WO2023057653A1 - Trps1 inhibitor for use in the treatment of rhabdomyosarcoma - Google Patents

Trps1 inhibitor for use in the treatment of rhabdomyosarcoma Download PDF

Info

Publication number
WO2023057653A1
WO2023057653A1 PCT/EP2022/078144 EP2022078144W WO2023057653A1 WO 2023057653 A1 WO2023057653 A1 WO 2023057653A1 EP 2022078144 W EP2022078144 W EP 2022078144W WO 2023057653 A1 WO2023057653 A1 WO 2023057653A1
Authority
WO
WIPO (PCT)
Prior art keywords
trps1
cells
expression
inhibitor
rhabdomyosarcoma
Prior art date
Application number
PCT/EP2022/078144
Other languages
French (fr)
Inventor
Julia VON MALTZAHN
Sören HÜTTNER
Björn VON EYSS
Original Assignee
Leibniz-Institut Für Alternsforschung - Fritz-Lipmann-Institut E.V. (Fli)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Leibniz-Institut Für Alternsforschung - Fritz-Lipmann-Institut E.V. (Fli) filed Critical Leibniz-Institut Für Alternsforschung - Fritz-Lipmann-Institut E.V. (Fli)
Publication of WO2023057653A1 publication Critical patent/WO2023057653A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Definitions

  • the present invention is in the field of treating a rhabdomyosarcoma.
  • the invention relates to a Tricho-Rhino-Phalangeal Syndrome Type I Protein (TRPS1) inhibitor for use in the treatment of rhabdomyosarcoma, preferably in a human subject.
  • the rhabdomyosarcoma is an embryonal rhabdomyosarcoma (EMRS).
  • EMRS embryonal rhabdomyosarcoma
  • the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells.
  • the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1-suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1-suppressive oligonucleotide.
  • TRPS1 is a GATA-like transcription factor with repressor function, which is controlling differentiation in various contexts, such as breast tissue or kidney nephrogenesis (Cornelissen et al., 2020; Gai et al., 2009).
  • the TRPS1 protein is highly conserved among species including humans and mice and contains nine zinc finger DNA binding domains.
  • One of the zinc fingers shares homology to GATA transcription factors, two zinc fingers are of the IKAROS type and six others lack homology to known DNA binding proteins.
  • the C-terminal IKAROS domain is required for TRPSI to function as a transcriptional repressor.
  • TRPS1 regulates fate and function of multiple cell types, including chondrocyte differentiation and apoptosis, mesenchymal stem cell differentiation, nephrogenesis, hair follicle cell proliferation and apoptosis, mammary epithelial cell differentiation, and Leydig cell proliferation.
  • TRPS1 has been implicated in tumorigenesis of breast cancer, prostate cancer, and osteosarcoma, for example, and was recently identified as a novel fusion partner in different sarcomas (Chang et al., 2007; Elster et al., 2018).
  • mutations in TRPS1 cause the human tricho-rhino-phalangeal syndrome 1 , a disorder mainly affecting the development of the skeletal system.
  • the expression and function of TRPS1 in the context of myogenic differentiation of MuSCs and RMS remains unknown so far.
  • Rhabdomyosarcoma is an aggressive pediatric soft tissue sarcoma of skeletal muscle accounting for 3 % of all childhood cancers and 50% of all soft tissue sarcomas (Saab et al., 2011). Tumors can arise at every side of the body. RMS is believed to originate from deregulated myoprogenitor cells, although recently also alternative cellular sources such as epithelial cells or adipocytes were described. RMS tumors are divided based on histopathological features into two major subtypes, embryonal RMS (ERMS) and alveolar RMS (ARMS).
  • ERMS embryonal RMS
  • ARMS alveolar RMS
  • ERMS is the most frequent RMS subtype (incidence rate: 60 %) and constitutes a heterogeneous group characterized by mutations in different signaling pathways.
  • the RAS-RAF-MAPK and PI3K-AKT-mTOR pathways are predominantly affected as well as chromosomal gains and losses.
  • ARMS is less frequent (approximately 20 % of RMS cases), but even more aggressive, and homogeneously characterized by the chromosomal translocation t(2; 13)/t(1 ; 13), encoding for a novel oncogenic fusion protein PAX3/7-FOXO1 , respectively.
  • RMS cells display an impaired terminal myogenic differentiation causing uncontrolled proliferation and tumor growth.
  • Muscle stem cells are tissue resident stem cells of skeletal muscle conferring the ability to form new myofibers thereby repairing damaged muscle throughout life. All MuSCs express the transcription factor Pax7 and under resting conditions, they remain in a quiescent state between the myofiber and the basal lamina. Upon stimuli, e.g. injury, MuSCs can activate and start to proliferate, differentiate, and fuse to each other or to existing myofibers thereby forming new myofibers. Myofibers are terminally differentiated, postmitotic, and multinucleated syncytia which express muscle structural proteins, such as myosin heavy chain (MHC) and troponins (TNN) important for force generation.
  • MHC myosin heavy chain
  • TPN troponins
  • Myogenic differentiation is governed by the highly regulated activity and temporal expression of the myogenic regulatory factors (MRFs) Myf5, MyoD1 , Myog, and Myf6. Upregulation of the transcription factors Myf5 and MyoD promotes MuSC activation and myoblast proliferation, followed by upregulation of the transcription factor Myog, promoting myogenic differentiation and fusion of myocytes, whereas Myf6 has functions in myofiber growth and maintenance.
  • MRFs myogenic regulatory factors
  • US2012059159 discloses microRNAs (microRNAI or microRNA-206) or combinations thereof, for use in the differentiation treatment of rhabdomyosarcoma to convert the sarcoma cells into terminally differentiated myogenic cells.
  • TRPS1 is not mentioned, neither as regulatory target nor as an inhibitor of terminal myogenic differentiation in rhabdomyosarcoma cells.
  • CN 109609644 describes the use of an inhibitor or antagonist of the PAX3-FKHR gene or protein for the preparation of a therapeutic agent for rhabdomyosarcoma. No link to TRPS1 is shown in this application.
  • XP055907519 discloses that elevated levels of PAX3 and cell proliferation genes are characteristic features of rhabdomyosarcoma (RMS). It is described that PAX2 and CCND2 are regulated by both, miR-1 and miR-206, and miR-29 regulates the expression of CCND2 and E2F7, suggesting a presence of a potential miRNA regulatory network that is deregulated in RMS. There is no revelation of a link to TRPS1 .
  • the technical problem underlying the present invention is to provide means for treating and/or preventing the growth of a rhabdomyosarcoma, such as an embryonal rhabdomyosarcoma (EMRS).
  • EMRS embryonal rhabdomyosarcoma
  • the invention therefore relates to a Tricho-Rhino-Phalangeal Syndrome Type I Protein (TRPS1) inhibitor for use in the treatment of a rhabdomyosarcoma, preferably in a human subject.
  • TRPS1 Tricho-Rhino-Phalangeal Syndrome Type I Protein
  • the present invention is based on the entirely unexpected finding that TRPS1 inhibition, in particular downregulation of TRPS1 levels in rhabdomyosarcoma cells inhibits proliferation of these cancer cells. Furthermore, it was observed that surprisingly upon TRPS1 downregulation, which is understood to be a functional inhibition of TRPS1 , leads to myogenic differentiation of the rhabdomyosarcoma cells, and leads to the formation of functional, non-proliferating muscle cells. Accordingly, it was surprisingly found that inhibition of TRPS1 represents a suitable treatment of rhabdomyosarcoma that inhibits cancer cell proliferation and induces differentiation of the cancer cells to a non-malignant phenotype.
  • the TRPS1 inhibitors of the invention should be applied in treatment of rhabdomyosarcomas with elevated TRPS1 levels. Since rhabdomyosarcoma mostly develops from mesenchymal progenitor cells that have not fully differentiated into myocytes of skeletal muscle, the TRPS1 level of differentiated myocytes can serve as a reference level for TRPSI levels to which the level in the cancer cells could be compared.
  • TRPS1 expression is especially increased and sustained in RMS, in particular in ERMS.
  • TRPS1 under physiological conditions downregulation of TRPS1 expression is required to allow normal myogenic differentiation during development.
  • TRPS1 is very often constantly upregulated which leads to suppressing myogenic differentiation and to development and maintenance of a cancerous state of the cells. This occurs particularly in ERMS.
  • the constant TRPS1 expression is at least partially mediated through lack of miR-1 expression in ERMS.
  • TRPS1 acts as a molecular and transcriptional suppressor in myogenic progenitors cells as well as in RMS cells, since upon reduction of TRPS1 levels myogenic differentiation programs governed by MYOG can be activated.
  • reduction of TRPS1 levels in ERMS cells effectively inhibited ERMS tumor growth.
  • TRPS1 is a major control factor in myogenic differentiation that prevents cellular differentiation and stops proliferation of myogenic progenitors as well as ERMS cells
  • functional inhibition of TRPS1 in particular downregulation of TRPS1 levels, is an effective treatment of RMS, in particular ERMS and other forms of RMS that show expression of TRPS1.
  • the rhabdomyosarcoma is an embryonal rhabdomyosarcoma (EMRS).
  • EMRS embryonal rhabdomyosarcoma
  • Treatment of EMRS is particularly preferred in the context of the present invention, since it was found that in this RMS subtype TRPS1 upregulation (which could also be interpreted as a lack of down regulation) does frequently occurred. Accordingly, among the different RMS types EMRS is very likely to be effectively treated by TRPS1 inhibitors as described herein.
  • TRPS1 mRNA expression and TRPS1 protein levels were determined in two additional ERMS lines, namely SMS-CTR and JR1 , confirming aberrantly high TRPS1 protein and mRNA levels compared to human skeletal myoblasts. Furthermore, it has been tested whether a single transfection with siRNA targeting TRPS1 would be sufficient to induce myogenic differentiation in SMS-CTR and JR1 cells.
  • TRPS1 is one of the main causes for impaired terminal myogenic differentiation in ERMS cells and that reduction of TRPS1 levels in ERMS cells permits myogenic differentiation.
  • TRPS1 levels in RD cells are regulated by miR-1 and that TRPSI and MYOD1 share common genomic binding sites.
  • the MYOG promoter is one of the critical targets of TRPS1 and MYOD1 . It could be demonstrated that TRPS1 restricts MYOG expression and thereby inhibits terminal myogenic differentiation. Reduction of TRPS1 levels in embryonal rhabdomyosarcoma therefore might be a therapeutic approach to drive embnryonal rhabdomyosarcoma cell into myogenic differentiation thereby generating postmitotic myotubes.
  • RMS RMS-RNTI
  • ARMS is often associated with characteristic chromosomal translocations and pathogenic fusion protein occurrence, in some cases it can also be associated with high levels of TRPS1.
  • the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPSI protein translation.
  • the TRPS1 inhibitor of the invention is a compound, nucleic acid, or any kind of reagent of set of reagents that leads to a functional inhibition of TRPS1 , preferably to a downregulation of TRPS1 mRNA or protein levels in a RMS cell.
  • functional inhibition refers to a decrease of TRPS1 molecules in a cell that are biologically active.
  • Biological activity of TRPS1 is mostly its function as a transcription factor that is involved in controlling gene expression and gene repression.
  • inhibitors of the invention prevent TRPS1 from being active as a transcription factor. Further ways of transcription factor inhibition are known to a person skilled in the art.
  • the TRPS1 inhibitor of the invention reduces TRPS1 levels, in particular protein levels, in a RMS cell. In embodiments, the TRPS1 inhibitor reduces TRPS1 mRNA levels, which subsequently also leads to a decrease of the protein levels. In embodiments, a TRPS1 inhibitor leads to a disruption of the TRPS1 gene which can lead to a lack of functional gene expression (gene knockout).
  • the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1- suppressive oligonucleotide.
  • Suitable suppressive oligonucleotides of the invention can be designed by a skilled person, for example based on the (preferably human) genomic and/or mRNA sequences of TRPS1 .
  • TRPS1-suppressive shRNAs or siRNAs as well as guide RNAs in conjunction with Cas9 have been used in the examples below.
  • the specific TRPS1 -suppressive oligonucleotides of the examples below represent embodiments of the present invention.
  • the TRPS1 inhibitor is a siRNA for knock down of human TRPS1 with one of the following sequences:
  • the TRPS1 inhibitor is a shRNA for knock down of TRPS1 with one of the following sequences:
  • the TRPS1 inhibitor is a siRNA for knock down of murine TRPS1 with one of the following sequences:
  • Suppressive oligonucleotides such as antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA have been extensively studied in the art and are already being used in clinical applications.
  • Such oligonucleotides can be designed for virtually any target gene/protein by using suitable design tools that are offered by academic institutions as well as by companies. Importantly, companies even offer sets of such oligonucleotides for almost every human gene/protein or offer to design such oligos upon order. Designing and testing target specific suppressive oligonucleotides therefore represent a routine procedure for a skilled person that is interested in suppressing expression of a specific target gene or protein.
  • guide RNA molecules that are used in conjunction with a RNA-guided endonuclease, for example by using the well-established CRISPR/Cas9 system, represent another kind of suppressive oligonucleotide. It is possible to generate gene knockout, here knockouts of Trspl , by introducing into a target cell a TRPS1 specific gRNA. Furthermore, one has to introduce an RNA-guided endonuclease, which interacts with the gRNA.
  • the gRNA leads the endonuclease to a target site in the genome and induces a DNA double strand break that is incorrectly repaired by non-homologous end-joining (NEJM) which results in so-called insertion-deletions (INDELs) in the target gene.
  • NJM non-homologous end-joining
  • INDELs insertion-deletions
  • PTC premature termination codon
  • NMD nonsense-mediated decay
  • TRPS1 -suppressive oligonucleotides and potentially required helper molecules can be introduced by any suitable and known way of introducing such molecules into a target cell.
  • helper molecules such as for example the Cas9 endonuclease in case of using the CRISPR/Cas system
  • the oligonucleotides and potentially required helper molecules can be introduced by expression plasmids injection, transfection or transduction, target cell transduction with viral vectors coding for the oligos and potential helper molecules, or by direct transfection or injection of the oligonucleotides and helper molecules.
  • the TRPS1 inhibitor is a self-delivering siRNA (sd-siRNA).
  • Sd-siRNAs represent suitable inhibitors in the context of the present invention, since they are capable of entering target cells without further reagents, such as transfection reagents.
  • the skilled person is aware of how to generate these now routinely used sd-siRNAs. Illustrative examples are described herein.
  • the TRPS1 inhibitor comprises or consists of miR-1 . It was surprisingly found that in RMS cells with high levels of TRPS1 the endogenous microRNA miR-1 is lowly expressed. In the experiments leading to the present invention it was unexpectedly found that miR-1 is a negative regulator of TRPS1 expression and that upregulation or ectopic expression of miR-1 suppresses TRPS1 levels in RMS cells. In fact, TRPS1 downregulation by miR-1 appears to be a naturally occurring event during myogenic differentiation. Accordingly, in embodiments miR-1 or miR-1 mimics as disclosed in the examples can be used as TRPS1 inhibitors for downregulation. Furthermore, it is understood that in embodiments of the invention the inhibitor can be a molecule/compound/composition that induces upregulation of endogenous miR-1 which then leads to a downregulation of TRPS1 in the RMS cells.
  • the TRPS1 inhibitor inhibits proliferation of rhabdomyosarcoma cells.
  • TRPS1 inhibition and in particular TRPS1 downregulation or knockout in RMS cells inhibits RMS cell proliferation and is therefore a suitable therapy for RMS, in particular to reduce or inhibit tumor growth.
  • the TRPS1 inhibitor induces myogenic differentiation of rhabdomyosarcoma cells. It is a further advantage of the present invention that it was found out that TRPS1 down regulation, in particular in RMS cells with high TRPS1 levels, induce differentiation of the cancer cells towards differentiated myogenic cells. It appears that at least in certain embodiments RMS cells have emerged from not terminally differentiated myogenic progenitor cells that failed to downregulate TRPS1 . Downregulation or inhibition of TRPS1 can induce such RMS cells to continue along the myogenic differentiation pathway to form differentiated non-proliferating myogenic cells that can even be functional in muscle tissue and can even contract.
  • the differentiation of rhabdomyosarcoma cells leads to formation of functional muscle cells. It was observed that downregulation of TRPSI in RMS cells, in particular in ERMS cells, can induce myogenic differentiation and lead to formation of functional muscle cells that integrate in the surrounding tissue. In embodiments, TRPS1 inhibition of down regulation leads to a loss of pathogenic features of RMS cells and an induction of physiological features, which can result in formation of non-pathogenic cells.
  • the rhabdomyosarcoma to be treated is associated with TRPS1 expression, which is preferably identified by analyzing rhabdomyosarcoma cells for TRPSI expression.
  • mRNA can be routinely analyzed by RT-PCR using target gene specific primers, or by RNA sequencing, for example. Protein levels can be analyzed, for example, by western blot, immunofluorescence or mass spectrometry.
  • TRPSI detection in RMS cells are used in the examples below and a skilled person has no problem to identify suitable techniques.
  • the TRPS1 inhibitor is administered transiently or constantly.
  • transient administration or presence of the TRPS1 inhibitor is sufficient for inducing differentiation and/or inhibiting proliferation of RMS cells.
  • the inhibitor can be introduced by techniques that enable constant or even controllable presence of the inhibitor.
  • stable delivery of nucleic acids that encode for a suppressive oligonucleotide under the control of a suitable genetic control elements for expression of the oligonucleotide can be used, such as expression plasmids or viral vectors encoding for the oligonucleotide under the control of a constitutively active or inducible promoter or promoter/enhancer combination.
  • Use of an inducible promoter makes it possible to induce expression of a suppressive oligonucleotide for a certain time and stop expression after the differentiation of the RMS cells has occurred.
  • the treatment of the invention further comprises (simultaneous or sequential) administration of one or more other antitumor therapies.
  • RMS is currently treated in multiple ways. Applied treatments can include surgery, chemotherapy, radiation, and possibly immunotherapy.
  • the treatment using TRPS1 inhibitors described herein can be used with any one or more of established or future treatment options and can result in an additive or synergistic therapeutic effect.
  • the present invention relates to a TRPS1-suppressive oligonucleotide for use in the treatment of a rhabdomyosarcoma, preferably a rhabdomyosarcoma associated with TRPS1 expression, wherein the TRPS1 -suppressive oligonucleotide is preferably a TRPS1- specific antisense oligonucleotide, microRNA (miR), shRNA, siRNA, or guide-RNA in conjunction with an RNA-guided endonuclease.
  • the TRPS1 -suppressive oligonucleotide is preferably a TRPS1- specific antisense oligonucleotide, microRNA (miR), shRNA, siRNA, or guide-RNA in conjunction with an RNA-guided endonuclease.
  • oligonucleotide-based drugs Delivery systems for oligonucleotide-based drugs are well established in the art and can be used in the context of the invention (see for example Thomas C. Roberts, Robert Langer & Matthew J. A. Wood, Advances in oligonucleotide drug delivery. Nature Reviews Drug Discovery volume 19, pages 673-694 (2020); Marine Imbert et al. Viral Vector-Mediated Antisense Therapy for Genetic Diseases. Genes (Basel). 2017 Feb; 8(2): 51).
  • the invention relates to a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide for use in the treatment of a rhabdomyosarcoma, preferably a rhabdomyosarcoma associated with TRPS1 expression.
  • nucleic acid molecules can be expression plasmids or RNA molecules that enable expression of the TRPS1-suppressive oligonucleotide in a RMS cell.
  • the nucleic acid molecule of the invention is comprised by a viral vector that facilitates delivery of the nucleic acid molecule to the target cell.
  • the oligonucleotides or nucleic acids of the invention can be delivery by means of peptide vectors or other established delivery vehicles.
  • the invention in another aspect, relates to a pharmaceutical composition for use in the treatment of a rhabdomyosarcoma as disclosed herein, comprising a TRPS1 inhibitor and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition of the invention preferably comprises a TRPS1 inhibitor in combination with a pharmaceutically acceptable carrier which may be any of those known in the art or devised hereafter and suitable for the intended use.
  • the pharmaceutical composition of the invention may include other ingredients, including dyes, preservatives, buffers and antioxidants.
  • the pharmaceutical composition as used herein can be formulated for administration by oral, intravenous, intramuscular, or subcutaneous, topical routes.
  • the pharmaceutical composition or the TRPS1 inhibitor can be directly applied to the cancerous tissue, i.e. the location of tumor.
  • the treatment rhabdomyosarcoma preferably EMRS
  • the various aspects of the invention are based on and/or are linked by the common and surprising finding that inhibition and in particular downregulation of TRPS1 levels is effective in treating rhabdomyosarcomas, in particular EMRS, by inducing differentiation or/and inhibition/downregulation of proliferation of the cancer cells.
  • the invention relates to a TRPS1 inhibitor for use in the treatment of a rhabdomyosarcoma, preferably ERMS.
  • TRPS1 Tricho-rhino-phalangeal syndrome Type 1 or “TRPS1” refers to a transcription factor also termed “transcriptional repressor GATA binding 1”. Further names TRPS1 used in the art comprise thricho-rhino-phalangeal syndrome Type I protein, trichorhinophalangeal syndrome I, Zinc finger protein GC79, LGCR, and GC79.
  • TRPS1 is a GATA-like transcription factor with repressor function, which is controlling differentiation in various contexts. Mutations in TRPS1 cause the human tricho-rhino-phalangeal syndrome 1 , a disorder mainly affecting the development of the skeletal system. TRPS1 regulates fate and function of multiple cell types, including chondrocyte differentiation and apoptosis, mesenchymal stem cell differentiation, nephrogenesis, hair follicle cell proliferation and apoptosis, mammary epithelial cell differentiation, and Leydig cell proliferation. Importantly, TRPS1 has been implicated in tumorigenesis of cancers such as, breast cancer, prostate cancer, osteosarcoma, and was identified as a novel fusion partner in different sarcomas.
  • cancers such as, breast cancer, prostate cancer, osteosarcoma
  • the TRPS1 protein is highly conserved among species including humans and mice and contains nine zinc finger DNA binding domains.
  • One of the zinc fingers shares homology to GATA transcription factors, two zinc fingers are of the IKAROS type and six others lack homology to known DNA binding proteins.
  • the C-terminal IKAROS domain is required for TRPSI to function as a transcriptional repressor.
  • the TRPS1 protein comprises 1281 amino acids and has a molecular mass of approximately 140 kDa, comprising a nuclear localization signal and nine DNA binding motifs of different types, including GATA and IKAROS-like zinc fingers, which systematically classify it as a GATA-like transcription factor.
  • GATA GATA
  • IKAROS-like zinc fingers which systematically classify it as a GATA-like transcription factor.
  • TRPS1 protein expression in the adult is detected at higher levels but not restricted to tissues such as female and male reproductive organs, the brain, the lung, the digestive system, the kidney, and the skin.
  • mutations or deletion of the TRPS1 gene cause a rare human syndrome, tricho-rhino-phalangeal syndrome type 1 , which is characterized by craniofacial and skeletal abnormalities.
  • TRPS1 Mouse models with a genetic deletion of the TRPS1 GATA domain resembled features of the human syndrome, revealing roles for TRPSI in chondro- and osteogenesis and hair growth. Subsequent studies identified a molecular interaction of TRPSI with Runt-related transcription factor 2 (Runx2), Indian hedgehog (Ihh)/Gli3 signaling, and signal transducer and activator of transcription 3 (Stat3) to control chondrogenic processes. Beyond its role in the development of the skeletal system, TRPS1 was found to be important for proper establishment of cell fate and differentiation in other tissues, such as breast tissue or kidney nephrogenesis. Deregulation of TRPSI is associated with certain types of human cancer, such as breast cancer.
  • TRPS1 was shown to bind together with TEA domain transcription factors (TEAD) at joint genomic sites to regulate YAP transcriptional activity through recruitment of co-repressor complexes modulating the chromatin landscape. TRPS1 depletion was associated with increased H3K27 acetylation at enhancer sites and changed enhancer-promoter long-range chromatin interactions (Elster et al., 2018).
  • the term “inhibitor of TRPS1” or“TRPS1 inhibitor” shall mean substance, compound, molecule or system which is capable of interfering with the expression of TRPS1 and in particular capable of downregulation of TRPSI mRNA and/or protein levels in rhabdomyosarcoma cells.
  • the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPSI protein translation.
  • TRPS1 mRNA and/or TRPS1 protein expression in the tissue of the rhabdomyosarcoma, especially ERMS has been observed.
  • the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1- suppressive oligonucleotide.
  • a TRPS1 inhibitor modulates the function of TRPSI negatively, i.e. inhibits functionality of TRPSI .
  • a TRPS1 inhibitor can displace TRPS1 from its target gene locus and induces, for example, transcriptional de-repression of target genes.
  • a TRPS1 inhibitor disrupts the interaction between TRPS1 and genomic/chromosomal DNA.
  • a TRPS1 inhibitor negatively regulates the translation of the CBX7 mRNA.
  • a TRPS1 inhibitor functions on the post- translational level, for example by accelerating or inducing TRPS1 protein degradation.
  • a TRPS1 inhibitor functions at the RNA level and reduces the mRNA levels of TRPS1 , such as a TRPS1 -specific siRNA or shRNA.
  • a TRPS1 inhibitor functions at DNA levels which leads to knock-down or know-out of TRPS1 , such as via CRISPR- Cas9.
  • a TRPS1 inhibitor can be a compound, a modulator or a ligand or a small molecule inhibitor or antagonist or an antibody binding to TRPS1 or a TRPS1 suppressive oligonucleotide, such as a TRPS1 siRNA or a TRPS1 shRNA, or any combinations thereof.
  • a TRPS1 inhibitor can be a TRPS1 -suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid or viral vector encoding a TRPS1-suppressive oligonucleotide.
  • a TRPS1 -suppressive oligonucleotide such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such
  • the TRPS1 suppressor can be a system including several components, such as for example a guide RNA in conjunction with an RNA- guided endonuclease, for example Cas9, which may function for example by generating a functional knock-out of the TRPS1 gene in the genomic DNA of a cell by means of the CRISPR/Cas9 system.
  • a TRPS1 inhibitor system can comprise several components that act together to generate a functional inhibition, for example a functional gene knock-out, of TRPS1 .
  • suitable system components that may lead to functional inhibition of TRPS1 and that can be used as a TRPS1 inhibitor in the sense of the invention.
  • a TRPS1 inhibitor can be a compound, such as a biological or chemical molecule, such as a small molecule, a protein, a nucleic acid, chemicals, inorganic molecules, organic molecules, cDNA encoding a protein, a secreted protein, a large molecule, an antibody, a morpholino, a triple helix molecule, a peptide, siRNA, shRNA, miRNA, antisense RNA, ribozyme or any other compound or combination of compounds that can be envisioned to be used as a functional inhibitor of TRPS1 in the treatment of a subject.
  • a biological or chemical molecule such as a small molecule, a protein, a nucleic acid, chemicals, inorganic molecules, organic molecules, cDNA encoding a protein, a secreted protein, a large molecule, an antibody, a morpholino, a triple helix molecule, a peptide, siRNA, shRNA, miRNA, antisense RNA,
  • the TRPS1 inhibitor comprises or consists of miR-1 .
  • miR-1 refers to a potential upstream regulator of TRPS1. Potential miR-1 binding sites were identified within the 3’ untranslated region (UTR) of the TRPS1 mRNA. Since miR-1 expression is strongly induced during myoblast differentiation, exerting pro-myogenic activity, and deregulation of miR-1 expression, is a common hallmark of RMS cells we tested whether miR-1 controls TRPS1 levels in RD cells and exerts similar effects in RD cells. These results demonstrate a role for TRPSI as a critical downstream target of miR-1 , whose expression is required to be reduced for efficient terminal myogenic differentiation.
  • the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPSI protein translation.
  • reducing TRPS1 levels shall mean the mRNA levels or the protein levels of TRPS1 are reduced at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%.
  • reducing TRPS1 levels can refer to a knockout of TRPS1 on genomic DNA, which means that no functional mRNA can be transcribed that leads to production of functional TRPS1 protein.
  • reducing TRPS1 levels can further refer an inhibitor that leads to the production of dysfunctional TRPS1 protein.
  • TRPS1 -suppressive oligonucleotide shall relate to any kind of oligonucleotide that induces a reduction of TRPS1 protein levels in a cell. This can be an oligonucleotide that, for example, induces the degradation of TRPS1 mRNA, or an oligonucleotide that induces gene silencing or a gene knock out.
  • gene silence relates to regulatory mechanisms that are involved in gene expression control in a cell to prevent the expression of a certain gene. Gene silencing can occur on either transcriptional or translational level. In particular, methods used to silence genes are being increasingly used to produce therapeutics to combat cancer and other diseases, such as infectious diseases and neurodegenerative disorders. When genes are silenced, their expression is reduced. In contrast, when genes are knocked out, this refers to a complete abolishment of (functional) gene expression.
  • Inhibitory or suppressive oligonucleotides that can be used as TRPS1 inhibitors comprise antisense oligonucleotides, shRNAs, siRNAs, microRNAs, ribozymes and guide RNA of the CRISPR/Cas system in conjunction with suitable RNA-guided endonucleases.
  • gene silencing induced by an inhibitory or suppressive oligonucleotide when used herein is understood to relate to a reduction of the mRNA or protein level of the target in the cell by at least 5% of the mRNA level found in cells without introduction of oligonucleotide.
  • gene silencing induced by an inhibitory or suppressive oligonucleotide leads to about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 100% decrease of mRNA and/or protein level compared to that found in cells without introduction of RNA interference.
  • mRNA and/or protein levels are reduced by at least about 70%, about 80%, about 90%, about 95%, about 99%, and about 100%.
  • an “antisense oligonucleotide” relates to an oligonucleotide, which is a short nucleic acid molecule or fragment that can bind to complementary target mRNA molecules when added to the cell.
  • Antisense oligonucleotide can be composed of single-stranded DNA or RNA and are usually 13-25 nucleotides long.
  • the antisense oligonucleotides can affect gene expression in two ways: by using an RNase H-dependent mechanism or by using a steric blocking mechanism. RNase H-dependent oligonucleotides cause the target mRNA molecules to be degraded, while steric-blocker oligonucleotides prevent translation of the mRNA molecule.
  • Antisense oligonucleotides are well established tools for reducing gene expression and therefore a skilled person can design and identify suitable antisense oligonucleotides functioning as TRPS1 inhibitors in the context of the present invention.
  • Antisense oligonucleotides are usually short synthetic oligonucleotide sequences with specific targeted inhibitory action that includes a region that is substantially complementary to an mRNA that codes a target protein.
  • a region that is substantially complementary to an mRNA refers to the region of the antisense oligonucleotide that is substantially complementary to a sequence, for example a target sequence, as defined herein.
  • Such sequences hybridize with the mRNA to form a double stranded hybrid trait, such as RNase H, which degrades the DNA I RNA hybrid strand that naturally occurs to trigger DNA replication. It leads to the activation of a widespread catalytic enzyme, which prevents protein translation.
  • ribozymes are catalytic RNA molecules used to inhibit gene expression. These molecules work by cleaving mRNA molecules, essentially silencing the genes that produced them.
  • ribozyme motifs include hammerhead, hairpin, hepatitis delta virus, group I, group II, and RNase P ribozymes.
  • Hammerhead, hairpin, and hepatitis delta virus (HDV) ribozyme motifs are generally found in viruses or viroid RNAs. These motifs are able to self-cleave a specific phosphodiester bond on an mRNA molecule. Lower eukaryotes and a few bacteria contain group I and group II ribozymes.
  • ribozyme motif can self-splice by cleaving and joining together phosphodiester bonds.
  • RNase P ribozyme The last ribozyme motif, the RNase P ribozyme, is found in Escherichia coli and is known for its ability to cleave the phosphodiester bonds of several tRNA precursors when joined to a protein cofactor.
  • the general catalytic mechanism used by ribozymes is similar to the mechanism used by protein ribonucleases.
  • RNA molecules bind to a specific site and attack the neighboring phosphate in the RNA backbone with their 2' oxygen, which acts as a nucleophile, resulting in the formation of cleaved products with a 2'3'-cyclic phosphate and a 5' hydroxyl terminal end.
  • This catalytic mechanism has been increasingly used by scientists to perform sequence-specific cleavage of target mRNA molecules.
  • attempts are being made to use ribozymes to produce gene silencing therapeutics, which would silence genes that are responsible for causing diseases. Accordingly, a person skilled in the art can design and identify ribozymes functioning as TRPS1 inhibitors in the context of the present invention.
  • RNA interference is a natural process used by cells to regulate gene expression. This process to silence genes first begins with the entrance of a double-stranded RNA (dsRNA) molecule into the cell, which triggers the RNAi pathway. The double-stranded molecule is then cut into small double-stranded fragments by an enzyme called Dicer. These small fragments, which include small interfering RNAs (siRNA) and microRNA (miRNA), are approximately 21-23 nucleotides in length. The fragments integrate into a multi-subunit protein called the RNA-induced silencing complex, which contains argonaute proteins that are essential components of the RNAi pathway.
  • the guide or antisense strand of the fragment that remains bound to RISC directs the sequence-specific silencing of the target mRNA molecule.
  • the genes can be silenced by siRNA molecules that cause the endonucleatic cleavage of the target mRNA molecules or by miRNA molecules that suppress translation of the mRNA molecule. With the cleavage or translational repression of the mRNA molecules, the genes that form them are rendered essentially inactive.
  • RNAi is thought to have evolved as a cellular defense mechanism against invaders, such as RNA viruses, or to combat the proliferation of transposons within a cell's DNA. Both RNA viruses and transposons can exist as double-stranded RNA and lead to the activation of RNAi.
  • siRNAs are being widely used to suppress specific gene expression and to assess the function of genes.
  • a “microRNA” shall mean a small single-stranded non-coding RNA molecule functioning in RNA silencing and post-transcriptional regulation of gene expression. miRNA functions via base-pairing with complementary sequences within mRNA molecules.
  • miRNAs can function as inhibitory oligonucleotides of the invention. miRNAs resemble the small interfering RNAs (siRNAs) of the RNA interference (RNAi) pathway, except miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins, whereas siRNAs derive from longer regions of double-stranded RNA.
  • siRNAs small interfering RNAs
  • miRNAs are abundant in many mammalian cell types and as extracellular circulating miRNAs. Circulating miRNAs are released into body fluids including blood and cerebrospinal fluid and have the potential to be available as biomarkers in a number of diseases. miRNAs appear to target about 60% of the genes of humans and other mammals.
  • miR-1 is a negative regulator of TRPS1 in mice and humans and therefore represents an inhibitor in the sense of the present invention.
  • miR-1 or any other miR that functions as a TRPS1 inhibitor can be artificially introduced into a target cell by established techniques known to a person skilled in the art.
  • the TRPS1 mRNA molecules are silenced.
  • a short hairpin RNA or small hairpin RNA or shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
  • RNAi RNA interference
  • An shRNA is an RNA molecule being composed of a short antisense strand, followed by a 5-9 nucleotide loop, and a complementary sense strand. In some embodiments, the sense strand may precede the nucleotide loop structure, followed by the antisense strand.
  • These shRNAs may be contained in plasmids, retroviruses, and lentiviruses. Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors.
  • shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover. Delivery of plasmids to cells through transfection to obtain shRNA expression can be accomplished using commercially available reagents in vitro. Use of a bacterial vector to obtain shRNA expression in cells is a relatively recent approach. It builds off research showing that recombinant Escherichia coli, containing a plasmid with shRNA, fed to mice can knock-down target gene expression in the intestinal epithelium. This approach was used in 2012 in clinical trials to try to treat patients with Familial Adenomatous Polyposis.
  • a variety of viral vectors can be used to obtain shRNA expression in cells including adeno-associated viruses (AAVs), adenoviruses, and lentiviruses.
  • AAVs adeno-associated viruses
  • adeno-associated viruses and adenoviruses the genomes remain episomal. This is advantageous as insertional mutagenesis is avoided. It is disadvantageous in that the progeny of the cell will lose the virus quickly through cell division unless the cell divides very slowly.
  • AAVs differ from adenoviruses in that the viral genes have been removed and they have diminished packing capacity.
  • the product mimics pri-microRNA (pri-miRNA) and is processed by Drosha.
  • the resulting pre-shRNA is exported from the nucleus by Exportin 5.
  • This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • the sense (passenger) strand is degraded.
  • the antisense (guide) strand directs RISC to mRNA that has a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC represses translation of the mRNA. In both of these cases, the shRNA leads to target gene silencing.
  • shRNA Short Hairpin RNA
  • siRNA or small interfering RNA or silencing RNA shall mean a class of double stranded (ds) RNA, non-coding RNA molecules typically 20-27 base pairs in length, similar to miRNA, and operating within the RNA interference (RNAi) pathway.
  • siRNAs interfere with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription and thereby preventing translation.
  • Naturally occurring siRNAs have a well-defined structure that is a short (usually 20 to 24-bp) double-stranded RNA (dsRNA) with phosphorylated 5' ends and hydroxylated 3' ends with two overhanging nucleotides.
  • siRNAs catalyzes production of siRNAs from long dsRNAs and small hairpin RNAs.
  • siRNAs can also be introduced into cells by transfection. Since in principle any gene can be knocked down by a synthetic siRNA with a complementary sequence, siRNAs are an important tool for validating gene function and drug targeting in the post-genomic era. Accordingly, a person skilled in the art can design and identify siRNAs functioning as TRPS1 inhibitors in the context of the present invention.
  • siRNA targeting to TRPS1 mRNA means siRNA in which a first strand of the duplex is substantially identical to the nucleotide sequence of a portion of the TRPS1 mRNA sequence. It is understood that the second strand of the siRNA duplex is complementary to both the first strand of the siRNA duplex and to the same portion of the TRPS1 mRNA.
  • siRNAs for specific gene silencing can be designed for example by using the web interface of the Whitehead Institute for Biomedical Research (http://jura.wi.mit.edu/siRNAext/) (Yuan et al., Nucl. Acids. Res. 2004 32:W130-W134).
  • This platform can be used to identify all potential siRNAs targeting the conserved regions as well as their respective off-target hits to sequences in the human, mouse and rat RefSeq database. Further tools a platforms for identifying and selecting siRNA or shRNA target sequences are widely available. Further tools and platforms for siRNA and shRNA design for optimal target knock down are well established and can be used by a person skilled in the art to design suitable oligonucleotides to function as TRPS1 inhibitors in the context of the invention.
  • siRNAs that contained the applied criteria decided by skilled person upon his needs were selected and synthesized.
  • “Self-delivering siRNA” shall mean siRNAs enter cells without the need of a transfection reagent.
  • the self-deliverable siRNA molecule is a chemically synthesized asymmetric siRNA duplex consisting of a 20-nt antisense (guide) strand and 13-15 base sense (passenger) strand conjugated to cholesterol at its 3' end using tetraethylenglycol (TEG) linker.
  • TAG tetraethylenglycol
  • most or all 2'OH positions of ribose residues are substituted with 2'OMe or 2'F modifications, conferring sd-siRNA molecule resistance to nuclease degradation in both extra- and intracellular environment. Additional nuclease protection can be provided by phosphorothioate modifications at 3' ends of guide and passenger strands. The combination of these modifications within an asymmetric siRNA scaffold is advantageous for self-delivering properties and long-term knockdown activity.
  • a guide-RNA in conjunction with an RNA-guided endonuclease shall mean RNA molecules interacting with RNA guided DNA endonuclease, preferably in the context of the CRISPR/Cas system, which can be used for genetic manipulation of target cells, such as RMS cells, for example for influencing expression of a target, here TRPS1 , for example by generating a functional knockout of the gene.
  • CRISPR is an abbreviation of Clustered Regularly Interspaced Short Palindromic Repeats and is a family of DNA sequences in bacteria.
  • the sequences contain snippets of DNA from viruses that have attacked the bacterium. These snippets are used by the bacterium to detect and destroy DNA from further attacks by similar viruses. These sequences play a key role in a bacterial defense system and form the basis of a technology known as CRISPR/Cas that effectively and specifically changes genes within organisms.
  • CRISPR RNAs CRISPR RNAs
  • tracrRNAs trans-activating crRNAs
  • Cas CRISPR-associated proteins
  • the three components required for the type II CRISPR nuclease system are the Cas9 protein, the mature crRNA and the tracrRNA, which can be reduced to two components by fusion of the crRNA and tracrRNA into a single guide RNA (sgRNA) and that re-targeting of the Cas9/sgRNA complex to new sites could be accomplished by altering the sequence of a short portion of the gRNA (Garneau, JE et al (2010). Nature 468: 67-71 ; Deltcheva, E et al. (2011). Nature 471 : 602-607, Jinek, M et al (2012) Science 337: 816-821).
  • sgRNA single guide RNA
  • CRISPR-Cas systems are RNA-guided adaptive immune systems of bacteria and archaea that provide sequence-specific resistance against viruses or other invading genetic material. This immune-like response has been divided into two classes on the basis of the architecture of the effector module responsible for target recognition and the cleavage of the invading nucleic acid (Makarova KS et al. Nat Rev Microbiol. 2015 Nov; 13(11):722-36.).
  • Class 1 comprises multisubunit Cas protein effectors
  • Class 2 consists of a single large effector protein. Both Class 1 and 2 use CRISPR RNAs (crRNAs) to guide a Cas nuclease component to its target site where it cleaves the invading nucleic acids.
  • CRISPR-Cas9 The most widely used CRISPR-Cas system is CRISPR-Cas9. It was demonstrated that the CRISPR/Cas9 system could be engineered for modification of double stranded DNA molecules inside a cell, for example efficient genetic in mammalian cells. The only sequence limitation of the CRISPR/Cas system appears to derive from the necessity of a protospacer-adjacent motif (PAM) located immediately 3’ to the target sequence. The PAM sequence is specific to the species of Cas9.
  • PAM protospacer-adjacent motif
  • the PAM sequence 5’-NGG-3’ is necessary for binding and cleavage of DNA by the commonly used Cas9 from Streptococcus pyogenes.
  • Cas9 variants with novel PAMs have been and may be engineered by directed evolution, thus dramatically expanding the number of potential target sequences.
  • Cas9 complexed with the crRNA and tracrRNA undergoes a conformational change and associates with PAM motifs throughout the genome interrogating the sequence directly upstream to determine sequence complementarity with the gRNA.
  • the formation of a DNA-RNA heteroduplex at a matched target site allows for cleavage of the target DNA by the Cas9-RNA complex.
  • RNA-guided Cas9 endonuclease first recognizes a 2- to 4-base-pair conserved sequence named the protospacer-adjacent motif (PAM), which flanks a target DNA site. Upon binding to the PAM, Cas9 interrogates the flanking DNA sequences for base-pairing complementarity to a guide RNA.
  • PAM protospacer-adjacent motif
  • RNA strand invasion accompanies local DNA unwinding to form an R-loop.
  • Precise cleavage of each DNA strand by the RuvC and HNH domains of Cas9 generates a blunt double-strand DNA (dsDNA) break (DSB) at a position three base pairs upstream of the 3' edge of the protospacer sequence, measuring from the PAM.
  • the DSB inducing activity of Cas9 as a preferred RNA-guided DNA endonuclease can be exploited by the present invention for generating DSB in the TRPS1 gene locus.
  • NHEJ non-homologous end joining
  • HDR homology-directed repair
  • RNA-guided DNA endonuclease refers to DNA endonucleases that interact with at least one RNA-Molecule.
  • RNA-guided DNA endonuclease and RNA-guided endonuclease are used interchangeably.
  • DNA endonucleases are enzymes that cleave the phosphodiester bond within a DNA polynucleotide chain.
  • the interacting RNA- molecule may guide the RNA-guided DNA endonuclease to the site or location in a DNA where the endonuclease becomes active.
  • RNA-guided DNA endonuclease refers to naturally occurring or genetically modified Cas nuclease components or CRISPR-Cas systems, which include, without limitation, multi-subunit Cas protein effectors of class 1 CRISPR-Cas systems as well as single large effector Cas proteins of class 2 systems.
  • the present invention is not limited to the use specific RNA-guided endonucleases and therefore comprises the use of any given RNA-guided endonucleases in the sense of the present invention suitable for use in the method described herein.
  • nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide relates to any kind of nucleic acid molecule which encodes for a TRPS1 -suppressive oligonucleotide and from which the oligonucleotide can be expressed.
  • This term also comprises the TRPS1 -suppressive oligonucleotides themselves, but also the plasmid encoding a TRPS1- suppressive oligonucleotide, as well as viral vectors or other vectors suitable for expression of TRPS1 -suppressive oligonucleotide in vivo and/or in vitro such as retroviruses, lentiviruses, adenovirus, adeno-associated virus.
  • the TRPS1-inhibotor of the invention is used for reducing RMS growth and driving it into terminal myogenic differentiation.
  • the invention relates to a TRPS1 inhibitor for use in the treatment of a rhabdomyosarcoma.
  • the terms “treat,” “treated,” “treating,” “treatment,” and the like are meant to refer to reducing or ameliorating a disorder and/or symptoms associated therewith.
  • “Treating” may refer to administration of the combination therapy to a subject after the onset, or suspected onset, of a blood disorder.
  • “Treating” includes the concepts of "alleviating”, which refers to lessening the frequency of occurrence or recurrence, or the severity, of any symptoms or other ill effects related to a cancer and/or the side effects associated with cancer therapy.
  • treating also encompasses the concept of "managing” which refers to reducing the severity of a particular disease or disorder in a patient or delaying its recurrence, e.g., lengthening the period of remission in a patient who had suffered from the disease. It is appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated.
  • subject refers to an animal which is the object of treatment, observation, or experiment.
  • a subject includes, but is not limited to, a mammal, including, but not limited to, a human or a non-human mammal, such as a non-human primate, bovine, equine, canine, ovine, feline.
  • Rhabdomyosarcoma is a relatively rare high-grade malignant neoplasm of the skeletal muscle, yet it represents the most common soft tissue cancer in children.
  • RMS is diagnosed with an incidence of 4.5 patients per million individuals below the age of 20. That equals to around 350 newly diagnosed cases per year in the United States.
  • RMS originates from skeletal muscle tissue at any site of the body. However, 30 % of pediatric tumors predominantly arise in the head and neck region, 20 % in extremities, and 15 % at genitourinary sites (Saab et al., 2011).
  • Rhabdomyosarcoma originates from myogenic progenitor cells.
  • Embryonal rhabdomyosarcoma ERMS
  • alveolar rhabdomyosarcoma RMS
  • ERMS Embryonal rhabdomyosarcoma
  • ARMS alveolar rhabdomyosarcoma
  • the more aggressive alveolar rhabdomyosarcoma (ARMS) subtype accounts for 30 % of RMS cases in children and adults and appears histologically as an accumulation of cells surrounding an open central space (Enterline and Horn, 1958). Additionally, pleomorphic and spindle cell/sclerosing RMS are considered two distinct RMS subtypes (Rudzinski et al., 2015).
  • rhabdomyosarcoma cell refers to primary or immortalized cells derived from rhabdomyosarcoma, for example, human embryonal rhabdomyosarcoma cells TE671 , RD cells or RH-30 cells. Further, “rhabdomyosarcoma cells” refers to in vivo tumor cells associated with Rhabdomyosarcoma.
  • Embryonal rhabdomyosarcoma displays a variety of tumor-promoting alterations.
  • the ERMS subtype is associated with recurrent mutations in components of the RAS-RAF-MAPK and PI3K-AKT-mTOR pathways (Shern et al., 2014).
  • IGF insulin-like growth factor
  • alterations in insulin-like growth factor (IGF)-signaling are frequently observed in ERMS tumors, such as high expression of the ligand insulin-like growth factor 2 (IGF2) as a result of a loss of heterozygosity and loss of imprinting at the 11 p15.5 locus (Makawita et al., 2009; Martins et al., 2011 ; Zhan et al., 1994).
  • Loss of function mutations or promoter methylation have been identified in the tumor suppressor genes phosphatase and tensin homolog (PTEN) and tumor protein 53 (TP53) (Seki et al., 2015; Shern et al., 2014). Additionally, deregulation of important developmental pathways such as Wnt, Notch, Shh and Hippo have been implicated in the pathogenesis of ERMS (Annavarapu et al., 2013; Conti et al., 2016; Mohamed et al., 2015; Zibat et al., 2010).
  • PTEN phosphatase and tensin homolog
  • TP53 tumor protein 53
  • Alveolar rhabdomyosarcoma are mostly characterized by a chromosomal translocation t(2; 13)(q35;q14) or alternatively t(1 ;13)(p36;q14), which results in the expression of a chimeric transcription factor. It contains the DNA binding domain of PAX3 or PAX7, respectively, fused to the transcriptional transactivation domain of the forkhead transcription factor FOXO1 (Barr et al., 1993; Davis et al., 1994).
  • PAX3-FOXO1 or PAX7-FOXO1 act as oncogenes and have been well characterized to drive the pathogenesis of the ARMS subtype (Keller et al., 2004; Xia et al., 2009). Notably, approximately 20 % of patients diagnosed with ARMS do not carry these characteristic translocations (Sorensen et al., 2002), and their tumor gene expression profiles are more similar to EMRS tumors, which is paralleled by a better clinical prognosis (Williamson et al., 2010). Therefore, current terminology also suggests a distinction of RMS tumors into fusion-positive and fusion-negative subgroups.
  • RMS subtypes of the invention include are pleomorphic rhabdomyosarcoma and spindle cell/sclerosing rhabdomyosarcoma.
  • Pleomorphic rhabdomyosarcoma (undifferentiated) rhabdomyosarcoma) also known as anaplastic rhabdomyosarcoma, is defined by the presence of pleomorphic cells with large, lobate hyperchromatic nuclei and multipolar mitotic figures. These tumors display high heterogeneity and extremely poor differentiation.
  • the pleomorphic cells may be diffuse or localized, with the diffuse variation correlating to a worse prognosis. It occurs most often in adults, rarely in children, and is often discovered in the extremities.
  • rhabdomyosarcoma is an added subtype listed in the 2020 WHO classification of soft tissue sarcomas. This subtype is very similar to that of leiomyosarcoma (cancer of the smooth muscle tissue), and it has a fascicular, spindled, and leiomyomatous growth pattern with notable rhabdomyoblastic differentiation.
  • the sclerosing aspect of this subtype has a hyaline sclerosis and pseudovascular development.
  • Treatment of rhabdomyosarcoma is a multidisciplinary practice involving the use of surgery, chemotherapy, radiation, and possibly immunotherapy.
  • Surgery is generally the first step in a combined therapeutic approach. Resectability varies depending on tumor site, and RMS often presents in sites that don't allow for full surgical resection without significant morbidity and loss of function. Less than 20% of RMS tumors are fully resected with negative margins.
  • Rhabdomyosarcomas are highly chemosensitive, with approximately 80% of cases responding to chemotherapy. In fact, multi-agent chemotherapy is indicated for all patients with rhabdomyosarcoma.
  • adjuvant and neoadjuvant therapy involving chemotherapeutic agents, treatment solely by surgical means had a survival rate of ⁇ 20%. Modern survival rates with adjuvant therapy are approximately 60-70%.
  • Radiation therapy which kills cancer cells with focused doses of radiation, is often indicated in the treatment of rhabdomyosarcoma, and the exclusion of this treatment from disease management has been shown to increase recurrence rates. Radiation therapy is used when resecting the entirety of the tumor would involve disfigurement or loss of important organs (eye, bladder, etc.). Generally, in any case where a lack of complete resection is suspected, radiation therapy is indicated. Administration is usually following 6-12 weeks of chemotherapy if tumor cells are still present. The exception to this schedule is the presence of parameningeal tumors that have invaded the brain, spinal cord, or skull. In these cases radiation treatment is started immediately. In some cases, special radiation treatment may be required.
  • the TRPS1 inhibitor inhibits proliferation of rhabdomyosarcoma cells, induces myogenic differentiation of rhabdomyosarcoma cells and thereby leads to formation of functional muscle cells.
  • Cell proliferation shall mean cells undergoing cell division or mitosis.
  • the term “inhibits proliferation” shall mean the growth of rhabdomyosarcoma cells is stopped or the rate of the growth of rhabdomyosarcoma cells is reduced.
  • MRFs myogenic regulatory factors
  • MyoD was identified as the first member of the MRF family, being able to induce a myogenic cell fate in non-myogenic cells, such as fibroblasts and adipocytes, when overexpressed in these cell types (Davis et al., 1987; Tapscott et al., 1988). Shortly after, the other members of the MRF family were discovered based on their ability to induce myoblast traits in non-myogenic cells (Braun et al., 1990; Braun et al., 1989; Edmondson and Olson, 1989; Miner and Wold, 1990; Rhodes and Konieczny, 1989; Wright et al., 1989). MRF transcription factors contain a basic helix-loop-helix (bHLH) domain.
  • bHLH basic helix-loop-helix
  • Myog expression mediates cell cycle exit, and together with MyoD, induction of genes associated with myocyte fusion and transcription of sarcomeric- and muscle-specific genes, including Mrf4, thereby facilitating terminal differentiation and sarcomere assembly. While expression of MyoD, Myf5 and Myog is transient, Mrf4 remains expressed in terminally differentiated myofibers controlling muscle growth-related processes and modulation of the MuSC niche (Hinterberger et al., 1991 ; Lazure et al., 2020).
  • Formation of functional muscle cells shall mean cells undergoing myogenic differentiation and become myotubes expressing normal levels of muscle function genes.
  • the rhabdomyosarcoma to be treated is associated with TRPS1 expression, which is preferably identified by analyzing rhabdomyosarcoma cells for TRPSI expression.
  • rhabdomyosarcoma associated with TRPS1 expression shall mean rhabdomyosarcoma with detectable TRPS1 expression.
  • the rhabdomyosarcoma is a rhabdomyosarcoma with elevated TRPS1 expression as compared to skeletal muscle cells, human myoblasts, and or non-proliferating or slowly proliferating muscle progenitor cells of mice or humans.
  • the elevated expression of TRPS1 can be due to amplification of TRPS1 loci, increased mRNA levels of TRPS1 and/or increased protein levels of TRPS1 or loss of a negative regulator of TRPS1 expression.
  • the elevated expression of TRPS1 can be evaluated by means of methods known in the art, for example, by western blot, immunofluorescence analysis, mass spectrometry, RT-PCR or RNA sequencing.
  • the TRPS1 inhibitor is administered transiently or constantly.
  • administered transiently shall mean that the inhibitor is only temporarily present in the target cell after administration. This can be due to degradation of the inhibitor and a stop of external administration or washing out of the inhibitor.
  • administered constantly shall mean that the inhibitor is constantly present over a certain period, for example due to constant and repeated administration, so that degraded inhibitors are replaced by newly administered inhibitors. Furthermore, it is possible that inhibitors, such as suppressive oligonucleotides, are constantly produced in a target cell, for example after administration of a nucleic acid molecule suitable for expression of the respective suppressive oligonucleotide.
  • the term “pharmacological effect” relates to a biochemical or physiological effect of a drug or compound on a cell, tissue or organ of a subject. Such a pharmacological effect can be measured by determining the differences that occur in presence of the drug or compound as compared to its absence in a certain setup, such as an experimental setup.
  • therapeutic effect refers to some extent of relief of one or more of the symptoms of a disorder (e.g., a neoplasia or tumor) or its associated pathology.
  • a disorder e.g., a neoplasia or tumor
  • Therapeutically effective amount refers to an amount of an agent/inhibitor which is effective, upon single or multiple dose administration to the cell or subject, in prolonging the survival of the patient with such a disorder, reducing one or more signs or symptoms of the disorder, preventing, or delaying, and the like beyond that expected in the absence of such treatment.
  • “Therapeutically effective amount” is intended to qualify the amount required to achieve a therapeutic effect.
  • a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the "therapeutically effective amount" (e.g., ED50) of the pharmaceutical composition required.
  • the physician or veterinarian could start doses of the compounds of the invention employed in a pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • the TRPS1 inhibitor as used herein is in combination with a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carrier refers to a carrier or excipient or diluent that can be administered to a subject, together with an agent, and which does not destroy the pharmacological activity thereof and is non-toxic when administered in does sufficient to deliver a therapeutic amount of the agent.
  • Administration of the TRPS1 inhibitor can be achieved by means of routes of administration known in the art. Possible routes of administration of the inhibitor include oral, subcutaneous, intravenous, intramuscular administration, and preferably local administration to the tumor/cancerous tissue.
  • the TRPS1 inhibitor possibly in combination with a pharmaceutically acceptable carrier, is applied directly to the cancerous tissue.
  • Simultaneous administration of one or more active agents or treatments shall mean administration of one or more agents at the same time.
  • inhibition of TRPS1 can be achieved by two or more TRPS1 inhibitor at the same time.
  • TRPS1 inhibitor can be administrated together with other active agent useful for treating rhabdomyosarcoma.
  • the treatment of the invention further comprises (simultaneous or sequential) administration of one or more other antitumor therapies.
  • Sequential administration of one or more active agents or treatments shall mean administration of the therapeutic agents in a sequential manner.
  • each therapeutic agent is administered at a different time.
  • Substantially simultaneous administration can be accomplished, for example, by administering to the subject a single dose having a fixed ratio of each therapeutic agent or in multiple, single doses for each of the therapeutic agents.
  • the term “simultaneously” refers to administration of one or more agents at the same time.
  • different TRPS1 inhibitors or TRPSI inhibitors in combination with other active agents useful for treating rhabdomyosarcoma, such a rhabdomyosarcoma associated with TRPS1 expression are administered simultaneously.
  • Simultaneously includes administration contemporaneously, that is during the same period of time.
  • the one or more agents are administered simultaneously in the same hour, or simultaneously in the same day.
  • Sequential or substantially simultaneous administration of each therapeutic agent can be affected by any appropriate route including, but not limited to, oral routes, intravenous routes, subcutaneous routes, intramuscular routes, direct injection into the cancer tissue, direct absorption through mucous membrane tissues (e.g., nasal, mouth, vaginal, and rectal), and ocular routes (e.g., intravitreal, intraocular, etc.).
  • the therapeutic agents can be administered by the same route or by different routes. For example, one component of a particular combination may be administered by intravenous injection while the other component(s) of the combination may be administered orally.
  • the components may be administered in any therapeutically effective sequence.
  • TRPS1 expression is increased in human ERMS and resists downregulation.
  • TRPS1 is downregulated during physiological myogenic differentiation of MuSCs and restrains myogenin expression.
  • TRPS1 suppresses myogenic differentiation and inhibits xenograft tumor growth of RD cells.
  • FIG. 4 Transcriptomic analysis reveal TRPS1 suppressed genes are associated with terminal myogenic differentiation.
  • TRPS1 is a critical downstream target of miR-1 .
  • TRPS1 loss-of-function RD cell models present with increased differention marker expression and decreased rhabdosphere growth, but no change in proliferation and apoptosis markers.
  • Figure 10 Extended RNA-sequencing analysis of induced TRPS1 knockdown in RD cells and validation of terminal differentiation.
  • FIG. 11 Extended TRPS1 ChlP-sequencing analysis and MYOD1 requirement for increased MYOG transcription.
  • Figure 12 Extended analysis of the miR-1 - TRPS1 axis.
  • Figure 13 Reduction of TRPS1 expression enhances myogenic differentiation in multiple ERMS model cell lines.
  • Figure 15 TRPS1 represses expression of MYOG through binding to its promoter thereby impairing binding of MYOD1 .
  • FIG. 16 Dynamic expression levels of TrpsI during myogenic differentiation.
  • Figure 17 TRPS1 repressed genes affect terminal myogenic differentiation.
  • Figure 18 Schematic summarizing how TRPSI affects differentiation of myogenic cells and inhibits differentiation in ERMS cells.
  • FIG. 1 (A) Immunohistochemistry (IHC) staining for TRPSI on human rhabdomyosarcoma (RMS) tissue micro array (TMA). The area within the dashed line is magnified in the upper right corner insert. Arrowheads indicate TRPS1 positive nuclei. Scale bar is 20 pm.
  • IHC Immunohistochemistry
  • RMS human rhabdomyosarcoma
  • TMA tissue micro array
  • SkM skeletal muscle, ERMS: embryonal RMS, ARMS: alveolar RMS.
  • HSkM human skeletal myoblast.
  • E Western blot analysis of TRPS1 and GAPDH expression in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2), ERMS (RD, TE-671), and ARMS cell lines (RH-18, RH-30, RH-41).
  • F Western blot analysis of TRPS1 , MHC, and GAPDH expression in human skeletal myoblasts (HSkM) cultured in growth medium (GM) and differentiation medium (DM).
  • G Densitometric quantification of TRPS1 and (H) MHC normalized to GAPDH from (F).
  • Figure 2 (M) Western blot analysis of TRPS1 and p-Actin expression in C2C12 myoblasts stably expressing empty vector (pLeGO) or V5-TRPS1 .
  • N IF images showing Myog (red), Mhc (green), and DAPI (blue) staining of empty vector or V5-TRPS1 overexpressing C2C12 cells after 3 days in differentiation medium (DM). Scale bar is 100 pm.
  • (C) Quantification of nuclei within devMHC positive cells from (A). Data represent the mean + SEM of n 3, one-way ANOVA with Tukey’s multiple comparison test, (*) p ⁇ 0.05, (***) p ⁇ 0.001.
  • D Experimental scheme for RD cell differentiation in TA muscle explants. RD cells stably expressing inducible shRNA (i-shRNA) were treated with doxycycline (DOX) for 2 days in growth medium (GM) followed by injection into TA muscle explants, which were cultured for additional 3 days in differentiation medium (DM) in the presence of DOX. TA explants were then prepared for IF analysis.
  • i-shRNA inducible shRNA
  • FIG. 4 (A) Experimental scheme for transcriptomic analysis of RD cells expressing an inducible shRNA targeting TRPS1 . Cells were treated with doxycycline (DOX) in growth medium (GM) for 2 days and subsequently in differentiation medium (DM) for 10 days followed by RNA isolation for RNA-sequencing and RT-qPCR. (B) Heatmap of differentially expressed genes (DEGs) common for both i-shTRPS1 conditions in DM with p ⁇ 0.05 and log2FC > ⁇ 0.5.
  • DOX doxycycline
  • GM growth medium
  • DM differentiation medium
  • GSEA Gene set enrichment analysis comparing the DEGs of i-shTRPS1#1 or (D) i-shTRPS1#2 with i- shNT for the hallmark genes sets and (E) i-shTRPS1#1 or (F) i-shTRPS1#2 with i-shNT for GO terms (top 5 categories in supplemental figure S4C).
  • G RT-qPCR analysis of CCND1, MYH3, and TNNC1 mRNA expression normalized to the housekeeper B2M in RD-i-shRNA cells at day 10 of culture in differentiation medium (DM) from (A).
  • FIG. 5 (A) Experimental scheme for the analysis of early myogenic events in RD-i-shRNA cells.
  • B Western blot analysis of TRPSI , MYOG and GAPDH expression in RD-i-shRNA cultured for 3 days in differentiation medium (DM) with doxycycline from (A).
  • D Densitometric quantification of MYOG protein expression normalized to GAPDH from (B).
  • E Western blot analysis of TRPS1 , MHC, and GAPDH protein expression in human myoblasts at day 5 of culture in differentiation medium (DM) after miRNA inhibitor (antagomiR) transfection from (D).
  • F Densitometric quantification of TRPSI and
  • FIG. 7 (A) Immunohistochemistry (IHC) staining of TRPS1 in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2) and ERMS cell line (RD) and ARMS cell line (RH-30). Scale bar is 50 pM.
  • B Re-analysis of RNA-sequencing data by (Stewart et al., 2018) for TRPSI mRNA expression in human tumors and controls. FW21 (fetal week 21) quadriceps, human myoblast, human myotube, ERMS, ARMS.
  • C Re-analysis of proteome data by (Stewart et al., 2018) for TRPSI protein expression in human tumors and controls.
  • MT myotube
  • ERMS ARMS.
  • Figure 8 (F) IF images of C2C12 cells expressing empty vector (pLeGO) or V5-TRPS1 after 1 , 2, and 3 days in differentiation medium (DM) showing staining for MyoD (green), Myog (red), and DAPI (blue). Scale bar is 50 pm.
  • Figure 9 (A) CRISPR/Cas9 targeting strategy for TRPSI knockout in RD cells as previously described in (Elster et al., 2018). Indicated sequence of Exon 3 is AGCCCT7GAAGTCTCCGCAAAGAGCAGAGGCAGATGACCC (SEQ ID NO. 31), wherein GAAGT CT CCGCAAAGAGCAGAGG (SEQ ID NO. 32) is the sgRNA sequence including PAM (underlined) (B) Western blot analysis of TRPS1 and GAPDH expression in RD and RD-TRPS1- KO cells using antibodies to detect the N-terminus or (C) the C-terminus of TRPS1 .
  • (E) Densitometric quantification of MHO normalized to GAPDH from (D). Data represent the mean + SEM of n 3, unpaired two-tailed t test, (*) p ⁇ 0.05.
  • Figure 12 (B) Bright-field images of human skeletal muscle myoblasts at 5 days of differentiation after transfection with a non-targeting or miR-1 targeting antagomiR at 0 days and 3 days of differentiation, related to figure 6D. Scale bar is 200 pm.
  • C IF images of TRPS1 (red, white) and DAPI (blue) staining of RD cells after transfection with siRNA and/or miRNA mimics for 3 days in differentiation medium demonstrating TRPS1 downregulation. Scale bar is 50 pm.
  • D IF images of MYOG (red, white), MHC (green, white), and DAPI (blue) staining of RD cells in the respective conditions after 3 days in differentiation medium. Scale bar is 50 pm.
  • GM growth medium
  • DM differentiation medium
  • G Immunoblot analysis of TRPSI and GAPDH levels in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2) and three ERMS (RD, SMS-CTR, JR1) cell lines.
  • Figure 14 (A) Experimental scheme for immunofluorescence (IF) analysis of mouse juvenile tibialis anterior (TA) muscle cross-sections. P: postnatal day, M: months. (B) IF images showing Trpsl (green), Pax7 (red), Laminin (grey), and DAPI (blue) staining of TA cross-sections from (A). White arrows mark Trpsl +/Pax7+ nuclei and yellow arrowheads mark Trpsl -ZPax7+ nuclei. Scale bar is 10 pm. (C) Quantification of Trpsl +/Pax7+ nuclei from (B).
  • (G) Experimental scheme for the analysis of CTX-induced injury of TA muscles combined with injection of self-delivering siRNAs at day 3 and 5 post injury.
  • H IF images at 10 dpi showing devMHC (red), Laminin (green), and DAPI (blue) staining of TA cross-sections from (G). Scale bar is 50 pm.
  • J Experimental scheme for extensor digitorum longus (EDL) single myofiber isolation and culture combined with siRNA transfection.
  • K IF images showing Myog (yellow, white) and DAPI (blue) staining of EDL myofiber-associated MuSC cluster after siRNA transfection and 72 hours of culture, related to (J). Scale bar is 20 pm.
  • Figure 15 (A) Experimental scheme for the analysis of early myogenic events in RD-i-shRNA cells.
  • B Immunoblot (IB) analysis of TRPS1 , MYOG, MYOD1 and GAPDH levels in RD-i-shRNA cultured for 3 days in differentiation medium (DM) with doxycycline from (A).
  • C Densitometric quantification of TRPS1 ,
  • D MYOG, and
  • E MYOD1 normalized to GAPDH from (B).
  • (F) IF images showing MYOG (red, white), MYOD1 (green, white), and DAPI (blue) staining of RD-i-shRNA cells after 3 days in differentiation medium from (A). Scale bar is 50 pm.
  • (S) ChlP-qPCR using an anti-MYOD1 antibody or normal mouse IgG and primers to amplify the MYOG locus or U2 control region in RD-i-shRNA cells treated with doxycycline for 2 days in GM and 3 days in DM. Data represent the mean + SEM of n 3, two-way ANOVA and Sidak’s multiple comparisons tests, (*) p ⁇ 0.05.
  • Figure 17 (A) Volcano plots with gene annotations for the top 25 DEGs sorted for padj with log2FC > 0.5_or log2FC ⁇ 0.5 from RD-i-shTRPS1#1 and (B) RD-i-shTRPS1#2 compared to RD-i- shNT, related to figure 3A. (C) Top 5 GSEA results, related to figure 3D-G. Size indicates the number of genes in the gene set. Enrichment score (ES) and normalized enrichment score (NES) represent to which degree this gene set is overrepresented at the top or the bottom of a ranked list of genes in the expression dataset. The nominal p-value (NOM p-val) indicates the statistical significance of the enrichment score.
  • the false discovery rate estimates the probability that the normalized enrichment score represents a false positive finding.
  • Family-wise error rate is a more conservatively estimated probability of a false positive normalized enrichment score.
  • Rank at max indicates the position in the ranked list at which the maximum enrichment score occurred.
  • Leading edge describes statistical parameters.
  • D Top 10 table of Ingenuity Pathway Analysis (IPA) upstream regulatory factor prediction for RD-i-shTRPS1#1 or RD-i-shTRPS1#2 compared to RD-i-shNT gene sets in RD cells during differentiation. The myogenic factors MYOD1 and miR-1 are highlighted.
  • IPA Ingenuity Pathway Analysis
  • E Experimental scheme for the immunoblot (IB) or immunofluorescence (IF) analysis of the differentiation status of RD-i-shRNA cells after continuous doxycycline (DOX) treatment or DOX removal for the last 4 days in DM.
  • F Immunoblot analysis of TRPS1 , MHO, and GAPDH in RD-i-shRNA cells upon continuous doxycycline (DOX) treatment or DOX removal for the last 4 days of culture in differentiation medium.
  • Figure 18 The shown data suggest that the increased TRPS1 levels in ERMS cells cause enhanced tumor growth by repressing terminal myogenic differentiation. Furthermore, TRPS1 mRNA is a direct miR-1 target in RD cells and miR-1 deficiency contributes to the enhanced TRPS1 levels observed in ERMS. Moreover, TRPS1 was found to directly bind to the MYOG promoter, thereby affecting binding of MYOD1 and repressing MYOG transcription.
  • TRPS1 protein was mainly expressed in single cells of the embryonal rhabdomyosarcoma (ERMS) subtype while no control tissue displayed TRPS1 expression.
  • ERMS embryonal rhabdomyosarcoma
  • TRPS1 expression in different human RMS cell lines and proliferating human skeletal muscle myoblasts (HSkM). Different from skeletal muscle crosssections, HSkM cells expressed low levels of TRPSI mRNA and protein hinting to expression of TRPS1 in proliferating cells.
  • TRPSI in ERMS cell lines RD and TE-671 ; ⁇ 5-10-fold enhanced compared to HSkMs
  • ARMS cell lines RH- 18, RH-30, and RH-41 showed a very low or no expression compared to human myoblasts and ERMS cells ( Figure 1 D,E, and Figure 7A).
  • TRPS1 expression needs to be downregulated to allow myogenic differentiation.
  • TRPS1 was detected in ⁇ 70% of Pax7-positive MuSCs of the tibialis anterior (T A) muscles at the early postnatal stage P7 and the juvenile stage P21 , while only ⁇ 30% of MuSCs express TRPS1 in the adult stage (2 months).
  • TRPS1 expression was found to peak around 5dpi, we had a closer look on the cell types expressing TRPS1 at this 5dpi. Thereby, we found TRPS1 to be expressed in 98% of Pax7+ MuSCs and in all MyoD1 positive cells marking activated/proliferating MuSCs and proliferating myoblasts (100%). Of note, only a very small proportion of nuclei (5%) of newly formed myofibers marked by developmental MHC (devMHC) were positive for TRPSI , presumably nuclei which derive from myoblasts which just underwent the fusion event.
  • deviceMHC developmental MHC
  • TRPS1 in regeneration of skeletal muscle, we in injected a self-delivering siRNAs into the damaged muscle at the peak of MuSC proliferation. Knockdown of TRPS1 during muscle regeneration led to a ⁇ 50% decrease in the number of devMHC expressing cells at day 10 post injury, a population of cells which represent a transient state of differentiation. This suggested to us that regeneration is enhanced, which is supported by the finding that the diameter of regenerating myofibers showed a trend towards bigger myofibers after knockdown of TRPS1.
  • MuSCs Since injection of a self-delivering siRNA might affect other cell types in addition to MuSCs, we cultured MuSCs on their adjacent myofibers from the extensor digitorum longus (EDL) for 72h after transfection with a siRNA targeting TRPS1 .
  • EDL extensor digitorum longus
  • MuSCs can be interrogated in their endogenous niche without affects from other mononucleated cells.
  • TRPS1 Knockdown of TRPS1 resulted in an increase in the size of clusters suggesting an increased ability to proliferate after reduction of TRPS1 level (8 vs 6 cells per cluster, si-TRPS1 vs si-scr).
  • Example 3 Sustained TRPS1 suppresses RD cell differentiation and promotes tumor growth in vivo
  • RD cells expressing a control shRNA developed subcutaneous large tumors (900 mm 3 ) while RD cells expressing a shRNA targeting TRPS1 formed significantly smaller tumors (300 mm 3 ).
  • the difference in tumor volume was accompanied by a reduction in tumor weight by 50% (Figure 3G-I).
  • the histological analysis of the tumors by H&E staining revealed a higher cytoplasmic proportion (eosinophil) in tumors derived from RD control cells compared to tumors formed from RD cells expressing a shRNA targeting TRPS1 , pointing towards enhanced myogenic differentiation.
  • RD cells muscle structural and contraction associated mRNAs, such as myosin heavy chain 3 (MHC3) and troponin C1 (TNNC1), as well as partial downregulation of cell cycle associated mRNAs, such as cycline D1 (CCND1) were found after reduction of TRPS1 levels during myogenic differentiation of RD cells ( Figure 4G).
  • MHC3 myosin heavy chain 3
  • TNNC1 troponin C1
  • CCND1 cycline D1
  • miR-1 can indeed directly affect TRPS1 expression on the protein level. Therefore, we performed a miRNA reporter assay, which is based on a luciferase reporter gene containing various regions of the TRPS1 mRNA 3’UTR, which can be tested for sensitivity to miR- 1 regulation (Figure 6M). Transfection of RD cells with the miR-1 mimic led to reduced luciferase activity when the co-transfected reporter plasmids contained either the large fragment of TRPS1 3’UTR2 or the isolated miR-1 seed region.
  • this novel miR-1 - TRPS1 - MYOG axis is deregulated in RD cells. Loss of miR-1 expression contributes to increased TRPS1 protein levels in ERMS and impairment of myogenic differentiation, at least in part, through suppression of MYOG transcription, thus, promoting tumor growth.
  • Example 7 Reduction of TRPS1 levels in other ERMS cell lines result in enhanced myogenic differentiation
  • TRPS1 mRNA expression and TRPS1 protein levels in two additional ERMS lines SMS-CTR and JR1 , confirming aberrantly high TRPS1 protein and mRNA levels compared to human skeletal myoblasts (Fig. 13 G, H).
  • TRPS1 expression enhanced myogenic differentiation measured by an increase in the percentage of MYOG+ nuclei in both cell lines (Fig. 13; J-L).
  • Trpsl protein was found rather in proliferating than in quiescent MuSCs.
  • TRPS1 binds to the MYOG promoter impairing induction of MYOG expression in RD cells
  • MYOG is a known inducer of myogenic differentiation described to be sufficient to overcome the impaired myogenic differentiation of RMS cells.
  • MYOD1 a well-known transcriptional inducer of MYOG expression during myogenic differentiation as a potential activated upstream regulator in RD cells when TRPS1 levels were experimentally reduced (Figure 17D). Indeed, we identified a -2.5-fold increase in MYOG protein levels upon reduction of TRPS1 expression while, unexpectedly, we did not observe changes in MYOD1 protein levels ( Figure 15A-E).
  • TRPS1 is a negative regulator of MYOG mRNA transcription potentially binding to a regulatory region of the MYOG gene, either together with or independent of MYOD1 .
  • RD-TRPS1-KO cells recapitulated the phenotype we observed after reducing TRPS1 expression using shRNA mediated approaches displaying increased presence of markers of myogenic differentiation, such as MYOG and MHC (Fig.9 and Figure 3). Indeed, we identified GATA-related binding motifs within TRPS1 binding sites in RD cells by HOMER known motif analysis including a previously described TRPS1 binding motif (40).
  • TRPS1 binding sites contained motifs of the myogenic regulatory factors MYOG (26 %) and MYOD1 (21 %) (Figure 15L). This prompted us to compare the newly identified TRPS1 binding sites with already published MYOD1 binding sites (55). Thereby we identified 3859 genomic binding sites, which are shared between TRPS1 and MYOD1 in RD cells. This accounts for ⁇ 1 Z4 of all TRPS1 binding sites and ⁇ 1/14 of all MYOD1 binding sites (Figure 15M).
  • TrpsI for functional regeneration of skeletal muscle
  • CX cardiotoxin
  • Figure 14G The knockdown of Trpsl led to a decrease in the percentage of devMHC+ myofibers at 10 dpi from 53 % in muscles injected with si-scr compared to 30 % in muscles injected with si- Trpsl ( Figure 141-1,1).
  • Figure 16B we found a trend towards larger diameters of regenerating myofibers after knockdown of Trpsl, suggesting enhanced/faster myogenic differentiation and thereby regeneration.
  • Trpsl levels did not result in enhanced activation of MuSCs per se as evidenced by a similar number of clusters per myofiber (Figure 16E).
  • detected changes in the cluster composition after knockdown of Trpsl In particular, we identified an increase in the percentage of Myog+ cells representing a cell population that is further differentiated. This coincided with a reduction in the population of Pax7+/Myod1 + cells, representing committed myoblasts ( Figure 14K, Fig.2 and Figure 16F). This suggests that reduction of Trpsl levels in MuSCs results in an increased ability to proliferate and differentiate.
  • Example 11 Reduction of TRPSI levels in ERMS cell lines allow terminal myogenic differentiation
  • GSEA Gene Set Enrichment Analysis
  • TRPS1 a reduction of TRPS1 expression during the early phases of terminal myogenic differentiation is sufficient for the formation of myotube-like structures and reduced proliferation making TRPS1 a promising candidate for treatment of ERMS.
  • TRPS1 a reduction of TRPS1 expression during the early phases of terminal myogenic differentiation is sufficient for the formation of myotube-like structures and reduced proliferation making TRPS1 a promising candidate for treatment of ERMS.
  • TRPS1 a regain of TRPS1 expression after doxycycline removal suggesting that most cells underwent terminal myogenic differentiation and therefore do not express TRPS1 anymore.
  • TRPS1 a transcriptional repressor
  • TRPS1 expression was identified in human RMS tumors and RMS cell lines.
  • the embryonal subtype showed consistently higher expression compared to the alveolar subtype.
  • Another possibility to explain the higher TRPS1 expression in ERMS could be the heterogeneous source of cells of origin for both RMS subtypes.
  • the RMS tumors of the embryonal subtype may arise at an earlier stage of the myogenic lineage, such as muscle stem cells, and the alveolar subtype eventually develops at a later myogenic stage, e.g. from myoblasts and myocytes, reflecting differences in TRPS1 expression before oncogenic transformation.
  • ERMS e.g.
  • TRPS1 in RD cells, the balancing function of TRPS1 to regulate myogenic differentiation is exploited by aberrant upregulation of its protein levels. Indeed, we could demonstrate that TRPS1 reduction promotes terminal myogenic differentiation of RD cells, finally reducing xenograft tumor growth in mice. Consistently, we found MYOG upregulation upon TRPS1 depletion, which was paralleled by downregulation of the cell cycle gene CCND1 and proliferation marker Ki67. Interestingly, MYOG expression is considered low in ERMS, fitting to increased TRPS1 levels in ERMS tumors.
  • TRPS1 expression in RD cells is causally linked to miR-1 misexpression.
  • TRPS1 is a direct target of miR-1 , which controls its protein levels through post-transcriptional regulation.
  • TRPSI mRNA was not observed after miR-1 transfection for 48 hours measured by RT- qPCR approach, suggesting that the observed effects on TRPS1 protein expression are mediated by translational control.
  • metabolic labeling of newly synthesized proteins revealed reduced levels of nascent TRPS1 protein after miR-1 mimic transfection in RD cells.
  • V5-TRPS1 Overexpression of V5-TRPS1 diminished the ability of miR-1 to induce MYOG and subsequent upregulation of MHO in RD cells, which identifies an interrelated miR-1 - TRPS1 - MYOG axis.
  • the lack of miR-1 expression is a contributing but not limiting mechanism leading to increased TRPS1 protein levels in RD cells.
  • Increased TRPS1 mRNA levels compared to human myoblasts might be caused by dysregulation of additional upstream pathways.
  • BMP/GDF5 signaling controlled TRPS1 expression in kidneys and chondrocytes.
  • TRPS1 prevents terminal myogenic differentiation of RD cells. Lack of miR-1 expression contributes to elevated expression of TRPSI , which could refine the embryonal subtype pathomechanism.
  • Human embryonal rhabdomyosarcoma RD cells and human alveolar rhabdomyosarcoma RH-30 cells were purchased from ATCC and DSMZ, respectively, and cultured in DMEM supplemented with 10 % FBS and penicillin/streptomycin.
  • SMS-CTR and JR1 cells were generously provided by Peter Houghton and Janet Shipley and cultured in DMEM supplemented with 10 % FBS and penicillin-streptomycinsupplemented with 2 % HS (Thermo Fisher Scientific #26050-088) and 1 % Penicillin-Streptomycin (Thermo Fisher Scientific #15140122)).
  • Human 293T/Lenti-X cells were purchased from ATCC and cultured in DMEM supplemented with 10 % FBS and penicillin/streptomycin.
  • Mouse C2C12 myoblasts were purchased from ATCC and cultured in DMEM supplemented with 10 % FBS and penicillin/streptomycin.
  • Human skeletal muscle myoblasts were either purchased from GIBCO or described in (von Malt leopard et al., 2013) and cultured on collagen-coated cell culture dishes in F12/DMEM supplemented with 20 % FBS and penicillin/streptomycin. Cells were maintained in a humidified incubator at 37 °C and 5 % CO2.
  • TE-671 , RH-18, RH-41 protein lysates and RNA extracts were a kind gift from Prof. S. Hashemolhosseini. Generation of TRPS1 knockout RD cells
  • TRPS1 knockout in RD cells was performed as recently described (Elster et al., 2018). TRPS1 knockout was validated by absence of the TRPS1 protein using antibodies that recognize both, TRPS1 N-terminus and C-terminus. Genomic DNA from RD cells was isolated and the region flanking the sgRNA targeting site was amplified by PCR. The amplicon was cloned into pJet and subjected to Sanger sequencing, revealing frameshifts leading to premature stop codons.
  • non-targeting shRNA i-shNT, sequence
  • TRPS1 -targeting shRNAs were expressed from a tetracycline inducible promotor from plasmid after lentiviral infection (i-shTRPS1#1 , i-shTRPS1#2).
  • siRNAs were purchased from Dharmacon (see below) and were was transfected using the RNAiMax (Invitrogen) reagent in a 1 :3 ratio. miRNA mimics and miRNA inhibitors (Thermo Fisher Scientific) were transfected using the RNAiMax (Invitrogen) reagent in a 1 :3 ratio.
  • Acute TRPS1 knockdown in RD-i-shRNA cells was induced by supplementing the growth medium with 1 pg/ml doxycycline (Sigma).
  • TRPS1 Rhabdomyosarcoma tissue micro arrays (TMA) were purchased from US Biomax. TRPS1 was detected using an anti-TRPS1 antibody following standard immunohistochemistry (IHC) protocols. Briefly, specimens were deparaffinized, antigen retrieval, blocking and antibody incubations as well as DAB substrate incubation were performed. Hematoxylin was used as nuclear counterstain. The IHC staining was analyzed by light microscopy using a Zeiss microscope. RNA isolation and RT-qPCR
  • DEGs Differentially expressed genes
  • ChlP-sequencing was performed as previously described (Elster et al., 2018). Briefly, RD and RD-TRPS1-KO cells were fixed in 1 % glutaraldehyde for 10 minutes. Nuclei were released using hypotonic buffer with protease inhibitors and lysed in ChIP lysis buffer. The chromatin was sonified in 1 .5 ml thin-walled reaction tubes (Diagenode) using a Bioruptor (Diagenode) with 60 cycles (30 sec ON, 30 sec OFF), yielding chromatin fragment sizes of approximately 200 bp.
  • DNA libraries for sequencing were prepared according to the manufacturer's instructions using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) and Dual Index Primers (NEBNext Multiplex Oligos for Illumina, NEB). The samples were purified using magnetic beads, the quality was checked with an Agilent Bioanalyzer 2100 and nextgeneration sequencing was performed using a HiSeq2500 (Illumina).
  • ChlP-qPCR was performed using the SimpleChIP® Plus Sonication Chromatin IP Kit (CST) according to the manufacturer's instructions. Briefly, cells were cross-linked as described above. Nuclei were extracted and lysed using the kit's components. For chromatin immunoprecipitation 2 pg of antibody or respective IgG control were incubated together with 10 pg cross-linked and sheared chromatin overnight at 4 °C under constant rotation. Subsequently, magnetic beads were added to the samples followed by incubation at 4 °C under constant rotation for two hours. IPs were then washed and eluted using the kit's components. DNA was purified using spin columns and quantified by qPCR assay.
  • CST SimpleChIP® Plus Sonication Chromatin IP Kit
  • Proteins were obtained by cell lysis using RIPA buffer containing PhosSTOP and Protease STOP inhibitors (Roche). Cleared protein lysates were separated on Bis-Tris gels by SDS-PAGE and transferred on PVDF membranes. Membranes were blocked in 5 % skim milk in TBS-T and incubated with primary and secondary antibodies dissolved in blocking reagent. Protein bands were visualized on a LAS camera system (ECL Imager) using the ECL-detection Kit (Pierce). For densitometric quantification of protein bands, FIJI software was used. Target protein expression was normalized to GAPDH from at least 3 independent biological replicates (3 protein lysates).
  • Wildtype C57BL/6 mice were either bred in house or purchased by Janvier (Source). NOD.SCID mice were purchased by Janvier. Upon arrival, mice had a one week acclimatization time. All mice were housed at the animal facility of the Leibniz-lnstitute on Aging - Fritz Lipmann Institute under specific-pathogen-free (SPF) conditions. The mice were maintained in groups of 2-5 mice in individually ventilated cages (IVC) with nesting material and enrichment, 12 hours day-night cycles, 20 - 24 °C , 40 - 70 % humidity, 17-fold air change; and received standard chow and water ad libitum according to the directive 2010/63 EU and GV SOLAS.
  • IVC individually ventilated cages
  • mice were checked daily by animal caretakers. Animal experiments reported in this study were aproaved by the “Thuringer Austinamt fur erbraucherschutz”, Bad Langensalza (FLI-17-005, FLI-18-001 , 03- 048-16).
  • Muscle cross-sections were prepared and immunofluorescence (IF) staining was performed according to known protocols. Of note, to detect devMHC by IF the samples must not be PFA fixated. Images were captured using Zeiss Observer Z1 microscopes. IF for cultured cells followed principally the same steps.
  • the lower hindlimbs of NOD.SCID mice were isolated from the knee to the ankle, and all tissue but the TA muscle attached to the bone were removed.
  • RD-i-shRNA cells were treated with 1 pg/ml doxycycline in growth medium for 48 hours.
  • 50,000 RD-i-shRNA cells were then injected into the isolated TA explants and cultured further in a12-well plate with doxycycline containing differentiation medium for 72 hours.
  • TA explants were then further processed for cross-sectioning and IF staining.
  • RD-shRenilla and RD-shTRPS1#1 cells were grown in serum-free medium on ultra-low attachment plates following known protocols. After 10 passages, spheres were dissociated using Accutase and 20000 cells were seeded into 12-well, cultured for 3 days and the number of spheres per well was counted. miRNA reporter assay
  • Luciferase vectors for miRNA reporter assays were constructed with the commercial kits following the manufacturer's instructions.
  • the TRPS1 3’UTR fragments UTR1 and UTR2 were PCR amplified from RD genomic DNA. miR-1 seed regions within the TRPS1 3’UTR, either wildtype or mutated were generated by DNA oligonucleotide annealing. Inserts were ligated to Spel and Mlu ⁇ digested pMIR-REPORT luciferase vector.
  • 150,000 RD cells were seeded in 24-well plates filled with 0.5 ml growth medium and incubated over night at 37 °C. The cells were then transfected with 0.5 pg of the reporter vectors (pMIR- REPORT and pbeta-GAL) together with the miRNA mimics (1 nM final) using Lipofectamine 2000 according to the manufacturer's instruction.
  • the reporter vectors pMIR- REPORT and pbeta-GAL
  • p-Galactosidase activity 30 pl of lysate, 20 pl 1x reporter lysis buffer and 50 pl 2x assay buffer were mixed in a 96-well plate and incubated at 37 °C for 30 min. The absorbance was measured at 405 nm and was used for normalization of luciferase activity.
  • RD cells were transfected with miR-NT or miR-1 miRNA mimic. 43 hours post transfection the cells were starved for 1 hour with methionine-free medium (Gibco, 21013-024). The medium was then replaced with methionine-free medium supplemented with 200 pM AHA (L- azidohomoalanine) (Invitrogen), an amino acid analog, and cells were incubated for 4 hours at 37 °C. Whole cell protein lysates were prepared and immunoprecipitation (IP) was performed using 2 pg anti-TRPS1 antibody (Abeam, ab209664) for 200 pg total protein.
  • IP immunoprecipitation
  • a Click-IT reaction was performed to biotinylate the incorporated AHA following the manufacturer's instructions (Invitrogen, C33372) and the beads were then washed and eluted.
  • the IP eluates as well as input protein samples were subjected to Western blotting as described in chapter 4.2.11.
  • a streptavidin-HRP conjugate was used for detection of biotinylated TRPS1 protein in the IP samples.
  • siRNAs The siRNAs used to transfect cells were purchased from Dharmacon as ON TARGETplus SMARTpool (4 different siRNAs against the target or non-targeting control), solubilized in 1x siRNA buffer (Dharmacon) at a concentration of 20 pM and stored at -20 °C.
  • the siRNA used for in vivo injection was purchased from Dharmacon as Accell SMARTpool, a modification allowing self-delivery without transfection reagent, solubilized and stored as described above.
  • m/rVanaTM miRNA mimics or inhibitors were purchased from Thermo Fisher Scientific, solubilized in DEPC-H2O at a concentration of 50 pM and stored at -80 °C. Table 2. miRNA mimics and inhibitors.
  • TRPS1 acts as a context-dependent regulator of mammary epithelial cell growth/differentiation and breast cancer development. Genes Dev. 34:179-193.
  • TRPS1 shapes YAP/TEAD-dependent transcription in breast cancer cells. Nat Commun. 9:3115.
  • Trpsl functions downstream of Bmp7 in kidney development. J Am Soc Nephrol. 20:2403-2411.
  • Myf6/MRF4 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool. EMBO Rep:e49499.
  • miR-206 integrates multiple components of differentiation pathways to control the transition from growth to differentiation in rhabdomyosarcoma cells. Skelet Muscle. 2:7
  • Pax7 activates myogenic genes by recruitment of a histone methyltransferase complex. Nat Cell Biol. 10:77-84.
  • MRF4 a new member of the muscle regulatory factor gene family. Genes Dev. 3:2050-2061 .
  • PAX3-FKHR and PAX7-FKHR gene fusions are prognostic indicators in alveolar rhabdomyosarcoma: a report from the children's oncology group. J Clin Oncol. 20:2672-2679.
  • MyoD1 a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science. 242:405-411. von Malt leopard, J., A.E. Jones, R.J. Parks, and M.A. Rudnicki. 2013. Pax7 is critical for the normal function of satellite cells in adult skeletal muscle. Proc Natl Acad Sci U S A. 110:16474-16479.
  • Myogenin a factor regulating myogenesis, has a domain homologous to MyoD. Cell. 56:607-617.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to a Tricho-Rhino-Phalangeal Syndrome Type I Protein (TRPS1) inhibitor for use in the treatment of a rhabdomyosarcoma, preferably in a human subject. Preferably, the rhabdomyosarcoma is an embryonal rhabdomyosarcoma (EMRS). In embodiments, the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells. In embodiments, the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1-suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1-suppressive oligonucleotide.

Description

TRPS1 INHIBITOR FOR USE IN THE TREATMENT OF RHABDOMYOSARCOMA
DESCRIPTION
The present invention is in the field of treating a rhabdomyosarcoma.
The invention relates to a Tricho-Rhino-Phalangeal Syndrome Type I Protein (TRPS1) inhibitor for use in the treatment of rhabdomyosarcoma, preferably in a human subject. Preferably, the rhabdomyosarcoma is an embryonal rhabdomyosarcoma (EMRS). In embodiments, the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells. In embodiments, the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1-suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1-suppressive oligonucleotide.
BACKGROUND OF THE INVENTION
TRPS1 is a GATA-like transcription factor with repressor function, which is controlling differentiation in various contexts, such as breast tissue or kidney nephrogenesis (Cornelissen et al., 2020; Gai et al., 2009). The TRPS1 protein is highly conserved among species including humans and mice and contains nine zinc finger DNA binding domains. One of the zinc fingers shares homology to GATA transcription factors, two zinc fingers are of the IKAROS type and six others lack homology to known DNA binding proteins. Importantly, the C-terminal IKAROS domain is required for TRPSI to function as a transcriptional repressor.
TRPS1 regulates fate and function of multiple cell types, including chondrocyte differentiation and apoptosis, mesenchymal stem cell differentiation, nephrogenesis, hair follicle cell proliferation and apoptosis, mammary epithelial cell differentiation, and Leydig cell proliferation. TRPS1 has been implicated in tumorigenesis of breast cancer, prostate cancer, and osteosarcoma, for example, and was recently identified as a novel fusion partner in different sarcomas (Chang et al., 2007; Elster et al., 2018). Furthermore, mutations in TRPS1 cause the human tricho-rhino-phalangeal syndrome 1 , a disorder mainly affecting the development of the skeletal system. However, the expression and function of TRPS1 in the context of myogenic differentiation of MuSCs and RMS remains unknown so far.
Rhabdomyosarcoma (RMS) is an aggressive pediatric soft tissue sarcoma of skeletal muscle accounting for 3 % of all childhood cancers and 50% of all soft tissue sarcomas (Saab et al., 2011). Tumors can arise at every side of the body. RMS is believed to originate from deregulated myoprogenitor cells, although recently also alternative cellular sources such as epithelial cells or adipocytes were described. RMS tumors are divided based on histopathological features into two major subtypes, embryonal RMS (ERMS) and alveolar RMS (ARMS). ERMS is the most frequent RMS subtype (incidence rate: 60 %) and constitutes a heterogeneous group characterized by mutations in different signaling pathways. However, the RAS-RAF-MAPK and PI3K-AKT-mTOR pathways are predominantly affected as well as chromosomal gains and losses. In contrast, ARMS is less frequent (approximately 20 % of RMS cases), but even more aggressive, and homogeneously characterized by the chromosomal translocation t(2; 13)/t(1 ; 13), encoding for a novel oncogenic fusion protein PAX3/7-FOXO1 , respectively. Of note, RMS cells display an impaired terminal myogenic differentiation causing uncontrolled proliferation and tumor growth.
Muscle stem cells (MuSCs) are tissue resident stem cells of skeletal muscle conferring the ability to form new myofibers thereby repairing damaged muscle throughout life. All MuSCs express the transcription factor Pax7 and under resting conditions, they remain in a quiescent state between the myofiber and the basal lamina. Upon stimuli, e.g. injury, MuSCs can activate and start to proliferate, differentiate, and fuse to each other or to existing myofibers thereby forming new myofibers. Myofibers are terminally differentiated, postmitotic, and multinucleated syncytia which express muscle structural proteins, such as myosin heavy chain (MHC) and troponins (TNN) important for force generation. Myogenic differentiation is governed by the highly regulated activity and temporal expression of the myogenic regulatory factors (MRFs) Myf5, MyoD1 , Myog, and Myf6. Upregulation of the transcription factors Myf5 and MyoD promotes MuSC activation and myoblast proliferation, followed by upregulation of the transcription factor Myog, promoting myogenic differentiation and fusion of myocytes, whereas Myf6 has functions in myofiber growth and maintenance.
Transcriptional deregulation of MRFs has been suggested to impair myogenic differentiation in RMS, yet the underlying causes are largely unknown. There is emerging evidence that miRNA expression patterns are often deregulated in RMS pathogenesis causing altered gene expression programs on a posttranscriptional level and ultimately leading to inhibition of myogenic differentiation. For example, expression of the pro-myogenic miRNAs miR-1/miR-206 and miR- 133 is strongly reduced in RMS while their expression is strongly induced and required for differentiation of myoblasts.
US2012059159 discloses microRNAs (microRNAI or microRNA-206) or combinations thereof, for use in the differentiation treatment of rhabdomyosarcoma to convert the sarcoma cells into terminally differentiated myogenic cells. TRPS1 is not mentioned, neither as regulatory target nor as an inhibitor of terminal myogenic differentiation in rhabdomyosarcoma cells.
CN 109609644 describes the use of an inhibitor or antagonist of the PAX3-FKHR gene or protein for the preparation of a therapeutic agent for rhabdomyosarcoma. No link to TRPS1 is shown in this application.
XP055907519 discloses that elevated levels of PAX3 and cell proliferation genes are characteristic features of rhabdomyosarcoma (RMS). It is described that PAX2 and CCND2 are regulated by both, miR-1 and miR-206, and miR-29 regulates the expression of CCND2 and E2F7, suggesting a presence of a potential miRNA regulatory network that is deregulated in RMS. There is no revelation of a link to TRPS1 .
Therefore, a need in the art for the development of effective treatment approaches that directly act on molecular drivers of RMS pathogenesis for providing a targeted and effective therapy remains. SUMMARY OF THE INVENTION
In light of the prior art the technical problem underlying the present invention is to provide means for treating and/or preventing the growth of a rhabdomyosarcoma, such as an embryonal rhabdomyosarcoma (EMRS).
This problem is solved by the features of the independent claim. Preferred embodiments of the present invention are provided by dependent claims.
The invention therefore relates to a Tricho-Rhino-Phalangeal Syndrome Type I Protein (TRPS1) inhibitor for use in the treatment of a rhabdomyosarcoma, preferably in a human subject.
The present invention is based on the entirely unexpected finding that TRPS1 inhibition, in particular downregulation of TRPS1 levels in rhabdomyosarcoma cells inhibits proliferation of these cancer cells. Furthermore, it was observed that surprisingly upon TRPS1 downregulation, which is understood to be a functional inhibition of TRPS1 , leads to myogenic differentiation of the rhabdomyosarcoma cells, and leads to the formation of functional, non-proliferating muscle cells. Accordingly, it was surprisingly found that inhibition of TRPS1 represents a suitable treatment of rhabdomyosarcoma that inhibits cancer cell proliferation and induces differentiation of the cancer cells to a non-malignant phenotype.
It was found that this therapeutic effect of TRPS1 inhibition is particularly pronounced in rhabdomyosarcoma cells that express high levels of TRPS1. Accordingly, in embodiments, the TRPS1 inhibitors of the invention should be applied in treatment of rhabdomyosarcomas with elevated TRPS1 levels. Since rhabdomyosarcoma mostly develops from mesenchymal progenitor cells that have not fully differentiated into myocytes of skeletal muscle, the TRPS1 level of differentiated myocytes can serve as a reference level for TRPSI levels to which the level in the cancer cells could be compared.
The data presented below show for the first time that surprisingly TRPS1 expression is especially increased and sustained in RMS, in particular in ERMS. Unexpectedly, it could be demonstrated that under physiological conditions downregulation of TRPS1 expression is required to allow normal myogenic differentiation during development. However, in RMS cells, TRPS1 is very often constantly upregulated which leads to suppressing myogenic differentiation and to development and maintenance of a cancerous state of the cells. This occurs particularly in ERMS. As shown herein, the constant TRPS1 expression is at least partially mediated through lack of miR-1 expression in ERMS.
It could further be shown that TRPS1 acts as a molecular and transcriptional suppressor in myogenic progenitors cells as well as in RMS cells, since upon reduction of TRPS1 levels myogenic differentiation programs governed by MYOG can be activated. Of note, reduction of TRPS1 levels in ERMS cells effectively inhibited ERMS tumor growth. Based on the discovery that TRPS1 is a major control factor in myogenic differentiation that prevents cellular differentiation and stops proliferation of myogenic progenitors as well as ERMS cells, it could be proven that functional inhibition of TRPS1 , in particular downregulation of TRPS1 levels, is an effective treatment of RMS, in particular ERMS and other forms of RMS that show expression of TRPS1. In embodiments, the rhabdomyosarcoma is an embryonal rhabdomyosarcoma (EMRS). Treatment of EMRS is particularly preferred in the context of the present invention, since it was found that in this RMS subtype TRPS1 upregulation (which could also be interpreted as a lack of down regulation) does frequently occurred. Accordingly, among the different RMS types EMRS is very likely to be effectively treated by TRPS1 inhibitors as described herein.
In further embodiments, reduction of TRPS1 levels in other ERMS modell cell lines result in enhanced myogenic differentiation. TRPS1 mRNA expression and TRPS1 protein levels were determined in two additional ERMS lines, namely SMS-CTR and JR1 , confirming aberrantly high TRPS1 protein and mRNA levels compared to human skeletal myoblasts. Furthermore, it has been tested whether a single transfection with siRNA targeting TRPS1 would be sufficient to induce myogenic differentiation in SMS-CTR and JR1 cells. Indeed, reduction of TRPS1 expression enhanced myogenic differentiation measured by an increase in the percentage of MYOG+ nuclei in both cell lines.These data suggest that TRPS1 is one of the main causes for impaired terminal myogenic differentiation in ERMS cells and that reduction of TRPS1 levels in ERMS cells permits myogenic differentiation.
Moreover, the data presented below show that TRPS1 levels in RD cells, the bona fide modell cell line for embryonal rhabdomyosarcoma, are regulated by miR-1 and that TRPSI and MYOD1 share common genomic binding sites. The MYOG promoter is one of the critical targets of TRPS1 and MYOD1 . It could be demonstrated that TRPS1 restricts MYOG expression and thereby inhibits terminal myogenic differentiation. Reduction of TRPS1 levels in embryonal rhabdomyosarcoma therefore might be a therapeutic approach to drive embnryonal rhabdomyosarcoma cell into myogenic differentiation thereby generating postmitotic myotubes.
However, in embodiments, other RMS types can also be treated by the inhibitors of the invention. For example, although ARMS is often associated with characteristic chromosomal translocations and pathogenic fusion protein occurrence, in some cases it can also be associated with high levels of TRPS1.
In embodiments, the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPSI protein translation.
It is particularly preferred that the TRPS1 inhibitor of the invention is a compound, nucleic acid, or any kind of reagent of set of reagents that leads to a functional inhibition of TRPS1 , preferably to a downregulation of TRPS1 mRNA or protein levels in a RMS cell. As used herein, functional inhibition refers to a decrease of TRPS1 molecules in a cell that are biologically active. Biological activity of TRPS1 is mostly its function as a transcription factor that is involved in controlling gene expression and gene repression. In embodiments, inhibitors of the invention prevent TRPS1 from being active as a transcription factor. Further ways of transcription factor inhibition are known to a person skilled in the art. In embodiments, the TRPS1 inhibitor of the invention reduces TRPS1 levels, in particular protein levels, in a RMS cell. In embodiments, the TRPS1 inhibitor reduces TRPS1 mRNA levels, which subsequently also leads to a decrease of the protein levels. In embodiments, a TRPS1 inhibitor leads to a disruption of the TRPS1 gene which can lead to a lack of functional gene expression (gene knockout). In embodiments, the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1- suppressive oligonucleotide.
Suitable suppressive oligonucleotides of the invention can be designed by a skilled person, for example based on the (preferably human) genomic and/or mRNA sequences of TRPS1 .
Suitable embodiments of TRPS1-suppressive shRNAs or siRNAs as well as guide RNAs in conjunction with Cas9 have been used in the examples below. The specific TRPS1 -suppressive oligonucleotides of the examples below represent embodiments of the present invention.
In embodiments, the TRPS1 inhibitor is a siRNA for knock down of human TRPS1 with one of the following sequences:
- GAAUGCAAAUGGCGGAUAU (SEQ ID NO. 1)
- CAACUCAUCCACCGAAUUA (SEQ ID NO. 2)
- GCUGGAAGCUCGCGAGUCA (SEQ ID NO. 3)
- CCACAGAUCUGAUUAAGCA (SEQ ID NO. 4)
In embodiments, the TRPS1 inhibitor is a shRNA for knock down of TRPS1 with one of the following sequences:
- TGCTGTTGACAGTGAGCGACAGGACAAGATAACAGTCAAATAGTGAAGCCACAGATGTA TTTGACTGTTATCTTGTCCTGCTGCCTACTGCCTCGGA (SEQ ID NO. 29)
- TGCTGTTGACAGTGAGCGAAAAGTTGATAGAAGTACTCAATAGTGAAGCCACAGATGTAT TGAGTACTTCTATCAACTTTCTGCCTACTGCCTCGGA (SEQ ID NO. 30)
In embodiments, the TRPS1 inhibitor is a siRNA for knock down of murine TRPS1 with one of the following sequences:
- CGGACAAGAAAGCGCCUUA (SEQ ID NO. 5)
- AGGAAAUAGUUCAUCCGUA (SEQ ID NO. 6)
- GAAUGCAAAUGGCGGAUAU (SEQ ID NO. 7)
- UGAUUAAGCACUUCCGAAA (SEQ ID NO. 8)
UCAAUAGCUUGUAAUGUCU (SEQ ID NO. 9)
GUGUAAAUUUUGUAGUUUC (SEQ ID NO. 10) - UCUGUGACUUUAGAUAUUC (SEQ ID NO. 11)
- GUAACAGACAGAAAUAUGU (SEQ ID NO. 12)
Depending of the type of suppressive oligonucleotide, different ways of delivery to the target cell have been established in the art. Suppressive oligonucleotides, such as antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA have been extensively studied in the art and are already being used in clinical applications. Such oligonucleotides can be designed for virtually any target gene/protein by using suitable design tools that are offered by academic institutions as well as by companies. Importantly, companies even offer sets of such oligonucleotides for almost every human gene/protein or offer to design such oligos upon order. Designing and testing target specific suppressive oligonucleotides therefore represent a routine procedure for a skilled person that is interested in suppressing expression of a specific target gene or protein.
As used herein, guide RNA molecules that are used in conjunction with a RNA-guided endonuclease, for example by using the well-established CRISPR/Cas9 system, represent another kind of suppressive oligonucleotide. It is possible to generate gene knockout, here knockouts of Trspl , by introducing into a target cell a TRPS1 specific gRNA. Furthermore, one has to introduce an RNA-guided endonuclease, which interacts with the gRNA. In embodiments, the gRNA leads the endonuclease to a target site in the genome and induces a DNA double strand break that is incorrectly repaired by non-homologous end-joining (NEJM) which results in so-called insertion-deletions (INDELs) in the target gene. This can lead to premature termination codon (PTC) in mRNA by changes in the reading-frame, which induces degradation of nascent mRNAs with a PTC by the nonsense-mediated decay (NMD) system. Thus, the introduction of INDELs in exons leads to disrupted protein expression.
In the context of the invention, TRPS1 -suppressive oligonucleotides and potentially required helper molecules (such as for example the Cas9 endonuclease in case of using the CRISPR/Cas system) can be introduced by any suitable and known way of introducing such molecules into a target cell. Multiple techniques have been described in the art and are currently being used, which are also dependent on the exact kind of oligonucleotide and underlying molecular mechanism of suppression. For example, the oligonucleotides and potentially required helper molecules can be introduced by expression plasmids injection, transfection or transduction, target cell transduction with viral vectors coding for the oligos and potential helper molecules, or by direct transfection or injection of the oligonucleotides and helper molecules.
In certain embodiments, the TRPS1 inhibitor is a self-delivering siRNA (sd-siRNA). Sd-siRNAs represent suitable inhibitors in the context of the present invention, since they are capable of entering target cells without further reagents, such as transfection reagents. The skilled person is aware of how to generate these now routinely used sd-siRNAs. Illustrative examples are described herein.
In embodiments, the TRPS1 inhibitor comprises or consists of miR-1 . It was surprisingly found that in RMS cells with high levels of TRPS1 the endogenous microRNA miR-1 is lowly expressed. In the experiments leading to the present invention it was unexpectedly found that miR-1 is a negative regulator of TRPS1 expression and that upregulation or ectopic expression of miR-1 suppresses TRPS1 levels in RMS cells. In fact, TRPS1 downregulation by miR-1 appears to be a naturally occurring event during myogenic differentiation. Accordingly, in embodiments miR-1 or miR-1 mimics as disclosed in the examples can be used as TRPS1 inhibitors for downregulation. Furthermore, it is understood that in embodiments of the invention the inhibitor can be a molecule/compound/composition that induces upregulation of endogenous miR-1 which then leads to a downregulation of TRPS1 in the RMS cells.
In embodiments of the invention, the TRPS1 inhibitor inhibits proliferation of rhabdomyosarcoma cells. As shown herein, TRPS1 inhibition and in particular TRPS1 downregulation or knockout in RMS cells inhibits RMS cell proliferation and is therefore a suitable therapy for RMS, in particular to reduce or inhibit tumor growth.
In embodiments, the TRPS1 inhibitor induces myogenic differentiation of rhabdomyosarcoma cells. It is a further advantage of the present invention that it was found out that TRPS1 down regulation, in particular in RMS cells with high TRPS1 levels, induce differentiation of the cancer cells towards differentiated myogenic cells. It appears that at least in certain embodiments RMS cells have emerged from not terminally differentiated myogenic progenitor cells that failed to downregulate TRPS1 . Downregulation or inhibition of TRPS1 can induce such RMS cells to continue along the myogenic differentiation pathway to form differentiated non-proliferating myogenic cells that can even be functional in muscle tissue and can even contract.
In embodiments of the invention, the differentiation of rhabdomyosarcoma cells leads to formation of functional muscle cells. It was observed that downregulation of TRPSI in RMS cells, in particular in ERMS cells, can induce myogenic differentiation and lead to formation of functional muscle cells that integrate in the surrounding tissue. In embodiments, TRPS1 inhibition of down regulation leads to a loss of pathogenic features of RMS cells and an induction of physiological features, which can result in formation of non-pathogenic cells.
In embodiments, the rhabdomyosarcoma to be treated is associated with TRPS1 expression, which is preferably identified by analyzing rhabdomyosarcoma cells for TRPSI expression.
The skilled person is aware of multiple routinely used techniques for analyzing target gene expression of presence of target proteins in cells. mRNA can be routinely analyzed by RT-PCR using target gene specific primers, or by RNA sequencing, for example. Protein levels can be analyzed, for example, by western blot, immunofluorescence or mass spectrometry. Several methods for TRPSI detection in RMS cells are used in the examples below and a skilled person has no problem to identify suitable techniques.
In embodiments, the TRPS1 inhibitor is administered transiently or constantly. In embodiments, transient administration or presence of the TRPS1 inhibitor is sufficient for inducing differentiation and/or inhibiting proliferation of RMS cells. As shown herein, it was unexpectedly found that even if an inhibitor of TRPS1 is only transiently present in a cell, the resulting downregulation of TRPS1 levels was sufficient to induce myogenic differentiation of RMS cells and that this phenotypic change that is maintained even after the inhibitor is no longer present in the cell. This hints to induction of a cellular differentiation program by TRPS1 downregulation/inhibition that is non- reversible. This is highly advantageous since the inhibitor does not have to be constantly present in the cell. Accordingly, in embodiments even a one-time administration of the inhibitor is sufficient to induce the therapeutic effect. In embodiments, the inhibitor is either administered once or constantly until a desired therapeutic effect is induced.
However, in embodiments the inhibitor can be introduced by techniques that enable constant or even controllable presence of the inhibitor. For example, stable delivery of nucleic acids that encode for a suppressive oligonucleotide under the control of a suitable genetic control elements for expression of the oligonucleotide can be used, such as expression plasmids or viral vectors encoding for the oligonucleotide under the control of a constitutively active or inducible promoter or promoter/enhancer combination. Use of an inducible promoter makes it possible to induce expression of a suppressive oligonucleotide for a certain time and stop expression after the differentiation of the RMS cells has occurred.
In embodiments, the treatment of the invention further comprises (simultaneous or sequential) administration of one or more other antitumor therapies.
RMS is currently treated in multiple ways. Applied treatments can include surgery, chemotherapy, radiation, and possibly immunotherapy. The treatment using TRPS1 inhibitors described herein can be used with any one or more of established or future treatment options and can result in an additive or synergistic therapeutic effect.
In another aspect, the present invention relates to a TRPS1-suppressive oligonucleotide for use in the treatment of a rhabdomyosarcoma, preferably a rhabdomyosarcoma associated with TRPS1 expression, wherein the TRPS1 -suppressive oligonucleotide is preferably a TRPS1- specific antisense oligonucleotide, microRNA (miR), shRNA, siRNA, or guide-RNA in conjunction with an RNA-guided endonuclease.
Delivery systems for oligonucleotide-based drugs are well established in the art and can be used in the context of the invention (see for example Thomas C. Roberts, Robert Langer & Matthew J. A. Wood, Advances in oligonucleotide drug delivery. Nature Reviews Drug Discovery volume 19, pages 673-694 (2020); Marine Imbert et al. Viral Vector-Mediated Antisense Therapy for Genetic Diseases. Genes (Basel). 2017 Feb; 8(2): 51).
In a further aspect, the invention relates to a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide for use in the treatment of a rhabdomyosarcoma, preferably a rhabdomyosarcoma associated with TRPS1 expression.
Such nucleic acid molecules can be expression plasmids or RNA molecules that enable expression of the TRPS1-suppressive oligonucleotide in a RMS cell. In embodiments, the nucleic acid molecule of the invention is comprised by a viral vector that facilitates delivery of the nucleic acid molecule to the target cell. Furthermore, the oligonucleotides or nucleic acids of the invention can be delivery by means of peptide vectors or other established delivery vehicles.
In another aspect, the invention relates to a pharmaceutical composition for use in the treatment of a rhabdomyosarcoma as disclosed herein, comprising a TRPS1 inhibitor and a pharmaceutically acceptable carrier. A pharmaceutical composition of the invention preferably comprises a TRPS1 inhibitor in combination with a pharmaceutically acceptable carrier which may be any of those known in the art or devised hereafter and suitable for the intended use. The pharmaceutical composition of the invention may include other ingredients, including dyes, preservatives, buffers and antioxidants. In some embodiment, the pharmaceutical composition as used herein can be formulated for administration by oral, intravenous, intramuscular, or subcutaneous, topical routes. In another embodiment, the pharmaceutical composition or the TRPS1 inhibitor can be directly applied to the cancerous tissue, i.e. the location of tumor.
In embodiments of the invention, the treatment rhabdomyosarcoma, preferably EMRS, further comprises simultaneous or sequential administration of one or more other active agents useful for treating the rhabdomyosarcoma. The various aspects of the invention are based on and/or are linked by the common and surprising finding that inhibition and in particular downregulation of TRPS1 levels is effective in treating rhabdomyosarcomas, in particular EMRS, by inducing differentiation or/and inhibition/downregulation of proliferation of the cancer cells. The various features and advantages of the invention that are disclosed in the context of one aspect of the invention are herewith also disclosed in the context of the other aspects of the invention described herein.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to a TRPS1 inhibitor for use in the treatment of a rhabdomyosarcoma, preferably ERMS.
As used herein, the term “Tricho-rhino-phalangeal syndrome Type 1” or “TRPS1” refers to a transcription factor also termed “transcriptional repressor GATA binding 1”. Further names TRPS1 used in the art comprise thricho-rhino-phalangeal syndrome Type I protein, trichorhinophalangeal syndrome I, Zinc finger protein GC79, LGCR, and GC79.
TRPS1 is a GATA-like transcription factor with repressor function, which is controlling differentiation in various contexts. Mutations in TRPS1 cause the human tricho-rhino-phalangeal syndrome 1 , a disorder mainly affecting the development of the skeletal system. TRPS1 regulates fate and function of multiple cell types, including chondrocyte differentiation and apoptosis, mesenchymal stem cell differentiation, nephrogenesis, hair follicle cell proliferation and apoptosis, mammary epithelial cell differentiation, and Leydig cell proliferation. Importantly, TRPS1 has been implicated in tumorigenesis of cancers such as, breast cancer, prostate cancer, osteosarcoma, and was identified as a novel fusion partner in different sarcomas. Of note, the TRPS1 protein is highly conserved among species including humans and mice and contains nine zinc finger DNA binding domains. One of the zinc fingers shares homology to GATA transcription factors, two zinc fingers are of the IKAROS type and six others lack homology to known DNA binding proteins. Importantly, the C-terminal IKAROS domain is required for TRPSI to function as a transcriptional repressor.
The TRPS1 gene (human NCBI gene ID 7227; https://www.genecards.org/cgi- bin/carddisp.pl?gene=TRPS1 ; https://www.uniprot.org/uniprot/Q9UHF7) encodes for a nuclear localized transcription factor with repression function. The TRPS1 protein comprises 1281 amino acids and has a molecular mass of approximately 140 kDa, comprising a nuclear localization signal and nine DNA binding motifs of different types, including GATA and IKAROS-like zinc fingers, which systematically classify it as a GATA-like transcription factor. There is a high conservation of the TRPS1 protein sequence across species with Xenopus and mouse sharing 73 % and 93 % similarity to the human protein, respectively.
High expression of TRPS1 was detected during mouse embryonal development in cartilage condensations, sites of joint development, hair follicles, and the snout as well as various other sites. According to the Human Protein Atlas, TRPS1 protein expression in the adult is detected at higher levels but not restricted to tissues such as female and male reproductive organs, the brain, the lung, the digestive system, the kidney, and the skin. In line with the expression pattern, mutations or deletion of the TRPS1 gene cause a rare human syndrome, tricho-rhino-phalangeal syndrome type 1 , which is characterized by craniofacial and skeletal abnormalities. Mouse models with a genetic deletion of the TRPS1 GATA domain resembled features of the human syndrome, revealing roles for TRPSI in chondro- and osteogenesis and hair growth. Subsequent studies identified a molecular interaction of TRPSI with Runt-related transcription factor 2 (Runx2), Indian hedgehog (Ihh)/Gli3 signaling, and signal transducer and activator of transcription 3 (Stat3) to control chondrogenic processes. Beyond its role in the development of the skeletal system, TRPS1 was found to be important for proper establishment of cell fate and differentiation in other tissues, such as breast tissue or kidney nephrogenesis. Deregulation of TRPSI is associated with certain types of human cancer, such as breast cancer. Here, TRPS1 was shown to bind together with TEA domain transcription factors (TEAD) at joint genomic sites to regulate YAP transcriptional activity through recruitment of co-repressor complexes modulating the chromatin landscape. TRPS1 depletion was associated with increased H3K27 acetylation at enhancer sites and changed enhancer-promoter long-range chromatin interactions (Elster et al., 2018).
As used herein, the term “inhibitor of TRPS1” or“TRPS1 inhibitor” shall mean substance, compound, molecule or system which is capable of interfering with the expression of TRPS1 and in particular capable of downregulation of TRPSI mRNA and/or protein levels in rhabdomyosarcoma cells. In embodiments, the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPSI protein translation.
In the context of the invention, increased TRPS1 mRNA and/or TRPS1 protein expression in the tissue of the rhabdomyosarcoma, especially ERMS, has been observed.
In embodiments, the TRPS1 inhibitor is a TRPS1-suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1- suppressive oligonucleotide.
In one embodiment, a TRPS1 inhibitor modulates the function of TRPSI negatively, i.e. inhibits functionality of TRPSI . In another embodiment, a TRPS1 inhibitor can displace TRPS1 from its target gene locus and induces, for example, transcriptional de-repression of target genes. In one embodiment, a TRPS1 inhibitor disrupts the interaction between TRPS1 and genomic/chromosomal DNA. In one embodiment, a TRPS1 inhibitor negatively regulates the translation of the CBX7 mRNA. In embodiments, a TRPS1 inhibitor functions on the post- translational level, for example by accelerating or inducing TRPS1 protein degradation. In another embodiment, a TRPS1 inhibitor functions at the RNA level and reduces the mRNA levels of TRPS1 , such as a TRPS1 -specific siRNA or shRNA. In some embodiments, a TRPS1 inhibitor functions at DNA levels which leads to knock-down or know-out of TRPS1 , such as via CRISPR- Cas9.
In embodiments, a TRPS1 inhibitor can be a compound, a modulator or a ligand or a small molecule inhibitor or antagonist or an antibody binding to TRPS1 or a TRPS1 suppressive oligonucleotide, such as a TRPS1 siRNA or a TRPS1 shRNA, or any combinations thereof.
In embodiments, a TRPS1 inhibitor can be a TRPS1 -suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid or viral vector encoding a TRPS1-suppressive oligonucleotide. In embodiments, the TRPS1 suppressor can be a system including several components, such as for example a guide RNA in conjunction with an RNA- guided endonuclease, for example Cas9, which may function for example by generating a functional knock-out of the TRPS1 gene in the genomic DNA of a cell by means of the CRISPR/Cas9 system. In such a context, a TRPS1 inhibitor system can comprise several components that act together to generate a functional inhibition, for example a functional gene knock-out, of TRPS1 . The skilled person in view of the present disclosure and the common general knowledge is aware of suitable system components that may lead to functional inhibition of TRPS1 and that can be used as a TRPS1 inhibitor in the sense of the invention.
In embodiments, a TRPS1 inhibitor can be a compound, such as a biological or chemical molecule, such as a small molecule, a protein, a nucleic acid, chemicals, inorganic molecules, organic molecules, cDNA encoding a protein, a secreted protein, a large molecule, an antibody, a morpholino, a triple helix molecule, a peptide, siRNA, shRNA, miRNA, antisense RNA, ribozyme or any other compound or combination of compounds that can be envisioned to be used as a functional inhibitor of TRPS1 in the treatment of a subject.
In embodiments, the TRPS1 inhibitor comprises or consists of miR-1 . miR-1 refers to a potential upstream regulator of TRPS1. Potential miR-1 binding sites were identified within the 3’ untranslated region (UTR) of the TRPS1 mRNA. Since miR-1 expression is strongly induced during myoblast differentiation, exerting pro-myogenic activity, and deregulation of miR-1 expression, is a common hallmark of RMS cells we tested whether miR-1 controls TRPS1 levels in RD cells and exerts similar effects in RD cells. These results demonstrate a role for TRPSI as a critical downstream target of miR-1 , whose expression is required to be reduced for efficient terminal myogenic differentiation.
In embodiments, the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPSI protein translation.
As used herein, reducing TRPS1 levels shall mean the mRNA levels or the protein levels of TRPS1 are reduced at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%. In embodiments, “reducing TRPS1 levels” can refer to a knockout of TRPS1 on genomic DNA, which means that no functional mRNA can be transcribed that leads to production of functional TRPS1 protein. In embodiments, “reducing TRPS1 levels” can further refer an inhibitor that leads to the production of dysfunctional TRPS1 protein.
The term “TRPS1 -suppressive oligonucleotide” shall relate to any kind of oligonucleotide that induces a reduction of TRPS1 protein levels in a cell. This can be an oligonucleotide that, for example, induces the degradation of TRPS1 mRNA, or an oligonucleotide that induces gene silencing or a gene knock out.
The term “gene silence" relates to regulatory mechanisms that are involved in gene expression control in a cell to prevent the expression of a certain gene. Gene silencing can occur on either transcriptional or translational level. In particular, methods used to silence genes are being increasingly used to produce therapeutics to combat cancer and other diseases, such as infectious diseases and neurodegenerative disorders. When genes are silenced, their expression is reduced. In contrast, when genes are knocked out, this refers to a complete abolishment of (functional) gene expression.
Inhibitory or suppressive oligonucleotides that can be used as TRPS1 inhibitors comprise antisense oligonucleotides, shRNAs, siRNAs, microRNAs, ribozymes and guide RNA of the CRISPR/Cas system in conjunction with suitable RNA-guided endonucleases.
In embodiments, the term gene silencing induced by an inhibitory or suppressive oligonucleotide, acting for example through RNA interference, when used herein is understood to relate to a reduction of the mRNA or protein level of the target in the cell by at least 5% of the mRNA level found in cells without introduction of oligonucleotide. In embodiments, gene silencing induced by an inhibitory or suppressive oligonucleotide leads to about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 100% decrease of mRNA and/or protein level compared to that found in cells without introduction of RNA interference. In a preferred embodiment, mRNA and/or protein levels are reduced by at least about 70%, about 80%, about 90%, about 95%, about 99%, and about 100%.
As used herein, an “antisense oligonucleotide” relates to an oligonucleotide, which is a short nucleic acid molecule or fragment that can bind to complementary target mRNA molecules when added to the cell. Antisense oligonucleotide can be composed of single-stranded DNA or RNA and are usually 13-25 nucleotides long. The antisense oligonucleotides can affect gene expression in two ways: by using an RNase H-dependent mechanism or by using a steric blocking mechanism. RNase H-dependent oligonucleotides cause the target mRNA molecules to be degraded, while steric-blocker oligonucleotides prevent translation of the mRNA molecule. The majority of antisense drugs function through the RNase H-dependent mechanism, in which RNase H hydrolyzes the RNA strand of the DNA/RNA heteroduplex. Antisense oligonucleotides are well established tools for reducing gene expression and therefore a skilled person can design and identify suitable antisense oligonucleotides functioning as TRPS1 inhibitors in the context of the present invention. Antisense oligonucleotides are usually short synthetic oligonucleotide sequences with specific targeted inhibitory action that includes a region that is substantially complementary to an mRNA that codes a target protein. “A region that is substantially complementary to an mRNA” refers to the region of the antisense oligonucleotide that is substantially complementary to a sequence, for example a target sequence, as defined herein. Such sequences hybridize with the mRNA to form a double stranded hybrid trait, such as RNase H, which degrades the DNA I RNA hybrid strand that naturally occurs to trigger DNA replication. It leads to the activation of a widespread catalytic enzyme, which prevents protein translation.
In the context of the invention, it is understood that “ribozymes” are catalytic RNA molecules used to inhibit gene expression. These molecules work by cleaving mRNA molecules, essentially silencing the genes that produced them. Several types of ribozyme motifs exist, including hammerhead, hairpin, hepatitis delta virus, group I, group II, and RNase P ribozymes. Hammerhead, hairpin, and hepatitis delta virus (HDV) ribozyme motifs are generally found in viruses or viroid RNAs. These motifs are able to self-cleave a specific phosphodiester bond on an mRNA molecule. Lower eukaryotes and a few bacteria contain group I and group II ribozymes. These motifs can self-splice by cleaving and joining together phosphodiester bonds. The last ribozyme motif, the RNase P ribozyme, is found in Escherichia coli and is known for its ability to cleave the phosphodiester bonds of several tRNA precursors when joined to a protein cofactor. The general catalytic mechanism used by ribozymes is similar to the mechanism used by protein ribonucleases. These catalytic RNA molecules bind to a specific site and attack the neighboring phosphate in the RNA backbone with their 2' oxygen, which acts as a nucleophile, resulting in the formation of cleaved products with a 2'3'-cyclic phosphate and a 5' hydroxyl terminal end. This catalytic mechanism has been increasingly used by scientists to perform sequence-specific cleavage of target mRNA molecules. In addition, attempts are being made to use ribozymes to produce gene silencing therapeutics, which would silence genes that are responsible for causing diseases. Accordingly, a person skilled in the art can design and identify ribozymes functioning as TRPS1 inhibitors in the context of the present invention.
RNA interference (RNAi) is a natural process used by cells to regulate gene expression. This process to silence genes first begins with the entrance of a double-stranded RNA (dsRNA) molecule into the cell, which triggers the RNAi pathway. The double-stranded molecule is then cut into small double-stranded fragments by an enzyme called Dicer. These small fragments, which include small interfering RNAs (siRNA) and microRNA (miRNA), are approximately 21-23 nucleotides in length. The fragments integrate into a multi-subunit protein called the RNA-induced silencing complex, which contains argonaute proteins that are essential components of the RNAi pathway. One strand of the molecule, called the "guide" strand, binds to RISC, while the other strand, known as the "passenger" strand is degraded. The guide or antisense strand of the fragment that remains bound to RISC directs the sequence-specific silencing of the target mRNA molecule. The genes can be silenced by siRNA molecules that cause the endonucleatic cleavage of the target mRNA molecules or by miRNA molecules that suppress translation of the mRNA molecule. With the cleavage or translational repression of the mRNA molecules, the genes that form them are rendered essentially inactive. RNAi is thought to have evolved as a cellular defense mechanism against invaders, such as RNA viruses, or to combat the proliferation of transposons within a cell's DNA. Both RNA viruses and transposons can exist as double-stranded RNA and lead to the activation of RNAi. Currently, siRNAs are being widely used to suppress specific gene expression and to assess the function of genes. As used herein, a “microRNA” shall mean a small single-stranded non-coding RNA molecule functioning in RNA silencing and post-transcriptional regulation of gene expression. miRNA functions via base-pairing with complementary sequences within mRNA molecules. As a result, these mRNA molecules are silenced, by one or more of the following processes: (1) cleavage of the mRNA strand into two pieces, (2) destabilization of the mRNA through shortening of its poly(A) tail, and (3) less efficient translation of the mRNA into proteins by ribosomes. Accordingly, miRNAs can function as inhibitory oligonucleotides of the invention. miRNAs resemble the small interfering RNAs (siRNAs) of the RNA interference (RNAi) pathway, except miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins, whereas siRNAs derive from longer regions of double-stranded RNA. miRNAs are abundant in many mammalian cell types and as extracellular circulating miRNAs. Circulating miRNAs are released into body fluids including blood and cerebrospinal fluid and have the potential to be available as biomarkers in a number of diseases. miRNAs appear to target about 60% of the genes of humans and other mammals.
In the context of the present invention, it was found that miR-1 is a negative regulator of TRPS1 in mice and humans and therefore represents an inhibitor in the sense of the present invention. miR-1 or any other miR that functions as a TRPS1 inhibitor can be artificially introduced into a target cell by established techniques known to a person skilled in the art. In the context of the invention, as a result of interference with miR-1 , the TRPS1 mRNA molecules are silenced.
As used herein, a short hairpin RNA or small hairpin RNA or shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). An shRNA is an RNA molecule being composed of a short antisense strand, followed by a 5-9 nucleotide loop, and a complementary sense strand. In some embodiments, the sense strand may precede the nucleotide loop structure, followed by the antisense strand. These shRNAs may be contained in plasmids, retroviruses, and lentiviruses. Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors. shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover. Delivery of plasmids to cells through transfection to obtain shRNA expression can be accomplished using commercially available reagents in vitro. Use of a bacterial vector to obtain shRNA expression in cells is a relatively recent approach. It builds off research showing that recombinant Escherichia coli, containing a plasmid with shRNA, fed to mice can knock-down target gene expression in the intestinal epithelium. This approach was used in 2012 in clinical trials to try to treat patients with Familial Adenomatous Polyposis. A variety of viral vectors can be used to obtain shRNA expression in cells including adeno-associated viruses (AAVs), adenoviruses, and lentiviruses. With adeno-associated viruses and adenoviruses, the genomes remain episomal. This is advantageous as insertional mutagenesis is avoided. It is disadvantageous in that the progeny of the cell will lose the virus quickly through cell division unless the cell divides very slowly. AAVs differ from adenoviruses in that the viral genes have been removed and they have diminished packing capacity. Once the plasmid or vector has integrated into the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III depending on the promoter choice. The product mimics pri-microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by Exportin 5. This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs RISC to mRNA that has a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC represses translation of the mRNA. In both of these cases, the shRNA leads to target gene silencing. Due to the ability of shRNA to provide specific, long-lasting, gene silencing there has been great interest in using shRNA for gene therapy applications. Design, Delivery, and Assessment of Gene Knockdown by shRNAs has been discussed widely in the art, for example by Moore et al. (Methods Mol Biol. 2010; 629: 141-158; Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown).
As used herein, it is understood that the terms siRNA or small interfering RNA or silencing RNA shall mean a class of double stranded (ds) RNA, non-coding RNA molecules typically 20-27 base pairs in length, similar to miRNA, and operating within the RNA interference (RNAi) pathway. siRNAs interfere with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription and thereby preventing translation. Naturally occurring siRNAs have a well-defined structure that is a short (usually 20 to 24-bp) double-stranded RNA (dsRNA) with phosphorylated 5' ends and hydroxylated 3' ends with two overhanging nucleotides. The Dicer enzyme catalyzes production of siRNAs from long dsRNAs and small hairpin RNAs. siRNAs can also be introduced into cells by transfection. Since in principle any gene can be knocked down by a synthetic siRNA with a complementary sequence, siRNAs are an important tool for validating gene function and drug targeting in the post-genomic era. Accordingly, a person skilled in the art can design and identify siRNAs functioning as TRPS1 inhibitors in the context of the present invention.
In the context of the invention, siRNA targeting to TRPS1 mRNA means siRNA in which a first strand of the duplex is substantially identical to the nucleotide sequence of a portion of the TRPS1 mRNA sequence. It is understood that the second strand of the siRNA duplex is complementary to both the first strand of the siRNA duplex and to the same portion of the TRPS1 mRNA. siRNAs for specific gene silencing can be designed for example by using the web interface of the Whitehead Institute for Biomedical Research (http://jura.wi.mit.edu/siRNAext/) (Yuan et al., Nucl. Acids. Res. 2004 32:W130-W134). This platform can be used to identify all potential siRNAs targeting the conserved regions as well as their respective off-target hits to sequences in the human, mouse and rat RefSeq database. Further tools a platforms for identifying and selecting siRNA or shRNA target sequences are widely available. Further tools and platforms for siRNA and shRNA design for optimal target knock down are well established and can be used by a person skilled in the art to design suitable oligonucleotides to function as TRPS1 inhibitors in the context of the invention.
Blast results were downloaded and analysed in order to extract the identity of the best off-target hit for the antisense strand as well as the positions of occurring mismatches. All siRNA candidates were ranked according to predicted properties. The siRNAs that contained the applied criteria decided by skilled person upon his needs were selected and synthesized.
“Self-delivering siRNA” (sd-siRNA) shall mean siRNAs enter cells without the need of a transfection reagent. In embodiments, the self-deliverable siRNA molecule is a chemically synthesized asymmetric siRNA duplex consisting of a 20-nt antisense (guide) strand and 13-15 base sense (passenger) strand conjugated to cholesterol at its 3' end using tetraethylenglycol (TEG) linker. In embodiments, most or all 2'OH positions of ribose residues are substituted with 2'OMe or 2'F modifications, conferring sd-siRNA molecule resistance to nuclease degradation in both extra- and intracellular environment. Additional nuclease protection can be provided by phosphorothioate modifications at 3' ends of guide and passenger strands. The combination of these modifications within an asymmetric siRNA scaffold is advantageous for self-delivering properties and long-term knockdown activity.
“A guide-RNA in conjunction with an RNA-guided endonuclease” shall mean RNA molecules interacting with RNA guided DNA endonuclease, preferably in the context of the CRISPR/Cas system, which can be used for genetic manipulation of target cells, such as RMS cells, for example for influencing expression of a target, here TRPS1 , for example by generating a functional knockout of the gene.
CRISPR is an abbreviation of Clustered Regularly Interspaced Short Palindromic Repeats and is a family of DNA sequences in bacteria. The sequences contain snippets of DNA from viruses that have attacked the bacterium. These snippets are used by the bacterium to detect and destroy DNA from further attacks by similar viruses. These sequences play a key role in a bacterial defense system and form the basis of a technology known as CRISPR/Cas that effectively and specifically changes genes within organisms.
Sequences of the CRISPR loci are transcribed and processed into CRISPR RNAs (crRNAs) which, together with a trans-activating crRNAs (tracrRNAs), complex with CRISPR-associated (Cas) proteins to dictate specificity of DNA cleavage by Cas nucleases through Watson-Crick base pairing between nucleic acids (Wiedenheft, B et al (2012). Nature 482: 331-338; Horvath, P et al (2010). Science 327: 167-170; Fineran, PC et a. (2012). Virology 434: 202-209).
It was shown that the three components required for the type II CRISPR nuclease system are the Cas9 protein, the mature crRNA and the tracrRNA, which can be reduced to two components by fusion of the crRNA and tracrRNA into a single guide RNA (sgRNA) and that re-targeting of the Cas9/sgRNA complex to new sites could be accomplished by altering the sequence of a short portion of the gRNA (Garneau, JE et al (2010). Nature 468: 67-71 ; Deltcheva, E et al. (2011). Nature 471 : 602-607, Jinek, M et al (2012) Science 337: 816-821).
CRISPR-Cas systems are RNA-guided adaptive immune systems of bacteria and archaea that provide sequence-specific resistance against viruses or other invading genetic material. This immune-like response has been divided into two classes on the basis of the architecture of the effector module responsible for target recognition and the cleavage of the invading nucleic acid (Makarova KS et al. Nat Rev Microbiol. 2015 Nov; 13(11):722-36.). Class 1 comprises multisubunit Cas protein effectors and Class 2 consists of a single large effector protein. Both Class 1 and 2 use CRISPR RNAs (crRNAs) to guide a Cas nuclease component to its target site where it cleaves the invading nucleic acids. Due to their simplicity, Class 2 CRISPR-Cas systems are the most studied and widely applied for genome editing. The most widely used CRISPR-Cas system is CRISPR-Cas9. It was demonstrated that the CRISPR/Cas9 system could be engineered for modification of double stranded DNA molecules inside a cell, for example efficient genetic in mammalian cells. The only sequence limitation of the CRISPR/Cas system appears to derive from the necessity of a protospacer-adjacent motif (PAM) located immediately 3’ to the target sequence. The PAM sequence is specific to the species of Cas9. For example, the PAM sequence 5’-NGG-3’ is necessary for binding and cleavage of DNA by the commonly used Cas9 from Streptococcus pyogenes. However, Cas9 variants with novel PAMs have been and may be engineered by directed evolution, thus dramatically expanding the number of potential target sequences. Cas9 complexed with the crRNA and tracrRNA undergoes a conformational change and associates with PAM motifs throughout the genome interrogating the sequence directly upstream to determine sequence complementarity with the gRNA. The formation of a DNA-RNA heteroduplex at a matched target site allows for cleavage of the target DNA by the Cas9-RNA complex. These methods and mechanisms are well known in the art.
As known in the art, CRISPR/Cas9 has been exploited to develop potent tools for genome manipulation in animals, plants and microorganisms and can be also used therapeutically, for example in cancer cells. The RNA-guided Cas9 endonuclease first recognizes a 2- to 4-base-pair conserved sequence named the protospacer-adjacent motif (PAM), which flanks a target DNA site. Upon binding to the PAM, Cas9 interrogates the flanking DNA sequences for base-pairing complementarity to a guide RNA. If there is complementarity between the first 12 base pairs (the ‘seed’ sequence) of the guide RNA and the target DNA strand, RNA strand invasion accompanies local DNA unwinding to form an R-loop. Precise cleavage of each DNA strand by the RuvC and HNH domains of Cas9 generates a blunt double-strand DNA (dsDNA) break (DSB) at a position three base pairs upstream of the 3' edge of the protospacer sequence, measuring from the PAM. The DSB inducing activity of Cas9 as a preferred RNA-guided DNA endonuclease can be exploited by the present invention for generating DSB in the TRPS1 gene locus. Mutations can arise either by non-homologous end joining (NHEJ) or homology-directed repair (HDR) of DSBs. NHEJ can produce small insertions or deletions (INDELs) at the cleavage site, whereas HDR uses a native (or engineered) DNA template to replace the targeted allele with an alternative sequence by recombination, which can result in gene disruption and resulting lack of functional gene expression.
In the context of the present invention, the term “RNA-guided DNA endonuclease” refers to DNA endonucleases that interact with at least one RNA-Molecule. In the context of the present invention the terms RNA-guided DNA endonuclease and RNA-guided endonuclease are used interchangeably. DNA endonucleases are enzymes that cleave the phosphodiester bond within a DNA polynucleotide chain. In case of RNA-guided DNA endonuclease, the interacting RNA- molecule may guide the RNA-guided DNA endonuclease to the site or location in a DNA where the endonuclease becomes active. In particular, the term RNA-guided DNA endonuclease refers to naturally occurring or genetically modified Cas nuclease components or CRISPR-Cas systems, which include, without limitation, multi-subunit Cas protein effectors of class 1 CRISPR-Cas systems as well as single large effector Cas proteins of class 2 systems. The present invention is not limited to the use specific RNA-guided endonucleases and therefore comprises the use of any given RNA-guided endonucleases in the sense of the present invention suitable for use in the method described herein. Details of the technical application of CRISPR/Cas systems and suitable RNA-guided endonuclease are known to the skilled person and have been described in detail in the literature, as for example by Barrangou R et al. (Nat Biotechnol. 2016 Sep 8;34(9):933-941), Maeder ML et al. (Mol Ther. 2016 Mar;24(3):430-46) and Cebrian-Serrano A et al. (Mamm Genome. 2017; 28(7): 247-261).
The term “nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide” relates to any kind of nucleic acid molecule which encodes for a TRPS1 -suppressive oligonucleotide and from which the oligonucleotide can be expressed. This term also comprises the TRPS1 -suppressive oligonucleotides themselves, but also the plasmid encoding a TRPS1- suppressive oligonucleotide, as well as viral vectors or other vectors suitable for expression of TRPS1 -suppressive oligonucleotide in vivo and/or in vitro such as retroviruses, lentiviruses, adenovirus, adeno-associated virus.
In embodiments, the TRPS1-inhibotor of the invention is used for reducing RMS growth and driving it into terminal myogenic differentiation.
The invention relates to a TRPS1 inhibitor for use in the treatment of a rhabdomyosarcoma. The terms "treat," "treated," "treating," "treatment," and the like are meant to refer to reducing or ameliorating a disorder and/or symptoms associated therewith. "Treating" may refer to administration of the combination therapy to a subject after the onset, or suspected onset, of a blood disorder. "Treating" includes the concepts of "alleviating", which refers to lessening the frequency of occurrence or recurrence, or the severity, of any symptoms or other ill effects related to a cancer and/or the side effects associated with cancer therapy. The term "treating" also encompasses the concept of "managing" which refers to reducing the severity of a particular disease or disorder in a patient or delaying its recurrence, e.g., lengthening the period of remission in a patient who had suffered from the disease. It is appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated.
The term "subject" refers to an animal which is the object of treatment, observation, or experiment. By way of example only, a subject includes, but is not limited to, a mammal, including, but not limited to, a human or a non-human mammal, such as a non-human primate, bovine, equine, canine, ovine, feline.
Rhabdomyosarcoma (RMS) is a relatively rare high-grade malignant neoplasm of the skeletal muscle, yet it represents the most common soft tissue cancer in children. RMS is diagnosed with an incidence of 4.5 patients per million individuals below the age of 20. That equals to around 350 newly diagnosed cases per year in the United States. RMS originates from skeletal muscle tissue at any site of the body. However, 30 % of pediatric tumors predominantly arise in the head and neck region, 20 % in extremities, and 15 % at genitourinary sites (Saab et al., 2011). Rhabdomyosarcoma originates from myogenic progenitor cells. Hence, the expression of many muscle-specific proteins can be found in these rhabdomyoblasts. A hallmark of rhabdomyoblasts is a deregulated myogenic differentiation program leading to continuous proliferation and impaired terminal differentiation. Embryonal rhabdomyosarcoma (ERMS) and alveolar rhabdomyosarcoma (ARMS) are two major subtypes of RMS which were historically classified by their appearance in light microscopy upon histological examination. Embryonal rhabdomyosarcoma (ERMS) is with 67 % the most frequent subtype of RMS in children and shares features of developing skeletal muscle tissue (Patton and Horn, 1962). The more aggressive alveolar rhabdomyosarcoma (ARMS) subtype accounts for 30 % of RMS cases in children and adults and appears histologically as an accumulation of cells surrounding an open central space (Enterline and Horn, 1958). Additionally, pleomorphic and spindle cell/sclerosing RMS are considered two distinct RMS subtypes (Rudzinski et al., 2015).
The term “rhabdomyosarcoma cell” refers to primary or immortalized cells derived from rhabdomyosarcoma, for example, human embryonal rhabdomyosarcoma cells TE671 , RD cells or RH-30 cells. Further, “rhabdomyosarcoma cells” refers to in vivo tumor cells associated with Rhabdomyosarcoma.
Embryonal rhabdomyosarcoma (ERMS) displays a variety of tumor-promoting alterations. The ERMS subtype is associated with recurrent mutations in components of the RAS-RAF-MAPK and PI3K-AKT-mTOR pathways (Shern et al., 2014). Furthermore, alterations in insulin-like growth factor (IGF)-signaling are frequently observed in ERMS tumors, such as high expression of the ligand insulin-like growth factor 2 (IGF2) as a result of a loss of heterozygosity and loss of imprinting at the 11 p15.5 locus (Makawita et al., 2009; Martins et al., 2011 ; Zhan et al., 1994). Loss of function mutations or promoter methylation have been identified in the tumor suppressor genes phosphatase and tensin homolog (PTEN) and tumor protein 53 (TP53) (Seki et al., 2015; Shern et al., 2014). Additionally, deregulation of important developmental pathways such as Wnt, Notch, Shh and Hippo have been implicated in the pathogenesis of ERMS (Annavarapu et al., 2013; Conti et al., 2016; Mohamed et al., 2015; Zibat et al., 2010).
Alveolar rhabdomyosarcoma (ARMS) are mostly characterized by a chromosomal translocation t(2; 13)(q35;q14) or alternatively t(1 ;13)(p36;q14), which results in the expression of a chimeric transcription factor. It contains the DNA binding domain of PAX3 or PAX7, respectively, fused to the transcriptional transactivation domain of the forkhead transcription factor FOXO1 (Barr et al., 1993; Davis et al., 1994). The resulting fusion proteins PAX3-FOXO1 or PAX7-FOXO1 act as oncogenes and have been well characterized to drive the pathogenesis of the ARMS subtype (Keller et al., 2004; Xia et al., 2009). Notably, approximately 20 % of patients diagnosed with ARMS do not carry these characteristic translocations (Sorensen et al., 2002), and their tumor gene expression profiles are more similar to EMRS tumors, which is paralleled by a better clinical prognosis (Williamson et al., 2010). Therefore, current terminology also suggests a distinction of RMS tumors into fusion-positive and fusion-negative subgroups.
Further RMS subtypes of the invention include are pleomorphic rhabdomyosarcoma and spindle cell/sclerosing rhabdomyosarcoma. Pleomorphic rhabdomyosarcoma (undifferentiated) rhabdomyosarcoma), also known as anaplastic rhabdomyosarcoma, is defined by the presence of pleomorphic cells with large, lobate hyperchromatic nuclei and multipolar mitotic figures. These tumors display high heterogeneity and extremely poor differentiation. The pleomorphic cells may be diffuse or localized, with the diffuse variation correlating to a worse prognosis. It occurs most often in adults, rarely in children, and is often discovered in the extremities. Due to the lack of discernible separation among cancers of this type, clinicians will often label undiagnosed sarcomas with little to no discernible features as anaplastic RMS. It is the most aggressive type of RMS, and will often require intensive treatment. Spindle cell/sclerosing rhabdomyosarcoma is an added subtype listed in the 2020 WHO classification of soft tissue sarcomas. This subtype is very similar to that of leiomyosarcoma (cancer of the smooth muscle tissue), and it has a fascicular, spindled, and leiomyomatous growth pattern with notable rhabdomyoblastic differentiation. It occurs often in the paratesticular region, and the prognosis for this particular form of RMS is excellent with a reported five-year survival rate of 95%. The sclerosing aspect of this subtype has a hyaline sclerosis and pseudovascular development.
Treatment of rhabdomyosarcoma is a multidisciplinary practice involving the use of surgery, chemotherapy, radiation, and possibly immunotherapy. Surgery is generally the first step in a combined therapeutic approach. Resectability varies depending on tumor site, and RMS often presents in sites that don't allow for full surgical resection without significant morbidity and loss of function. Less than 20% of RMS tumors are fully resected with negative margins. Rhabdomyosarcomas are highly chemosensitive, with approximately 80% of cases responding to chemotherapy. In fact, multi-agent chemotherapy is indicated for all patients with rhabdomyosarcoma. Before the use of adjuvant and neoadjuvant therapy involving chemotherapeutic agents, treatment solely by surgical means had a survival rate of <20%. Modern survival rates with adjuvant therapy are approximately 60-70%.
There are two main methods of chemotherapy treatment for RMS. There is the VAC regimen, consisting of vincristine, actinomycin D, and cyclophosphamide, and the IVA regimen, consisting of ifosfamide, vincristine, and actinomycin D. These drugs are administered in 9-15 cycles depending on the staging of the disease and other therapies used. Other drug and therapy combinations may also show additional benefit. Addition of doxorubicin and cisplatin to the VAC regimen was shown to increase survival rates of patients with alveolar-type, early-stage RMS in IRS study III, and this same addition improved survival rates and doubled bladder salvage rates in patients with stage III RMS of the bladder. In children and young adults with stage IV metastatic rhabdomyoscarcoma, a Cochrane review has found no evidence to support the use of high-dose chemotherapy as a standard therapy.
Radiation therapy, which kills cancer cells with focused doses of radiation, is often indicated in the treatment of rhabdomyosarcoma, and the exclusion of this treatment from disease management has been shown to increase recurrence rates. Radiation therapy is used when resecting the entirety of the tumor would involve disfigurement or loss of important organs (eye, bladder, etc.). Generally, in any case where a lack of complete resection is suspected, radiation therapy is indicated. Administration is usually following 6-12 weeks of chemotherapy if tumor cells are still present. The exception to this schedule is the presence of parameningeal tumors that have invaded the brain, spinal cord, or skull. In these cases radiation treatment is started immediately. In some cases, special radiation treatment may be required. Brachytherapy, or the placement of small, radioactive “seeds” directly inside the tumor or cancer site, is often indicated in children with tumors of sensitive areas such as the testicles, bladder, or vagina. This reduces scattering and the degree of late toxicity following dosing. Radiation therapy is more often indicated in higher stage classifications. In embodiments of the invention, the TRPS1 inhibitor inhibits proliferation of rhabdomyosarcoma cells, induces myogenic differentiation of rhabdomyosarcoma cells and thereby leads to formation of functional muscle cells.
Cell proliferation shall mean cells undergoing cell division or mitosis. In the context of the invention, the term “inhibits proliferation” shall mean the growth of rhabdomyosarcoma cells is stopped or the rate of the growth of rhabdomyosarcoma cells is reduced.
Physiological induction of myogenic differentiation proceeds through irreversible cell cycle arrest of myoblasts, followed by a gradual increase in expression of muscle function genes, leading to fusion of myoblasts into multinuleate myofibers. Upon activating stimuli, such as injury, a cascade of myogenic regulatory factors (MRFs) is induced in muscle stem cells (MuSC) in a stepwise manner to promote the different cell state transitions towards myogenic differentiation. The MRFs are a group of muscle specific transcription factors comprising myogenic determination factor 1 (MyoD), myogenic factor 5 (Myf5), myogenin (Myog) and myogenic regulatory factor 4 (Mrf4). MyoD was identified as the first member of the MRF family, being able to induce a myogenic cell fate in non-myogenic cells, such as fibroblasts and adipocytes, when overexpressed in these cell types (Davis et al., 1987; Tapscott et al., 1988). Shortly after, the other members of the MRF family were discovered based on their ability to induce myoblast traits in non-myogenic cells (Braun et al., 1990; Braun et al., 1989; Edmondson and Olson, 1989; Miner and Wold, 1990; Rhodes and Konieczny, 1989; Wright et al., 1989). MRF transcription factors contain a basic helix-loop-helix (bHLH) domain. Upon heterodimerization with members of the ubiquitously expressed E-protein family of bHLH proteins, they bind to DNA with the consensus sequence CANNTG, a motif found at promoters of muscle-specific genes (Lassar et al., 1991 ; Massari et al. 2000). MyoD and Myf5 proteins are absent in quiescent MuSCs, but are rapidly expressed upon activation in part through direct transcriptional activation by Pax7 and Pax3 (Hu et al., 2008; McKinnell et al., 2008). In this state, MuSCs become proliferative myoblasts and progress further to become elongated myocytes marked by MyoD dependent transcriptional upregulation of Myog (Deato et al., 2008). Myog expression mediates cell cycle exit, and together with MyoD, induction of genes associated with myocyte fusion and transcription of sarcomeric- and muscle-specific genes, including Mrf4, thereby facilitating terminal differentiation and sarcomere assembly. While expression of MyoD, Myf5 and Myog is transient, Mrf4 remains expressed in terminally differentiated myofibers controlling muscle growth-related processes and modulation of the MuSC niche (Hinterberger et al., 1991 ; Lazure et al., 2020).
“Formation of functional muscle cells” shall mean cells undergoing myogenic differentiation and become myotubes expressing normal levels of muscle function genes.
In embodiments, the rhabdomyosarcoma to be treated is associated with TRPS1 expression, which is preferably identified by analyzing rhabdomyosarcoma cells for TRPSI expression.
The term “rhabdomyosarcoma associated with TRPS1 expression” shall mean rhabdomyosarcoma with detectable TRPS1 expression. In embodiments, the rhabdomyosarcoma is a rhabdomyosarcoma with elevated TRPS1 expression as compared to skeletal muscle cells, human myoblasts, and or non-proliferating or slowly proliferating muscle progenitor cells of mice or humans. The elevated expression of TRPS1 can be due to amplification of TRPS1 loci, increased mRNA levels of TRPS1 and/or increased protein levels of TRPS1 or loss of a negative regulator of TRPS1 expression. The elevated expression of TRPS1 can be evaluated by means of methods known in the art, for example, by western blot, immunofluorescence analysis, mass spectrometry, RT-PCR or RNA sequencing.
In embodiments, the TRPS1 inhibitor is administered transiently or constantly.
The term “administered transiently” shall mean that the inhibitor is only temporarily present in the target cell after administration. This can be due to degradation of the inhibitor and a stop of external administration or washing out of the inhibitor.
The term “administered constantly” shall mean that the inhibitor is constantly present over a certain period, for example due to constant and repeated administration, so that degraded inhibitors are replaced by newly administered inhibitors. Furthermore, it is possible that inhibitors, such as suppressive oligonucleotides, are constantly produced in a target cell, for example after administration of a nucleic acid molecule suitable for expression of the respective suppressive oligonucleotide.
In the context of the invention, the term “pharmacological effect” relates to a biochemical or physiological effect of a drug or compound on a cell, tissue or organ of a subject. Such a pharmacological effect can be measured by determining the differences that occur in presence of the drug or compound as compared to its absence in a certain setup, such as an experimental setup.
The term "therapeutic effect" refers to some extent of relief of one or more of the symptoms of a disorder (e.g., a neoplasia or tumor) or its associated pathology. "Therapeutically effective amount" as used herein refers to an amount of an agent/inhibitor which is effective, upon single or multiple dose administration to the cell or subject, in prolonging the survival of the patient with such a disorder, reducing one or more signs or symptoms of the disorder, preventing, or delaying, and the like beyond that expected in the absence of such treatment. "Therapeutically effective amount" is intended to qualify the amount required to achieve a therapeutic effect. A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the "therapeutically effective amount" (e.g., ED50) of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in a pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
In one embodiment, the TRPS1 inhibitor as used herein is in combination with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carrier refers to a carrier or excipient or diluent that can be administered to a subject, together with an agent, and which does not destroy the pharmacological activity thereof and is non-toxic when administered in does sufficient to deliver a therapeutic amount of the agent.
Administration of the TRPS1 inhibitor can be achieved by means of routes of administration known in the art. Possible routes of administration of the inhibitor include oral, subcutaneous, intravenous, intramuscular administration, and preferably local administration to the tumor/cancerous tissue. In some embodiments, the TRPS1 inhibitor, possibly in combination with a pharmaceutically acceptable carrier, is applied directly to the cancerous tissue. Simultaneous administration of one or more active agents or treatments shall mean administration of one or more agents at the same time. For example, in one embodiment, inhibition of TRPS1 can be achieved by two or more TRPS1 inhibitor at the same time. In other embodiment, TRPS1 inhibitor can be administrated together with other active agent useful for treating rhabdomyosarcoma.
In embodiments, the treatment of the invention further comprises (simultaneous or sequential) administration of one or more other antitumor therapies. Sequential administration of one or more active agents or treatments shall mean administration of the therapeutic agents in a sequential manner. In one embodiment, each therapeutic agent is administered at a different time. In other embodiments, by administration of two or more therapeutic agents wherein at least two of the therapeutic agents are administered in a sequential manner which is a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to the subject a single dose having a fixed ratio of each therapeutic agent or in multiple, single doses for each of the therapeutic agents.
As used herein, the term "simultaneously" refers to administration of one or more agents at the same time. For example, in certain embodiments, different TRPS1 inhibitors or TRPSI inhibitors in combination with other active agents useful for treating rhabdomyosarcoma, such a rhabdomyosarcoma associated with TRPS1 expression, are administered simultaneously. Simultaneously includes administration contemporaneously, that is during the same period of time. In certain embodiments, the one or more agents are administered simultaneously in the same hour, or simultaneously in the same day. Sequential or substantially simultaneous administration of each therapeutic agent can be affected by any appropriate route including, but not limited to, oral routes, intravenous routes, subcutaneous routes, intramuscular routes, direct injection into the cancer tissue, direct absorption through mucous membrane tissues (e.g., nasal, mouth, vaginal, and rectal), and ocular routes (e.g., intravitreal, intraocular, etc.). The therapeutic agents can be administered by the same route or by different routes. For example, one component of a particular combination may be administered by intravenous injection while the other component(s) of the combination may be administered orally. The components may be administered in any therapeutically effective sequence.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, e.g., J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements) Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach , Irl Press; D. M. J. Lilley and J.
E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies: A Laboratory Manual: Portable Protocol NO. I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0-87969-544-7); Antibodies: A Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-3,4-2), 1855. Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes (2001 , New York, N.Y., Marcel Dekker, ISBN 0-8247-0562-9); and Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3. Also, all publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.
FIGURES
The following figures are presented to describe particular embodiments of the invention, without being limiting in scope.
Brief description of the Figures:
Figure 1 : TRPS1 expression is increased in human ERMS and resists downregulation.
Figure 2: TRPS1 is downregulated during physiological myogenic differentiation of MuSCs and restrains myogenin expression.
Figure 3: TRPS1 suppresses myogenic differentiation and inhibits xenograft tumor growth of RD cells.
Figure 4: Transcriptomic analysis reveal TRPS1 suppressed genes are associated with terminal myogenic differentiation.
Figure 5: TRPS1 represses MYOG expression through binding to its promoter thereby impairing MYOD1 binding.
Figure 6: TRPS1 is a critical downstream target of miR-1 .
Figure 7: TRPS1 expression analysis in cell lines and re-analysis from omics-datasets validates increase in ERMS.
Figure 8: Overexpression of TRPS1 impairs myogenic differentiation
Figure 9: TRPS1 loss-of-function RD cell models present with increased differention marker expression and decreased rhabdosphere growth, but no change in proliferation and apoptosis markers.
Figure 10: Extended RNA-sequencing analysis of induced TRPS1 knockdown in RD cells and validation of terminal differentiation.
Figure 11 : Extended TRPS1 ChlP-sequencing analysis and MYOD1 requirement for increased MYOG transcription.
Figure 12: Extended analysis of the miR-1 - TRPS1 axis. Figure 13: Reduction of TRPS1 expression enhances myogenic differentiation in multiple ERMS model cell lines.
Figure 14: TRPS1 levels have to decrease to allow proper myogenic differentiation.
Figure 15: TRPS1 represses expression of MYOG through binding to its promoter thereby impairing binding of MYOD1 .
Figure 16: Dynamic expression levels of TrpsI during myogenic differentiation.
Figure 17: TRPS1 repressed genes affect terminal myogenic differentiation.
Figure 18: Schematic summarizing how TRPSI affects differentiation of myogenic cells and inhibits differentiation in ERMS cells.
Detailed description of the Figures:
Figure 1 : (A) Immunohistochemistry (IHC) staining for TRPSI on human rhabdomyosarcoma (RMS) tissue micro array (TMA). The area within the dashed line is magnified in the upper right corner insert. Arrowheads indicate TRPS1 positive nuclei. Scale bar is 20 pm. SkM: skeletal muscle, ERMS: embryonal RMS, ARMS: alveolar RMS.(B) Quantification of frequency score (1 = 0-25 %, 2 = 25 - 50 %, 3 = 50 - 75 %, 4 = 75 - 100 % positive TRPS1 nuclei) from (A); SkM n = 8, ERMS n = 25, ARMS n = 24; one-way ANOVA with Tukey’s multiple comparisons test, ns = not significant, (*) p < 0.05, (***) p < 0.001.(C) Quantification of staining intensity score (1 = low, 2 = mid, 3 = high) from (A); ERMS n = 22, ARMS n = 16; unpaired two-tailed t test, (*) p < 0.05. (D) RT-qPCR analysis of TRPS1 mRNA expression normalized to the housekeeper GAPDH. Data represent the mean + SEM of n = 3, one-way ANOVA and Dunnett's multiple comparisons tests, ns = not significant, (*) p < 0.05, (**) p < 0.01 , (****) p < 0.0001 . HSkM: human skeletal myoblast.(E) Western blot analysis of TRPS1 and GAPDH expression in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2), ERMS (RD, TE-671), and ARMS cell lines (RH-18, RH-30, RH-41).(F) Western blot analysis of TRPS1 , MHC, and GAPDH expression in human skeletal myoblasts (HSkM) cultured in growth medium (GM) and differentiation medium (DM). (G) Densitometric quantification of TRPS1 and (H) MHC normalized to GAPDH from (F). Data represent the mean + SEM of n = 3, one-way ANOVA and Tukey's multiple comparisons test, ns = not significant, (*) p < 0.05, (**) p < 0.01 .(I) Western blot analysis of TRPS1 , MHC, and GAPDH expression in human RD cells cultured in growth medium (GM) and differentiation medium (DM). (J) Densitometric quantification of TRPS1 and (K) MHC normalized to GAPDH from (I). Data represent the mean + SEM of n = 3, one-way ANOVA and Tukey's multiple comparisons test, ns = not significant, (*) p < 0.05.
Figure 2: (M) Western blot analysis of TRPS1 and p-Actin expression in C2C12 myoblasts stably expressing empty vector (pLeGO) or V5-TRPS1 . (N) IF images showing Myog (red), Mhc (green), and DAPI (blue) staining of empty vector or V5-TRPS1 overexpressing C2C12 cells after 3 days in differentiation medium (DM). Scale bar is 100 pm. (O) Quantification of the fusion index (ratio of the number of nuclei within MHC+ cells to all nuclei) from (N). Data represent the mean + SEM of n = 3, unpaired two-tailed t tests, (****) p < 0.0001 . (P) Quantification of Myog positive nuclei from (N). Data represent the mean + SEM of n = 3, unpaired two-tailed t tests, (****) p < 0.0001 . (Q) RT-qPCR analysis of myog mRNA expression normalized to the housekeeper b2m in C2C12- pLeGO and C2C12-V5-TRPS1 cells at day 3 of culture in differentiation medium (DM). