WO2023068362A1 - Use of redox nanoparticles for treatment of cells - Google Patents

Abstract

Disclosed are: a mammalian cell modification method comprising a step for preparing nanoparticles each based on a copolymer that includes a polymer chain segment having a poly(ethylene glycol) segment and a cyclic nitroxide serves as a pendant and mammalian cells; and a step for combining the prepared nanoparticles with the prepared mammalian cells in vitro; a blended product comprising a combination of the nanoparticles and the mammalian cells; and a preparation containing the nanoparticles as an active ingredient. According to the above-mentioned subjects, for example, the damage of the provided mammalian cells by stress under an external environment is recovered when the cells are damaged by the stress previously, and the cells are protected from the stress when the cells are not subjected to the stress.

Description

Use of redox nanoparticles for cell treatment

The present invention relates to the use of redox-active copolymer-based nanoparticles for the treatment or modification of mammalian cells, more specifically poly(ethylene glycol) (PEG) segments and cyclic nitroxide radicals. Novel application or use of nanoparticles of amphiphilic copolymers containing polymer chain segments having as pendants for cell processing.

It is known that even if mesenchymal stem cells or neural stem cells are transplanted into cerebral infarction lesions, the cell survival rate 28 days after transplantation is as low as 1-8% (Nakagomi N, et al. Stem Cells (2009). ) 27 (9): 2185-2195, doi: 10. 1002/stem. 161 (hereinafter abbreviated as Non-Patent Document 1.), George PM, et al. Biomaterials, 2018; 178: 63-72. Doi: 10, 1016/j. biomaterials, 2018. 06. 010 (hereinafter abbreviated as Non-Patent Document 2)). One of the causes of cerebral infarction lesions is the excessive production of free radicals and reactive oxygen species due to ischemia, creating an intolerant environment for the survival and engraftment of transplanted cells. In addition, cell therapy for ischemic stroke is needed, but only 0.06-0.8% of cells administered intraarterially/intravenously are detected in the brain parenchyma, making it difficult to realize nerve regeneration therapy. (Rosado-Castro PH, et al. Regenerative Medicine, 2013; 8(2): 145-155 (hereinafter abbreviated as Non-Patent Document 3)). However, since direct administration allows cells to be administered directly into the brain parenchyma, the use of such an administration system would contribute to regenerative medicine.

On the other hand, redox nanoparticles, in particular block copolymers containing hydrophobic polymer segments with cyclic nitroxyl radicals in their side chains and poly(ethylene glycol) (PEG) segments, self-assemble from an aqueous solution. Polymer micellized nanoparticles are known as a preparation capable of scavenging free radicals generated by ischemia and inflammation (WO 2009/133647 A (hereinafter abbreviated as Patent Document 1), WO 2016 /052463 A (hereinafter abbreviated as Patent Document 2)). Also amphiphilic copolymers comprising polymer chain segments having PEG segments and cyclic nitroxide radicals as pendant (or side chains), specifically copolymers of maleic anhydride and styrene, wherein maleic anhydride Nanoparticles based on copolymers, to which PEG chains are grafted via units and covalently attached pendant residues of agents such as cyclic nitroxide radicals, have also been investigated in vitro or in vitro. It is known to exhibit a redox action caused by a cyclic nitroxide radical in vivo (Japanese Patent Application Laid-Open No. 2019-123773 (hereinafter abbreviated as Patent Document 3)).

For example, it has been shown that when the former nanoparticles are administered to a mouse model of transient cerebral ischemia through the carotid artery, they are incorporated into the cytoplasm of neurons in cerebral ischemic lesions and exhibit neuroprotective effects (Mujagic A. , et al. Brain research, 2020; 1743: 146922, doi: 1016/j.braineres. , 2017, doi: 10. 1161/STROKAHA. 116. 016356 (hereinafter abbreviated as Non-Patent Document 5)).

If, in light of the findings of these technologies, for example, the combined use of cells and redox nanoparticles before transplantation can correct or improve the above-mentioned disadvantages of cell transplantation technology, it can be applied to a wide range of applications including regenerative medicine. It will contribute to the development of technical fields using such cells.

In view of the above background art, an object of the present invention is to provide mammalian cells (hereinafter also referred to as transplanted cells or simply cells) for treating or preserving them or stabilizing them in a place or area where they may reside. The purpose of the present invention is to obtain a means that can be handled easily and efficiently, and can be administered directly to a predetermined site or region where the cell transplantation or the like is desired, although this is not a limitation.
From this point of view, the present inventors have conducted research and found that specific redox nanoparticles based on the copolymers disclosed in Patent Document 1 or 2 or Patent Document 3 and mammalian cells or When combined or used together with cells for transplantation, the cells are modified, and stress such as oxidative stress in the external environment to the cells is suppressed under preserving or culturing conditions of the cells before transplantation. It has been found that the stress-induced cell damage caused by the stress is reversed. It has been found that cells modified in this way can significantly suppress oxidative stress caused by free radicals and reactive oxygen species on the cells even in a predetermined place or region where transplantation is desired after transplantation. Furthermore, it is understood that the redox nanoparticles are not limited to cells for transplantation, and similarly act or effect on a wide range of cells.

Accordingly, the present specification provides the invention in the following non-limiting aspects.
[Aspect 1]
providing nanoparticles and mammalian cells based on a copolymer of formula (I) or formula (II);
A method of modifying mammalian cells comprising the step of combining said provided nanoparticles and provided mammalian cells in vitro.

Formula (I):

In the above formula,
A represents unsubstituted or substituted C ₁ -C ₁₂ ^alkyl and the substituent, if substituted, represents a formyl group, a group of formula R′R ^″ CH—, where R ^′ and R ^″ are independently and C ₁ -C ₄ alkoxy or R ^′ and R ^″ together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—,
L ₁ represents a direct bond or a divalent linking group,
L ₂ —R ₁ is a group in which L ₂ is —(CH ₂ ) _a —NH—(CH ₂ ) _a — or —(CH ₂ ) _a —O—(CH ₂ ) _a —, and R ₁ is represented by the formula

any of the cyclic nitroxide radical residues represented by
_R2 is chloro, bromo or hydroxyl;
In the above, the repeating units in the polymer backbone with L ₂ -R ₁ and R ₂ are randomly present, the unit p with L ₂ -R ₁ is in the range of 2 to 100, and R ₂ is absent (zero) or is in the range 1 to 20, provided that the total number of these units is n,
Z is H, SH or S(C=S)-Ph, Ph represents phenyl optionally substituted with 1 or 2 methyl or methoxy;
each a is independently 0 or an integer from 1 to 5;
m represents an integer from 2 to 10,000,
n represents an integer of 3 to 100;

Formula (II):

In the above formula,
x+y is an integer from 5 to 1400, n is an integer from 5 to 1400, x+y:n is in a ratio of 1:1 to 5, x:y is in a ratio of 1 to 20:1, x: y is in a ratio of 1 to 60:1;
(1) In the repeating unit with y, in L-PEG-A, L is O or NH, and PEG is represented by the following formula,

wherein p is an integer from 1 to 6, q is an integer from 5 to 500,
A is
A1: represents an unsubstituted or substituted C ₁ -C ₁₂ alkoxy group, where the substituents when substituted are a formyl group, a formula R ^a R ^b CH— (wherein R ^a and R ^b are independently C ₁ -C ₄ alkoxy or R ¹ and R ² taken together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—. , or A2: the following formula

represents a group represented by
The repeating unit accounts for 2% to 15% of the total units of the copolymer represented by formula (I),
(2) in the repeating unit with the subscript x,
(a) either one of R ₁ or R ₂ is
a1: the following formula

, where
TEMPO is the following formula

any of the cyclic nitroxide radical residues represented by
any residue represented by
a2: the following formula

A residue represented by either
a3: the following formula

is represented by
wherein R ₃ is a C _1-3 alkyl group and r is an integer from 2 to 6, the residue
A residue selected from the group consisting of
the other is OH, or (b) R ₁ and R ₂ together represent —O— and form a cyclic anhydride residue, or (c) R ₁ and R ₂ are each OH represents
However, in the repeating unit marked with x,
(i) either one of R ₁ or R ₂ in (a) comprises the residue of a1, or (ii) either one of R ₁ or R ₂ in (a) includes the residue of a1 or (iii) either one of R ₁ or R ₂ of (a) comprises a residue of a1 and a residue of a3, or (iv) R ₁ of (a) or Either one of R ₂ comprises residues a1, residues a2 and residues a3, or (v) the repeating units marked with x are the above (i), (ii) to (iv) ) may contain a group defined in (b) or (c) in addition to the residue defined in
Here, the units containing each of the above residues and groups are present independently and randomly, and the units containing the residues defined in (a) account for 15% to 60% of the total number of repeating units marked with x. occupy
[Aspect 2]
In the modification method of aspect 1, the prepared mammalian cells may be damaged in advance by stress in an external environment, and when the stress is applied, the modification is caused by the stress. while the modification protects the cell from the stress when not subjected to the stress.
[Aspect 3]
The modified method of aspect 1, wherein the in vitro combining the nanoparticles and the mammalian cells comprises mixing the nanoparticles and the mammalian cells in a medium for culturing the mammalian cells. Said modified method, comprising the steps of:
[Aspect 4]
The modified method of aspect 1, wherein the in vitro combining the nanoparticles and the mammalian cells comprises mixing the nanoparticles and the mammalian cells in a medium for culturing the mammalian cells. permeating said nanoparticles into said mammalian cells.
[Aspect 5]
A formulation in which mammalian cells are combined in vitro with nanoparticles based on a copolymer of formula (I) or formula (II) as defined in aspect 1.
[Aspect 6]
6. The formulation of aspect 5, wherein said combined form is such that said nanoparticles and said mammalian cells coexist in a medium in which a mammal is cultured.
[Aspect 7]
6. The formulation of aspect 5, wherein said combined form is such that said nanoparticles and said mammalian cells coexist in a medium in which said mammal is cultured, and said mammalian cells are permeated with said nanoparticles. thing.
[Aspect 8]
In vitro mammalian cells comprising, as an active ingredient, nanoparticles based on the copolymer represented by formula (I) or (II) as defined in aspect 1 Preparations for modification.
[Aspect 9]
8. The preparation of aspect 7, wherein said modification protects mammalian cells from stress in the external environment or restores damage to mammalian cells caused by said stress.
[Aspect 10]
9. The preparation of aspect 8, wherein said protection of mammalian cells results in improved engraftment and/or improved differentiation of the transplanted cells into cells of interest when the cells are transplanted.

