WO2023064707A1 - Compounds and methods for reducing tau expression - Google Patents

Compounds and methods for reducing tau expression Download PDF

Info

Publication number
WO2023064707A1
WO2023064707A1 PCT/US2022/077740 US2022077740W WO2023064707A1 WO 2023064707 A1 WO2023064707 A1 WO 2023064707A1 US 2022077740 W US2022077740 W US 2022077740W WO 2023064707 A1 WO2023064707 A1 WO 2023064707A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligomeric
modified
modified oligonucleotide
certain embodiments
oligomeric compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/077740
Other languages
English (en)
French (fr)
Inventor
Susan M. Freier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to JP2024520945A priority Critical patent/JP2024539596A/ja
Priority to US18/699,132 priority patent/US20250340872A1/en
Priority to EP22881922.3A priority patent/EP4413138A4/en
Publication of WO2023064707A1 publication Critical patent/WO2023064707A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/343Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • RNAi agents, methods, and pharmaceutical compositions for reducing the amount or activity of tan RNA in a cell or animal, and in certain instances reducing the amount of tan protein in a cell or animal.
  • Such agents, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease.
  • neurodegenerative diseases include tauopathies, Alzheimer’s disease (AD), frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, or Dravet’s Syndrome.
  • Such symptoms or hallmarks include loss of memory, loss of motor function, and increase in the number and/or volume of neurofibrillary inclusions.
  • exon 10 leads to inclusion of the microtubule binding domain encoded by exon 10. Since there are 3 microtubule binding domains elsewhere in tan, this tan isoform (with exon 10 included) is termed 4R tan, where ‘R’ refers to the number of repeats of microtubule binding domains. Tan without exon 10 is termed 3R tan. Since more microtubule binding domains (4R compared with 3R) increases the binding to microtubules, 4R tan presumably significantly increases microtubule binding and assembly. The ratio of 3R/4R tan is developmentally regulated, with fetal tissues expressing exclusively 3R tan and adult human tissues expressing approximately equal levels of 3R/4R tau. Deviations from the normal ratio of 3R/4R tan are characteristic of neurodegenerative FTD tauopathies. It is not known how changing the 3R/4R tau ratio at a later stage in the adult animal will affect tau pathogenesis.
  • tan may be important in neurodegenerative syndromes.
  • neurofibrillary inclusions are aggregates of hyperphosphorylated tan protein.
  • amyloid beta containing plaques neurofibrillary inclusions are a hallmark of Alzheimer's disease and correlate significantly with cognitive impairment.
  • 95% of tan accumulations in AD are found in neuronal processes and is termed neuritic dystrophy. The process(es) whereby this microtubule associated protein becomes disengaged from microtubules and forms accumulations of proteins and how this relates to neuronal toxicity is not well understood.
  • Neuronal tan inclusions are a pathological characteristic of not only Alzheimer's disease, but also a subset of frontotemporal dementia (FTD), PSP, and CBD.
  • FTD frontotemporal dementia
  • PSP frontotemporal dementia
  • CBD CBD
  • the link between tan and neurodegeneration was solidified by the discovery that mutations in the tan gene cause a subset of FTD.
  • FTD frontotemporal dementia
  • These genetic data have also highlighted the importance of the 3R:4R ratio of tan. Many of the tan mutations that cause FTD lead to a change in tan splicing, which leads to preferential inclusion of exon 10, and thus to increased 4R tan.
  • the overall tan levels are normal. Whether the tan isoform change or the amino acid change or both cause neurodegeneration remains unknown.
  • Recent data suggest that PSP may also be associated with an increased 4R:3R tan ratio.
  • mice To help understand the influence of tan ratios on neurodegeneration, a mouse model based on one of the splicing tan mutations (N279K) has been generated using a minigene that includes the tau promoter and the flanking intronic sequences of exon 10. As in humans, these mice demonstrate increased levels of 4R tau compared with transgenics expressing WT tau and develop behavioral and motor abnormalities as well as accumulations of aggregated tau in the brain and spinal cord.
  • N279K splicing tan mutations
  • Tau protein has been associated with multiple diseases of the brain including Alzheimer's disease, FTD, PSP, CBD, dementia pugilistica, parkinsonism linked to chromosome, Lytico-Bodig disease, tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, argyrophilic grain disease, corticobasal degeneration or frontotemporal lobar degeneration and others. Tan-associated disorders such as AD are the most common cause of dementia in the elderly. AD affects an estimated 15 million people worldwide and 40% of the population above 85 years of age. AD is characterized by two pathological hallmarks: tau neurofibrillary inclusions (NFT) and amyloid-P (A ) plaques.
  • NFT tau neurofibrillary inclusions
  • A amyloid-P
  • RNAi agents, methods and pharmaceutical compositions for reducing the amount or activity of tau RNA and in certain embodiments reducing the amount of tau protein in a cell or animal.
  • the animal has a neurodegenerative disease.
  • the neurodegenerative disease is a tauopathy, Alzheimer’s disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, or Dravet’s Syndrome.
  • RNAi agents useful for reducing expression of tau RNA are oligomeric duplexes.
  • the neurodegenerative disease is a tauopathy, Alzheimer’s disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, or Dravet’s Syndrome.
  • the neurodegenerative disease is AD or FTD.
  • the symptom or hallmark includes loss of memory, loss of motor function, and increase in the number and/or volume of neurofibrillary inclusions.
  • 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety.
  • a 2’-deoxynucleoside is a 2’-p-D-deoxynucleoside and comprises a 2’-p-D-deoxyribosyl sugar moiety, which has the P-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2’-OMe means a 2’-OCH 3 group in place of the 2 ’-OH group of a furanosyl sugar moiety.
  • A“2’-O-methyl sugar moiety” or “2’-OMe sugar moiety” or “2’-O-methylribosyl sugar moiety” means a sugar moiety with a 2’-OCH 3 group in place of the 2’-OH group of a furanosyl (e.g., ribosyl) sugar moiety.
  • a 2’-OMe sugar moiety is in the fl-D-ribos l configuration.
  • 2’-OMe nucleoside or “2’-OMe modified nucleoside” means a nucleoside comprising a 2’- OMe sugar moiety.
  • 2’-F nucleoside or “2’-F modified nucleoside” means a nucleoside comprising a 2’-F modified sugar moiety.
  • xylo 2’-F means a 2’-F sugar moiety in the p-D-xylosyl configuration.
  • 2 ’-substituted nucleoside means a nucleoside comprising a 2’-substituted furanosyl sugar moiety.
  • 2 ’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'- substituent group other than H or OH.
  • 3’ target site refers to the 3 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • administering means providing a pharmaceutical agent or composition to a subject.
  • RNAi oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
  • the symptom or hallmark is loss of memory, loss of motor function, and increase in the number and/or volume of neurofibrillary inclusions.
  • the progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine ( m C) and guanine (G).
  • Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art and are not considered complementary nucleobases as defined herein unless indicated otherwise.
  • inosine can pair, but is not considered complementary, with adenosine, cytosine, or uracil.
  • oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • conjugate group means a group of atoms that is directly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that modifies one or more properties of a molecule compared to the identical molecule lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • constrained ethyl or “cEf ’ or “cEt modified sugar moiety” means a -D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4 ’-carbon and the 2 ’-carbon of the -D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
  • cEt nucleoside means a nucleoside comprising cEt modified sugar.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • diluent means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition can be a liquid, e.g., aCSF, PBS, or saline solution.
  • double-stranded in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another.
  • the two strands of a double-stranded region are separate molecules.
  • the two strands are regions of the same molecule that has folded onto itself (e.g., a hairpin structure).
  • duplex or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to antisense agent-mediated, and in particular RNAi agent-mediated, reduction of the amount or activity of the target nucleic acid.
  • intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • inverted nucleoside means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage, as shown herein.
  • inverted sugar moiety means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage.
  • lipid nanoparticle is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an RNAi agent or a plasmid from which an RNAi agent is transcribed.
  • a pharmaceutically active molecule such as a nucleic acid molecule, e.g., an RNAi agent or a plasmid from which an RNAi agent is transcribed.
  • LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of each of which are hereby incorporated herein by reference.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • mismatch or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • neurodegenerative disease means a condition marked by progressive loss of function or structure, including loss of neuronal function and death of neurons.
  • the neurodegenerative disease is a tauopathy, Alzheimer’s disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, or Dravef s Syndrome.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleoside overhang refers to unpaired nucleotides at either or both ends of an oligomeric duplex formed by hybridization two oligonucleotides.
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means an inactive or less active form of a compound which, when administered to a subject, is metabolized to form the active, or more active, compound.
  • a prodrug comprises a cell-targeting moiety and at least one active compound.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics.
  • RNAi agents may comprise conjugate groups and/or terminal groups.
  • an RNAi agent modulates the amount, activity, and/or activity of a target nucleic acid.
  • the term RNAi agent excludes antisense compounds that act through RNase H.
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • standard in vitro assay means the assay described in Example 2 and reasonable variations thereof.
  • stereorandom or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • the number of molecules having the (N) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the ( ) configuration of the stereorandom chiral center.
  • the stereorandom chiral center is not racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety.
  • a stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoroamidate intemucleoside linkage.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • stabilized phosphate group means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’-phosphate as naturally occurs on DNA or RNA.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2’-OH(H) p-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) -D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • symptom or “hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing the subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • a hallmark is apparent on a brain MRI scan.
  • symptoms and hallmarks include loss of memory, loss of motor function, and/or increase in the number and/or volume of neurofibrillary inclusions.
  • target nucleic acid and “target RNA” mean a nucleic acid that an oligomeric compound is designed to affect.
  • Target RNA means an mRNA transcript and includes pre-mRNA and mRNA unless otherwise specified.
  • Treating disease means any disease or disorder associated with any tan nucleic acid or expression product thereof.
  • diseases may include a neurodegenerative disease.
  • Such neurodegenerative diseases may include tauopathies, Alzheimer’s disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, and Dravet’s Syndrome.
  • Tan RNA means any messenger RNA (mRNA) expression product of a DNA sequence encoding tan.
  • Tan nucleic acid means any nucleic acid encoding tan.
  • a tan nucleic acid includes a DNA sequence encoding tan, an RNA sequence transcribed from DNA encoding tan (including genomic DNA comprising introns and exons), and an mRNA sequence encoding tan.
  • “Tan mRNA” means an mRNA encoding a tan protein. Tan nucleic acid may also be referred to herein as mammalian microtubule-associated protein tan (MAPT), including human microtubule-associated protein tan (MAPT).
  • MTT mammalian microtubule-associated protein tan
  • MAT human microtubule-associated protein tan
  • Tan protein means the polypeptide expression product of a tan nucleic acid.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • treating means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • Embodiment 14 The oligomeric compound of embodiment 11, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.
  • Embodiment 18 The oligomeric compound of any of embodiments 1-17, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 19 The oligomeric compound of embodiment 18, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 22 The oligomeric compound of any of embodiments 1-18, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
  • Embodiment 27 The oligomeric compound of embodiment 26, wherein the modified nucleobase is 5- methylcytosine.
  • Embodiment 33 The oligomeric compound of embodiment 31, wherein the conjugate moiety is selected from a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, Cl 8 alkenyl, C17 alkenyl, Cl 5 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl
  • Embodiment 55 The oligomeric duplex of any of embodiments 39-52, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
  • Embodiment 64 The oligomeric duplex of any of embodiments 39-63, wherein the second modified oligonucleotide comprises a terminal group.
  • Embodiment 67 The oligomeric duplex of any of embodiments 39-66, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.
  • Embodiment 68 The oligomeric duplex of embodiment 67, wherein the modified oligonucleotide of the first oligomeric compound has a sugar motif (from 5' to 3') of yfyfyfylyfylylylyfylyyy and the second modified oligonucleotide has a sugar motif (from 5' to 3') of fyfylylylylylylylyfyf, wherein each “y” represents a 2’-OMe sugar moiety and each “f ’ represents a 2’-F sugar moiety.
  • Embodiment 76 A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of any of embodiments 37-69, the antisense agent of any of embodiments 70-71, or the population of any of embodiments 72-75, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 78 The pharmaceutical composition of embodiment 777, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the oligomeric duplex, the antisense agent, or the population, and phosphate buffered saline or artificial cerebrospinal fluid.
  • Embodiment 79 A method comprising administering to an animal the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of any of embodiments 37-69, the antisense agent of any of embodiments 70- 71, the population of any of embodiments 72-75, or the pharmaceutical composition of any of embodiments 76-78.
  • Embodiment 87 The method of embodiment 82 or embodiment 83, wherein the tan-associated disease is
  • Embodiment 88 The method of embodiment 82 or embodiment 83, wherein the tan-associated disease is progressive supranuclear palsy (PSP).
  • PSP progressive supranuclear palsy
  • Embodiment 90 The method of embodiment 82 or embodiment 83, wherein the tan-associated disease is corticobasal ganglionic degeneration (CBD).
  • CBD corticobasal ganglionic degeneration
  • Embodiment 92 The method of embodiment 82 or embodiment 83, wherein the tan-associated disease is
  • Embodiment 93 The method of any of embodiments 83-92, wherein at least one symptom or hallmark of the tan-associated disease is ameliorated.
