination of detection primers and probes for the methylation site is selected from any combination of primers and probes shown in Table 2, Table 12, and Table 30.

In some embodiments, the detection primer and probe combination of each methylation site is selected from any one of the following combinations (the site information of Epstein-Barr virus genomic DNA is relative to SEQ ID NO: 94):

11029bp of Epstein-Barr virus genomic DNA:

Forward primer: GAGTGTTATTTTTGGAATAGTAG (SEQ ID NO: 7),

Reverse primer: TTAAACTCTCTTTATTAACTATAATC (SEQ ID NO: 8),

Methylation probe FAM-TGAATTTTGTTGGCGGGAGAAGGA-BHQ 1 (SEQ ID NO: 9),

Unmethylated probe HEX-TGAATTTTGTTGGTGGGAGAAGGA-BHQ 1 (SEQ ID NO: 10);

45850bp of Epstein-Barr virus genomic DNA:

Forward primer: AGTTTATGTTTGTGATGAGGTT (SEQ ID NO: 11),

Reverse primer: CCTAATCAATCACTCAAATACC (SEQ ID NO: 12),

Methylation probe: FAM-AGATTTAGGTTCGTGGGGTATTTAG-BHQ 1 (SEQ ID NO: 13),

Unmethylated probe: HEX-AGATTTAGGTTTGTGGGGTATTTAG-BHQ1 (SEQ ID NO: 14);

57946bp of Epstein-Barr virus genomic DNA:

Forward primer TGATTATTTTTTGTGTTAGTGGT (SEQ ID NO: 15),

Reverse primer AAATAACCCCCACAAAAAACC (SEQ ID NO: 16),

Methylation probe FAM-AGGATAGAGGGAGGCGGCGGT-BHQ1 (SEQ ID NO: 17),

Unmethylated probe HEX-AGGATAGAGGGAGGTGGTGGTT-BHQ1 (SEQ ID NO: 18);

66227bp of Epstein-Barr virus genomic DNA:

Forward primer: GGATAGGGTTTTTTTTGTGGAT (SEQ ID NO: 19),

Reverse primer: CATAATAATCTTTCAAACCCAAC (SEQ ID NO: 20),

Methylation probe: FAM-AGGAAGATGTCGCGCGGGTTAG-BHQ1 (SEQ ID NO: 21),

Unmethylated probe: HEX-AGGAAGATGTTGTGTGGGTTAGT-BHQ1 (SEQ ID NO: 22);

128103bp of Epstein-Barr virus genomic DNA:

Forward primer: GATAGGTGTTTAAGTTGGGTA (SEQ ID NO: 23),

Reverse primer: CTCCAAATTCAAACTTCTTTAAC (SEQ ID NO: 24),

Methylation probe: FAM-TGTTTTCGTCGCGTAGGTTAGTA-BHQ1 (SEQ ID NO: 25),

Unmethylated probe: HEX-TGTTTTTGTTGTGTAGGTTAGTAATG-BHQ1 (SEQ ID NO: 26).

10717bp of Epstein-Barr virus genomic DNA:

Forward primer: AAGGGGTATAAGAATGTCGGC (SEQ ID NO: 33),

Reverse primer: TAATTATTCGCAAAACCGCCCT (SEQ ID NO: 34),

Probe: VIC-TTAACCGAACCGCCCGACT-MGB (SEQ ID NO: 35),

14015bp of Epstein-Barr virus genomic DNA:

Forward primer: TCGGGAGAGGTAGTTTTTAAAGC (SEQ ID NO: 36),

Reverse primer: AACAAAATAACGCCCATTCG (SEQ ID NO: 37),

Probe: FAM-TTGGTAGTGATTTGGATTCGAA-MGB (SEQ ID NO: 38),

11029bp of Epstein-Barr virus genomic DNA:

Forward primer: AATTTATGGTTTAGTGCGTCG (SEQ ID NO: 79),

Reverse primer: TCTCTTATTAACTATAATCCGTCGC (SEQ ID NO: 80),

Probe: FAM-TGAATTTTGTTGGCGGGAGAAGGA-BHQ1 (SEQ ID NO: 81),

14566bp of Epstein-Barr virus genomic DNA:

Forward primer: TTTCGTTTTGTTTTGCGTTCGG (SEQ ID NO: 82),

Reverse primer: CTTACCTCTAACCCGATACCG (SEQ ID NO: 83),

Probe: FAM-ACCTTCACTTCGATCTCCCCTA-MGB (SEQ ID NO: 84),

Site 11062 of Epstein-Barr virus genomic DNA:

Forward primer: TAACGTTTTATTTGGGAGGAGC (SEQ ID NO: 76)

Reverse primer: AACAAAACGTAATTAATCCCGC (SEQ ID NO: 77)

Probe: FAM-TACTCCACCTCTAAAATCCCA-MGB (SEQ ID NO: 78)

In some embodiments, the detection reagents/methods herein can detect and differentially analyze miRNA content. In some embodiments, the detection primer and probe combination of the miRNA is selected from any combination of the following:

Primer/probe combinations targeting miR-BART1-5p:

miR-BART1-5p reverse transcription neck loop primer:

GGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCCACAGC (SEQ ID NO: 45),

miR-BART1-5p forward primer: GCCGTCTTAGTGGAAGTGACG (SEQ ID NO: 46),

miR-BART1-5p reverse primer: TGCAGGGTCCGAGGTATTC (SEQ ID NO: 47),

miR-BART1-5p probe: FAM-ACCAGAGCCCACAGCA-MGB (SEQ ID NO: 48).

Primer/probe combinations targeting miR-BART2-5p:

miR-BART2-5p reverse transcription neck loop primer:

GGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCGCAAGGG (SEQ ID NO: 49),

miR-BART2-5p forward primer: GCCGCTATTTTCTGCATTCG (SEQ ID NO: 50),

miR-BART2-5p reverse primer: TGCAGGGTCCGAGGTATTC (SEQ ID NO: 51),

miR-BART2-5p probe: FAM-CCAGAGCCGCAAGG-MGB (SEQ ID NO: 52),

Primer/probe combinations for BART6-3p:

miR-BART6-3p reverse transcription neck loop primer:

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTAAGG (SEQ ID NO: 53),

miR-BART6-3p forward primer: GCCGGGGATCGGACTAG (SEQ ID NO: 54),

miR-BART6-3p reverse primer: CAGTGCAGGGTCCGAGGTAT (SEQ ID NO: 55),

miR-BART6-3p probe: VIC-ACTGGATACGACTCTAAGG-MGB (SEQ ID NO: 56),

Primer/probe combinations targeting miR-BART7-3p:

miR-BART7-3p reverse transcription neck loop primer:

GGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCCCCTGGA (SEQ ID NO: 57),

miR-BART7-3p forward primer: CGGCCATCATAGTCCAGTGT (SEQ ID NO: 58),

miR-BART7-3p reverse primer: TGCAGGGTCCGAGGTATTC (SEQ ID NO: 59),

miR-BART7-3p probe: FAM-ACCAGAGCCCCCTGGA-MGB (SEQ ID NO: 60),

Primer/probe combinations targeting miR-BART13-3p:

miR-BART13-3p reverse transcription neck loop primer:

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGCC (SEQ ID NO: 61),

miR-BART13-3p forward primer: CGGTGTAACTTGCCAGGGA (SEQ ID NO: 62),

miR-BART13-3p reverse primer: CAGTGCAGGGTCCGAGGTAT (SEQ ID NO: 63),

miR-BART13-3p probe: VIC-TGGATACGACTCAGCCG-MGB (SEQ ID NO: 64),

Primer/probe combinations for BART17-5p:

miR-BART17-5p reverse transcription neck loop primer:

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTGTAT (SEQ ID NO: 65),

miR-BART17-5p forward primer: CGGTAAGAGGACGCAGGC (SEQ ID NO: 66),

miR-BART17-5p reverse primer: CAGTGCAGGGTCCGAGGTAT (SEQ ID NO: 67),

miR-BART17-5p probe: VIC-ACTGGATACGACCTTGTATG-MGB (SEQ ID NO: 68), primer/probe combination for miR-16-5p:

miR-16-5p reverse transcription neck loop primer:

GGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCCGCCAAT (SEQ ID NO: 69),

miR-16-5p forward primer: CGGGCTAGCAGCACGTAAA (SEQ ID NO: 70),

miR-16-5p reverse primer: TGCAGGGTCCGAGGTATTC (SEQ ID NO: 71),

miR-16-5p probe: CY5-CAGAGCCCGCCAATA-MGB (SEQ ID NO: 72).

In some embodiments, the detection reagent/method herein can detect Epstein-Barr virus load.

In some embodiments, the EB virus load detection comprises a nucleotide sequence such as primers shown in SEQ ID NO: 1 to 2 and a nucleotide sequence such as a probe shown in SEQ ID NO: 3 for quantitative The amplified target gene is the BamHI-w fragment of Epstein-Barr virus. In some embodiments, forward primer 5'-CCCAACACT CCACCACACC-3' (SEQ ID NO: 1), reverse primer: 5'-TCTTAGGAGCTGTCCGAGGG-3' (SEQ ID NO: 2), probe 5'-FAM -CACACACTACACACACCCACCCGTCTC-TAMRA-3' (SEQ ID NO: 3). In some embodiments, the primers and probes include forward primer TGCCAAAGAGCCAGATCTAAG (SEQ ID NO: 27), reverse primer AGTGTCAGATTTCGGGTCCAAA (SEQ ID NO: 28), probe FAM-CAGCCCCAAAGCGGGTGCA-BHQ 1 (SEQ ID NO: 29)

In some embodiments, the detection of the EB virus load comprises primers and probes for detecting the housekeeping gene β-globin gene. In some embodiments, the primer nucleotide sequence of the housekeeping gene β-globin gene is shown in SEQ ID NO: 4 to 5, and the probe nucleotide sequence is shown in SEQ ID NO: 6. Specifically, the two primer sequences are 5'-GTGCACCTGACTCCTGAGGAGA-3' (SEQ ID NO: 4) and 5'-CCTTGATACCAACCTGCCCAG-3' (SEQ ID NO: 5), and the probe sequence is 5'-FAM-AAGGTGAACGTGGATGAAGTTGGTGG- TAMRA-3' (SEQ ID NO: 6). In some embodiments, the primers and probes include forward primer GTGCATCTGACTCCTGAGGAGA (SEQ ID NO: 73), reverse primer CCTTGATACCAACCTGCCCAG (SEQ ID NO: 74), probe VIC-AAGGTGAACGTGGATGAAGTTGGTGG-BHQ1 (SEQ ID NO: 75 ).

In some embodiments, the detection of the EB virus load comprises primers and probes for detecting LMP-2. In some embodiments, the primers and probes include forward primer AGCTGTAACTGTGGTTTCCATGAC (SEQ ID NO: 30), reverse primer GCCCCCTGGCGAAGAG (SEQ ID NO: 31), probe FAM-CTGCTGCTACTGGCTTTCGTCCTCTGG-BHQ 1 (SEQ ID NO: 32).

In some embodiments, the detecting comprises primers and probes for detecting GAPDH3. In some embodiments, the primers and probes include forward primer GGTGGAGGAAGTTAGGGTTCGT (SEQ ID NO: 91), reverse primer CAACTCAACTCCAAACTAAACTCCACTA (SEQ ID NO: 92), probe CY5-TTGGGTTTTGACGTTGATT-MGB (SEQ ID NO: 93 )

In some embodiments, the 5' of the probe described herein carries a fluorescent group, and the 3' carries a fluorescent quenching group. In some embodiments, the 5' of the probe described herein carries a FAM fluorophore, a HEX fluorophore, a VIC fluorophore, or a CY5 fluorophore. In some embodiments, the 3' of the probe described herein carries a TAMRA fluorescent quencher, a BHQ1 fluorescent quencher, or an MGB fluorescent quencher.

Nucleic acid sample preservation solution and preservation method

In one aspect of the present invention, a sample preservation solution is provided. One aspect of the present invention provides a kit for preserving a nucleic acid-containing biological sample comprising a sample preservation solution. One aspect of the present invention provides a method for preserving a nucleic acid-containing biological sample using a sample preservation solution.

In some embodiments, the sample preservation solution comprises one or more components selected from EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and/or trisodium phosphate. In some embodiments, the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.

In some embodiments, in the sample preservation solution:

- the content range of the EDTA is 0.7%-1.5% (w/w);

- the content range of the NaCl is 0.01%-0.1% (w/w);

- the concentration range of the absolute ethanol is 15%-35% (w/w);

- the content range of the sodium citrate is 0.1%-1.0% (w/w);

- the concentration range of the NP40 is 0.01%-0.1% (v/v);

- said glutathione content ranges from 0.07% to 0.7% (w/w); and/or

- The content of trisodium phosphate ranges from 0.07% to 0.4% (w/w).

In some embodiments, in the sample preservation solution:

- said EDTA content is about 1.05% (w/w);

- said NaCl content is about 0.035% (w/w);

- said concentration of absolute ethanol is about 27.6% (w/w);

- said sodium citrate content is about 0.21% (w/w);

- said NP40 concentration is about 0.035% (v/v);

- said glutathione content is about 0.21% (w/w); and/or

- The content of said trisodium phosphate is about 0.14% (w/w).

In some embodiments, the sample preservation solution includes antibiotics; preferably, the antibiotics include penicillin-streptomycin double antibody.

In some embodiments, the pH value of the sample preservation solution is 7.6-8.0. In some embodiments, the pH value of the sample preservation solution is 7.7-7.9. In some embodiments, the pH value of the sample preservation solution is 7.6, 7.7, 7.8, 7.9, or 8.0. In some embodiments, the pH value of the sample preservation solution is 7.8.

In some embodiments, the sample preservation solution has a better preservation effect on DNA, miRNA, and/or DNA methylation than the control sample preservation solution. In some embodiments, the DNA is derived from Epstein-Barr virus, the miRNA is derived from Epstein-Barr virus, and/or the DNA methylation is methylation of Epstein-Barr virus DNA.

miRNA extraction reagents and methods

One aspect of the present invention provides a miRNA extraction reagent. One aspect of the present invention provides a kit comprising miRNA extraction reagents. One aspect of the present invention provides a method for extracting miRNA from a sample using an miRNA extraction reagent.

In some embodiments, the step of extracting miRNA comprises:

i) adding a lysate to the sample preservation solution; preferably, proteinase K is also added;

ii) adding binding solution and nucleic acid adsorption material;

iii) removing the liquid portion, adding a rinse solution to the nucleic acid adsorbing material for washing; and

iv) removing the liquid part, adding an eluent to the nucleic acid adsorption material, and eluting the nucleic acid and/or the miRNA from the nucleic acid adsorption material.

In some embodiments, the miRNA is Epstein-Barr virus-associated miRNA.

In some embodiments, the miRNA extraction reagents and methods include a lysis solution, a binding solution, a washing solution 1, and/or a washing solution 2. In some embodiments, the miRNA extraction reagents and methods include a lysis solution, a binding solution, a washing solution 1, and/or a washing solution 2.

In some embodiments, in step iii), rinse solution 1 and rinse solution 2 are sequentially added to the nucleic acid adsorption material for washing, and the liquid part is removed after each wash and then the next wash is performed; preferably, the nucleic acid adsorption material is The material was washed at least twice with the rinse solution 2.

In some embodiments, the miRNA extraction reagents/methods comprise a lysate. In some embodiments, the lysate comprises one or more components selected from guanidine thiocyanate, citric acid, Triton-100, and/or EDTA. In some embodiments, the lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA.

In some embodiments, in the lysate:

- the content range of the guanidinium thiocyanate is 28%-40% (w/w);

- the content range of the citric acid is 1.8%-2.6% (w/w);

- the content range of the Triton-100 is 0.8%-1.6% (w/w);

- said EDTA content ranges from 0.5% to 0.9% (w/w); and/or

- The pH range of the lysate is 3.8-4.2.

In some embodiments, in the lysate:

- said content of guanidinium thiocyanate is about 32% (w/w);

- said citric acid content is about 2.2% (w/w);

- the content of said Triton-100 is about 1.1% (w/w);

- said EDTA content is about 0.7% (w/w); and/or

- The pH of the lysate is about 4.0.

In some embodiments, the miRNA extraction reagent/method comprises a binding solution. In some embodiments, the binding solution comprises one selected from magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, sodium lauryl sarcosine, and/or isopropanol or multiple components. In some embodiments, the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, sodium sarcosine, and isopropanol.

In some embodiments, in the binding solution:

- the content range of the magnesium chloride is 0.1%-0.4% (w/w);

- the content range of disodium edetate is 0.5%-1.0% (w/w);

- the content range of the sodium bicarbonate is 0.6%-1.0% (w/w);

- the content range of the guanidinium thiocyanate is 13%-16% (w/w);

- the content range of the sodium lauryl sarcosine is 1.0%-1.4% (w/w);

- said isopropanol is present in an amount ranging from 60% to 80% (w/w); and/or

- The pH range of the binding solution is 4.8-5.2.

In some embodiments, in the binding solution:

- said magnesium chloride content is about 0.24% (w/w);

- the content of disodium edetate is about 0.71% (w/w);

- said sodium bicarbonate content is about 0.83% (w/w);

- said content of guanidinium thiocyanate is about 14.9% (w/w);

- the content of sodium sarcosyl is about 1.2% (w/w);

- said isopropanol is present in an amount of about 70% (w/w); and/or

- The pH value of the binding solution is about 5.0.

In some embodiments, the miRNA extraction reagent/method comprises Wash 1. In some embodiments, the rinse solution 1 comprises one or more components selected from disodium edetate, sodium bicarbonate, guanidine thiocyanate, and/or sodium lauryl sarcosine . In some embodiments, the rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidine thiocyanate, and sodium lauryl sarcosinate.

In some embodiments, in the rinse solution 1:

- the content range of disodium edetate is 0.4%-0.9% (w/w);

- the content range of the sodium bicarbonate is 0.5%-0.9% (w/w);

- the content range of the guanidinium thiocyanate is 50%-55% (w/w);

- the content of sodium sarcosyl is in the range of 0.8%-1.2% (w/w); and/or

- The pH range of the rinse solution 1 is 6.2-6.6.

In some embodiments, in the rinse solution 1:

- the content of disodium edetate is about 0.5% (w/w);

- the content of said sodium bicarbonate is about 0.6% (w/w);

- said content of guanidinium thiocyanate is about 53% (w/w);

- the content of sodium sarcosyl is about 0.9% (w/w); and/or

- The pH value of the rinse solution 1 is about 6.4.

In some embodiments, ethanol is added to the rinse solution 1 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse solution 1:ethanol is 1:1-1:2; preferably, the volume The ratio is about 2:3.

In some embodiments, the miRNA extraction reagent/method comprises the wash solution 2. In some embodiments, the rinse solution 2 includes tris (Tris) or sodium chloride. In some embodiments, the rinse solution 2 comprises tris (Tris) and sodium chloride.

In some embodiments, in the rinse solution 2:

- the content range of the tris (Tris) is 0.5%-0.7% (w/w);

- said sodium chloride content ranges from 0.6% to 1.8% (w/w); and/or

- The pH range of the rinse solution 2 is 6.6-7.0.

In some embodiments, in the rinse solution 2:

- the content of tris (Tris) is about 0.6% (w/w);

- said sodium chloride content is about 1.2% (w/w); and/or

- The pH value of the rinse solution 2 is about 6.8.

In some embodiments, ethanol is added to the rinse solution 2 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse solution 2:ethanol is 1:1.6-1:3; preferably, the volume The ratio is about 1:2.3.

In some embodiments, the eluent is DEPC water.

In some embodiments, the miRNA extraction reagent/method comprises a nucleic acid adsorbent material. In some embodiments, the nucleic acid adsorption material is magnetic beads that adsorb RNA. In some embodiments, in some embodiments, the magnetic core of the magnetic beads is ferric hydroxide. In some embodiments, the magnetic beads are coated with silica. In some embodiments, the surface of the magnetic beads is embedded with hydroxyl groups. In some embodiments, the particle size of the magnetic beads is 50-100 nm.

Epstein-Barr Viral Load Detection Reagent

In some embodiments, the detection of the Epstein-Barr virus load comprises the detection of the BamHI-W fragment in the Epstein-Barr virus genome, and/or the LMP-2 gene. In some embodiments, the detection of the Epstein-Barr virus load comprises the detection of the BamHI-W fragment in the Epstein-Barr virus genome. In some embodiments, the detection of the Epstein-Barr virus load comprises the detection of the LMP-2 gene in the Epstein-Barr virus genome.

Nasopharyngeal brush or nasopharyngeal swab

In some embodiments, the kit of the present invention further comprises a nasopharyngeal brush or a nasopharyngeal swab. In some embodiments, the uses and methods of the present invention further comprise obtaining a sample using a nasopharyngeal brush or a nasopharyngeal swab. In some embodiments, the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab that does not rely on the guidance of a clinician and a nasopharyngoscope.

Nasopharyngeal Cancer Treatment

In some embodiments, the present invention provides a method for treating nasopharyngeal carcinoma in an individual in need thereof, comprising providing drug, radiotherapy, surgery, cell therapy and/or oncolytic virus therapy to the individual, wherein the Individual samples are tested by the screening and/or diagnosing method for nasopharyngeal carcinoma according to the present invention and judged to be positive for nasopharyngeal carcinoma.

In some embodiments, the present invention provides a method for treating nasopharyngeal carcinoma in an individual in need thereof, comprising 1) performing the screening and/or diagnosing method for nasopharyngeal carcinoma according to the present invention on a sample from said individual 2) If the test result is positive for nasopharyngeal carcinoma, provide nasopharyngeal carcinoma treatment; preferably, the nasopharyngeal carcinoma treatment adopts drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus treatment.

In some embodiments, the nasopharyngeal carcinoma screening and/or diagnosis method of the present invention comprises:

(1) Epstein-Barr virus genome nucleic acid methylation detection;

(2) Detection of Epstein-Barr virus-related miRNA content; and/or

(3) Detection of EB virus nucleic acid load.

In some embodiments, the individual is a human. In some embodiments, the method comprises providing a therapeutically effective amount of a drug, radiation therapy, surgery, cell therapy, and/or oncolytic virus therapy. Relevant treatment methods include but are not limited to those mentioned in the following literature: Liu et al., Front Oncol. 2021; 11: 635737 (doi: 10.3389/fonc.2021.635737). This application incorporates these documents by reference in their entirety.

In some embodiments, the method of treating nasopharyngeal carcinoma comprises radiation therapy. In certain embodiments, the radiotherapy is intensity-modulated radiotherapy (IMRT).

In some embodiments, the method of treating nasopharyngeal carcinoma comprises proton therapy.

In some embodiments, the method of treating nasopharyngeal carcinoma comprises chemotherapy. In some embodiments, the chemotherapy uses a platinum-containing chemotherapy drug.

In some embodiments, the method of treating nasopharyngeal carcinoma comprises targeted therapy. In some embodiments, the targeted therapy comprises an antibody drug or a small molecule drug.

In some embodiments, the method of treating nasopharyngeal carcinoma comprises immunotherapy. In some embodiments, the immunotherapy comprises cell therapy or oncolytic virotherapy. In some embodiments, the cell therapy comprises chimeric antigen receptor modified T cell (CAR-T) therapy or chimeric antigen receptor modified NK cell (CAR-NK) therapy.

Beneficial effect

Compared with the prior art, the present invention has the following beneficial effects:

The present invention proposes that Epstein-Barr virus methylation site/miRNA can be used as a diagnostic marker for nasopharyngeal carcinoma, which is independent of clinicians and nasopharyngoscope-guided nasopharyngeal brush or nasopharyngeal swab (nasopharyngeal blind examination) samples It has the advantages of high sensitivity and high specificity, and is conducive to the promotion of nasopharyngeal brushes or nasopharyngeal swabs (blind nasopharyngeal examination) that do not rely on clinicians and nasopharyngoscope guidance.

Implementation items/technical solutions

Specifically, the present invention can solve the technical problems existing in the prior art through the following technical solutions:

Item 1. A kit for detecting Epstein-Barr virus, characterized in that, the kit includes one or more selected from nucleic acid methylation detection reagents, miRNA detection reagents, miRNA extraction reagents, and/or sample preservation solutions reagent.

Item 2. The kit as described in Item 1, characterized in that, the kit includes a nucleic acid methylation detection reagent, and the nucleic acid methylation detection reagent can carry out methylation for the methylation site in the Epstein-Barr virus genome chemical detection.

Item 3. The kit as described in item 2, wherein the methylation site in the Epstein-Barr virus genome comprises one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 10717bp, 11029bp, 14015bp, 14566bp, 45850bp, 57946bp, 66227bp and 128103bp sites of the Epstein-Barr virus genome DNA sequence.

Item 4. The kit according to any one of items 2-3, wherein the methylation site in the Epstein-Barr virus genome comprises EB equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 10717bp, 11029bp, and 14015bp sites of the viral genome DNA sequence.

Item 5. The kit as described in any one of items 2-4, wherein the methylation site in the Epstein-Barr virus genome comprises one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) the sites of 11029bp, 45850bp, 57946bp, 66227bp and 128103bp of the Epstein-Barr virus genome DNA sequence.

Item 6. The kit as described in any one of items 2-5, wherein the methylation site in the Epstein-Barr virus genome comprises one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) the 11029bp, 57946bp and 66227bp sites of the Epstein-Barr virus genome DNA sequence.

Item 7. The kit as described in any one of items 2-6, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 11029bp site of the sequence.

Item 7.1. The kit as described in any one of items 2-7, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 10717bp site of the sequence.

Item 7.2. The kit as described in any one of item 2-7.1, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 14015bp site of the sequence.

Item 7.3. The kit as described in any one of item 2-7.2, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 14566bp site of the sequence.

Item 7.4. The kit as described in any one of item 2-7.3, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 45850bp site of the sequence.

Item 7.5. The kit as described in any one of item 2-7.4, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 57946bp site of the sequence.

Item 7.6. The kit as described in any one of item 2-7.5, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 66227bp site of the sequence.

Item 7.7. The kit as described in any one of item 2-7.6, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genomic DNA equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 128103bp site of the sequence.

Item 8. The kit according to any one of Items 1-7.7, characterized in that, the kit includes the miRNA detection reagent, and the miRNA detection reagent can be used for one or more miRNAs from Epstein-Barr virus. detection.

Item 9. The kit as described in Item 8, wherein the miRNA comprises one or more of the following miRNAs: EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR-BART6- 3p, EBV-miR-BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p; preferably comprising all six of said miRNAs.

Item 10. The kit according to Item 9, wherein the miRNA comprises EBV-miR-BART1-5p and EBV-miR-BART7-3p.

Item 11. The kit according to any one of Items 9-10, wherein the miRNA comprises EBV-miR-BART 1-5p.

Item 12. The kit according to any one of Items 9-11, wherein the miRNA comprises EBV-miR-BART2-5p.

Item 13. The kit according to any one of Items 9-12, wherein the miRNA comprises EBV-miR-BART6-3p.

Item 14. The kit according to any one of Items 9-13, wherein the miRNA comprises EBV-miR-BART7-3p.

Item 15. The kit according to any one of Items 9-14, wherein the miRNA comprises EBV-miR-BART13-3p.

Item 16. The kit according to any one of Items 9-15, wherein the miRNA comprises EBV-miR-BART 17-5p.

Item 17. The kit as described in any one of Items 1-16, wherein the kit includes the sample preservation solution, and the sample preservation solution comprises EDTA, NaCl, absolute ethanol, citric acid One or more components of sodium, NP40, glutathione, and/or trisodium phosphate.

Item 18. The kit according to Item 17, wherein the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.

Item 19. A kit for preserving a nucleic acid-containing biological sample, characterized in that it comprises a sample preservation solution comprising EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and Trisodium Phosphate.

Item 20. The kit according to any one of Items 17-19, wherein in the sample preservation solution:

The content range of the EDTA is 0.7%-1.5% (w/w);

The content range of the NaCl is 0.01%-0.1% (w/w);

The concentration range of the absolute ethanol is 15%-35% (w/w);

The content range of the sodium citrate is 0.1%-1.0% (w/w);

The concentration range of the NP40 is 0.01%-0.1% (v/v);

The glutathione content ranges from 0.07% to 0.7% (w/w); and/or

The content range of the trisodium phosphate is 0.07%-0.4% (w/w).

Item 21. The kit according to any one of Items 17-20, wherein in the sample preservation solution:

The content of said EDTA is about 1.05% (w/w);

The content of said NaCl is about 0.035% (w/w);

The concentration of absolute ethanol is about 27.6% (w/w);

The content of the sodium citrate is about 0.21% (w/w);

The concentration of said NP40 is about 0.035% (v/v);

The glutathione content is about 0.21% (w/w); and/or

The content of the trisodium phosphate is about 0.14% (w/w).

Item 22. The kit according to item 17-21, wherein the sample preservation solution includes antibiotics; preferably, the antibiotics include penicillin-streptomycin double antibody.

Item 23. The kit according to any one of Items 17-22, wherein the pH value of the sample preservation solution is 7.6-8.0; preferably, the pH value of the sample preservation solution is 7.8.

Item 24. The kit according to any one of Items 17-23, characterized in that, compared with the control sample preservation solution, the sample preservation solution has a better preservation effect on DNA, miRNA, and/or DNA methylation. good.

Item 25. The kit according to Item 24, wherein the DNA is derived from Epstein-Barr virus, the miRNA is derived from Epstein-Barr virus, and/or the DNA methylation is methylation of Epstein-Barr virus DNA.

Item 26. The kit according to any one of Items 1-25, wherein the kit includes the miRNA extraction reagent, and the miRNA extraction reagent includes a lysate, a binding solution, a rinse solution 1, and/or or rinse solution 2.

Item 27. A kit comprising miRNA extraction reagents, characterized in that the miRNA extraction reagents comprise lysis solution, binding solution, washing solution 1, and/or washing solution 2.

Item 28. The kit according to Item 26 or 27, wherein the miRNA extraction reagent comprises the lysate, and the lysate comprises guanidinium thiocyanate, citric acid, Triton-100, and/or one or more components of EDTA.

Item 29. The kit according to Item 26 or 27, wherein the miRNA extraction reagent comprises the lysate, which comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA .

Item 30. The kit according to any one of Items 26-29, wherein in the lysate:

The content scope of described guanidinium thiocyanate is 28%-40% (w/w);

The content range of the citric acid is 1.8%-2.6% (w/w);

The content range of the Triton-100 is 0.8%-1.6% (w/w);

The content range of the EDTA is 0.5%-0.9% (w/w); and/or

The pH range of the lysate is 3.8-4.2.

Item 31. The kit according to any one of Items 26-30, wherein in the lysate:

The content of the guanidinium thiocyanate is about 32% (w/w);

The content of said citric acid is about 2.2% (w/w);

The content of the Triton-100 is about 1.1% (w/w);

The content of said EDTA is about 0.7% (w/w); and/or

The pH of the lysate is about 4.0.

Item 32. The kit according to any one of Items 26-31, wherein the miRNA extraction reagent comprises the binding liquid, and the binding liquid comprises magnesium chloride, disodium edetate, carbonic acid One or more components of sodium hydrogen, guanidinium thiocyanate, sodium lauryl sarcosinate, and/or isopropanol.

Item 33. The kit according to any one of Items 26-32, wherein the miRNA extraction reagent comprises the binding solution, and the binding solution comprises magnesium chloride, disodium edetate, and sodium bicarbonate , guanidinium thiocyanate, sodium lauryl sarcosinate, and isopropanol.

Item 34. The kit according to any one of Items 26-33, wherein in the binding solution:

The content range of the magnesium chloride is 0.1%-0.4% (w/w);

The content range of the disodium edetate is 0.5%-1.0% (w/w);

The content scope of described sodium bicarbonate is 0.6%-1.0% (w/w);

The content range of the guanidine thiocyanate is 13%-16% (w/w);

The content range of the sodium lauryl sarcosinate is 1.0%-1.4% (w/w);

The content range of the isopropanol is 60%-80% (w/w); and/or

The pH range of the binding solution is 4.8-5.2.

Item 35. The kit according to any one of Items 26-34, wherein in the binding solution:

The content of said magnesium chloride is about 0.24% (w/w);

The content of disodium edetate is about 0.71% (w/w);

The content of the sodium bicarbonate is about 0.83% (w/w);

The content of guanidine thiocyanate is about 14.9% (w/w);

The content of sodium sarcosyl is about 1.2% (w/w);

The content of said isopropanol is about 70% (w/w); and/or

The pH of the binding solution is about 5.0.

Item 36. The kit according to any one of Items 26-35, wherein the miRNA extraction reagent comprises the rinse solution 1, and the rinse solution 1 comprises disodium edetate, carbonic acid One or more components of sodium hydrogen, guanidinium thiocyanate, and/or sodium lauryl sarcosinate.

Item 37. The kit according to any one of items 26-36, wherein the miRNA extraction reagent comprises the rinse solution 1, and the rinse solution 1 comprises disodium edetate, sodium bicarbonate , guanidinium thiocyanate, and sodium lauryl sarcosinate.

Item 38. The kit according to any one of Items 26-37, wherein in the rinse solution 1:

The content range of the disodium edetate is 0.4%-0.9% (w/w);

The content scope of described sodium bicarbonate is 0.5%-0.9% (w/w);

The content range of the guanidinium thiocyanate is 50%-55% (w/w);

The content range of the sodium lauryl sarcosyl is 0.8%-1.2% (w/w); and/or

The pH range of the rinse solution 1 is 6.2-6.6.

Item 39. The kit according to any one of Items 26-38, wherein in the rinse solution 1:

The content of disodium edetate is about 0.5% (w/w);

The content of the sodium bicarbonate is about 0.6% (w/w);

The content of the guanidinium thiocyanate is about 53% (w/w);

The content of sodium sarcosyl is about 0.9% (w/w); and/or

The pH of the Rinse 1 was about 6.4.

Item 40. The kit according to any one of Items 26-39, wherein the miRNA extraction reagent comprises the rinse solution 2, and the rinse solution 2 comprises tris (Tris) or chlorine sodium chloride.

Item 41. The kit according to any one of Items 26-40, wherein the miRNA extraction reagent comprises the rinse solution 2, and the rinse solution 2 comprises tris (Tris) and chlorine sodium chloride.

Item 42. The kit according to any one of Items 26-41, wherein in the rinse solution 2:

The content range of the tris (Tris) is 0.5%-0.7% (w/w);

The content range of the sodium chloride is 0.6%-1.8% (w/w); and/or

The pH range of the rinse solution 2 is 6.6-7.0.

Item 43. The kit according to any one of Items 26-42, wherein in the rinse solution 2:

The content of tris (Tris) is about 0.6% (w/w);

The sodium chloride content is about 1.2% (w/w); and/or

The pH value of the rinse solution 2 is about 6.8.

Item 44. The kit according to any one of Items 26-43, wherein the miRNA extraction reagent comprises magnetic beads that adsorb RNA.

Item 45. The kit according to Item 44, wherein the magnetic core of the magnetic beads is ferric hydroxide, coated with silicon dioxide, and hydroxy groups are embedded on the surface.

Item 46. The kit according to Item 44 or 45, wherein the magnetic beads have a particle diameter of 50-100 nm.

Item 47. The kit according to any one of Items 26-46, further comprising a nasopharyngeal brush or a nasopharyngeal swab.

Item 48. The kit according to Item 47, wherein the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab independent of the guidance of a clinician and a nasopharyngoscope.

Item 49. The kit according to any one of Items 1-48, characterized in that, the kit also includes EB virus load detection reagents; preferably, the EB virus load detection reagents contain In the BamHI-W fragment, and/or the detection reagent of LMP-2 gene.

Item 50. The kit according to Item 49, wherein the EB virus load detection reagent includes a detection reagent for LMP-2 gene.

Item 51. The kit according to any one of Items 1-50, wherein the kit is a nasopharyngeal carcinoma screening kit.

Item 51.1. The kit according to any one of Items 1-51, wherein the kit is a diagnostic kit for nasopharyngeal carcinoma.

Item 52. A method for detecting Epstein-Barr virus-related nucleic acids in a sample, characterized in that the method comprises the following steps:

(a) placing the sample in a sample preservation solution;

(b) Conduct one or more tests selected from the following:

(b-2) detecting the content of Epstein-Barr virus-related miRNA in the sample preservation solution containing the sample;

Preferably, it also includes extracting the miRNA from the sample preservation solution; and/or

Item 53. The method as described in Item 52, characterized in that, step (b-1) is included, and the methylation site detected for methylation of the Epstein-Barr virus genome nucleic acid includes one or more of the following sites : the sites equivalent to 10717bp, 11029bp, 14015bp, 14566bp, 45850bp, 57946bp, 66227bp and 128103bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).

Item 54. The method as described in Item 53, wherein the methylation site comprises positions equivalent to 10717bp, 11029bp, and 14015bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.1. The method according to any one of Item 53-54, wherein the methylation site comprises a position equivalent to 10717bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.2. The method according to any one of Item 53-54.1, wherein the methylation site comprises a position equivalent to 11029bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.3. The method according to any one of Item 53-54.2, wherein the methylation site comprises a position equivalent to 14015bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.4. The method according to any one of Item 53-54.3, wherein the methylation site comprises a position corresponding to 14566 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.5. The method according to any one of Item 53-54.4, wherein the methylation site comprises a position equivalent to 45850bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.6. The method according to any one of Item 53-54.5, wherein the methylation site comprises a position corresponding to 57946 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.7. The method according to any one of Item 53-54.6, wherein the methylation site comprises a position corresponding to 66227bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 54.8. The method according to any one of Item 53-54.7, wherein the methylation site comprises a position corresponding to 128103 bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94) point.

Item 55. The method according to any one of Items 52-54.8, characterized in that step (b-2) is included, and the miRNA includes one or more of the following miRNAs: EBV-miR-BART1-5p, EBV- miR-BART2-5p, EBV-miR-BART6-3p, EBV-miR-BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p; preferably comprising all six of said miRNAs.

Item 56. The method according to Item 55, wherein the miRNA comprises EBV-miR-BART1-5p and EBV-miR-BART7-3p.

Item 56.1. The method according to any one of Items 55-56, wherein the miRNA comprises EBV-miR-BART1-5p.

Item 56.2. The method according to any one of Items 55-56.1, wherein the miRNA comprises EBV-miR-BART2-5p.

Item 56.3. The method according to any one of Items 55-56.2, wherein the miRNA comprises EBV-miR-BART6-3p.

Item 56.4. The method according to any one of Items 55-56.3, wherein the miRNA comprises EBV-miR-BART7-3p.

Item 56.5. The method according to any one of Items 55-56.4, wherein the miRNA comprises EBV-miR-BART13-3p.

Item 56.6. The method according to any one of Items 55-56.5, wherein the miRNA comprises EBV-miR-BART17-5p.

Item 57. The method according to any one of Items 52-56.6, wherein the step of extracting the Epstein-Barr virus-related miRNA comprises:

ii) adding binding solution and nucleic acid adsorption material;

Item 58. A method for extracting miRNA, comprising the steps of:

ii) adding binding solution and nucleic acid adsorption material;

Item 59. The method according to any one of Items 57-58, wherein the lysate comprises one or more compounds selected from guanidine thiocyanate, citric acid, Triton-100, and/or EDTA A component; Preferably, the lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA.

Item 60. The method according to Item 59, wherein in the lysate:

The content scope of described guanidinium thiocyanate is 28%-40% (w/w);

The content range of the citric acid is 1.8%-2.6% (w/w);

The content range of the Triton-100 is 0.8%-1.6% (w/w);

The content range of the EDTA is 0.5%-0.9% (w/w); and/or

The pH range of the lysate is 3.8-4.2.

Item 61. The method according to any one of Items 59-60, wherein in the lysate:

The content of the guanidinium thiocyanate is about 32% (w/w);

The content of said citric acid is about 2.2% (w/w);

The content of the Triton-100 is about 1.1% (w/w);

The content of said EDTA is about 0.7% (w/w); and/or

The pH of the lysate is about 4.0.

Item 62. The method according to any one of Items 57-61, wherein the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, dodecyl Sodium sarcosinate, and/or one or more components of isopropanol; preferably, the combined solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, dodecane Sodium sarcosinate, and isopropanol.

Item 63. The method according to Item 62, wherein in the binding solution:

The content range of the magnesium chloride is 0.1%-0.4% (w/w);

The content range of the disodium edetate is 0.5%-1.0% (w/w);

The content scope of described sodium bicarbonate is 0.6%-1.0% (w/w);

The content range of the guanidine thiocyanate is 13%-16% (w/w);

The content range of the sodium lauryl sarcosinate is 1.0%-1.4% (w/w);

The content range of the isopropanol is 60%-80% (w/w); and/or

The pH range of the binding solution is 4.8-5.2.

Item 64. The method according to any one of Items 62-63, wherein in the binding solution:

The content of said magnesium chloride is about 0.24% (w/w);

The content of disodium edetate is about 0.71% (w/w);

The content of the sodium bicarbonate is about 0.83% (w/w);

The content of the guanidinium thiocyanate is about 14.9% (w/w);

The content of sodium sarcosyl is about 1.2% (w/w);

The content of said isopropanol is about 70% (w/w); and/or

The pH of the binding solution is about 5.0.

Item 65. The method according to any one of Items 57-64, characterized in that in step iii), rinse solution 1 and rinse solution 2 are sequentially added to the nucleic acid adsorption material for washing, and the liquid part is removed after each washing Then perform the next wash; preferably, wash the nucleic acid adsorption material with the rinse solution 2 at least twice.

Item 66. The method according to Item 65, wherein the rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidinium thiocyanate, and/or lauryl sarcosine One or more components of sodium; preferably, the rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidinium thiocyanate, and sodium lauryl sarcosinate.

Item 67. The method according to Item 66, wherein in the rinse solution 1:

The content range of the disodium edetate is 0.4%-0.9% (w/w);

The content scope of described sodium bicarbonate is 0.5%-0.9% (w/w);

The content range of the guanidinium thiocyanate is 50%-55% (w/w);

The content range of the sodium lauryl sarcosyl is 0.8%-1.2% (w/w); and/or

The pH range of the rinse solution 1 is 6.2-6.6.

Item 68. The method according to any one of Items 66-67, wherein in the rinse solution 1:

The content of disodium edetate is about 0.5% (w/w);

The content of the sodium bicarbonate is about 0.6% (w/w);

The content of the guanidinium thiocyanate is about 53% (w/w);

The content of sodium sarcosyl is about 0.9% (w/w); and/or

The pH of the Rinse 1 was about 6.4.

Item 69. The method according to any one of Items 66-68, wherein ethanol is added to the rinse solution 1 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse solution 1:ethanol is 1:1-1:2; preferably, the volume ratio is about 2:3.

Item 70. The method according to any one of Items 65-69, wherein the rinse solution 2 comprises Tris (Tris) or sodium chloride; preferably, the rinse solution 2 comprises Tris Hydroxymethylaminomethane (Tris) and Sodium Chloride.

Item 71. The method according to Item 70, wherein in the rinse solution 2:

The content range of the tris (Tris) is 0.5%-0.7% (w/w);

The content range of the sodium chloride is 0.6%-1.8% (w/w); and/or

The pH range of the rinse solution 2 is 6.6-7.0.

Item 72. The method according to any one of Items 70-71, wherein in the rinse solution 2:

The content of tris (Tris) is about 0.6% (w/w);

The sodium chloride content is about 1.2% (w/w); and/or

The pH value of the rinse solution 2 is about 6.8.

Item 73. The method according to any one of Items 70-72, wherein ethanol is added to the rinse solution 2 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse solution 2:ethanol is 1:1.6-1:3; preferably, the volume ratio is about 1:2.3.

Item 74. The method according to any one of Item 57-73, wherein the eluent is DEPC water.

Item 75. The method according to any one of Items 57-74, wherein the nucleic acid adsorption material is a magnetic bead capable of adsorbing RNA.

Item 76. The method as described in Item 75, wherein the magnetic core of the magnetic bead is ferric hydroxide, coated with silicon dioxide, and the surface is embedded with hydroxyl groups; preferably, the magnetic bead The diameter is 50-100nm.