According to the present invention, nanoparticles based on the copolymer represented by formula (I) or formula (II) can effectively modify mammalian cells. For example, the nanoparticles can protect mammalian cells from stress in the external environment, including oxidative stress, or can recover mammalian cells from damage caused by the stress, thus facilitating the handling of the cells. to In addition, the mammalian cell formulation that is combined in vitro with the nanoparticles is also free in vivo, where the modified mammalian cells can exist in a predetermined place or region in the living body in which they have been transplanted. Since oxidative stress caused by radicals and reactive oxygen species can be suppressed, cell survival and engraftment rate can be kept high even after transplantation. Therefore, the present invention facilitates in vitro handling of mammalian cells, enables effective use of mammalian cells, and can contribute to, for example, the development of regenerative medicine.

1 is a diagram showing the results of fluorescent immunostaining in 1-3-1 of Example 1. FIG. 1 is a diagram and graph showing the results of RT-PCR and real-time PCR in 1-3-2 of Example 1. FIG. 2 is a graph showing the results of cell viability assay in 2-2 of Example 2. FIG. 2 is a graph and photographs showing the evaluation results of apoptosis in 2-3 of Example 2. FIG. 2 is a graph and photographs showing evaluation results of superoxide in 2-3 of Example 2. FIG. 2 is a graph showing evaluation results of inflammatory cytokines in 2-4 of Example 2. FIG. 3 is a photograph of an electron spin resonance spectrum and fluorescence immunostaining showing the evaluation results of dynamics of redox nanoparticles in a culture environment in Example 3. FIG. 4 is a graph showing the results of transplantation of cells and redox nanoparticles for determining the optimum concentration of redox nanoparticles to be used in direct intracerebral transplantation of nervous system cells into the cerebral infarction mice of Example 5. FIG. Graphs and photographs showing evaluation results of improvement of the transplantation environment by redox in 5-1 of Example 5. FIG. 10 is a graph showing mouse behavior evaluation results in 5-2 of Example 5. FIG. Blue: PBS, orange: redox nanoparticles, gray: cells + PBS, yellow: cells + redox nanoparticles *p<0.05, n=6 10 is a graph and photographs showing evaluation results of transplanted cells in 5-3 of Example 5. FIG. 10 is a graph showing the results of a test of uptake of redox nanoparticles of Example 6 into nervous system cells. Fig. 10 is a graph showing the results of a test of uptake of the redox nanoparticles of Example 7 (related to the copolymer of formula (II)) into nervous system cells. FIG. 11 is a conceptual diagram related to the content of an experiment in Example 8(1); FIG. 11 is a conceptual diagram related to the content of an experiment in Example 8(2); FIG. 11 is a conceptual diagram related to the experimental content of Example 9(1). FIG. 10 is a conceptual diagram relating to the content of an experiment in Example 9(2); It is a fluorescence photographed image (the original is a color image) in Example 8 (1). Fig. 10 is a graph showing the results of intracellular RNP quantification in Example 8(1). Fig. 10 is a graph showing the measurement results of the intracellular residual amount of RNP in Example 8(1). Fig. 10 is a graph showing the measurement results of intracellular RNP 8 hours after OGD treatment in Example 8(2). FIG. 10 is a graphical representation of molar concentration-converted values of intracellular RNP measurement results in Example 8(2). FIG. Fig. 10 is a graph showing the measurement results of RNP-positive cells before and after OGD treatment in Example 9(1). It is a fluorescence photographed image (original is a color image) in Example 9 (1). Fig. 10 is a graph showing the measurement results of RNP-positive cells before and after OGD loading in Example 9 (1). Fig. 10 is a graph showing the measurement results of viable cells before and after OGD loading in Example 9(2). Fig. 10 is a graph showing the measurement results of viable cells before and after RNP and OGD treatment in Example 9(2). Fig. 10 is a graph showing the measurement results of viable cells before and after OGD loading (fold change) in Example 9(2). FIG. 10 is a graph showing the results of calculating the cell-level response to RNP administration in an experimental example preceding Example 8, based only on the average value of fluorescence intensity. FIG.

Unless otherwise specified, the terms used in this specification shall be interpreted as having the meaning commonly used in the technical field.

Copolymer-based nanoparticles comprising poly(ethylene glycol) segments and polymer chain segments having pendant cyclic nitroxides of formula (I) or formula (II) disclosed herein are As long as the object of the present invention is met, not only nanoparticles composed only of these copolymers, but also copolymers represented by the formula (I), wherein L ₂ is —(CH ₂ ) _a —NH—(CH ₂ ) _a —, interaction with polyanionic polymers such as poly(meth)acrylic acid, polysulfonic acid, etc., as well as through self-assembly of the copolymer. Known per se nanoparticles formed via silica nanoparticles or organic-inorganic hybrid nanoparticles formed via silica nanoparticles (see, for example, WO 2013/118783 A), and copolymers represented by formula (II) It can also be a silica-containing core-shell type micelle particle formed via a trialkoxysilyl group in the residue defined as a3 of (see Patent Document 3).

The block copolymer represented by formula (I) and nanoparticles thereof can be obtained by the methods disclosed in Patent Documents 1 and 2. Specifically, a plurality of block copolymers obtained by the methods described in these patent documents are added to an aqueous medium (containing water, if necessary, a phosphate buffer and / or salt, a water-soluble organic solvent can be contained.), the copolymer can self-assemble or associate to form the nanoparticles. While not wishing to be bound by theory, such molecular assemblies are shelled with poly(ethylene glycol) (PEG) segments that are highly soluble and highly mobile in aqueous media, and consist primarily of L ₂ -R ₁ and It is understood to form core-shell nanoparticles with a region (core) formed from hydrophobic polymer segments with repeating units of R ₃ . Nanoparticles are on the order of nanometers in size, and are contemplated to have sizes in the range of, but not limited to, 5 nm to 500 nm, 10 nm to 300 nm, 10 nm to 100 nm, or 10 nm to 60 nm. . As used herein, the nanosize of nanoparticles means the average particle size that can be determined in an aqueous solution or homogeneous aqueous dispersion containing them by dynamic light scattering (DLS) analysis. Nano-sized particles formed in an aqueous medium can be obtained as a solid by, for example, freeze-drying, centrifugation, and the like. Such nanoparticles may be abbreviated herein as redox nanoparticles.

In the copolymer represented by formula (I), the divalent linking group defined for L ₁ is a poly(ethylene glycol) (hereinafter sometimes abbreviated as PEG) segment and a cyclic nitroxide radical as a side chain may not adversely affect the functionality of the attached poly(methylstyrene) segments, such as the aforementioned nanoparticle-forming ability, redox functionality due to cyclic nitroxide radicals. However, non-limiting divalent linking groups generally refer to groups containing up to 34, preferably 18, more preferably up to 10 carbons and optionally oxygen and nitrogen atoms. do. Specific examples of such a linking group include the following groups:

or —(CH ₂ ) _b S—, —CO( _CH 2 ) b S— _, —(CH ₂ ) _b NH—, —(CH ₂ ) _b CO—, —CO is selected from -, -OCOO-, and -CONH-, and each b is independently an integer of 1 to 5; If such a linking group has a different structure depending on the orientation of the bond, it shall be incorporated into formula (I) with the orientation described herein.

As for the copolymer and nanoparticles represented by formula (II), those described in Patent Document 3 can be used as they are.

"In vitro" means combinations, preparations, formulations of mammalian cells and said nanoparticles that are treated or prepared ex vivo, and in vivo combination or exclude anything that is prepared or formulated. Specifically, after the redox nanoparticles are administered in vivo, the particles are formed in vivo with cells, organs containing cells, organs or tissues, or parts thereof, or combined. are outside the scope of said preparations and formulations.

"Modification of mammalian cells" means that the cells are changed or modified so as to meet the purpose of the present invention, specifically, suppressing stress under the external environment to mammalian cells , or to alter the cell so that it can be protected from the external environment. On the other hand, it means that the cells, which have been damaged in the external environment in advance, are prepared so that they can recover from the damage. Although not limited as long as the purpose of the present invention is met, stress in the external environment means an action that may have some adverse effect on the functions originally maintained by cells in an environment in which cells can exist in vitro, The causative agent may be oxygen, which may be present in the air. In addition, but not limited to, when cells are cultured, it may be an action based on reactive oxygen species or free radicals that may be generated in the culture environment, which may adversely affect the survival of the cells. When redox nanoparticles are used together with cells for transplantation for cell transplantation or cell therapy, such effects may be due to the in vivo transplantation area or administration site of the transplanted cells or the lesion or lesion requiring treatment. Or it may be an effect caused by reactive oxygen species or free radicals in the vicinity thereof.

"Environmental stress" may be oxidative stress, and also includes stress resulting from oxidation or, in some cases, reduction, where the aforementioned adverse effects on cells are primarily based on reactive oxygen species or free radicals, etc. can.

“Protecting stressed cells in an external environment” includes suppressing the decrease in cell viability due to the aforementioned stress, and in some cases, improving cell viability. In addition, "recovering damage to mammalian cells caused by the stress" means that when mammalian cells are damaged in advance by the stress, the nanoparticles recover the damage afterwards. means to let
Thus, a method comprising a step of combining redox nanoparticles and mammalian cells, a preparation comprising redox nanoparticles as an active ingredient can be used for the preservation of mammalian cells, and when the cells are transplanted or administered in vivo. In particular, it is possible to preserve cells in vivo, for example, to suppress or improve the decrease in viability, and to maintain or maintain the original functions of the cells. Additionally, mammalian cells that have suffered any damage can provide cells with reduced or no damage, as the redox nanoparticles can restore or heal the damage. In addition, such cytoprotection or reversal of cellular damage may be achieved by redox nanoparticle-treated cells scavenging free radicals that are overproduced within cells, e.g., cell survival in transplanted cell foci or lesions. , to increase the engraftment rate.
Combining nanoparticles and mammalian cells in vitro is not limited to any aspect of the combination as long as the object of the present invention can be achieved. The nanoparticles that may be contained in a medium in which animal cells can be cultured and the mammalian cells that may be contained in a diluent or in a medium for culturing mammalian cells are combined into one. means. These components are not limited to being integrally contained in a single container or one element of a kit, and even if they are contained in separate containers, they are also included in the configuration of the combination. The diluent may be an aqueous medium commonly used in the art (distilled water, deionized water, phosphate buffered saline (PBS), physiological saline, etc.), and the medium in which mammalian cells can be cultured is , known per se in the art and may be commercially available media.
A specific example of such a combination is, for example, the formulation of aspect 6, wherein said nanoparticles and said mammalian cells are in coexistence in a medium in which the mammal is cultured. Further, in the combined form, the nanoparticles and the mammalian cells coexist in a culture medium for culturing a mammal, and the mammalian cells are permeated with the nanoparticles. can be mentioned.

Therefore, an "active ingredient" is an ingredient that helps exhibit the aforementioned actions or functions. A "preparation" is an entity made to perform such an action or function.

"Mammalian cells" include, but are not limited to, embryonic stem cells, induced pluripotent stem cells, pluripotent stem cells, somatic (tissue) stem cells, hematopoietic stem cells, mesenchymal stem cells, and neural stem cells. , and nerve cells and glial cells (astrocytes, microglia, oligodendrocytes) differentiated from these cells, or brain, spinal cord, peripheral nerves, heart, liver, kidney, pancreas, lung, intestine, blood, blood vessels , Bone, muscle, and other target tissues, organs, and all progenitor cells and cells induced to differentiate into organs, for example, mammalian cells including human cells. When these cells are used, for example, in transplantation or cell therapy, the cells are embryonic stem cells, induced pluripotent stem cells, pluripotent stem cells, somatic (tissue) stem cells, hematopoietic stem cells, neural stem cells, intercellular stem cells. Leaf stem cells and cells induced to differentiate from these cells can be used.

Formulations comprising said redox nanoparticles and said cells in vitro are also provided, wherein the redox nanoparticles and cells can be present in combination. Combined forms include, but are not limited to, contained independently in the same container or device, or contained together, e.g., to form a culture system, or different It may be contained individually in a container to form, for example, a cell preparation kit or the like. When the aforementioned culture system is formed, the redox nanoparticles and the cells can be a mixture containing, if necessary, nutrients and the like required for culturing cells known per se. Such a mixture may be in a state in which the redox nanoparticles and the cells are brought into contact or cultured together so that the particles are endocytosed into the cells. Accordingly, the formulation referred to herein may include redox nanoparticles that are incorporated into cells.

Such formulations include embryonic stem cells, induced pluripotent stem cells, pluripotent stem cells, somatic (tissue) stem cells, hematopoietic stem cells, neural stem cells, mesenchymal stem cells, and induced differentiation from these cells. When the cells are obtained, they can be used for cell transplantation or cell therapy or regenerative medicine. The target site or region for such transplantation is not limited as long as the object of the present invention is met, but includes brain, spinal cord, peripheral nerve, heart, liver, kidney, lung, pancreas, intestinal tract, blood, blood vessel, It can be part or all of bone, cartilage, muscle, and eye (retina). injury, myocardial infarction, heart failure, cardiomyopathy, liver failure, renal failure, lung disorder, acute respiratory distress syndrome, diabetes, inflammatory bowel disease, ischemic bowel disease, blood diseases such as leukemia, immune diseases such as autoimmune diseases, Examples include sepsis, severe infections, graft-versus-host disease (GVHD), bone/cartilage diseases, muscle diseases, retinitis pigmentosa, ischemic optic neuropathy, and the like. These formulations can be injected or implanted directly into a lesion or lesion, but cells and redox nanoparticles are present individually, or redox nanoparticles are incorporated into cells, and may be administered intravenously, cerebral artery, or Administration, intrathecal administration, subcutaneous implantation, intramuscular administration, and the like can be used.

Such formulations can also be prepared by including excipients and diluents commonly used in the art.

The present invention will be further described below using specific examples, but the present invention is not limited to these examples.

The redox nanoparticles used in the following examples are represented by formula (I) prepared by the method described in Patent Document 2, where A is methyl, _L is para-xylylene, and m is about 40, p is 15, q is 4, a is 0, Z is S(C=S)-Ph, Ph is unsubstituted phenyl, and R ₁ is listed above The leftmost residue among the three cyclic nitroxy radicals: 2,2,6,6-tetramethylpiperidine-1-oxyl (2,2,6,6-tetramethylpiperidine-1-oxyl) It is formed, for example, from a block copolymer (PEG-b-PMNT) as follows. 2,2,6,6-tetramethylpiperidine-1-oxylamine is sometimes abbreviated as TEMPOL.
PEG-b-PMNT was dissolved in dimethylformamide (DMF) at a concentration of 150 mg/mL, and the solution was placed in a dialysis membrane, sealed, and dialyzed against distilled water to prepare redox nanoparticles (RNP). . Distilled water was replaced every 2, 4, 8 and 20 hours from the start of dialysis, and the solution in the dialysis membrane was collected after 24 hours. A 10-fold concentration of PBS was added to the solution in the dialysis membrane so that the final concentration was 1-fold of the PBS concentration. As a result of measuring the particle size and particle size distribution by the dynamic light scattering method (DLS), the particle size (Z-Ave) was 26.5 nm, the polydispersity index (PDI) was 0.12, and the particle size distribution was uniform. .

As for the copolymer of formula (II), nanoparticles prepared according to "Production Example 17: Preparation of nanoparticles of SMAPo ^TN (N564)" in Patent Document 3 were used.
Example 1: Preparation of Cells Used in this Example, Others 1-1. Method for Inducing Dental Pulp Stem Cells Dental pulp was collected from an adult third molar, cut into small pieces with a scalpel, and placed in a growth medium in a 6 cm dish. The growth medium used had the following composition (DMEM/F12 supplemented with 10% FBS, 10 μM MEM nonessential amino acids (Nacarai Tesque, Inc. Kyoto Japan), 2 mM GlutaMAX, 50 μU / ml of penicillin, 50 μg / ml of streptomycin (Fujifilm Wako Pure Chemical Corporation), and 0.25 µg/ml of Fungizone (Hyclone Laboratories)). Minced pieces were seeded into 6 cm dishes with 3 ml of growth medium. After the spindle-shaped cells grown from the slices reached 80% confluence, they were subcultured at a ratio of 1:3 with 0.1% trypsin containing 0.2% EDTA. 1×10 ⁴ cells were plated in growth medium in 10 cm dishes. Two or three weeks later, the largest colony was recovered by colonial cloning using the filter paper method, and cultured in the same growth medium. The separated cells were dental pulp stem cells, and the material used for the medium was purchased from Thermo Fisher Science Co. Ltd.

1-2. Method for Inducing Nervous System Cells 1.0×10 ⁵ dental pulp stem cells were cultured in a 6 cm dish in the aforementioned growth medium. After the cells reached 80% confluence, they were cultured in a neural differentiation medium. The neural differentiation induction medium used had the following composition (DMEM/F12, 5% FBS supplemented with 15nM all-trans-retinoic acid (ATRA), 20nM progesterone, 20nM estradiol, 20nM NGF-1, 10ng/ml thyroxine, 10 nM dexamethasone, 50 μM ascorbic acid, and 20 ng/ml IGF-1). The neural differentiation induction medium was exchanged twice a week. Five or six weeks later, colonies of nervous system cells were observed in the pulp stem cell sheets and isolated by colonial cloning using the filter paper method. The isolated cells were cultured in a matrigel-coated (Becton Dickinson and Company) 35 mm dish in neuronal maintenance medium (N-GRO; DV Biologics, Calif., USA). The nerve maintenance medium was changed twice a week (see Takahashi H, et. al. above).

1-3. Evaluation of cultured cells 1-3-1. Fluorescent Immunostaining 2×10 5 dental pulp stem cells and 2×10 ⁵ neural cells were cultured on a cover glass placed in a 35 mm dish. Cells were fixed with 99.8% methanol at −30° C. for 15 minutes, washed with PBS three times, and treated with Blocking One Histo (Nacalai Tesque, Kyoto, Japan) for 10 minutes at room temperature. Cells were subjected to antigen-antibody reaction using the following primary antibodies overnight at 4°C, and then reacted with appropriate secondary antibodies for 60 minutes at room temperature in a dark room. After washing with PBS three times, the cells were mounted using a mounting medium containing DAPI (SCR-038448, dianova). Observations were made using a fluorescence microscope (Leica Microsystems Wetzlar, Germany). As a negative control, a sample without primary antibody was also prepared and confirmed. Antibodies used: rabbit anti-Nestin antibody (1:200; cat. No., N5413; Sigma-Aldrich), rabbit anti-Doublecortin (DCX) antibody (1:1000; cat. No., ab18723; Abcam), mouse anti-MAP2 Antibody (1:500; cat. No., M4403; Sigma-Aldrich), rabbit anti-GFAP antibody (1:1000; cat. No., ab7260; Abcam).

The results are shown in Figure 1. From this figure, expression of Doublecortin and MAP2 was not observed in dental pulp stem cells, whereas expression of Doublecortin and MAP2 was observed in nervous system cells. Expression of NESTIN was observed in both dental pulp stem cells and nervous system cells.
In the figure, A: Dental pulp stem cells, B: Nervous system cells, Bar=50μm, DCX: Doublecortin

1-3-2. RT-PCR, real-time PCR
Total RNA was extracted from cultured cells using Trizol reagent (Cat. No., 15596-018; Invitrogen). The specimens used were dental pulp stem cells induced from the pulp of another 3 individuals (n=3) and nervous system cells induced therefrom. cDNA was prepared from the extracted total RNA using a reverse transcription kit (Applied Biosystems, Cheshire, UK). For RT-PCR, cDNA was reacted using the following primers and a thermal cycler.
Primer:
Nestin (F: AACAGCGACGGAGGTCTCTA, R: TTCTCTTGTCCCGCAGACTT)
βIII-tubulin (F: TCCGCTCAGGGGCCTTTGGAC, R: GCTCCGCCCCCTCCGTGTAG)
MAP2 (F: AGTTCAGGCCCACTCTCCCTCC, R: GGAGCCAGAGCTGATTCCCCA)
GFAP (F: GGAAGATTGAGTCGCTGGAG, R: ATACTGCGTGCGGATCTCTT)
Olig2 (F: AGGACAAGAAGCAAATGACAG, R: TCCATGGCGATGTTGAGG)
PRL13A (F: GAAGGTGGTGGTCGTACGCT, R: TGCCGTCAAACACCTTGAGA)
A 2% agarose gel was prepared and the bands were confirmed by electrophoresis.
For real-time PCR, cDNA was mixed with qPCR master mix (Cat. No., A15297; Applied Biosystems) and TaqMan probes (Nestin, DCX, MAP2, GFAP, Olig2) and reacted with QuantStudio5 (Thermo Fisher Scientific). PRL13A (Hs03043887_gH) was used as a control. Data were compared using the comparative C _T (ΔΔCT) method.

The results are shown in FIG. From this figure, not only Doublecortin and MAP2 but also nestin (NESTIN), GFPA and Olig2 were strongly expressed in nervous system cells compared to dental pulp stem cells.
In the figure, A: RT-PCR, B: real-time PCR, (i) dental pulp stem cells, (ii) neural cells, control: PRL13A nd: not detected

Example 2: Examination of neuroprotective effect of redox nanoparticles under hypoxic culture + reperfusion environment 2-1. Method of hypoxic culture + reperfusion culture A hypoxic culture + reperfusion model was used in vitro as a pseudo model of peri-infarct foci (Abramov AY, et al., J Neurosci. 2007;27(5):1129- 38.). Hypoxic culture (1% oxygen, 37°C) was performed by changing the culture medium of nervous system cells to DMEM/F12 without glucose. After 8 hours, the culture dish was taken out, the culture medium was changed to one containing glucose, and normal culture was performed. The reperfusion time was adjusted for each experiment.

2-2. Cell Survival Assay Neural cells were cultured in 24-well plates at 1.0×10 ⁵ cells/well. Hypoxia culture + reperfusion for 24 hours was performed. Before hypoxic culture and reperfusion, TEMPOL or redox nanoparticles were administered into the culture medium as an antioxidant. TEMPOL and redox nanoparticles were adjusted to 0, 10, 25, 50, 100, and 200 μM in terms of TEMOL concentration. After culturing, a WST-8 solution (KISHIDA CHEMICAL, Japan) was added, and after culturing at 37°C for 4 hours, absorbance at 450 nm was measured. Four wells were prepared for each concentration, an experiment was performed with n=3, and average values were compared. Ordinary cultured cells were used as controls.

The results are shown in FIG. From this figure, redox nanoparticles improved cell viability compared to TEMPOL when performing a cell viability assay using WST-8. It was also confirmed in vitro that redox nanoparticles have a concentration-dependent effect. 100 or 200 μM redox nanoparticles significantly improved cell viability compared to no redox nanoparticles (P<0.05). On the other hand, TEMPOL did not improve cell viability at any concentration.
In the figure, A: TEMPOL, B: redox nanoparticles, *p<0.05, **p<0.001, ns: no significant difference, OGD (oxygen glucose deprivation): oxygen glucose deprivation, n=3

2-3. Evaluation of apoptosis Hypoxic culture and reperfusion were performed in the same manner as in 2-2 above, and cells were fixed with 4% paraformaldehyde. TUNEL staining (Cat. No., 1 684 795; Sigma-Aldrich) was performed and observed under a fluorescence microscope. The number of TUNEL-positive cells was counted by randomly observing 5 visual fields at 400x magnification. Experiments were performed with n=3. Ordinary cultured cells were used as controls.

The results are shown in FIG. The following can be confirmed from this figure. Compared to TEMPOL, redox nanoparticles inhibited apoptosis of neural cells under hypoxic culture + reperfusion conditions. It was also confirmed in vitro that redox nanoparticles have a concentration-dependent effect. Redox nanoparticles at 100 or 200 μM suppressed apoptosis of neural cells with a significant difference (P<0.001) compared to no redox nanoparticles. On the other hand, TEMPOL did not suppress apoptosis at any concentration.
In the figure, A: TEMPOL, B: redox nanoparticles,
C: TUNEL staining Red indicates TUNEL staining, blue indicates cell nuclei, and (i) control (ii) TEMPOL (iii) redox nanoparticles, Bar=50 μm, *p<0.05, **p<0.001, ns : No significant difference, OGD: Same as above, n=3

2-3. Evaluation of superoxide As in 2-1 above, hypoxic culture + reperfusion was performed for 15 minutes. After washing twice with PBS, 2 ml of MitoSOX (Invitrogen) diluted to 0.25 μM with PBS was added, and the cells were kept at 37°C in a dark room for 10 minutes. cultured. After cells were fixed with 4% paraformaldehyde, the cells were mounted with DAPI-containing mounting medium, and superoxide that reacted with MitoSOX in mitochondria was observed under a fluorescence microscope. Fluorescence intensity was measured using ImageJ and average values were compared. Experiments were performed with n=3. Ordinary cultured cells were used as controls.

The results are shown in FIG. The following can be confirmed from this figure. Redox nanoparticles scavenged superoxide in mitochondria compared to TEMPOL. In addition, redox nanoparticles showed a concentration-dependent effect. Redox nanoparticles at 100 or 200 μM significantly quenched superoxide compared to no redox nanoparticles at P<0.05. On the other hand, TEMPOL could not significantly scavenge superoxide at any concentration.
In the figure, A: TEMPOL, B: redox nanoparticles, C: MitoSOX Red indicates superoxide that reacted with MitoSOX, blue indicates cell nuclei (i) Control (ii) TEMPOL (iii) Redox nanoparticles, Bar=50 μm , *p<0.05, OGD: same as above, n=3

2-4. Evaluation of Inflammatory Cytokine Hypoxic culture and reperfusion for 12 hours were performed in the same manner as in 2-1 above. TEMPOL and redox nanoparticles were adjusted to a concentration of 100 µM in terms of TEMPOL. After hypoxic culture and reperfusion, the cell supernatant was collected and IL-6 and IL-8 were analyzed using an ELISA kit (IL-6; Cat. No., D6050; R&D systems, IL-8; Cat. No., ab14030). ; Abcam). Experiments were performed with n=3. Ordinary cultured cells were used as controls.

The results are shown in FIG. The following can be confirmed from this figure. Redox nanoparticles inhibited the generation of IL-6 and IL-8 in the culture supernatant after hypoxic culture + reperfusion with a significant difference compared to the case without redox nanoparticles. On the other hand, TEMPOL also decreased IL-6 and IL-8, but was less effective than redox nanoparticles, and no significant difference was observed.
In the figure, A: IL-6, B: IL-8, *p<0.05, **p<0.001, ns: no significant difference, OGD: same, n=3

Example 3: Evaluation of dynamics of redox nanoparticles in a culture environment (electron spin resonance method and fluorescence immunostaining)
Rhodamine-labeled redox nanoparticles were used to assess the dynamics of redox nanoparticles in neurons (Hosoo H, et al., Stroke. 2017;48(8):2238-47). Electron spin resonance method was used to measure the structure and quantity of free radicals (Yoshitomi T, et al., Bioconjugate chemistry. 2009;20(9):1792-8, Vong LB, et al., Biomaterials. 2015 ;55:54-63). Nervous system cells were prepared by normal culture for 9 hours and hypoxia culture + reperfusion for 1 hour, and TEMPOL and rhodamine-labeled redox nanoparticles were administered to 200 μM as described above. Cell supernatants and cell suspensions were prepared for evaluation by electron spin resonance. The cell suspension was washed three times with Hanks solution to remove TEMPOL- or rhodamine-labeled redox nanoparticles adhering to the outside of the cells. The cell suspension was adjusted to 6.0×10 ⁶ cells/400 μl, and 100 μl was measured by the electron spin resonance method. In addition, reduced radicals in the culture supernatant and cell suspension were measured by reoxidation using potassium hexacyanoferrate(III) (10 mM; Kanto Chemical Co., Japan).

The ESR measurement conditions were Magnetic Field 335.5+/-7.5mT, Gain x790, Modulation Width 0.2mT, Time constant 1sec., Sweep time 2min.

Similarly, nervous system cells were prepared by normal culture for 9 hours and hypoxia culture + reperfusion for 1 hour, and rhodamine-labeled redox nanoparticles were administered to 200 μM. After fixing the cells with 4% paraformaldehyde, the cells were mounted with a DAPI-containing mounting medium and observed under a fluorescence microscope.

The results are shown in FIG. The following can be confirmed from this figure. In both TEMPOL and redox nanoparticles, normal culture (Fig. 7.A) and hypoxic culture + reperfusion (Fig. 7.B), no signal was confirmed in the cell suspension by electron spin resonance method. When the signal was measured using potassium hexacyanoferrate(III) in the cell suspension, no signal could be confirmed in the TEMPOL group, ie TEMPOL was not present in the cells. On the other hand, a sharp triplet signal was detected for rhodamine-labeled redox nanoparticles. In other words, the redox nanoparticles were disintegrated in the cells and existed in a polymer state, indicating that redox reactions occurred ((Yoshitomi T, et al., Biomacromolecules. 2009;10( 3):596-601.) Also, in the examination of the culture supernatant (Fig. 7.C), a sharp triplet signal was detected in the TEMPOL group, while a broad signal was detected in the rhodamine-labeled redox nanoparticle group. (See above.) Furthermore, even when potassium hexacyanoferrate(III) was added to the culture supernatant, a sharp triplet signal was detected in the TEMPOL group. Fluorescent immunostaining showed that rhodamine-labeled redox nanoparticles were in the cytoplasm both after normal culture and hypoxic culture + reperfusion. confirmed (Fig. 7. A, B).
In the figure, A: electron spin resonance method and fluorescence immunostaining of normal culture, B: electron spin resonance method and fluorescence immunostaining of hypoxic culture + reperfusion, C: electron spin of culture supernatant of hypoxic culture + reperfusion Resonance method Red indicates rhodamine and blue indicates cell nuclei.

In VIVO
In the studies below, redox nanoparticles were used at 500 μM as seen in Example 5 below.
Example 4. Creation of cerebral infarction model mice due to distal middle cerebral artery occlusion The animal experiment plan was approved by the University of Tsukuba Life Science Animal Resource Center (approval number: #20-132). All experiments were conducted in accordance with the "Guidelines for the Care and Use of Laboratory Animals."

　C.B-17/Icr-scid/scidJcl mice (male, 7-8 weeks old, body weight 20-25 g) were purchased from CLEA, Japan and used. A mouse distal middle cerebral artery occlusion model was prepared by the method reported by Taguchi et al. (See Taguchi A, et al., The Journal of clinical investigation. 2004;114(3):330-8.). Briefly, mice were anesthetized by intraperitoneal injection of a mixed solution of ketamine (70 mg/kg) and xylazine (14 mg/kg). A skin incision was made on the temporal region of the mouse and a small craniotomy was made in the temporal bone with a dental drill. After coagulating the middle cerebral artery distal to the olfactory nerve with bipolar forceps, occlusion was confirmed by cutting with microscissors. Body temperature was maintained at 37°C on a heat pad during the procedure and when awaking from anesthesia.

Example 5. Method of direct intracerebral transplantation of nervous system cells into mice with cerebral infarction Four weeks after transplantation of cells and redox nanoparticles (0, 200, 500, 1000 μM) to determine the optimal concentration of redox nanoparticles in advance The mouse brain was taken out and the number of surviving transplanted cells was confirmed. A cell suspension of nervous system cells was prepared in advance and adjusted so that 1.0×10 ⁵ cells would be transplanted. In addition, the redox nanoparticles were mixed with the cell suspension before cell transplantation to form a mixed solution. 500, 1000 µM showed more survival than 0, 200, and no difference was observed at 500, 1000 µM. See FIG.

In this test, the transplanted cells or substances were divided into 4 groups: PBS, redox nanoparticles, cells + PBS, and cells + redox nanoparticles. Two days after the cerebral infarction treatment, the mice were fixed in a head fixator (NARISHIGE, Japan) after general anesthesia as in 3-6. A skin incision was made in the midline of the head, and Hamilton Syringe (Cat. No., 4025-11701, GLSciences) was used at the periinfarct site 1 mm anteriorly and 1.5 mm laterally from bregma to a depth of 2 mm from the surface of the brain. was injected into the brain by pointing the needle to The injection was performed slowly over 10 minutes, and the needle was slowly withdrawn after waiting 5 minutes after injection.

5-1. Evaluation of improvement of transplantation environment by redox In order to show that the transplantation environment was improved by redox nanoparticles, mice transplanted with PBS and redox nanoparticles were compared. Two days after the cerebral infarction treatment, mice were given general anesthesia as described above, and PBS and redox nanoparticles were implanted into the peri-infarct foci. One hour after transplantation, 27 mg/kg of dihydroethidium (Cat. No., D1168, Invitrogen) (200 μl in total) was intraperitoneally administered twice at 30-minute intervals (Hu D, et al., The Journal of Neuroscience. 2006; 26(15):3933-41). After 4 hours, the mice were perfusion-fixed with 4% paraformaldehyde, the brains were taken out, and cryosections were prepared. Observation was performed with a fluorescence microscope after mounting with DAPI-containing mounting medium. Dihydroethidium reacted with superoxide can be observed using a fluorescence microscope at 518/606 nm. Three peri-infarct lesions were observed randomly at 400x magnification. Fluorescence intensity was measured and compared using ImageJ. The experiment was performed with n=4, and the brain of a mouse not treated with cerebral infarction was used as a control.

The results are shown in FIG. According to this figure, when observing the signal of superoxide in response to dihydroethidium in the peri-infarct foci under a fluorescence microscope, the redox nanoparticle group (Fig. 9. iii) showed P in the PBS group (Fig. 9. ii). Superoxide production in periinfarct cells was suppressed with a significant difference of <0.05.
In the figure, *p<0.05, Bar=50μm, n=4

5-2. Mouse Behavioral Evaluation For the evaluation of paralysis in a mouse model of cerebral infarction due to distal middle cerebral artery occlusion, evaluation was performed every week after transplantation by adhesive removal test and cylinder test. Four groups of PBS, redox nanoparticles, cells + PBS, and cells + redox nanoparticles were compared (n=6). To briefly describe the evaluation method, the adhesive removal test attached a 3x4 mm tape to the palm of the mouse forelimb and measured the time it took for the mouse to remove the tape (Bouet V, et al., Nat Protoc. 2009;4(10 ):1560-4.). In the Cylinder test, mice were placed in a transparent plastic cylinder with a diameter of 8 cm and a height of 12 cm, and the number of times they used their forelimbs was measured. The rate of forelimb use was calculated using the following formula [paralyzed forelimb/(paralyzed forelimb + non-paralyzed forelimb + both sides)] x 100 (Craft TK, et al., Stroke. 2005;36(9):2006- 11.).

The results are shown in FIG. From FIG. 10, it was confirmed that cell therapy using cells + redox nanoparticles according to the present invention improved neurological symptoms in cerebral infarction model mice. Specifically, it is as follows. Adhesive removal test (Fig. 10. A) and Cylinder test (Fig. 10. B) behavioral evaluation of mice showed improvement in all four groups. Furthermore, the groups containing cells (cells + PBS and cells + redox nanoparticles group) showed better improvement in behavioral assessment from 1 week after transplantation compared to the groups without cells (PBS, redox nanoparticles group). rice field. Although there was no significant difference between the cells + PBS group and the cells + redox nanoparticles group, the cells + redox nanoparticles group tended to improve behavioral assessment at 6 weeks after transplantation (P = 0.059).
In the figure, solid line: PBS, dashed line: redox nanoparticles, dashed line: cells + PBS, dotted line: cells + redox nanoparticles, *p<0.05, n=6

5-3. Evaluation of Transplanted Cells To evaluate the number of transplanted cells and the degree of differentiation, mice were perfusion-fixed with 4% paraformaldehyde one week and six weeks after transplantation, and the mouse brains were excised and cryosections were prepared. Antigen-antibody treatment was performed overnight at 4°C using the following primary antibodies, followed by 60 minutes at room temperature in the dark using appropriate secondary antibodies. Mounting was performed using DAPI-containing mounting medium (SCR-038448, dianova). Observations were made using a fluorescence microscope (Leica Microsystems Wetzlar, Germany). The primary antibodies used were mouse anti-STEM121 antibody (1:1000, cat. No., Y40410; Cellartis-Takara Bio), rabbit anti-DCX antibody (1:500, cat. No., ab18723; Abcam), rabbit anti-MAP2 antibody. (1:500, cat. No., GTX133109; GeneTex Inc), rabbit anti-GFAP antibody (1:500, cat. No., ab7260; Abcam). The number of transplanted cells was determined by observing 3 random peri-infarction lesions at 1000x magnification and comparing the average values (n=6).

The results are shown in FIG. The following can be confirmed from this figure. One week after transplantation (Fig. 11.A), there was no difference in the survival rate of transplanted cells between the PBS and redox nanoparticle groups. However, at 6 weeks after transplantation (Fig. 11.B), the survival rate of transplanted cells was higher in the redox nanoparticles group than in the PBS group (P<0.05). Fluorescent immunostaining showed positive cells for both Doublecortin, MAP2, and GFAP in both the PBS group (Fig. 11. A-i) and the redox nanoparticle group (Fig. 11. A-ii) one week after transplantation. Six weeks after transplantation, most of the cells in the PBS group (Fig. 11.B-i) were GFAP-positive, but only a few were Doublecortin-positive, and no MAP2-positive cells were observed. On the other hand, most of the cells in the redox nanoparticle group (Fig. 11.B-ii) were GFAP-positive cells, and some Doublecortin and MAP2-positive cells were observed. Neurons were found only in the redox nanoparticle group.
In the figure, A: 7 days after transplantation, B: 42 days after transplantation, (i) PBS, (ii) redox nanoparticles, Bar=50 μm, *p<0.05, n=6

<Statistical evaluation>
For the above statistical analysis, syntax was used for mouse behavior evaluation. ANOVA and post-hoc test were used for multiple group comparisons. SPSS (version 22; IBM Corp., Armonk, NY, USA) was used for analysis and p<0.05 was considered significant. same as below.

In VITRO:
Example 6: Uptake of Redox Nanoparticles (Related to the Copolymer of Formula (I)) into Neural Cells Neural cells were cultured in a 24-well plate at 6×10 ⁴ cells/well. Rhodamine-labeled redox nanoparticles were separately administered to the culture solution at 100 µM and 500 µM, and normal culture was performed. After 15 minutes, 1 hour, 3 hours, 6 hours and 24 hours after administration, observation was performed using a fluorescence microscope. After that, each well was washed twice with Hanks, and the cells were fixed with 4% paraformaldehyde for 15 minutes. After washing twice with Hanks, antigen-antibody reaction was performed overnight at 4°C using the following primary antibody, and then reaction was allowed to proceed for 60 minutes at room temperature in a dark room using an appropriate secondary antibody. After washing with Hanks, they were mounted using DAPI-containing mounting medium (SCR-038448, dianova). Observation was performed at the same time using a fluorescence microscope, fluorescence intensity was measured using ImageJ, and average values were compared.

Antibody used: mouse anti-rhodamine antibody (1:250; Cat. No., ab9093; Abcam).

The results are shown in Figure 12 (upper and lower figures). 15 minutes and 1 hour after administration of rhodamine-labeled redox nanoparticles, no redox nanoparticles were observed in the cells, but they were taken up into the cells after 3 hours (upper figure). Similar results were obtained when an anti-rhodamine antibody was used (lower figure).

Example 7: Uptake of Redox Nanoparticles (Related to the Copolymer of Formula (II)) into Neural Cells Neural cells were cultured in a 24-well plate at 3.2×10 ⁴ cells/well. Cy5-labeled nanoparticles prepared according to "Production Example 17: Preparation of nanoparticles of SMAPo ^TN (N564)" in Patent Document 3 (Japanese Patent Application Laid-Open No. 2019-123773) were administered into the culture medium at a concentration of 3.2 mM. Then, normal culture was performed. Observation was performed using a fluorescence microscope 1 hour, 3 hours, 6 hours, and 24 hours after administration. Fluorescence intensity was measured using ImageJ and average values were compared.

The results are shown in FIG. Cy5-labeled nanoparticles were confirmed in cells from 1 hour after administration, and intracellular uptake increased 6 hours and 24 hours after administration.
The above examples are referred to as the above experimental examples.

In the following, we will perform in vitro verification of further antioxidant effects on RNP's cell permeability, intracellular distribution, residual amount, and hypoxia/undernutrition (OGD).

In the above experimental example, it can be seen that the cell penetration of RNP at a concentration of around 100 μM may require about 1 to 3 hours of penetration time. Here, we will quantify changes over time and further verify resistance to oxidative stress (OGD) caused by hypoxia and undernutrition. Until now, the antioxidant capacity of RNP was limited to the observation of the preventive effect by treatment before OGD in cell experiments, and verification of the recovery effect against the damage that occurred was insufficient. We aim to quantify the amount of RNP more specifically and clarify the details of the antioxidant effect of RNP.

Example 8: Verification of cell permeability of RNP (1) Establishment of RNP penetration time In order to evaluate the permeability of RNP over time by treatment time and establish the most effective concentration and treatment time, Based on 100 μM, which was determined to be present, the intracellular RNP amount was measured by fluorescence observation of Rhodamine in RNP for each treatment time. FIG. 14 shows a conceptual diagram of the contents of the experiment. Cells were seeded at a density of 10,000 cells/well on a 2.5 v/v % Matrigel-coated 24-well plate. NB27 medium, which is a nerve cell medium, was used as the medium. RNP treatment of the cells was carried out by normal culture at 37° C. in a 5% CO ₂ environment for 48 hours after seeding, and then the medium was changed to 100 μM RNP:DMEM/LG medium. The treatment time was set to 15 minutes, 1 hour, 3 hours, 6 hours and 12 hours, respectively, and untreated cells were cultured for the same time as a control group.

After each RNP treatment time, each cell was washed twice with PBS(-), the medium was returned to the normal neuronal cell medium NB27 medium, and all-in-one fluorescence was used by Keyence. Photographs were taken with a microscope (BZ-X800). Photographs were taken immediately after each RNP treatment and after washing, and normal culture was performed for 48 hours after all conditions were completed.

For image analysis, imageJ software (Ver.1.53q) was used to determine the total area of positive Rhodamine signals from fluorescence images and the total area of cells from phase contrast images. changed. The threshold for positive signal calculation was determined according to the ISO Data parameter of the software.

(2) Re-verification of optimal concentration of RNP In order to re-verify the optimal concentration for RNP administration, explore the permeability to cells with RNP:DMEM/LG medium at concentrations of 10, 50, 100, and 500 µM, referring to the above experimental example. bottom. FIG. 15 shows a conceptual diagram of the contents of the experiment. Cells were seeded at a density of 10,000 cells/well on a 2.5 v/v % Matrigel-coated 24-well plate. NB27 medium, which is a nerve cell medium, was used as the medium. RNP treatment of the cells was carried out by normal culture at 37° C. under 5% CO ₂ environment for 48 hours after seeding, and then the medium was changed to RNP:DMEM/LG medium adjusted to each concentration. As for the treatment time, the OGD load was applied immediately after the medium exchange, and culture was performed for 8 hours. After completion of OGD, each cell was washed twice with PBS(-), the medium was returned to normal neuronal cell medium NB27 medium, and photographed with a Keyence All-in-one microscope (BZ-X800). Imaging was performed after washing immediately after OGD.

For image analysis, imageJ software (Ver.1.53q) was used to determine the total area of Rhodamine signal-positive from the fluorescence image and the total area of the entire cell from the phase contrast image, and quantify the positive area divided by the cell area. . Threshold for positive signal calculation was performed according to the ISOData parameter of the software.

Example 9: Verification of antioxidant effect of RNP (1) Verification of antioxidant capacity of RNP against reperfusion damage In order to verify the antioxidant effect of reperfusion after neuronal oxidative stress, RNP was applied to cells before and after OGD loading. It was set to show preventive and therapeutic effects, respectively. FIG. 16 shows a conceptual diagram of the contents of the experiment. Cells were seeded at a density of 10,000 cells/well on a 2.5 v/v % Matrigel-coated 24-well plate. NB27 medium, which is a nerve cell medium, was used as the medium. Cells were treated with RNP after seeding and normal culture at 37°C in a 5% _CO2 environment for 48 hours. rice field.

Samples (PreRNP) for prophylactic effect observation were cultured normally for 48 hours, then the medium was changed to RNP medium, and OGD was applied for 8 hours at 37°C in a 1% O ₂ environment. After OGD, the medium was removed by aspiration, the cells were washed twice with PBS(-), and the neuron medium was replaced with NB27 medium, and simulated reperfusion damage was given at 37°C and 5% CO ₂ for 48 hours. rice field.

Samples (PostRNP) for observation of therapeutic effects were cultured for 48 hours, washed twice with PBS(-), replaced with DMEM/LG medium, and placed under OGD at 37°C and 1% O2 for 8 hours. processed. After OGD, the medium was replaced with RNP:DMEM/LG medium with the RNP concentration adjusted as described above, and cultured at 37°C under 5% CO ₂ environment for 12 hours. After RNP treatment, the medium was removed by aspiration, the cells were washed twice with PBS(-), and the neuron medium was replaced with NB27 medium, and simulated reperfusion damage was given at 37°C in a 5% CO ₂ environment. .

After each experiment, each cell was washed twice with PBS(-), the medium was replaced with DMEM/LG, and images were taken with a Keyence all-in-one microscope (BZ-X800).

(2) Quantitation of antioxidant capacity of RNP Antioxidant capacity of RNP against oxidative stress during OGD loading was measured by cell viability measurement. FIG. 17 shows a conceptual diagram of the contents of the experiment. RNP was administered to the cells before and after OGD loading, and the prophylactic and therapeutic effects of each were determined. Cells were seeded at a density of 5,000 cells/well on 2.5 v/v % matrigel-coated 96-well plates. NB27 medium, which is a nerve cell medium, was used as the medium. RNP treatment of the cells was carried out using DMEM/LG medium adjusted to RNP concentrations of 10, 50, 100 and 500 μM, respectively, after normal culture at 37° C. and 5% CO ₂ for 48 hours after seeding.

Samples for observation of preventive effect were cultured normally for 48 hours, then the medium was changed to RNP:DMEM/LG medium, and OGD was applied for 16 hours at 37°C in a 1% O ₂ environment. After OGD, the medium was removed by aspiration, the cells were washed twice with PBS(-), replaced with NB27 medium, which is a neuronal medium, and reperfusion damage was given for 2 hours at 37°C in a 5% CO ₂ environment.

After 48 hours of normal culture, cells were washed twice with PBS(-), the medium was replaced with DMEM/LG medium, and OGD was performed for 16 hours at 37°C under 1% O ₂ environment. processed. After OGD, the RNP concentration was replaced with the DMEM/LG medium adjusted as described above, and permeated for 1 hour at 37°C in a 5% CO ₂ environment. After infiltration culture, the medium was replaced with NB27 medium, which is a neuronal medium, and reperfusion damage was given for 1 hour.

Immediately after completing a series of protocols, cell viability was measured using a 1:1 mixture of CellTiter Glo2.0 (Promega) reagent and DMEM/LG. The medium was removed, the cells were washed twice with PBS(-), replaced with CellTiter Glo2.0:DMEM/LG solution, the well plate was gently agitated for 2 minutes, and allowed to stand at room temperature for 10 minutes for reaction. After the reaction, the plate was set in a Varioskan LUX microplate reader (Thermo) and the yellow luminescence of Luciferin reacted with ATP in living cells was quantified by luminometric measurement.

Results of Verification of Cell Permeability of RNP in Example 8 (1) Regarding Establishment of RNP Permeation Time FIG. Intracellular RNP was quantified by the ratio of the cell area to the RNP-positive signal area in the photograph. The results are shown in FIG. The amount of intracellular RNP immediately after RNP treatment increased in proportion to the treatment time. It was found that it was distributed significantly and widely in the cells even for 1 hour, it was confirmed that the amount was almost the same up to 3 hours, and that the amount further increased after 6 hours, but there was no constant proportionality.

In addition, after all treatments were completed, the cells were returned to the 37°C incubator and normal culture was performed for 4 days, after which the intracellular residual amount of RNP was measured. The results are shown in FIG. From FIG. 20, it can be seen that a constant amount of RNP was confirmed even in the sample treated with RNP for 15 minutes, and there was no significant difference from the sample treated with RNP for up to 24 hours. From these results, it was found that the intracellular distribution of RNP spreads over time for a certain period of time even after administration, and that the drug does not escape from the cells within a few days. However, since a significantly weaker signal was confirmed immediately after administration than in the sample after 1 hour, it was determined that the lower limit of the effective RNP treatment time was set to 1 hour and future experiments could be performed.

(2) Re-verification of optimal RNP concentration The optimal concentration of RNP was examined by comparing the intracellular permeability in terms of area ratio in the same manner as described above. The results are shown in Figures 21 and 22, respectively. According to Fig. 21, the highest value was observed at 500 μM as a result of administration at the time of OGD load, assuming the affected area, but converted by molar concentration vs. penetration rate. It shows a lower permeation efficiency.

Results of verification of antioxidant effect of RNP by Example 9 (1) Verification of antioxidant capacity of RNP against reperfusion damage FIG. 23 shows the results converted to . From FIG. 23, it can be seen that there was no significant difference between 50 μM and 100 μM, but the RNP permeability increased at 500 μM when administered after OGD loading. FIG. 24 shows the results of photographing the cells in each experiment taken with a fluorescence microscope after the completion of each experiment in Example 9(1). Qualitative analysis of cell damage was performed by qualitatively comparing axonal damage (yellow circles) with dendrite and cell body damage (white circles) in FIG. As a result, RNP-treated OGD-loaded cells showed only partial damage similar to hypoxic culture, but RNP-untreated OGD-loaded cells showed cell body collapse and axonal degeneration/damage. were seen a lot. In addition, the area ratio of cells to RNP-positive cells was calculated in order to investigate the recovery effect of cells upon reperfusion. The results are shown in FIG. As for FIG. 25, since the images were taken in the same well, a decrease in the area ratio of the RNP-positive signal means that the cells recovered from the damage and spread normally.

(2) Quantification of antioxidant capacity of RNP In order to quantify that the antioxidant effect of RNP against oxidative stress is effective even after oxidative stress, RNP was administered to each cell before and after OGD treatment, and the were compared (see FIG. 17 for details of the experiment). The results are shown in Figures 26 and 27, respectively. From these figures, it was found that the survival rate of cells increased in proportion to the concentration of RNP, but there was no significant difference between 50 µM and 500 µM. OGD pre-administration (PreRNP) and post-administration (PostRNP) caused a difference in the value from the control value of 0 μM, so when the control value for each condition was reconstituted with a fold change (Fold Change) set to 1, it was 10 μM or less. At 50 µM or more, the survival rate was significantly increased, indicating that the survival rate depends more on the concentration of RNP than on the timing of administration (see Fig. 28).

The highest viability was observed at 500 μM, but this was because the Rhodamine signal in the RNP partially overlapped with the emission spectrum of Luciferin, which is used to measure cell viability, and too high an RNP concentration affected the results. 100 μM and 50 μM were set as effective concentrations.

<Discussion>
In administering RNP, this experiment was conducted to observe the response at the cellular level over time and to analyze its behavior and effects in more detail.

In the above experimental example, only the average value of fluorescence intensity was calculated and compared. Based on this (see FIG. 29), the intracellular distribution amount that substantially affects cells was quantified by the area ratio.

In the study of the optimal administration time of RNP, the analysis immediately after administration showed a similar signal at 1 to 6 hours, and the highest value was shown at 24 hours, because there were many physical problems at the time of transplantation. One hour, when the penetration efficiency was the highest, was judged to be optimal. From the above, it was proved that the cell penetration of RNP is very rapid due to the structural characteristics of Micelle. However, even in the sample treated for 15 minutes, the signal ratio increased further after 4 days of continuous culture, and the distribution was almost the same as in the sample treated for 24 hours. was dissociated and the Rhodamine inside flowed into the cytoplasm, and it was thought that several days were necessary for this to occur.

In the verification of the optimal concentration of RNP, the amount of RNP also increased in a concentration-dependent manner, but the efficiency was similarly high at the dose concentration-to-signal ratio of 50 μM and 100 μM, and the signal was the highest at 500 μM, but the efficiency was 100 μM. was about 40% lower than the From this result, while 100 μM obtained in the above experimental example seems to be an appropriate concentration, it was necessary to verify whether not only the penetration rate but also the therapeutic effect showed the same efficiency.

In the verification of the antioxidant capacity of RNP, we first qualitatively and quantitatively analyzed the antioxidant effect and cell penetration rate during oxidative stress. In the qualitative evaluation of antioxidant effect, RNP was administered before OGD treatment, and after applying OGD-induced oxidative stress, further reperfusion stress was applied to maximize cell damage. As a result, compared with the hypoxia/NB27 cultured cells in the control group, the cells after OGD without RNP administration showed cytoplasmic collapse and dendrite and axonal damage in all fields of view. was found to be large. However, it was also confirmed that at 50 μM or more, the cell shape was maintained and the damaged area remained at the area where the RNP was localized. Furthermore, the fact that the area ratio decreased over time in imaging of the same sample immediately after OGD and after reperfusion was confirmed by the experiment in Example 8 (1) that RNP did not leak in about 4 days, and that the cell morphology From the comparison, it is suggested that the area ratio of the constant amount of RNP was relatively decreased due to the recovery of the cells and the expansion of the area of the entire cytoplasm. In addition, in the measurement of the cell permeability of RNP with OGD loading, it was confirmed that the RNP-positive signal increased markedly at 10 μM and 500 μM after OGD pretreatment compared to OGD pretreatment. The difference is thought to be due to protein denaturation and cell membrane loosening. The distribution of RNPs suggests that the RNPs once taken up are adjacent to and adhere to intracellular organelles, especially the endoplasmic reticulum. confirmed.

In quantifying the antioxidant effect, RNP was administered before and after OGD, and the conditions were set so that both preventive and therapeutic effects could be identified. As a result, it became clear that the survival rate of cells increased in a concentration-dependent manner after administration of RNP, and no significant difference was observed from 50 μM to 500 μM. This again proves that the appropriate concentration of RNP is 50 μM to 100 μM, and suggests that it has not only a preventive effect but also an effective therapeutic effect on damage that has already occurred.     

Claims (10)

1. providing nanoparticles and mammalian cells based on a copolymer of formula (I) or formula (II);
   A method of modifying mammalian cells comprising the step of combining said provided nanoparticles and provided mammalian cells in vitro.
   
   Formula (I):
   

   

   In the above formula,
   A represents unsubstituted or substituted C ₁ -C ₁₂ ^alkyl and the substituent, if substituted, represents a formyl group, a group of formula R′R ^″ CH—, where R ^′ and R ^″ are independently and C ₁ -C ₄ alkoxy or R ^′ and R ^″ together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—,
   L ₁ represents a direct bond or a divalent linking group,
   L ₂ —R ₁ is a group in which L ₂ is —(CH ₂ ) _a —NH—(CH ₂ ) _a — or —(CH ₂ ) _a —O—(CH ₂ ) _a —, and R ₁ is represented by the formula
   

   

   any of the cyclic nitroxide radical residues represented by
   _R2 is chloro, bromo or hydroxyl;
   In the above, the repeating units in the polymer backbone with L ₂ -R ₁ and R ₂ are randomly present, the unit p with L ₂ -R ₁ is in the range of 2 to 100, and R ₂ is absent (zero) or is in the range 1 to 20, provided that the total number of these units is n,
   Z is H, SH or S(C=S)-Ph, Ph represents phenyl optionally substituted with 1 or 2 methyl or methoxy;
   each a is independently 0 or an integer from 1 to 5;
   m represents an integer from 2 to 10,000,
   n represents an integer of 3 to 100;
   
   Formula (II):
   

   

   In the above formula,
   x+y is an integer from 5 to 1400, n is an integer from 5 to 1400, x+y:n is in a ratio of 1:1 to 5, x:y is in a ratio of 1 to 20:1, x: y is in a ratio of 1 to 60:1;
   (1) In the repeating unit with y, in L-PEG-A, L is O or NH, and PEG is represented by the following formula,
   

   

   wherein p is an integer from 1 to 6, q is an integer from 5 to 500,
   A is
   A1: represents an unsubstituted or substituted C ₁ -C ₁₂ alkoxy group, where the substituents when substituted are a formyl group, a formula R ^a R ^b CH— (wherein R ^a and R ^b are independently C ₁ -C ₄ alkoxy or R ¹ and R ² taken together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—. , or A2: the following formula
   

   

   represents a group represented by
   The repeating unit accounts for 2% to 15% of the total units of the copolymer represented by formula (I),
   (2) in the repeating unit with the subscript x,
   (a) either one of R ₁ or R ₂ is
   a1: the following formula
   

   

   , where
   TEMPO is the following formula
   

   

   any of the cyclic nitroxide radical residues represented by
   any residue represented by
   a2: the following formula
   

   

   A residue represented by either
   a3: the following formula
   

   

   is represented by
   wherein R ₃ is a C _1-3 alkyl group and r is an integer from 2 to 6, the residue
   A residue selected from the group consisting of
   the other is OH, or (b) R ₁ and R ₂ together represent —O— and form a cyclic anhydride residue, or (c) R ₁ and R ₂ are each OH represents
   However, in the repeating unit marked with x,
   (i) either one of R ₁ or R ₂ in (a) comprises the residue of a1, or (ii) either one of R ₁ or R ₂ in (a) includes the residue of a1 or (iii) either one of R ₁ or R ₂ of (a) comprises a residue of a1 and a residue of a3, or (iv) R ₁ of (a) or Either one of R ₂ comprises residues a1, residues a2 and residues a3, or (v) the repeating units marked with x are the above (i), (ii) to (iv) ) may contain a group defined in (b) or (c) in addition to the residue defined in
   Here, the units containing each of the above residues and groups are present independently and randomly, and the units containing the residues defined in (a) account for 15% to 60% of the total number of repeating units marked with x. occupy
2. 2. The modification method according to claim 1, wherein the prepared mammalian cells may be damaged in advance by stress in an external environment, and when the stress is applied, the modification is caused by the stress. Said modification method, wherein said modification recovers cells from damage, while said modification protects cells from said stress when not subjected to said stress.
3. 2. The modified method of claim 1, wherein combining the nanoparticles and the mammalian cells in vitro comprises mixing the nanoparticles and the mammalian cells in a medium for culturing the mammalian cells. said method of modification, comprising the step of:
4. 2. The modified method of claim 1, wherein combining the nanoparticles and the mammalian cells in vitro comprises mixing the nanoparticles and the mammalian cells in a medium for culturing the mammalian cells. permeating said nanoparticles into said mammalian cells by doing so.
5. An in vitro combination of nanoparticles based on copolymers of formula (I) or formula (II) and mammalian cells.
   
   Formula (I):
   

   

   In the above formula,
   A represents unsubstituted or substituted C ₁ -C ₁₂ ^alkyl and the substituent, if substituted, represents a formyl group, a group of formula R′R ^″ CH—, where R ^′ and R ^″ are independently and C ₁ -C ₄ alkoxy or R ^′ and R ^″ together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—,
   L ₁ represents a direct bond or a divalent linking group,
   L ₂ —R ₁ is a group in which L ₂ is —(CH ₂ ) _a —NH—(CH ₂ ) _a — or —(CH ₂ ) _a —O—(CH ₂ ) _a —, and R ₁ is represented by the formula
   

   

   any of the cyclic nitroxide radical residues represented by
   _R2 is chloro, bromo or hydroxyl;
   In the above, the repeating units in the polymer backbone with L ₂ -R ₁ and R ₂ are randomly present, the unit p with L ₂ -R ₁ is in the range of 2 to 100, and R ₂ is absent (zero) or is in the range 1 to 20, provided that the total number of these units is n,
   Z is H, SH or S(C=S)-Ph, Ph represents phenyl optionally substituted with 1 or 2 methyl or methoxy;
   each a is independently 0 or an integer from 1 to 5;
   m represents an integer from 2 to 10,000,
   n represents an integer of 3 to 100;
   
   Formula (II):
   

   

   In the above formula,
   x+y is an integer from 5 to 1400, n is an integer from 5 to 1400, x+y:n is in a ratio of 1:1 to 5, x:y is in a ratio of 1 to 20:1, x: y is in a ratio of 1 to 60:1;
   (1) In the repeating unit with y, in L-PEG-A, L is O or NH, and PEG is represented by the following formula,
   

   

   wherein p is an integer from 1 to 6, q is an integer from 5 to 500,
   A is
   A1: represents an unsubstituted or substituted C ₁ -C ₁₂ alkoxy group, where the substituents when substituted are a formyl group, a formula R ^a R ^b CH— (wherein R ^a and R ^b are independently C ₁ -C ₄ alkoxy or R ¹ and R ² taken together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—. , or A2: the following formula
   

   

   represents a group represented by
   The repeating unit accounts for 2% to 15% of the total units of the copolymer represented by formula (I),
   (2) in the repeating unit with the subscript x,
   (a) either one of R ₁ or R ₂ is
   a1: the following formula
   

   

   , where
   TEMPO is the following formula
   

   

   any of the cyclic nitroxide radical residues represented by
   any residue represented by
   a2: the following formula
   

   

   A residue represented by either
   a3: the following formula
   

   

   is represented by
   wherein R ₃ is a C _1-3 alkyl group and r is an integer from 2 to 6, the residue
   A residue selected from the group consisting of
   the other is OH, or (b) R ₁ and R ₂ together represent —O— and form a cyclic anhydride residue, or (c) R ₁ and R ₂ are each OH represents
   However, in the repeating unit marked with x,
   (i) either one of R ₁ or R ₂ in (a) comprises the residue of a1, or (ii) either one of R ₁ or R ₂ in (a) includes the residue of a1 or (iii) either one of R ₁ or R ₂ of (a) comprises a residue of a1 and a residue of a3, or (iv) R ₁ of (a) or Either one of R ₂ comprises residues a1, residues a2 and residues a3, or (v) the repeating units marked with x are the above (i), (ii) to (iv) ) may contain a group defined in (b) or (c) in addition to the residue defined in
   Here, the units containing each of the above residues and groups are present independently and randomly, and the units containing the residues defined in (a) account for 15% to 60% of the total number of repeating units marked with x. occupy
6. 6. The formulation of claim 5, wherein said combined form is such that said nanoparticles and said mammalian cells coexist in a medium in which a mammal is cultured.
7. 6. The method of claim 5, wherein said combined form is such that said nanoparticles and said mammalian cells coexist in a medium in which said mammal is cultured, and said mammalian cells are permeated with said nanoparticles. compound.
8. A preparation for modifying mammalian cells in vitro, comprising nanoparticles based on a copolymer of formula (I) or formula (II) as an active ingredient.
   Formula (I):
   

   

   In the above formula,
   A represents unsubstituted or substituted C ₁ -C ₁₂ ^alkyl and the substituent, if substituted, represents a formyl group, a group of formula R′R ^″ CH—, where R ^′ and R ^″ are independently and C ₁ -C ₄ alkoxy or R ^′ and R ^″ together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—,
   L ₁ represents a direct bond or a divalent linking group,
   L ₂ —R ₁ is a group in which L ₂ is —(CH ₂ ) _a —NH—(CH ₂ ) _a — or —(CH ₂ ) _a —O—(CH ₂ ) _a —, and R ₁ is represented by the formula
   

   

   any of the cyclic nitroxide radical residues represented by
   _R2 is chloro, bromo or hydroxyl;
   In the above, the repeating units in the polymer backbone with L ₂ -R ₁ and R ₂ are randomly present, the unit p with L ₂ -R ₁ is in the range of 2 to 100, and R ₂ is absent (zero) or is in the range 1 to 20, provided that the total number of these units is n,
   Z is H, SH or S(C=S)-Ph, Ph represents phenyl optionally substituted with 1 or 2 methyl or methoxy;
   each a is independently 0 or an integer from 1 to 5;
   m represents an integer from 2 to 10,000,
   n represents an integer of 3 to 100;
   
   Formula (II):
   

   

   In the above formula,
   x+y is an integer from 5 to 1400, n is an integer from 5 to 1400, x+y:n is in a ratio of 1:1 to 5, x:y is in a ratio of 1 to 20:1, x: y is in a ratio of 1 to 60:1;
   (1) In the repeating unit with y, in L-PEG-A, L is O or NH, and PEG is represented by the following formula,
   

   

   wherein p is an integer from 1 to 6, q is an integer from 5 to 500,
   A is
   A1: represents an unsubstituted or substituted C ₁ -C ₁₂ alkoxy group, where the substituents when substituted are a formyl group, a formula R ^a R ^b CH— (wherein R ^a and R ^b are independently C ₁ -C ₄ alkoxy or R ¹ and R ² taken together represent —OCH ₂ CH ₂ O—, —O(CH ₂ ) ₃ O— or —O(CH ₂ ) ₄ O—. , or A2: the following formula
   

   

   represents a group represented by
   The repeating unit accounts for 2% to 15% of the total units of the copolymer represented by formula (I),
   (2) in the repeating unit with the subscript x,
   (a) either one of R ₁ or R ₂ is
   a1: the following formula
   

   

   , where
   TEMPO is the following formula
   

   

   any of the cyclic nitroxide radical residues represented by
   any residue represented by
   a2: the following formula
   

   

   A residue represented by either
   a3: the following formula
   

   

   is represented by
   wherein R ₃ is a C _1-3 alkyl group and r is an integer from 2 to 6, the residue
   A residue selected from the group consisting of
   the other is OH, or (b) R ₁ and R ₂ together represent —O— and form a cyclic anhydride residue, or (c) R ₁ and R ₂ are each OH represents
   However, in the repeating unit marked with x,
   (i) either one of R ₁ or R ₂ in (a) comprises the residue of a1, or (ii) either one of R ₁ or R ₂ in (a) includes the residue of a1 or (iii) either one of R ₁ or R ₂ of (a) comprises a residue of a1 and a residue of a3, or (iv) R ₁ of (a) or Either one of R ₂ comprises residues a1, residues a2 and residues a3, or (v) the repeating units marked with x are the above (i), (ii) to (iv) ) may contain a group defined in (b) or (c) in addition to the residue defined in
   Here, the units containing each of the above residues and groups are present independently and randomly, and the units containing the residues defined in (a) account for 15% to 60% of the total number of repeating units marked with x. occupy
9. 9. The preparation of claim 8, wherein said modification protects mammalian cells from stress in the external environment or restores mammalian cell damage caused by said stress.
10. 9. The preparation of claim 8, wherein said protection of mammalian cells results in improved engraftment and/or improved differentiation of the transplanted cells into cells of interest when the cells are transplanted.

Images