  • Embodiment 95 A method of reducing tan in a cell comprising contacting the cell with the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of any of embodiments 37-69, the antisense agent of any of embodiments 70-71, the population of any of embodiments 72-75, or the pharmaceutical composition according to any of embodiments 76-78.
  • Embodiment 101 The use of any of embodiments 98-100, wherein at least one symptom or hallmark is ameliorated.
  • non-bicyclic modifed sugar moieties comprise a substituent group at the 2 ’-position.
  • substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F, -OCH 3 (“OMe” or “O-methyl”), and -O(CH 2 )2OCH 3 (“MOE”).
  • these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • DMAOE O(CH 2 ) 2 O(CH 2 ) 2 N(CH3) 2
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring p-D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • Modified furanosyl sugar moieties described herein are in the -D-ribosyl isomeric configuration unless otherwise specified.
  • oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ or inverted 5’ to 3’.
  • the linkage is at the 2’ position
  • the 2 ’-substituent groups may instead be at the 3 ’-position.
  • Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
  • F-HNA fluoro hexitol nucleic acid
  • F-HNA fluoro hexitol nucleic acid
  • F-HNA fluoro hexitol nucleic acid
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
  • morpholinos may be modified, for example, by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are refered to herein as “modified morpholinos.”
  • antisense oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 15-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17- 23 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 19-29 linked nucleosides.
  • At least one nucleoside comprises a 2’-F modified sugar. In certain embodiments, at least 2 nucleosides comprise 2’-F modified sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2’-F modified sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2’-F modified sugar moieties. In certain embodiments, one, but not more than one nucleoside comprises a 2’-F modified sugar. In certain embodiments, 1 or 2 nucleosides comprise 2’-F modified sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2’-F modified sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2’-F modified sugar moieties.
  • sense oligonucleotides consist of 21 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 22 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 23 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 25 linked nucleosides.
  • 1-4 nucleosides of an sense oligonucleotide is/are DNA.
  • the 1-4 DNA nucleosides are at one or both ends of the sense oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 11-39, 69-112, 157-204, 253- 290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, 1045-1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, 1045-1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 40-68, 113-156, 205-252, 291-328, 376-422, 453-482, 517-550, 581-610, 651-690, 722-
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide comprise any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 329/376, 330/377, 691/722, 694/725, 696/727, 721/752, 759/905, 774/920, 787/933, 848/994, 850/996, 855/1001, 857/1003, 858/1004, 860/1006, 861/1007, 863/1009, 864/1010, 866/1012, 890/1036, 891/1037, 1045/1444, 1050/1449, 1115
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety.
  • suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2’-4’ bridge selected from -O-CH2- and -O- CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety, a 2’-F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety.
  • At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified intemucleoside linkage.
  • the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage.
  • At least one of the first or second intemucleoside linkages from the 5’ end and/or the 3 ’ end of the second modified oligonucleotide comprises a mesyl phosphoramidate intemucleoside linkage.
  • each intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate intemucleoside linkage.
  • At least one nucleobase of the first modified oligonucleotide and/or the second modified oligonucleotide can be a modified nucleobase.
  • the modified nucleobase is 5 -methylcytosine.
  • the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside.
  • the stabilized phosphate group comprises a cyclopropyl phosphorate or an (EJ-vinyl phosphorate.
  • the first modified oligonucleotide can comprise a conjugate group.
  • the conjugate group comprises a conjugate linker and a conjugate moiety.
  • the conjugate group is attached to the first modified oligonucleotide at the 5 ’-end of the first modified oligonucleotide.
  • the conjugate group is attached to the first modified oligonucleotide at the 3’- end of the modified oligonucleotide.
  • the conjugate group comprises N-acetyl galactosamine.
  • an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein.
  • an antisense agent which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of Tan nucleic acid through the activation of RISC/Ago2.
  • Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes.
  • an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein.
  • oligomeric compounds comprise a terminal group.
  • oligomeric compounds comprise a phosphorus-containing group at the 5 ’-end of the antisense oligonucleotide and/or the sense oligonucleotide.
  • the terminal group is a phosphate stabilized phosphate group.
  • a conjugate linker comprises a pyrrolidine.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a oligomeric compound comprises two oligonucleotides each consisting of a specified number or range of linked nucleosides and the antisense oligonucleotide having a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker- nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotides of an oligomeric compound and are not used in determining the percent complementarity of the antisense oligonucleotide with the reference nucleic acid.
  • conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, and a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • oligomeric duplex includes a two nucleoside overhang at the 3 ’end of the antisense oligonucleotide, and a blunt end at the 5’-end of the antisense oligonucleotide.
  • the oligomeric duplexes described herein comprise:
  • the antisense oligonucleotide of the oligomeric duplex has a stabilized phosphate group at the 5’ end of thereof.
  • the oligomeric duplex additionally has two phosphorothioate intemucleoside linkages between the terminal three nucleotides at both the 5 ’-end of the sense oligonucleotide and at the 5 ’-end of the antisense oligonucleotide.
  • every nucleoside in the sense oligonucleotide and the antisense oligonucleotide of the oligomeric duplex is a modified nucleoside.
  • each nucleoside is independently modified with a 2’-O-methyl or 2’-fluoro, e.g. in an alternating motif.
  • the oligomeric duplex comprises a conjugate.
  • the type of modifications contained in the alternating motif may be the same or different.
  • the alternating pattern i.e., modifications on every other nucleoside, may be the same, but each of the sense oligonucleotide or antisense oligonucleotide can be selected from several possibilities of modifications within the alternating motif such as "ABABAB ... ", "ACACAC ... " "BDBDBD ... " or "CDCDCD ... ,” etc.
  • the sense oligonucleotide when paired with the antisense oligonucleotide in the oligomeric duplex the alternating motif in the sense oligonucleotide may start with "ABABAB” from 5' -3' of the oligonucleotide and the alternating motif in the antisense oligonucleotide may start with "BAB ABA" from 5' -3 'of the oligonucleotide within the duplex region.
  • the introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense oligonucleotide and/or antisense oligonucleotide interrupts the initial modification pattern present in the sense oligonucleotide and/or antisense oligonucleotide.
  • This interruption of the modification pattern of the sense and/or antisense oligonucleotide by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense oligonucleotide surprisingly enhances the gene silencing activity to the target gene.
  • the modification of the nucleotide next to the motif is a different modification than the modification of the motif.
  • the portion of the sequence containing the motif is " ... NaYYYNb- • where "Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and "Na” and “Nb” represent a modification to the nucleotide next to the motif "YYY” that is different than the modification of Y, and where Na and Nb can be the same or different modifications.
  • Na and/or Nb may be present or absent when there is a wing modification present.
  • the sense oligonucleotide may be represented by formula (I): 5' n p -N a -(X X X )i-N b -Y Y Y -N b -(Z Z Z ) r N a -nq 3' (I) wherein: i and j are each independently 0 or 1; p and q are each independently 0-6; each N a independently represents 0-25 linked nucleosides comprising at least two differently modified nucleosides; each Nb independently represents 0-10 linked nucleosides; each n p and nq independently represent an overhanging nucleoside; wherein N b and Y do not have the same modification; and
  • the YYY motif occurs at or near the cleavage site of the target nucleic acid.
  • the YYY motif can occur at or near the vicinity of the cleavage site (e.g., can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13) of the sense oligonucleotide , the count starting from the 1 st nucleotide from the 5’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end.
  • k is 1 and 1 is 0, or k is 0 and 1 is 1 , or both k and 1 are 1.
  • k is 0 and 1 is 0 and the antisense oligonucleotide may be represented by the formula: 5’ np’-Na’-Y’Y’Y’-Na’-n,’ 3’ (la).
  • Each X’, Y’, and Z’ may be the same or different from each other.
  • XXX, YYY, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • each Nb independently represents 1-10, 1-7, 1-5, or 1-4 linked nucleosides.
  • Each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • each N b , N b ’ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
  • Each N a , N a ’ independently 2-20, 2-15, or 2-10 linked nucleosides.
  • Each N a , N a ’, Nb, Nb’ independently comprises modifications of alternating pattern.
  • At least one of the Y nucleotides may form a base pair with one of the Y’ nucleotides.
  • at least two of the Y nucleotides may form base pairs with the corresponding Y’ nucleotides; or all three of the Y nucleotides may form base pairs with the corresponding Y’ nucleotides.
  • the modification is a 2’- NMA modification.
  • each nucleoside of antisense oligonucleotide is paired in the duplex region (i.e., the antisense oligonucleotide has no overhanging nucleosides).
  • the antisense oligonucleotide includes unpaired nucleosides at the 3 ’-end and/or the 5’end (overhanging nucleosides).
  • each nucleoside of sense oligonucleotide is paired in the duplex region (i.e., the sense oligonucleotide has no overhanging nucleosides).
  • oligomeric compounds comprise or consist of an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • oligomeric duplexes comprise an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system (CNS). Such tissues include the cortex, spinal cord, and the hippocampus.
  • oligomeric compounds, oligomeric duplexes, or antisense agents described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • the oligomeric compound or oligomeric duplex is an RNAi agent.
  • the CSF is artificial CSF (aCSF).
  • a pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid.
  • a pharmaceutical composition consists essentially of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • compositions comprising one or more oligomeric compounds, oligomeric duplexes, or antisense agents provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodmgs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.
  • a prodmg can include the incorporation of additional nucleosides at one or both ends of oligomeric compound, oligomeric duplex, or antisense agent, which are cleaved by endogenous nucleases within the body, to form the active compound.
  • pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • oligomeric compounds, oligomeric duplexes, or antisense agents are in aqueous solution with sodium. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in aqueous solution with potassium. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in PBS. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in water. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in aCSF. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH. Certain Hotspot Regions
  • nucleobases 1754-1783 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric duplexes comprise antisense oligonucleotides complementary to a portion of nucleobases 1754-1783 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • the antisense oligonucleotide has a sugar motif of 5’ - yfyyyfyyyyyyyyfyfyyyyyyyyyyyyyyyyyyyyyy -3’, wherein each “y” represents a 2'-OMe sugar moiety, and each “f ’ represents a 2'-F sugar moiety.
  • nucleobases 2332-2362 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric duplexes comprise antisense oligonucleotides complementary to a portion of nucleobases 2332-2362 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • the antisense oligonucleotide has an intemucleoside linkage motif of 5’- ssooooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • the antisense oligonucleotide has a sugar motif of 5’- yfyyfyyyyyyyyfyfyyyyyyyyyyyyfyfyyyyyyyyyy -3’ , wherein each “y” represents a 2'-OMe sugar moiety, and each “f” represents a 2'-F sugar moiety.
  • nucleobase sequences of SEQ ID NOs: 890, 1330, and 1431 are complementary to a portion of nucleobases 6523-6552 of SEQ ID NO: 1.
  • nucleobase sequences of Compound Nos: 1703939, 1703471, and 1703942 are complementary to a portion of nucleobases 6523-6552 of SEQ ID NO: 1.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as ( ) or (S), as a or such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
  • RNAi compounds targeting human MAPT SEQ ID NO: 1
  • RNAi compound was treated with RNAi compound at a concentration of 15 nM by LipofectAMINE 2000, at a density of 30,000 cells per well. After a treatment period of 24 hours, total RNA was isolated from the cells and MAPT RNA levels were measured by quantitative real-time RTPCR. MAPT RNA was measured by human primer probe set RTS3104 (forward sequence AAGATTGGGTCCCTGGACAAT, designated herein as SEQ ID NO: 3; reverse sequence
  • RNAi compounds in the tables below consist of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide.
  • the antisense RNAi oligonucleotide is 23 nucleosides in length; has a sugar motif (from 5' to 3') of: yfyyyfyyyyyyyfyfyyyyyyyy, wherein each “y” represents a 2'-O-methylribosyl sugar, and each “f ’ represents a 2'-fluororibosyl sugar; and has an intemucleoside linkage motif (from 5' to 3') of: ssooooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage.
  • “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementary target nucleic acid sequence. “Stop site” indicates the 3'-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the target nucleic acid sequence. Each antisense RNAi oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above).
  • “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementary target nucleic acid sequence. “Stop site” indicates the 3'-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the target nucleic acid sequence.
  • Each antisense RNAi oligonucleotide listed in the tables below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NM 001377265.1), with a single mismatch at the 5’ end.
  • RNAi compounds described herein above were tested for their single dose effects on MAPT RNA in vitro.
  • the RNAi compounds were tested in a series of experiments that had the same culture conditions. Cultured A- 172 cells were treated with RNAi compound at a concentration of 1 n by LipofectAMINE
  • RNAiMAX at a density of 10,000 cells per well. After a treatment period of 72 hours, total RNA was isolated from the cells and MAPT RNA levels were measured by quantitative real-time RTPCR. MAPT RNA was measured by human primer probe set RTS3104 (described herein above). MAPT RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of MAPT RNA is presented in the table below as percent MAPT RNA relative to the amount of MAPT RNA in untreated control cells (% UTC).

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Medicinal Preparation (AREA)
PCT/US2022/077740 2021-10-07 2022-10-07 Compounds and methods for reducing tau expression Ceased WO2023064707A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2024520945A JP2024539596A (ja) 2021-10-07 2022-10-07 タウ発現を低減するための化合物及び方法
US18/699,132 US20250340872A1 (en) 2021-10-07 2022-10-07 Compounds and methods for reducing tau expression
EP22881922.3A EP4413138A4 (en) 2021-10-07 2022-10-07 COMPOUNDS AND METHODS FOR REDUCING TAU PROTEIN EXPRESSION

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163253516P 2021-10-07 2021-10-07
US63/253,516 2021-10-07
US202263317743P 2022-03-08 2022-03-08
US63/317,743 2022-03-08

Publications (1)

Publication Number Publication Date
WO2023064707A1 true WO2023064707A1 (en) 2023-04-20

Family

ID=85988949

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/077740 Ceased WO2023064707A1 (en) 2021-10-07 2022-10-07 Compounds and methods for reducing tau expression

Country Status (4)

Country Link
US (1) US20250340872A1 (cg-RX-API-DMAC7.html)
EP (1) EP4413138A4 (cg-RX-API-DMAC7.html)
JP (1) JP2024539596A (cg-RX-API-DMAC7.html)
WO (1) WO2023064707A1 (cg-RX-API-DMAC7.html)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11926827B2 (en) 2021-12-13 2024-03-12 Eli Lilly And Company MAPT RNA interference agents
WO2025027577A1 (en) * 2023-08-02 2025-02-06 Consejo Nacional De Investigaciones Científicas Y Técnicas (Conicet) Micrornas designed against the microtubule-associated protein tau for the treatment of tauopathies
WO2025032348A1 (en) 2023-08-10 2025-02-13 Harness Therapeutics Limited Functional nucleic acid
WO2025163334A1 (en) 2024-02-02 2025-08-07 Harness Therapeutics Limited Functional nucleic acid
WO2026002277A1 (zh) * 2024-06-28 2026-01-02 艾码生物科技(南京)有限公司 靶向Tau的RNA干扰方法、核酸及其应用
WO2026010722A1 (en) * 2024-07-03 2026-01-08 Voyager Therapeutics, Inc. Compositions and methods for regulating mapt
WO2026021537A1 (en) * 2024-07-26 2026-01-29 Qilu Pharmaceutical Co., Ltd. iRNA COMPOSITION AND METHOD OF USING SAME
WO2026026776A1 (zh) * 2024-08-01 2026-02-05 北京尧景基因技术有限公司 抑制APP基因表达的siRNA及其缀合物和应用
WO2026026592A1 (zh) * 2024-08-02 2026-02-05 北京尧景基因技术有限公司 抑制MAPT基因表达的siRNA及其缀合物和应用
US12551569B2 (en) 2024-03-31 2026-02-17 Arrowhead Pharmaceuticals, Inc. RNAi agents for inhibiting expression of microtubule associated protein tau (MAPT), compositions thereof, and methods of use
WO2026067655A1 (zh) * 2024-09-26 2026-04-02 大睿生物医药科技(上海)有限公司 调控TAU表达的dsRNA分子

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8779116B2 (en) * 2002-08-05 2014-07-15 University Of Iowa Research Foundation SiRNA-mediated gene silencing
WO2021188626A1 (en) * 2020-03-18 2021-09-23 University Of Massachusetts Oligonucleotides for mapt modulation

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW202246503A (zh) * 2013-07-19 2022-12-01 美商百健Ma公司 用於調節τ蛋白表現之組合物
US11077132B2 (en) * 2015-02-04 2021-08-03 F. Hoffmann-La Roche Ag Tau antisense oligomers and uses thereof
HUE065170T2 (hu) * 2016-09-29 2024-05-28 Biogen Ma Inc Vegyületek és módszerek a TAU expresszió csökkentésére
AU2021246024A1 (en) * 2020-03-30 2022-10-27 Alnylam Pharmaceuticals, Inc. Microtubule associated protein Tau (MAPT) iRNA agent compositions and methods of use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8779116B2 (en) * 2002-08-05 2014-07-15 University Of Iowa Research Foundation SiRNA-mediated gene silencing
WO2021188626A1 (en) * 2020-03-18 2021-09-23 University Of Massachusetts Oligonucleotides for mapt modulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4413138A4 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11926827B2 (en) 2021-12-13 2024-03-12 Eli Lilly And Company MAPT RNA interference agents
WO2025027577A1 (en) * 2023-08-02 2025-02-06 Consejo Nacional De Investigaciones Científicas Y Técnicas (Conicet) Micrornas designed against the microtubule-associated protein tau for the treatment of tauopathies
WO2025032348A1 (en) 2023-08-10 2025-02-13 Harness Therapeutics Limited Functional nucleic acid
WO2025163334A1 (en) 2024-02-02 2025-08-07 Harness Therapeutics Limited Functional nucleic acid
US12551569B2 (en) 2024-03-31 2026-02-17 Arrowhead Pharmaceuticals, Inc. RNAi agents for inhibiting expression of microtubule associated protein tau (MAPT), compositions thereof, and methods of use
WO2026002277A1 (zh) * 2024-06-28 2026-01-02 艾码生物科技(南京)有限公司 靶向Tau的RNA干扰方法、核酸及其应用
WO2026010722A1 (en) * 2024-07-03 2026-01-08 Voyager Therapeutics, Inc. Compositions and methods for regulating mapt
WO2026021537A1 (en) * 2024-07-26 2026-01-29 Qilu Pharmaceutical Co., Ltd. iRNA COMPOSITION AND METHOD OF USING SAME
WO2026026776A1 (zh) * 2024-08-01 2026-02-05 北京尧景基因技术有限公司 抑制APP基因表达的siRNA及其缀合物和应用
WO2026026592A1 (zh) * 2024-08-02 2026-02-05 北京尧景基因技术有限公司 抑制MAPT基因表达的siRNA及其缀合物和应用
WO2026067655A1 (zh) * 2024-09-26 2026-04-02 大睿生物医药科技(上海)有限公司 调控TAU表达的dsRNA分子

Also Published As

Publication number Publication date
US20250340872A1 (en) 2025-11-06
EP4413138A1 (en) 2024-08-14
EP4413138A4 (en) 2026-04-01
JP2024539596A (ja) 2024-10-29

Similar Documents

Publication Publication Date Title
WO2023064707A1 (en) Compounds and methods for reducing tau expression
JP7557469B2 (ja) Appの発現を低減するための化合物及び方法
IL289789B2 (en) Compounds and methods for lowering tau expression
WO2022246251A2 (en) Compounds for modulating unc13a expression
EP4281084A1 (en) Compounds and methods for reducing dux4 expression
EP4189090A1 (en) Compounds and methods for reducing app expression
CN117106778A (zh) 用于降低kcnt1表达的化合物和方法
WO2023092057A1 (en) Compounds and methods for modulating progranulin expression
WO2022246204A2 (en) Compounds for reducing ptbp1 expression
WO2022066956A1 (en) Compounds and methods for reducing apoe expression
EP4519441A2 (en) Rnai agents for modulating snca
WO2024064854A2 (en) Compounds and methods for reducing mecp2 expression
JP7799640B2 (ja) Plp1を調節するための化合物及び方法
WO2023164696A2 (en) Rnai agents of prion expression
WO2022072787A1 (en) Compounds for modulating chmp7
WO2019183440A1 (en) Methods for modulating fmr1 expression
WO2023183876A2 (en) Rnai agents of modulating plp1
US20250340874A1 (en) Compounds and methods for reducing pcdh19 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22881922

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024520945

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022881922

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022881922

Country of ref document: EP

Effective date: 20240507

WWP Wipo information: published in national office

Ref document number: 18699132

Country of ref document: US