Item 77. The method according to any one of Items 52-76, wherein the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and/or One or more components of trisodium phosphate; preferably, the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.

Item 78. A method for preserving a nucleic acid-containing biological sample, characterized in that the sample is placed in a sample preservation solution, and the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, and glutathione peptides, and trisodium phosphate.

Item 79. The method according to any one of Items 77-78, wherein in the sample preservation solution:

The content range of the EDTA is 0.7%-1.5% (w/w);

The content range of the NaCl is 0.01%-0.1% (w/w);

The concentration range of the absolute ethanol is 15%-35% (w/w);

The content range of the sodium citrate is 0.1%-1.0% (w/w);

The concentration range of the NP40 is 0.01%-0.1% (v/v);

The glutathione content ranges from 0.07% to 0.7% (w/w); and/or

The content range of the trisodium phosphate is 0.07%-0.4% (w/w).

Item 80. The method according to any one of Items 77-79, wherein in the sample preservation solution:

The content of said EDTA is about 1.05% (w/w);

The content of said NaCl is about 0.035% (w/w);

The concentration of absolute ethanol is about 27.6% (w/w);

The content of the sodium citrate is about 0.21% (w/w);

The concentration of said NP40 is about 0.035% (v/v);

The glutathione content is about 0.21% (w/w); and/or

The content of the trisodium phosphate is about 0.14% (w/w).

Item 81. The method according to Item 77-80, wherein the sample preservation solution contains antibiotics; preferably, the antibiotics contain penicillin-streptomycin double antibody.

Item 82. The method according to any one of Items 77-81, wherein the pH value of the sample preservation solution is 7.6-8.0; preferably, the pH value of the sample preservation solution is 7.8.

Item 83. The method according to any one of Items 77-82, characterized in that, compared with the control sample preservation solution, the sample preservation solution has a better preservation effect on DNA, miRNA, and/or DNA methylation .

Item 84. The method according to any one of Items 52-83, characterized in that step (b-3) is included, and the detection of the EB virus load comprises targeting the BamHI-W fragment in the Epstein-Barr virus genome, and/or LMP -2 gene detection.

Item 85. The method according to Item 84, wherein the detection of the EB virus load comprises detection of the LMP-2 gene.

Item 86. The method according to any one of Items 52-85, wherein the method is used for screening nasopharyngeal carcinoma.

Item 86.1 The method according to any one of Items 52-86, wherein said method is used for the diagnosis of nasopharyngeal carcinoma.

Item 87. The method according to any one of Items 52-86.1, wherein the sample is a nasopharyngeal sample.

Item 88. The method according to any one of Item 52-87, characterized in that, before step (a), it also includes using a nasopharyngeal brush and/or a nasopharyngeal swab to obtain the sample; preferably, the Nasopharyngeal brushes and/or nasopharyngeal swabs are nasopharyngeal brushes and/or nasopharyngeal swabs that do not rely on the guidance of clinicians and nasopharyngoscopes.

Item 89. A method for treating nasopharyngeal carcinoma in an individual in need thereof, comprising providing the individual with drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus therapy, wherein a sample of the individual has received the The method described in any one of 52-88 was detected and judged to be positive for nasopharyngeal carcinoma.

Item 90. A method for treating nasopharyngeal carcinoma in an individual in need thereof, comprising 1) performing the detection according to the method according to any one of Items 52-88 on a sample from the individual; 2) if the detection result shows that the nasal If the pharyngeal cancer is positive, provide nasopharyngeal cancer treatment; preferably, the nasopharyngeal cancer treatment uses drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus treatment.

Item 91. Use of the kit according to any one of claims 1-51.1 in the preparation of products for nasopharyngeal cancer screening.

Item 92. Use of the kit according to any one of claims 1-51.1 in the preparation of products for the diagnosis of nasopharyngeal carcinoma.

In one aspect of the present invention, the technical problems existing in the prior art can be solved by the following technical requirements:

Claim item 1. A test kit for nasopharyngeal carcinoma detection, characterized in that the test kit comprises:

(i) nucleic acid methylation detection reagent, described nucleic acid methylation detection reagent can carry out methylation detection at methylation site in Epstein-Barr virus genome, and described methylation site comprises the equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) the 10717bp, 11029bp and 14015bp sites of the Epstein-Barr virus genome DNA sequence;

(ii) miRNA detection reagents, the miRNA detection reagents can detect the content of multiple miRNAs from Epstein-Barr virus, and the miRNAs include EBV-miR-BART1-5p and EBV-miR-BART7-3p; and

(iii) EB virus load detection reagent, said EB virus load detection reagent comprises a detection reagent for LMP-2 gene.

Claim 2. The kit as claimed in claim 1, wherein the miRNA comprises EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR-BART6-3p, EBV-miR- BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p.

Claim item 3. The test kit according to any one of claim items 1-2, characterized in that, the test kit comprises the sample preservation solution, and the sample preservation solution comprises EDTA, NaCl, dehydrated alcohol, citric acid Sodium, NP40, Glutathione, and Trisodium Phosphate, of which,

The content range of the EDTA is 0.7%-1.5% (w/w);

The content range of the NaCl is 0.01%-0.1% (w/w);

The concentration range of the absolute ethanol is 15%-35% (w/w);

The content range of the sodium citrate is 0.1%-1.0% (w/w);

The concentration range of the NP40 is 0.01%-0.1% (v/v);

The glutathione content ranges from 0.07% to 0.7% (w/w); and

The content range of the trisodium phosphate is 0.07%-0.4% (w/w),

The pH value of the sample preservation solution is 7.6-8.0.

Claim item 4. The kit as described in any one of claim items 1-3, characterized in that, the kit includes miRNA extraction reagents, and the miRNA extraction reagents include lysate, binding solution, rinse solution 1, and rinse Liquid 2.

Claim item 5. The test kit as claimed in claim item 4, wherein the lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA, wherein:

The content scope of described guanidinium thiocyanate is 28%-40% (w/w);

The content range of the citric acid is 1.8%-2.6% (w/w);

The content range of the Triton-100 is 0.8%-1.6% (w/w);

The content range of said EDTA is 0.5%-0.9% (w/w); and

The pH range of the lysate is 3.8-4.2,

The combination solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidine thiocyanate, sodium lauryl sarcosine, and isopropanol, wherein:

The content range of the magnesium chloride is 0.1%-0.4% (w/w);

The content range of the disodium edetate is 0.5%-1.0% (w/w);

The content scope of described sodium bicarbonate is 0.6%-1.0% (w/w);

The content range of the guanidine thiocyanate is 13%-16% (w/w);

The content range of the sodium lauryl sarcosinate is 1.0%-1.4% (w/w);

The content range of the isopropanol is 60%-80% (w/w); and

The pH range of the binding solution is 4.8-5.2,

The rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidine thiocyanate, and sodium lauryl sarcosine, wherein,

The content range of the disodium edetate is 0.4%-0.9% (w/w);

The content scope of described sodium bicarbonate is 0.5%-0.9% (w/w);

The content range of the guanidinium thiocyanate is 50%-55% (w/w);

The content range of the sodium sarcosyl is 0.8%-1.2% (w/w); and

The pH range of the rinse solution 1 is 6.2-6.6,

The rinse solution 2 comprises tris (Tris) and sodium chloride, wherein:

The content range of the tris (Tris) is 0.5%-0.7% (w/w);

The sodium chloride content ranges from 0.6% to 1.8% (w/w); and

The pH range of the rinse solution 2 is 6.6-7.0.

Claim 6. The kit according to any one of claims 1-5, wherein the kit also comprises a nasopharyngeal brush or a nasopharyngeal swab, and the nasopharyngeal brush and/or nasopharyngeal swab Nasopharyngeal brushes and/or nasopharyngeal swabs are clinician-independent and nasopharyngoscope-guided.

Claim 7. Use of the kit as described in any one of claims 1-6 in the preparation of products for nasopharyngeal carcinoma detection.

Requirement 8. A method for detecting Epstein-Barr virus-related nucleic acids in a sample, characterized in that the method comprises the following steps:

(a) placing the sample in a sample preservation solution;

(b) conduct the following tests:

(b-2) extracting Epstein-Barr virus-related miRNA from the sample preservation solution and detecting the content of the miRNA; and

(b-3) detecting the Epstein-Barr virus nucleic acid load on the sample preservation solution containing the sample,

Wherein, the methylation sites detected by the methylation include sites equivalent to 10717bp, 11029bp, and 14015bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94), and the miRNA includes EBV- miR-BART1-5p and EBV-miR-BART7-3p, the EB virus load detection reagent includes the detection of LMP-2 gene.

Claim 9. The method as claimed in claim 8, wherein the miRNA comprises EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR-BART6-3p, EBV-miR-BART7 -3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p.

Claim item 10. The method as described in any one of claim items 8-9, wherein the step of extracting the Epstein-Barr virus-related miRNA comprises:

ii) adding binding solution and nucleic acid adsorption material;

iv) removing the liquid portion, adding an eluent to the nucleic acid adsorption material, and eluting the miRNA from the nucleic acid adsorption material.

Claim 11. The method of claim 10, wherein:

The lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA, wherein:

The content scope of described guanidinium thiocyanate is 28%-40% (w/w);

The content range of the citric acid is 1.8%-2.6% (w/w);

The content range of the Triton-100 is 0.8%-1.6% (w/w);

The content range of said EDTA is 0.5%-0.9% (w/w); and

The pH range of the lysate is 3.8-4.2,

The content range of the magnesium chloride is 0.1%-0.4% (w/w);

The content range of the disodium edetate is 0.5%-1.0% (w/w);

The content scope of described sodium bicarbonate is 0.6%-1.0% (w/w);

The content range of the guanidine thiocyanate is 13%-16% (w/w);

The content range of the sodium lauryl sarcosinate is 1.0%-1.4% (w/w);

The content range of the isopropanol is 60%-80% (w/w); and

The pH range of the binding solution is 4.8-5.2,

The content range of the disodium edetate is 0.4%-0.9% (w/w);

The content scope of described sodium bicarbonate is 0.5%-0.9% (w/w);

The content range of the guanidinium thiocyanate is 50%-55% (w/w);

The content range of the sodium sarcosyl is 0.8%-1.2% (w/w); and

The pH range of the rinse solution 1 is 6.2-6.6,

The rinse solution 2 comprises tris (Tris) and sodium chloride, wherein:

The content range of the tris (Tris) is 0.5%-0.7% (w/w);

The sodium chloride content ranges from 0.6% to 1.8% (w/w); and

The pH range of the rinse solution 2 is 6.6-7.0.

Claim 12. The method according to claim 11, wherein ethanol is added to the rinse solution 1 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse solution 1:ethanol is 1:1 - 1:2; and, before contacting the nucleic acid adsorption material, adding ethanol to the rinse liquid 2, the volume ratio of the rinse liquid 2:ethanol is 1:1.6-1:3.

Claim item 13. The method according to any one of claim items 8-12, wherein the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and triphosphate Sodium, of which:

The content range of the EDTA is 0.7%-1.5% (w/w);

The content range of the NaCl is 0.01%-0.1% (w/w);

The concentration range of the absolute ethanol is 15%-35% (w/w);

The content range of the sodium citrate is 0.1%-1.0% (w/w);

The concentration range of the NP40 is 0.01%-0.1% (v/v);

The glutathione content ranges from 0.07% to 0.7% (w/w); and

The content range of the trisodium phosphate is 0.07%-0.4% (w/w),

The pH value of the sample preservation solution is 7.6-8.0.

Claim 14. The method according to any one of claims 8-13, characterized in that the method is used for the detection of nasopharyngeal carcinoma.

Claim item 15. The method according to any one of claim items 8-14, wherein the sample is a nasopharyngeal sample, and before step (a), it also includes using a nasopharyngeal brush and/or a nasopharyngeal swab Preferably, the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab independent of the guidance of a clinician and a nasopharyngoscope.

Claim 16. A method for treating nasopharyngeal carcinoma in an individual in need thereof, comprising providing the individual with drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus therapy, wherein the sample of the individual has received as The detection by the method described in any one of Claims 8-15 is judged to be positive for nasopharyngeal carcinoma.

Claim 17. A method for treating nasopharyngeal carcinoma in an individual in need, comprising 1) performing detection according to the method described in any one of Claims 8-15 on a sample from the individual; 2) the detection result If it is positive for nasopharyngeal carcinoma, treatment for nasopharyngeal carcinoma is provided; preferably, the treatment for nasopharyngeal carcinoma adopts drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus treatment.

Description of drawings

Figure 1 shows the detection of Epstein-Barr virus DNA load and Epstein-Barr virus DNA methylation in nasopharyngeal swab samples independent of clinicians and guided by nasopharyngoscope, where NPC is nasopharyngeal carcinoma (NPC) and MD is A Methylation difference (methylation difference, MD), EBV DNA load is EBV DNA load.

Figure 2 is the detection of Epstein-Barr virus DNA load and Epstein-Barr virus DNA methylation in nasopharyngeal swab samples guided by clinicians and nasopharyngoscopes.

Figure 3 is a side-by-side comparison of EBV DNA load and EBV DNA methylation detection in the same patient in dependent and independent clinician-guided and nasopharyngoscope-guided nasopharyngeal brush samples. Among them, brush refers to nasopharyngeal brushing samples that rely on clinicians and nasopharyngoscope guidance, and blind brush refers to nasopharyngeal brushing samples that do not rely on clinicians and nasopharyngoscope guidance.

Figure 4 is a parallel comparison of the DNA preservation effect of the self-prepared sample preservation solution, the commercial DNA preservation solution and the commercial RNA preservation solution.

Figure 5 is a parallel comparison of the DNA methylation preservation effects of the self-prepared sample preservation solution, the commercial DNA preservation solution and the commercial RNA preservation solution.

Figure 6 is a parallel comparison of self-made sample preservation solution, commercially available DNA preservation solution and commercial RNA preservation solution for the miRNA preservation effects.

Figure 7 is a parallel comparison of the extraction effects of self-prepared RNA extraction reagents and commercially available RNA extraction reagents on the miRNAs shown.

Figure 8 shows the detection results related to Epstein-Barr virus DNA.

Figure 9 is the detection structure related to DNA methylation of Epstein-Barr virus.

Figure 10 shows the detection results related to miRNA.

Detailed ways

The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, which are only used to explain the present invention, and are not intended to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

Example 1 A sampling method for nasopharyngeal swabbing that does not rely on clinicians and nasopharyngoscope guidance

Use a nasopharyngeal brush or nasopharyngeal swab, which is directly operated by a clinical nurse. The nasopharyngeal brush or nasopharyngeal swab directly enters the nasopharynx through the nasal cavity and rotates, brushes the sample and takes it back.

After sampling, use high-pressure sterilized scissors to cut off the head of the nasopharyngeal brush or nasopharyngeal swab, put it into a 1.5mL centrifuge tube filled with 500μL sterile PBS buffer, close the lid tightly and mix it upside down. Store in a negative 80-degree ultra-low temperature refrigerator for subsequent experiments.

Example 2 A sampling method that relies on clinicians and nasopharyngoscope-guided nasopharyngeal brushing samples

(1) Use 1% tetracaine and 0.5% ephedrine hydrochloride to soak sterile cotton swabs, insert one on each side into the nasal cavity of the subject, and last for about 3 to 3 minutes, until the nasopharynx of the subject is reached. The mucous membrane is topically anesthetized and the turbinates are contracted.

(2) Under the guidance of the electronic nasopharyngoscope, operated by a clinician or resident doctor, the nasopharyngeal brush enters the nasopharynx through the middle meatus with the nasopharyngoscope, rolls samples at suspicious parts of the nasopharynx, and then quickly retrieve.

(3) After sampling, use high-pressure sterilized scissors to cut off the brush head of the nasopharyngeal brush, put it into a 1.5mL centrifuge tube containing 500 μL of sterile PBS buffer, close the lid tightly and mix it upside down, and store in Store in a negative 80-degree ultra-low temperature refrigerator for subsequent experiments.

Example 3 Detection of Methylation of Epstein-Barr Virus DNA and Epstein-Barr Virus DNA Load in Nasopharyngeal Brushing Samples Not Dependent on Clinicians and Nasopharyngoscope Guidance

1. Experimental method

1. Sample source

A total of 162 subjects were recruited, including 78 patients with nasopharyngeal carcinoma and 84 relatively healthy people without nasopharyngeal carcinoma: all 78 patients with nasopharyngeal carcinoma were enrolled in the nasopharyngeal clinic of Sun Yat-sen University Cancer Center. Patients who were diagnosed with nasopharyngeal carcinoma by pathological biopsy; among the 84 relatively healthy people who did not suffer from nasopharyngeal carcinoma, 25 of them came to the nasopharyngeal clinic of Sun Yat-sen University Cancer Prevention and Control Center, and were diagnosed with nasopharyngeal carcinoma by pathological biopsy Patients with chronic inflammation, another 59 cases were from community health examiners in Sihui City, Guangdong Province.

2. Collection of nasopharyngeal swab samples

With embodiment 1.

3. Epstein-Barr virus DNA load detection

(1) Extraction of sample DNA

After the DNA extraction is pre-treated, it is extracted using an automated nucleic acid extractor. The process is as follows:

(a) The nasopharyngeal brush sample is first clamped with tweezers after autoclaving and rinsed back and forth in PBS solution for five times, and then scraped the brush with tweezers to scrape off the exfoliated cells that may remain on the brush .

(b) The sample solution after pretreatment was loaded into the automated extraction workstation to extract the total DNA, and the nucleic acid was extracted according to the standard magnetic bead extraction process using the Hamilton automated workstation (Chemagic Star, Hamilton Robotic).

①. Transfer the sample solution after pretreatment to the 96-well deep-well plate 1 provided with the kit, add 350 μl lysis buffer 1 to lyse the sample at room temperature for 20 minutes.

②. After lysis, add 50 μl of magnetic beads and 950 μl of binding buffer 2 to each sample well to fully bind the released nucleic acid to the magnetic beads.

③. Put the sample mixture on the special magnetic stand for the equipment, and use the top method from above the solution to make the magnetic beads adsorb to the magnetic rod cover. Use 3, 4, and 5 pairs of magnetic beads with 800 μl of elution buffer successively. Elution was performed followed by a final elution with 1.6 ml of elution buffer 6.

④. Add 150 μl of lysis buffer 7 to dissolve the DNA adsorbed on the magnetic beads, and then transfer to a 500 μL eppendorf tube for storage.

The concentration of DNA was quantified using the Nanodrop 1000 absorbance method (NanoDrop Technologies, Waltham, MA, USA). The DNA solution was stored at -20°C, and the RNA solution was stored at -80°C for subsequent use.

(2), detection of Epstein-Barr virus DNA load

The method of fluorescent quantitative PCR was used to quantitatively detect the Epstein-Barr virus DNA load in nasopharyngeal brush samples, and the detection primers and probes are shown in Table 1.

Table 1:

In this reaction system, the target gene amplified for the quantification of EBV DNA is the BamHI-W fragment of EB virus, which consists of 76 nucleotides. The forward and reverse primer sequences are: 5'-CCCAACACTCCACCACACC-3 ' (SEQ ID NO: 1), and 5'-TCTTAGGAGCTGTCCGAGGG-3' (SEQ ID NO: 2).

In addition, there are double-labeled hybridization probes in the system. The two ends of the probe carry FAM fluorescent group and TAMRA fluorescent quenching group respectively. The probe sequence is: 5'-FAM-CACACACTACACACACCCACCCGTCTC-TAMRA-3' (SEQ ID NO: 3 ). In order to strengthen the quality control of the sampling process, the fluorescent quantitative PCR system also includes primers and probes for the housekeeping gene β-globin gene. The sequences of the two primers are 5'-GTGCACCTGACTCCTGAGGAGA-3' (SEQ ID NO: 4); 5'-CCTTGATACCAACCTGCCCAG-3' (SEQ ID NO: 5), the amplified fragment is 102bp. The sequence of the probe for this gene is 5'-FAM-AAGGTGAACGTGGATGAAGTTGGTGG-TAMRA-3' (SEQ ID NO: 6). The two ends of the same probe have fluorescent groups and quenching groups respectively. The sequences of primers and probes are provided by life technology company synthesis.

The volume of each gene Q-PCR reaction system is 8 μL, including 4 μL of 2×mix solution, 1 μL of primers (including forward and reverse primers), 0.2 μL of probe, 0.8 μL of water and 2 μL of DNA template.

The Q-PCR reaction conditions are denaturation at 95°C for 5 minutes; 45 reaction cycles, each cycle condition is 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 15 seconds.

Standards for these two genes were obtained by plasmid construction, and 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ and 10 ⁷ copies/μL were used to obtain a standard curve for each gene. After the PCR reaction of the sample to be tested is completed, the expression levels of the EBVDNA and β-globin genes are calculated according to the standard curve, and the unit is copy/ng DNA.

4. Methylation detection of Epstein-Barr virus DNA

(1) DNA bisulfite detection

According to the kit instructions (ZYMO RESEARCH, CA, USA), the genomic DNA of 500ng samples was first treated with bisulfite and purified, and the modified DNA was converted as a template for q-PCR detection.

(2) EBV DNA methylation detection, aiming at five methylation sites of 11029bp, 45850bp, 57946bp, 66227bp and 128103bp on the EBV genomic DNA (the EBV genome is GenBank LOCUS is NC_007605), these sites are located in EBV C promoter region (11029bp), latent infection phase gene (57946bp), early lytic infection phase gene (45850bp), late lytic infection phase gene (66227bp and 128103bp) on the genome. For each site, design a pair of primers and a pair of fluorescent probes. One of the fluorescent probes is methylated for this site, and the 5' and 3' ends are labeled with FAM and BHQ1 respectively, named as probes 1 (Probe1), a fluorescent probe is not methylated at this site, and the 5' and 3' ends are labeled with HEX and BHQ1 respectively, named as probe 2 (Probe2). The sequences of primers and probes are shown in Table 2 . The primer and probe sequences for the five methylation sites are listed in Table 2.

Table 2:

(3) Q-PCR reaction system

20 μl reaction system, including 10 μL mix, 1.5 μL primer, 0.8 μL each of probe 1 and probe 2, 4.9 μL water, 2 μL DNA. The reaction conditions were 95 °C for 5 min, followed by 45 cycles with each cycle set to 95 °C for 15 s, 58 °C for 60 s, and 40 °C for 30 s.

(4) Calculate methylation difference

After q-PCR is completed, calculate the methylation difference (Methylation Difference, MD) of each site, and the formula for calculating the MD value is:

MD= _CTm - _CTu ,

CT _m is the Ct value after amplification with the amplification primers and methylated probes at this site, and CT _u is the Ct value after amplification with the amplification primers and unmethylated probes at this site.

The cut off value (COV), AUC, sensitivity, specificity, and Youden index of each site MD value and Epstein-Barr virus DNA load in the diagnosis of nasopharyngeal carcinoma were analyzed.

Among them, Youden index: also known as the correct index, is a method to evaluate the authenticity of screening tests, assuming that its false negative (missed diagnosis rate) and false positive (misdiagnosed rate) are equally harmful, it can be applied Youden index. Indicates the total ability of the screening method to detect true patients and non-patients. The larger the index, the better the effect of the screening experiment and the greater the accuracy.

Youden Index = Sensitivity + Specificity - 1.

2. Experimental results

The results are shown in Figure 1, indicating that both the Epstein-Barr virus DNA load and the MD value of each methylation site were significantly different in nasopharyngeal swabbing. The EB virus DNA load in the nasopharyngeal carcinoma group was significantly higher than that in the non-nasopharyngeal carcinoma control group; the MD value of each methylation site in the nasopharyngeal carcinoma group was significantly lower than that in the non-nasopharyngeal carcinoma control group (in nasopharyngeal carcinoma Significant methylation occurs at the site, CTm is smaller than CTu).

The sensitivity and specificity of each methylation site MD value and Epstein-Barr virus DNA load as diagnostic markers for nasopharyngeal carcinoma were further analyzed. The results are shown in Table 3, wherein the sensitivity of the MD value of the methylation site located at 11029bp of the Epstein-Barr virus genomic DNA in the diagnosis of nasopharyngeal carcinoma is 85.90%, the specificity is 97.60%, and the Youden index is 83.50%. The MD value of the methylation site located at 57946bp of Epstein-Barr virus genomic DNA has a sensitivity of 92.30%, a specificity of 78.60%, and a Youden index of 70.90% in the diagnosis of nasopharyngeal carcinoma; it is located at 128103bp of Epstein-Barr virus genomic DNA The sensitivity of the MD value of the methylation site in the diagnosis of nasopharyngeal carcinoma was 81.60%, the specificity was 79.80%, and the Youden index was 61.40%. The accuracy of the diagnosis of nasopharyngeal carcinoma is significantly better than that of Epstein-Barr virus DNA load (the sensitivity is 75.60%, the specificity is 85.70%, and the Youden index is 61.30%). In guided nasopharyngeal swabbing samples, the decrease in sampling precision resulted in a decrease in the Epstein-Barr virus load, resulting in low sensitivity and specificity for the diagnosis of nasopharyngeal carcinoma.

table 3:

NPC: nasopharyngeal carcinoma (NPC); Control: control; EB virus DNA load greater than the Cut off value is judged as nasopharyngeal carcinoma, EB virus DNA methylation site MD value less than the Cut off value is judged as nasopharyngeal carcinoma ;AUC(Area Under Curve): The area under the ROC curve and the coordinate axis.

Furthermore, each methylation site was used to construct a nasopharyngeal carcinoma diagnostic model, and the sensitivity and specificity of each model in the diagnosis of nasopharyngeal carcinoma were analyzed. The results are shown in Table 4.

Table 4:

bamHI is the Epstein-Barr virus DNA load, and its unit is copy/ng DNA; in each model, the judgment standard is that the model Pd score is greater than the cut off value, which is judged as nasopharyngeal carcinoma; AUC (Area Under Curve): the area under the ROC curve and the coordinate axis circumference into the area.

Among them, models 1 to 6 are nasopharyngeal carcinoma diagnostic models constructed only using the MD values calculated by Epstein-Barr virus DNA methylation. Sex is the best.

At the same time, models 7 to 13 were constructed by combining the EBV DNA load and the MD value of the EBV DNA methylation site. Except for model 12, the diagnostic accuracy is also better than using the EBV DNA load alone as a nasopharyngeal carcinoma. diagnostic markers. Among them, model 9 has the best accuracy.

Example 4 Prediction of Epstein-Barr Virus DNA Methylation and Epstein-Barr Virus DNA Load Detection in Nasopharyngeal Swipe Samples Independent of Clinicians and Nasopharyngoscope Guidance for Nasopharyngeal Carcinoma

1. Experimental method

1. Sample source

Among the recruited community physical examination personnel in Sihui City, Guangdong Province, 8 recruited subjects were different from the other 84 relatively healthy persons without nasopharyngeal carcinoma. These 8 persons were diagnosed with nasopharyngeal carcinoma at different times during follow-up. Pharyngeal cancer.

2. Collection of nasopharyngeal brush samples

All subjects collected nasopharyngeal samples according to the method of Example 1.

3. Epstein-Barr virus DNA load detection

With embodiment 3.

4. Epstein-Barr virus DNA methylation detection

With embodiment 3.

2. Experimental results

The results are shown in Table 5. According to the formulas of Model 2 and Model 9 constructed in Example 3, the Pd score of these 8 samples in Model 2 and Model 9 were calculated. Although these 8 patients were not found to have nasopharyngeal carcinoma at the time of sampling, they were successively diagnosed with nasopharyngeal carcinoma during follow-up visits in the following months. According to the Pd score of model 2, a total of 4 people from numbers 2 to 5 were judged as nasopharyngeal carcinoma; according to the Pd score of model 9, a total of 5 people from numbers 1 to 5 were judged to be nasopharyngeal carcinoma. At the same time, it was found that among the six people from No. 1 to No. 6, at least one of the five sites had an MD value exceeding the detection line and was judged to be nasopharyngeal carcinoma. The data suggested that the detection of Epstein-Barr virus DNA methylation had a positive effect on the occurrence of nasopharyngeal carcinoma. Good predictive power.

table 5:

Epstein-Barr virus DNA load, greater than Cut off value = 60.52 is judged as nasopharyngeal carcinoma; Epstein-Barr virus DNA methylation MD, 11029, 45850, 57946, 66227 and 128103 cut off values were -0.39, -0.04, -1.07, - 2.91 and -2.19, less than the Cut off value is judged as nasopharyngeal carcinoma;

Model 2 logit(Pd score)＝＝-1.94-1.04×11029MD-0.20×57946MD-0.23×66227MD, cut offvalue＝0.46, greater than it is judged as nasopharyngeal carcinoma;

Model 9 logit(Pd Score)＝-1.47+0.0018×bamHI-1.18×11029MD, cut off value＝0.22, greater than it is judged as nasopharyngeal carcinoma;

In bold, it was interpreted as positive for nasopharyngeal carcinoma.

Example 5 Relying on the detection of methylation of Epstein-Barr virus DNA and the load of Epstein-Barr virus DNA in nasopharyngeal swab samples guided by clinicians and nasopharyngoscope

1. Experimental method

1. Sample source

A total of 170 subjects were recruited, including 98 patients with nasopharyngeal carcinoma diagnosed by pathological biopsy, and 72 relatively healthy people without nasopharyngeal carcinoma (among them, 24 cases were diagnosed with nasopharyngeal mucositis by pathological biopsy, 48 cases were recruited for physical examination in the community of Sihui City, Guangdong Province)

2. Collection of nasopharyngeal brush samples

All subjects collected nasopharyngeal samples according to the method of Example 2, and 38 nasopharyngeal cancer patients also collected nasopharyngeal samples according to the method of Example 1.

5. Epstein-Barr virus DNA load detection

With embodiment 3.

6. Epstein-Barr virus DNA methylation detection

With embodiment 3.

2. Experimental results

The results are shown in Figure 2 and Table 6. For nasopharyngeal swab samples that rely on clinicians and nasopharyngoscope guidance, the Epstein-Barr virus DNA load and the MD value at 11029bp of Epstein-Barr virus DNA were applied to the sensitivity and sensitivity of nasopharyngeal carcinoma diagnosis. The specificity was comparable, and the MD values of the remaining methylated sites (ie, 45850bp, 57946bp, 66227bp, and 128103bp) had similar diagnostic accuracy.

Table 6:

Comparing the nasopharyngeal brush sampling samples of the same patient relying on and not relying on the guidance of clinicians and nasopharyngoscopes, the results are shown in Figure 3. Due to the lack of guidance of endoscopes, the sampling accuracy is reduced, and the results are not dependent on clinicians and nasopharyngoscopes. The Epstein-Barr virus DNA load in nasopharyngeal samples decreased significantly, with a median value of 275, ranging from 1 to 8744, while the median EBV DNA load in nasopharyngeal brush samples guided by clinicians and nasopharyngoscopes was 5144, Range 94 to 40095. Different from the Epstein-Barr virus DNA load, the median value of the Epstein-Barr virus DNA 11029 locus MD value was -2.79 in the nasopharyngeal brush sampling samples guided by clinicians and nasopharyngoscopes, ranging from -4.53 to -1.13, In contrast, the median value was -2.77 in the clinician-guided and nasopharyngoscope-guided nasopharyngeal brush sampling samples, and the range was -4.77 to 0, with no significant change between the two groups.

Example 6 Nasopharyngeal sample preservation solution capable of simultaneously preserving DNA and RNA

6.1 Experimental design:

A comparison of two groups of preservation solutions was set up, namely self-preparation and a commercially available DNA preservation solution, and self-preparation and a commercially available RNA preservation solution. Each group selected 6 patients with nasopharyngeal carcinoma, with one swab on the left and right. Place them in self-prepared and commercially available preservation solutions, and then use Tiangen DNA extraction reagent to extract DNA, Qiagen RNA extraction reagent to extract RNA, DNA/RNA is used for the detection of downstream targets, the targets include BamHI-W, LMP -2, C4, W2, miR-BART1-5p, miR-BART7-3p.

6.2 Experimental materials and methods:

6.2.1 The formulation of the self-made preservation solution is shown in Table 7.

Table 7:

试剂组分名称Reagent component name	配方含量Formula content
去离子水Deionized water	100mL100mL
EDTA-2NaEDTA-2Na	1.5g1.5g
NaClNaCl	0.05g0.05g

无水乙醇Absolute ethanol	50mL50mL
柠檬酸钠Sodium citrate	0.3g0.3g
NP40NP40	50μL50μL
青霉素-链霉素双抗溶液Penicillin-Streptomycin Double Antibody Solution	100x，加1mL100x, add 1mL
谷胱甘肽Glutathione	0.3g谷胱甘肽0.3g glutathione
磷酸三钠trisodium phosphate	0.2g磷酸三钠0.2g trisodium phosphate
pHpH	7.87.8

6.2.2 Commercially available preservation solution

Two commercially available preservation solutions were selected, one of which was swab DNA storage solution at room temperature, the manufacturer was Sangon, product number: B641913, and the other was RNA storage solution RNAstore, the manufacturer was Kangwei Century, product number: CW0592.

6.2.3 Extraction of sample DNA

The DNA was extracted using the Magnetic Beads Method Universal Genomic DNA Extraction Kit, manufactured by Tiangen Biochemical Technology (Beijing) Co., Ltd., article number: DP705, and extracted using Tianlong NP968 Automatic Nucleic Acid Extractor (Xi’an Tianlong Technology Co., Ltd.). The process is as follows:

1. Take out 200 μL of sample solution to a 1.5ml centrifuge tube for experimentation, add 100 μL of digestion solution GHA and 20 μL of Proteinase K, and vortex for 10 sec to mix.

2. Put it in a metal bath, place it at 75°C for 15 minutes, and mix it upside down 3 times during the period, 3-5 times each time.

3. Transfer the above solution to column 1 of the matching 96-well deep-well plate, add 300 μL of lysate GHL, 300 μL of isopropanol, and 15 μL of magnetic bead suspension GH, and place it on the special magnetic stand for the equipment. Attach the magnetic beads to the magnetic rod cover from above the solution.

4. The magnetic beads were eluted with 900 μL buffer GDZ, and then eluted once with 500 μL buffer GDZ.

5. Use 900 μL of washing solution PWD to elute the magnetic beads, and then use 300 μL of washing solution PWD to elute once.

6. Add 80 μL DEPC water to dissolve the DNA adsorbed on the magnetic beads, then transfer to EP tubes and store at -20°C.

6.2.4 Extraction of sample RNA

RNA was extracted using commercially available extraction reagent miRNeasy Tissue/Cells Advanced Kits, the manufacturer is Qiagen, product number: 217684, and the extraction steps are as follows:

1. Add 260 μL of Buffer RLT to the 200 μL sample solution, and vortex for one minute.

2. Add 80 μL of Buffer AL, stir well, and incubate at room temperature for 3 minutes.

3. Transfer the lysate to a gDNA depletion spin column and place it in a collection tube. Centrifuge at ≥8000x g (≥10,000rpm) for 30 seconds. Discard the spin column, leaving the centrifuged liquid.

4. Add 1 volume of isopropanol and mix by pipetting.

5. Transfer 700μL of the sample to the RNeasy Mini spin column and place in a 2mL collection tube. Close the lid and centrifuge at ≥8000x g for 15 seconds.

6. Add 700μL Buffer RWT to the RNeasy Mini spin column. Close the lid, centrifuge at ≥8000x g for 15 seconds, and discard the waste.

7. Add 500μL Buffer RPE to the RNeasy Mini spin column. Close the lid, centrifuge at ≥8000x g for 15 seconds, and discard the waste.

8. Add 500 μL of 80% ethanol to the RNeasy Mini spin column. Close the lid, centrifuge at ≥8000xg for 15 seconds, discard the waste liquid and collection tube.

9. Place the RNeasy Mini spin column into a new 2mL collection tube. Centrifuge at full speed for 1 min with the lid closed to dry the membrane and discard the waste and collection tube.

10. Place the RNeasy Mini spin column into a new 1.5mL collection tube. Add 50 μL of RNase-free water and incubate for 1 min. Cover and centrifuge at full speed for 1 min to elute RNA.

6.3 Target related information

6.3.1 Qualitative detection of Epstein-Barr virus DNA

The method of fluorescent quantitative PCR was used to qualitatively detect the Epstein-Barr virus DNA in the nasopharyngeal brush sample, and the detection primers and probes are shown in Table 8.

Table 8:

Note: LMP-2 primers are from Lao, T.D., Nguyen, T.A.H., Ngo, K.D., et al. Molecular Screening of Nasopharyngeal Carcinoma: Detection of LMP-1, LMP-2 Gene Expression in Vietnamese Nasopharyngeal Swab Samples.2019, Asian Pac J Cancer Prev, 20(9): 2757-2761.

The qPCR reaction system is shown in Table 10 and Table 11:

Vazyme (Novazyme Taq Pro HS Universal U+Probe Master Mix, Item No. QN114)

Table 10:

Table 11:

6.3.2 Methylation detection of Epstein-Barr virus DNA

(1) DNA bisulfite detection

According to the kit instructions (ZYMO RESEARCH, CA, USA), the genomic DNA of the 5 μL sample was first treated and purified with bisulfite, and 22 μL was eluted to obtain the converted modified DNA as a template for q-PCR detection.

(2) The method of fluorescent quantitative PCR was used to qualitatively detect the methylation status of EBV DNA, and the detection primers and probes were shown in Table 12. The methylation sites were respectively located in the C promoter region and the w promoter region of the EBV genome.

Table 12:

The reaction system of qPCR is shown in Table 13 and Table 14:

Table 13:

Table 14:

名称name	终浓度Final concentration	体积(μL)Volume (μL)
Platinum ^TM Taq DNA Polymerase Platinum ^TM Taq DNA Polymerase	2.5U/rxn2.5U/rxn	0.100.10
10X PCR Buffer 10X PCR Buffer	1×1×	2.002.00
50mM MgCl250mM MgCl2	1.5mM1.5mM	0.600.60
10mM dNTP10mM dNTPs	0.2mM each0.2mM each	0.400.40
ROXROX	50×50×	0.400.40
Forward primerForward primer	300nM300nM	0.600.60
Reverse primerReverse primer	300nM300nM	0.600.60
ProbeProbe	150nM150nM	0.300.30
细胞系DNAcell line DNA	the	2.002.00
WaterWater	the	xx
TotalTotal	//	2020

The qPCR reaction conditions are shown in Table 15:

Table 15:

6.3.3 Detection of EB virus miRNA:

The nucleotide sequence of the EBV-encoded microRNA involved in this study:

EBV-miR-BART1-5p: UCUUAGUGGAAGUGACGUGCUGUG (SEQ ID NO: 39)

EBV-miR-BART7-3p: CAUCAUAGUCCAGUGUCCAGGG (SEQ ID NO: 42)

The primers and probes used are listed in Table 16.

Table 16:

Reverse transcription reaction system:

The reverse transcription kit uses TaqMan ^™ MicroRNA Reverse Transcription Kit (Applied Biosystems), catalog number: 4366596.

(1) Thaw the components in the Taqman MicroRNA Reverse Transcription Kit on ice and vortex to mix.

(2) Prepare an RNase-free centrifuge tube, refer to the table below, and prepare the reverse transcription master mix on ice.

(3) Melt the reverse transcription primer and RNA template on ice, and vortex to mix.

(4) Add RNA (5 μL), 7 μL reverse transcription master mix, and 3 μL reverse transcription primer to 15 μl reverse transcription system, vortex to mix, and centrifuge. The reaction system is shown in Table 17.

(5) Place the reaction tube on ice for 5 minutes, and then perform the reverse transcription experiment; see Table 18 for the reaction conditions.

Table 17:

ComponentComponent	Volume(μL)Volume(μL)
RNase-free waterRNase-free water	4.164.16
100mM dNTPs(with dTTP)100mM dNTPs(with dTTP)	0.150.15
10×RT Buffer10×RT Buffer	1.501.50
RNase Inhibitor 20U/μLRNase Inhibitor 20U/μL	0.190.19
Multiscribe ^TM Reverse Transcriptase 50U/μL Multiscribe ^™ Reverse Transcriptase 50U/μL	1.001.00
RT primer(终浓度25nM)RT primer (final concentration 25nM)	3.003.00
RNARNA	5.005.00
Total volumeTotal volume	15.0015.00

Table 18:

Reverse transcription reaction conditions:

温度temperature	时间time	循环数number of cycles
16℃16°C		30min30min	11
42℃42°C		30min30min	11
85℃85°C		5min5min	11

qPCR reaction system:

qPCR was performed using TaqMan ^™ Fast Advanced Master Mix (Applied Biosystems), catalog number: 4444557.

(1) Thaw the components used in the reaction on ice, mix well and place on ice for later use.

(2) Calculate the required reagent volume according to the 20 μL reaction system (Table 19). Add each component to a centrifuge tube, vortex to mix, and centrifuge.

Table 19:

TaqMan ^TM Fast Advanced Master Mix TaqMan ^™ Fast Advanced Master Mix	10.00μL10.00 μL
cDNAcDNA	1.00μL1.00 μL
Primer F(终浓度300nM)Primer F (final concentration 300nM)	0.60μL0.60 μL
Primer R(终浓度300nM)Primer R (final concentration 300nM)	0.60μL0.60μL
探针(终浓度200nM)Probe (final concentration 200nM)	0.40μL0.40 μL
RNase-free waterRNase-free water	xμLxμL
Total volumeTotal volume	20.00μL20.00μL

(3) Add 20 μl of reaction solution to each reaction well.

(4) Seal the film of the reaction plate or cover the cap of the eight-tube tube tightly, and centrifuge to avoid the generation of air bubbles.

(5) Run the quantitative PCR reaction program, and set the reaction program as shown in Table 20:

Table 20:

6.4 qPCR test results:

6.4.1 The results of DNAload detection are shown in Figure 4.

6.4.2 The results of methylation detection are shown in Figure 5.

6.4.3 miRNA detection results are shown in Figure 6.

These results show that the comprehensive preservation performance of the self-made preservation solution for DNA, DNA methylation, and miRNA is better than that of the commercial DNA preservation solution and the commercial RNA preservation solution.

Example 7 Reagents and methods for miRNA extraction

7.1 Experimental design:

Select 6 patients with nasopharyngeal carcinoma, collect swabs and put them in the preservation solution, use the self-prepared RNA extraction reagent to extract the RNA in the preservation solution, and purchase a commercially available RNA extraction reagent for comparison, use Nanodrop and Qubit after the extraction is completed The concentrations of total RNA and miRNA were measured separately, and the extraction effect of miRNA was evaluated in combination with downstream miRNA target detection.

7.2 Experimental materials and methods:

7.2.1 The formulas of self-prepared extraction reagents are shown in Table 21 to Table 24:

Table 21:

Table 22:

Table 23:

Table 24:

Magnetic beads: Nanjing Ruibeixi Biotechnology Co., Ltd., product number: NB0207.

7.2.2 RNA extraction

4. Add 1 volume of isopropanol and mix by pipetting.

Use the self-prepared extraction reagent to extract sample RNA, load it into the automatic nucleic acid extraction instrument Tianlong NP968 (Xi'an Tianlong Technology Co., Ltd.) for extraction, the operation steps are as follows:

1 Pipette 200uL swab sample solution into a 1.5mL centrifuge tube.

2 Add an equal amount of lysate (ie 200 uL), shake and mix for 25-30 s, add 20 μL proteinase K, and let stand at room temperature for 10 min. Add 600uL of binding buffer and 20uL of magnetic beads, vortex and mix well, so that the nucleic acid released after cleavage is fully bound to the magnetic beads.

3. Add the mixed solution into the first column of the 96-well deep-well plate, and place it on the special magnetic frame for the equipment. The magnetic rod is from above the solution to make the magnetic beads adsorb to the magnetic rod cover.

4. Use 700uL rinse liquid 1/ethanol mixed solution (wash liquid 1/absolute ethanol volume ratio 1:1.5) to elute the magnetic beads, and then use 700uL rinse liquid 2/ethanol mixed solution (rinse liquid 2/absolute ethanol volume ratio ratio 2:2.3) eluted twice.

5 Add 50 μL DEPC water to dissolve the RNA adsorbed on the magnetic beads, then transfer to EP tubes and store at -80°C.

7.2.3 Qubit detection

1. Configure Qubit working solution, dilute Qubit microRNA reagent in Qubit microRNA buffer at a ratio of 1:200.

2. Prepare the Qubit standard reaction solution, and put 190 μL of the Qubit working solution into a thin-walled light-transmitting 0.5mL PCR tube.

3. Add 10 μL each of

Qubit microRNA standard

1 and 2 to the reaction solution prepared in the previous step, and vortex for 2-3 seconds to make the final volume 200 μL. Be careful not to generate air bubbles.

4. Prepare the Qubit sample reaction solution, and put 198 μL of the Qubit working solution into a thin-walled light-transmitting 0.5mL PCR tube.

5. Add 2 μL of sample RNA to the reaction solution prepared in the previous step, and vortex for 2-3 seconds to make the final volume 200 μL.

6. All the above samples were placed at room temperature for 2 minutes.

7. On the main interface of the Qubit 3.0 Fluorometer, insert the EP tube containing the No. 1 standard into the sample chamber and close the lid. When the read is complete, remove criterion 1.

8. Insert the test tube containing standard 2 into the sample chamber, when the reading is complete, remove standard 2.

9. On the Assay screen, select the sample volume and units, ie 2 μL. Insert the EP tube into the sample chamber, close the lid, and take out the sample tube after the reading is completed. The instrument displays the results on the assay screen.

7.3 Target information and detection results

7.3.1 The nucleotide sequence of EBV-encoded microRNA involved in this study:

EBV-miR-BART1-5p: UCUUAGUGGAAGUGACGUGCUGUG (SEQ ID NO: 39)

EBV-miR-BART7-3p: CAUCAUAGUCCAGUGUCCAGGG (SEQ ID NO: 42)

The primers and probes involved are shown in Table 25.

Table 25:

7.3.2 Qubit detection results (detection of miRNA content) are shown in Table 26.

Table 26:

样本编号sample number	市售RNA提取试剂(ng/μL)Commercially available RNA extraction reagent (ng/μL)	自配RNA提取试剂(ng/μL)Self-prepared RNA extraction reagent (ng/μL)
11	4.14.1	28.628.6
22	1.061.06	2.372.37
33	0.6490.649	2.032.03
44	0.5180.518	1.981.98
55	6.246.24	17.917.9
66	0.8410.841	3.043.04

7.3.3 Nanodrop detection results (detection of Total RNA content) are shown in Table 27.

Table 27:

样本编号sample number	市售RNA提取试剂(ng/μL)Commercially available RNA extraction reagent (ng/μL)	自配RNA提取试剂(ng/μL)Self-prepared RNA extraction reagent (ng/μL)
11	1818	32.832.8
22	6.16.1	11.511.5
33	3.13.1	11.211.2
44	2.92.9	12.412.4
55	19.219.2	23.923.9
66	4.64.6	11.611.6

7.3.4 qPCR test results are shown in Figure 7.

These experimental results show that the extraction effect of the self-prepared extraction reagent formula used in this example on RNA, including miRNA, is significantly better than that of commercially available reagents.

Example 8 Detection of nasopharyngeal carcinoma based on miRNA as a supplementary biomarker

8.1 Sample source:

A total of 184 samples were collected, including 88 patients with nasopharyngeal carcinoma and 96 persons without nasopharyngeal carcinoma. All 88 patients with nasopharyngeal carcinoma were diagnosed with nasopharyngeal carcinoma by pathological biopsy; among the 96 patients without nasopharyngeal carcinoma, 25 patients were patients with other nasopharyngeal diseases, and the remaining 71 patients were healthy people.

8.2 Target information:

Detection of EBV miRNA

The nucleotide sequence of the EBV-encoded microRNA involved in this study:

EBV-miR-BART1-5p: UCUUAGUGGAAGUGACGUGCUGUG (SEQ ID NO: 39)

EBV-miR-BART2-5p: UAUUUUCUGCAUUCGCCCUUGC (SEQ ID NO: 40)

EBV-miR-BART6-3p: CGGGGAUCGGACUAGCCUUAGA (SEQ ID NO: 41)

EBV-miR-BART7-3p: CAUCAUAGUCCAGUGUCCAGGG (SEQ ID NO: 42)

EBV-miR-BART13-3p: UGUAACUUGCCAGGGACGGCUGA (SEQ ID NO: 43)

EBV-miR-BART17-5p: UAAGAGGACGCAGGCAUACAAG (SEQ ID NO: 44)

The miRNA primer probe sequences are shown in Table 28.

Table 28:

DNA load primer probes are shown in Table 29.

Table 29:

Source of LMP-2 primers: Lao, T.D., Nguyen, T.A.H., Ngo, K.D., et al. Molecular Screening of Nasopharyngeal Carcinoma: Detection of LMP-1, LMP-2 Gene Expression in Vietnamese Nasopharyngeal Swab Samples.2019, Asian Pac J Cancer Prev, 20(9): 2757-2761.

The primer probes for the methylation detection of Epstein-Barr virus DNA are shown in Table 30. The methylation sites were located in the C promoter region and the W promoter region of the EBV genome, respectively.

Table 30:

C1 upstream and downstream primer sequences are from Zheng Xiaohui's doctoral thesis: Zheng Xiaohui. 2020. Xinjiang Medical University. The application of detection of nucleic acid markers of Epstein-Barr virus in nasopharynx in the molecular diagnosis of nasopharyngeal carcinoma.

The C10 probe is derived from the probe of this patent 11029.

8.3 Experimental results

The results are shown in Figure 8-Figure 10, whether it is the Epstein-Barr virus DNA load, or each methylation site and miRNA in nasopharyngeal brushing examination, there are significant differences. The expression levels of each site in the nasopharyngeal carcinoma group were significantly higher than those in the non-nasopharyngeal carcinoma control group.

The nasopharyngeal carcinoma diagnosis model 1 was constructed by combining the Epstein-Barr virus DNA load and each methylation site, and the sensitivity and specificity of the model for nasopharyngeal carcinoma diagnosis were analyzed, in which A1 is BamHI-W, A2 is LMP-2, B1 is methylated C1, B2 is methylated C4, B3 is methylated W1, B4 is methylated C10, and B5 is methylated W2. The results are shown in Table 31. The model includes sites A2, B2, B3 and B4, with a sensitivity of 92.6%, a specificity of 93.1%, and a Youden index of 0.857.

Combined with Epstein-Barr virus DNA load, methylation sites and miRNA to construct a nasopharyngeal carcinoma diagnostic model 2-9, in which E1 is miR-BART1-5p, E2 is miR-BART17-5p, E3 is miR-BART6-3p, E4 is miR-BART7-3p, E5 is miR-BART2-5p, and E6 is miR-BART13-3p. After adding E1 and E4-6 separately on the basis of model 1, the performance of the model has been improved to varying degrees. Add E1 and E4 at the same time, the sensitivity is 96.3%, the specificity is 100.0%, and the Youden index is 0.963. After adding all 6 miRNAs, the sensitivity is 100.0%, the specificity is 96.6%, and the Youden index is 0.966 .

Table 31:

Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the scope of the present invention. For those of ordinary skill in the art, on the basis of the above descriptions and ideas, they can also make There is no need to and cannot exhaustively list all the implementation manners for other changes or changes in different forms. All modifications, equivalent replacements and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the claims of the present invention.

Claims

A kit for detecting Epstein-Barr virus, characterized in that the kit includes one or more reagents selected from nucleic acid methylation detection reagents, miRNA detection reagents, miRNA extraction reagents, and/or sample preservation solutions.
The kit according to claim 1, wherein the kit comprises a nucleic acid methylation detection reagent, and the nucleic acid methylation detection reagent can detect methylation at a methylation site in the Epstein-Barr virus genome .
The kit according to claim 2, wherein the methylation site in the Epstein-Barr virus genome comprises one or more of the following sites: EB equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) Sites of 10717bp, 11029bp, 14015bp, 14566bp, 45850bp, 57946bp, 66227bp and 128103bp of the viral genome DNA sequence.
The kit according to any one of claims 2-3, wherein the methylation site in the Epstein-Barr virus genome comprises the Epstein-Barr virus genome equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) The 10717bp, 11029bp, and 14015bp positions of the DNA sequence.
The kit according to any one of claims 2-4, wherein the methylation site in the Epstein-Barr virus genome comprises one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO : 94) the sites of 11029bp, 45850bp, 57946bp, 66227bp and 128103bp of the Epstein-Barr virus genome DNA sequence.
The kit according to any one of claims 2-5, wherein the methylation site in the Epstein-Barr virus genome comprises one or more of the following sites: equivalent to GenBank LOCUS NC_007605 (SEQ ID NO : 11029bp, 57946bp, and 66227bp of the Epstein-Barr virus genome DNA sequence of 94).
The kit according to any one of claims 2-6, wherein the methylation site in the Epstein-Barr virus genome comprises a part of the Epstein-Barr virus genome DNA sequence equivalent to GenBank LOCUS NC_007605 (SEQ ID NO: 94) 11029bp site.
The kit according to any one of claims 1-7, characterized in that the kit contains the miRNA detection reagent, and the miRNA detection reagent can detect the content of one or more miRNAs from Epstein-Barr virus.
The kit according to claim 8, wherein the miRNA comprises one or more of the following miRNAs: EBV-miR-BART1-5p, EBV-miR-BART2-5p, EBV-miR-BART6-3p, EBV-miR-BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p; preferably comprising all six of said miRNAs.
The kit according to claim 9, wherein the miRNA comprises EBV-miR-BART1-5p and EBV-miR-BART7-3p.
The kit according to any one of claims 9-10, wherein the miRNA comprises EBV-miR-BART1-5p.
The kit according to any one of claims 9-11, wherein the miRNA comprises EBV-miR-BART2-5p.
The kit according to any one of claims 9-12, wherein the miRNA comprises EBV-miR-BART6-3p.
The kit according to any one of claims 9-13, wherein the miRNA comprises EBV-miR-BART7-3p.
The kit according to any one of claims 9-14, wherein the miRNA comprises EBV-miR-BART13-3p.
The kit according to any one of claims 9-15, wherein the miRNA comprises EBV-miR-BART17-5p.
The kit according to any one of claims 1-16, wherein the kit includes the sample preservation solution, and the sample preservation solution comprises selected from EDTA, NaCl, absolute ethanol, sodium citrate, One or more components of NP40, glutathione, and/or trisodium phosphate.
The kit according to claim 17, wherein the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.
A kit for preserving a nucleic acid-containing biological sample, characterized in that it comprises a sample preservation solution comprising EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate .
The kit according to any one of claims 17-19, wherein in the sample preservation solution:

The content range of the EDTA is 0.7%-1.5% (w/w);

The content range of the NaCl is 0.01%-0.1% (w/w);

The concentration range of the absolute ethanol is 15%-35% (w/w);

The content range of the sodium citrate is 0.1%-1.0% (w/w);

The concentration range of the NP40 is 0.01%-0.1% (v/v);

The glutathione content ranges from 0.07% to 0.7% (w/w); and/or

The content range of the trisodium phosphate is 0.07%-0.4% (w/w).
The kit according to any one of claims 17-20, wherein in the sample preservation solution:

The content of said EDTA is about 1.05% (w/w);

The content of said NaCl is about 0.035% (w/w);

The concentration of absolute ethanol is about 27.6% (w/w);

The content of the sodium citrate is about 0.21% (w/w);

The concentration of said NP40 is about 0.035% (v/v);

The glutathione content is about 0.21% (w/w); and/or

The content of the trisodium phosphate is about 0.14% (w/w).
The kit according to one of claims 17-21, wherein the sample preservation solution contains antibiotics; preferably, the antibiotics contain penicillin-streptomycin double antibody.
The kit according to any one of claims 17-22, wherein the pH value of the sample preservation solution is 7.6-8.0; preferably, the pH value of the sample preservation solution is 7.8.
The kit according to any one of claims 17-23, characterized in that, compared with the control sample preservation solution, the sample preservation solution has a better preservation effect on DNA, miRNA, and/or DNA methylation.
The kit according to claim 24, wherein the DNA is derived from Epstein-Barr virus, the miRNA is derived from Epstein-Barr virus, and/or the DNA methylation is methylation of Epstein-Barr virus DNA.
The kit according to any one of claims 1-25, wherein the kit comprises the miRNA extraction reagent, and the miRNA extraction reagent comprises a lysate, a binding solution, a rinse solution 1, and/or a rinse Liquid 2.
A kit comprising a miRNA extraction reagent, characterized in that the miRNA extraction reagent comprises a lysate, a binding solution, a washing solution 1, and/or a washing solution 2.
The kit according to claim 26 or 27, wherein the miRNA extraction reagent comprises the lysate, and the lysate comprises guanidinium thiocyanate, citric acid, Triton-100, and/or or one or more components of EDTA.
The kit according to claim 26 or 27, wherein the miRNA extraction reagent comprises the lysate, and the lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA.
The kit according to any one of claims 26-29, wherein in the lysate:

The content scope of described guanidinium thiocyanate is 28%-40% (w/w);

The content range of the citric acid is 1.8%-2.6% (w/w);

The content range of the Triton-100 is 0.8%-1.6% (w/w);

The content range of the EDTA is 0.5%-0.9% (w/w); and/or

The pH range of the lysate is 3.8-4.2.
The kit according to any one of claims 26-30, wherein in the lysate:

The content of the guanidinium thiocyanate is about 32% (w/w);

The content of said citric acid is about 2.2% (w/w);

The content of the Triton-100 is about 1.1% (w/w);

The content of said EDTA is about 0.7% (w/w); and/or

The pH of the lysate is about 4.0.
The kit according to any one of claims 26-31, wherein the miRNA extraction reagent comprises the binding solution, and the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate , guanidinium thiocyanate, sodium lauryl sarcosinate, and/or one or more components of isopropanol.
The kit according to any one of claims 26-32, wherein the miRNA extraction reagent comprises the binding solution, and the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, sulfur Guanidine Cyanate, Sodium Lauryl Sarcosinate, and Isopropanol.
The kit according to any one of claims 26-33, wherein in the binding solution:

The content range of the magnesium chloride is 0.1%-0.4% (w/w);

The content range of the disodium edetate is 0.5%-1.0% (w/w);

The content scope of described sodium bicarbonate is 0.6%-1.0% (w/w);

The content range of the guanidine thiocyanate is 13%-16% (w/w);

The content range of the sodium lauryl sarcosinate is 1.0%-1.4% (w/w);

The content range of the isopropanol is 60%-80% (w/w); and/or

The pH range of the binding solution is 4.8-5.2.
The kit according to any one of claims 26-34, wherein in the binding solution:

The content of said magnesium chloride is about 0.24% (w/w);

The content of disodium edetate is about 0.71% (w/w);

The content of the sodium bicarbonate is about 0.83% (w/w);

The content of guanidine thiocyanate is about 14.9% (w/w);

The content of sodium sarcosyl is about 1.2% (w/w);

The content of said isopropanol is about 70% (w/w); and/or

The pH of the binding solution is about 5.0.
The kit according to any one of claims 26-35, wherein the miRNA extraction reagent comprises the rinse solution 1, and the rinse solution 1 comprises disodium edetate, sodium bicarbonate , guanidinium thiocyanate, and/or one or more components of sodium lauryl sarcosinate.
The kit according to any one of claims 26-36, wherein the miRNA extraction reagent comprises the rinse solution 1, and the rinse solution 1 comprises disodium edetate, sodium bicarbonate, sulfur Guanidine Cyanate, and Sodium Lauryl Sarcosinate.
The kit according to any one of claims 26-37, wherein in the rinse solution 1:

The content range of the disodium edetate is 0.4%-0.9% (w/w);

The content scope of described sodium bicarbonate is 0.5%-0.9% (w/w);

The content range of the guanidinium thiocyanate is 50%-55% (w/w);

The content range of the sodium lauryl sarcosyl is 0.8%-1.2% (w/w); and/or

The pH range of the rinse solution 1 is 6.2-6.6.
The kit according to any one of claims 26-38, wherein in the rinse solution 1:

The content of disodium edetate is about 0.5% (w/w);

The content of the sodium bicarbonate is about 0.6% (w/w);

The content of the guanidinium thiocyanate is about 53% (w/w);

The content of sodium sarcosyl is about 0.9% (w/w); and/or

The pH of the Rinse 1 was about 6.4.
The kit according to any one of claims 26-39, wherein the miRNA extraction reagent comprises the rinsing solution 2, and the rinsing solution 2 comprises Tris (Tris) or sodium chloride .
The kit according to any one of claims 26-40, wherein the miRNA extraction reagent comprises the rinsing solution 2, and the rinsing solution 2 comprises tris (Tris) and sodium chloride .
The kit according to any one of claims 26-41, wherein in the rinse solution 2:

The content range of the tris (Tris) is 0.5%-0.7% (w/w);

The content range of the sodium chloride is 0.6%-1.8% (w/w); and/or

The pH range of the rinse solution 2 is 6.6-7.0.
The kit according to any one of claims 26-42, wherein in the rinse solution 2:

The content of tris (Tris) is about 0.6% (w/w);

The sodium chloride content is about 1.2% (w/w); and/or

The pH value of the rinse solution 2 is about 6.8.
The kit according to any one of claims 26-43, wherein the miRNA extraction reagent comprises magnetic beads that adsorb RNA.
The test kit according to claim 44, wherein the magnetic core of the magnetic beads is ferric hydroxide, coated with silicon dioxide, and the surface is embedded with hydroxyl groups.
The kit according to claim 44 or 45, wherein the magnetic beads have a particle diameter of 50-100 nm.
The kit according to any one of claims 26-46, wherein the kit further comprises a nasopharyngeal brush or a nasopharyngeal swab.
The kit according to claim 47, wherein the nasopharyngeal brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab independent of the guidance of a clinician and a nasopharyngoscope.
The kit according to any one of claims 1-48, wherein the kit also comprises an EB virus load detection reagent; preferably, the EB virus load detection reagent contains -W fragment, and/or detection reagent of LMP-2 gene.
The kit according to claim 49, wherein the EB virus load detection reagent comprises a detection reagent for the LMP-2 gene.
The kit according to any one of claims 1-50, wherein the kit is a screening and/or diagnostic kit for nasopharyngeal carcinoma.
A method for detecting Epstein-Barr virus-related nucleic acids in a sample, characterized in that the method comprises the following steps:

(a) placing the sample in a sample preservation solution;

(b) Conduct one or more tests selected from the following:

(b-1) performing Epstein-Barr virus genomic nucleic acid methylation detection on the sample preservation solution containing the sample;

(b-2) extract Epstein-Barr virus-related miRNA from the sample preservation solution and detect the content of the miRNA; and/or

(b-3) Detection of Epstein-Barr virus nucleic acid load on the sample preservation solution containing the sample.
The method according to claim 52, characterized in that, step (b-1) is included, and the methylation site detected by the Epstein-Barr virus genome nucleic acid methylation comprises one or more of the following sites: equivalent Sites at 10717bp, 11029bp, 14015bp, 14566bp, 45850bp, 57946bp, 66227bp and 128103bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).
The method according to claim 53, wherein the methylation site comprises sites corresponding to 10717bp, 11029bp, and 14015bp of the Epstein-Barr virus genomic DNA sequence of GenBank LOCUS NC_007605 (SEQ ID NO: 94).
The method according to any one of claims 52-54, characterized in that, comprising step (b-2), the miRNA comprises one or more of the following miRNAs: EBV-miR-BART1-5p, EBV-miR- BART2-5p, EBV-miR-BART6-3p, EBV-miR-BART7-3p, EBV-miR-BART13-3p, and EBV-miR-BART17-5p; preferably comprise all six of said miRNAs.
The method of claim 55, wherein the miRNA comprises EBV-miR-BART1-5p and EBV-miR-BART7-3p.
The method according to any one of claims 52-56, wherein the step of extracting the Epstein-Barr virus-related miRNA comprises:

i) adding a lysate to the sample preservation solution; preferably, proteinase K is also added;

ii) adding binding solution and nucleic acid adsorption material;

iii) removing the liquid portion, adding a rinse solution to the nucleic acid adsorbing material for washing; and

iv) removing the liquid part, adding an eluent to the nucleic acid adsorption material, and eluting the nucleic acid and/or the miRNA from the nucleic acid adsorption material.
A method for extracting miRNA, comprising the following steps:

i) adding a lysate to the sample preservation solution; preferably, proteinase K is also added;

ii) adding binding solution and nucleic acid adsorption material;

iii) removing the liquid portion, adding a rinse solution to the nucleic acid adsorbing material for washing; and

iv) removing the liquid part, adding an eluent to the nucleic acid adsorption material, and eluting the nucleic acid and/or the miRNA from the nucleic acid adsorption material.
The method according to any one of claims 57-58, wherein the lysate comprises one or more groups selected from guanidine thiocyanate, citric acid, Triton-100, and/or EDTA points; preferably, the lysate comprises guanidine thiocyanate, citric acid, Triton-100, and EDTA.
The method according to claim 59, wherein in the lysate:

The content scope of described guanidinium thiocyanate is 28%-40% (w/w);

The content range of the citric acid is 1.8%-2.6% (w/w);

The content range of the Triton-100 is 0.8%-1.6% (w/w);

The content range of the EDTA is 0.5%-0.9% ( x /w); and/or

The pH range of the lysate is 3.8-4.2.
The method according to any one of claims 59-60, wherein in the lysate:

The content of the guanidinium thiocyanate is about 32% (w/w);

The content of said citric acid is about 2.2% (w/w);

The content of the Triton-100 is about 1.1% (w/w);

The content of said EDTA is about 0.7% (w/w); and/or

The pH of the lysate is about 4.0.
The method according to any one of claims 57-61, wherein the binding solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, lauryl sarcosine sodium bicarbonate, and/or one or more components of isopropanol; preferably, the combined solution comprises magnesium chloride, disodium edetate, sodium bicarbonate, guanidinium thiocyanate, lauryl inosine Sodium Hydroxide, and Isopropanol.
The method according to claim 62, characterized in that, in the binding solution:

The content range of the magnesium chloride is 0.1%-0.4% (w/w);

The content range of the disodium edetate is 0.5%-1.0% (w/w);

The content scope of described sodium bicarbonate is 0.6%-1.0% (w/w);

The content range of the guanidine thiocyanate is 13%-16% (w/w);

The content range of the sodium lauryl sarcosinate is 1.0%-1.4% (w/w);

The content range of the isopropanol is 60%-80% (w/w); and/or

The pH range of the binding solution is 4.8-5.2.
The method according to any one of claims 62-63, wherein in the binding solution:

The content of said magnesium chloride is about 0.24% (w/w);

The content of disodium edetate is about 0.71% (w/w);

The content of the sodium bicarbonate is about 0.83% (w/w);

The content of guanidine thiocyanate is about 14.9% (w/w);

The content of sodium sarcosyl is about 1.2% (w/w);

The content of said isopropanol is about 70% (w/w); and/or

The pH of the binding solution is about 5.0.
The method according to any one of claims 57-64, characterized in that, in step iii), rinse solution 1 and rinse solution 2 are sequentially added to the nucleic acid adsorption material for cleaning, and the liquid part is removed after each cleaning and then carried out Next washing; preferably, washing the nucleic acid adsorption material with the rinse solution 2 at least twice.
The method according to claim 65, wherein the rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidinium thiocyanate, and/or sodium lauryl sarcosinate One or more components; preferably, the rinse solution 1 comprises disodium edetate, sodium bicarbonate, guanidinium thiocyanate, and sodium lauryl sarcosinate.
The method according to claim 66, wherein in the rinse solution 1:

The content range of the disodium edetate is 0.4%-0.9% (w/w);

The content scope of described sodium bicarbonate is 0.5%-0.9% (w/w);

The content range of the guanidinium thiocyanate is 50%-55% (w/w);

The content range of the sodium lauryl sarcosyl is 0.8%-1.2% (w/w); and/or

The pH range of the rinse solution 1 is 6.2-6.6.
The method according to any one of claims 66-67, wherein in the rinse solution 1:

The content of disodium edetate is about 0.5% (w/w);

The content of the sodium bicarbonate is about 0.6% (w/w);

The content of the guanidinium thiocyanate is about 53% (w/w);

The content of sodium sarcosyl is about 0.9% (w/w); and/or

The pH of the Rinse 1 was about 6.4.
The method according to any one of claims 66-68, wherein ethanol is added to the rinse liquid 1 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse liquid 1:ethanol is 1: 1-1:2; preferably, said volume ratio is about 2:3.
The method according to any one of claims 65-69, wherein the rinse solution 2 comprises tris (Tris) or sodium chloride; preferably, the rinse solution 2 comprises tris Trisaminomethane (Tris) and Sodium Chloride.
The method according to claim 70, wherein in the rinse solution 2:

The content range of the tris (Tris) is 0.5%-0.7% (w/w);

The content range of the sodium chloride is 0.6%-1.8% (w/w); and/or

The pH range of the rinse solution 2 is 6.6-7.0.
The method according to any one of claims 70-71, wherein in the rinsing solution 2:

The content of tris (Tris) is about 0.6% (w/w);

The sodium chloride content is about 1.2% (w/w); and/or

The pH value of the rinse solution 2 is about 6.8.
The method according to any one of claims 70-72, wherein ethanol is added to the rinse liquid 2 before contacting the nucleic acid adsorption material, and the volume ratio of the rinse liquid 2:ethanol is 1: 1.6-1:3; preferably, said volume ratio is about 1:2.3.
The method according to any one of claims 57-73, wherein the eluent is DEPC water.
The method according to any one of claims 57-74, wherein the nucleic acid adsorption material is a magnetic bead capable of adsorbing RNA.
The method according to claim 75, wherein the magnetic core of the magnetic beads is ferric hydroxide, coated with silicon dioxide, and the surface is embedded with hydroxyl groups; preferably, the particle diameter of the magnetic beads is 50-100nm.
The method according to any one of claims 52-76, wherein the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and/or triphosphate One or more components of sodium; preferably, the sample preservation solution comprises EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and trisodium phosphate.
A method for preserving a nucleic acid-containing biological sample, characterized in that the sample is placed in a sample preservation solution, the sample preservation solution comprising EDTA, NaCl, absolute ethanol, sodium citrate, NP40, glutathione, and Trisodium Phosphate.
The method according to any one of claims 77-78, wherein in the sample preservation solution:

The content range of the EDTA is 0.7%-1.5% (w/w);

The content range of the NaCl is 0.01%-0.1% (w/w);

The concentration range of the absolute ethanol is 15%-35% (w/w);

The content range of the sodium citrate is 0.1%-1.0% (w/w);

The concentration range of the NP40 is 0.01%-0.1% (v/v);

The glutathione content ranges from 0.07% to 0.7% (w/w); and/or

The content range of the trisodium phosphate is 0.07%-0.4% (w/w).
The method according to any one of claims 77-79, wherein in the sample preservation solution:

The content of said EDTA is about 1.05% (w/w);

The content of said NaCl is about 0.035% (w/w);

The concentration of absolute ethanol is about 27.6% (w/w);

The content of the sodium citrate is about 0.21% (w/w);

The concentration of said NP40 is about 0.035% (v/v);

The glutathione content is about 0.21% (w/w); and/or

The content of the trisodium phosphate is about 0.14% (w/w).
The method according to one of claims 77-80, wherein the sample preservation solution contains antibiotics; preferably, the antibiotics contain penicillin-streptomycin double antibody.
The method according to any one of claims 77-81, wherein the pH value of the sample preservation solution is 7.6-8.0; preferably, the pH value of the sample preservation solution is 7.8.
The method according to any one of claims 77-82, characterized in that, compared with the control sample preservation solution, the preservation effect of the sample preservation solution on DNA, miRNA, and/or DNA methylation is better.
The method according to any one of claims 52-83, characterized in that, comprising step (b-3), the detection of the EB virus load comprises targeting the BamHI-W fragment in the Epstein-Barr virus genome, and/or LMP-2 genetic testing.
The method according to claim 84, wherein the detection of the EB virus load comprises the detection of the LMP-2 gene.
The method according to any one of claims 52-85, wherein the method is used for screening and/or diagnosing nasopharyngeal carcinoma.
The method of any one of claims 52-86, wherein the sample is a nasopharyngeal sample.
The method according to any one of claims 52-87, characterized in that, before step (a), further comprising using a nasopharyngeal brush and/or a nasopharyngeal swab to obtain the sample; preferably, the nasopharyngeal The brush and/or nasopharyngeal swab is a nasopharyngeal brush and/or nasopharyngeal swab that is independent of the clinician and nasopharyngoscope guidance.
A method of treating nasopharyngeal carcinoma for an individual in need thereof, comprising providing the individual with drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus therapy, wherein the sample of the individual has received the method of claim 52- 88. The method described in any one of 88 is detected and judged to be positive for nasopharyngeal carcinoma.
A method for treating nasopharyngeal carcinoma in an individual in need, comprising 1) performing detection according to the method according to any one of claims 52-88 on a sample from the individual; 2) if the detection result shows nasopharyngeal carcinoma If it is positive, provide nasopharyngeal carcinoma treatment; preferably, the nasopharyngeal carcinoma treatment adopts drugs, radiotherapy, surgery, cell therapy and/or oncolytic virus treatment.
Use of the kit according to any one of claims 1-51 in preparing products for screening and/or diagnosing nasopharyngeal carcinoma.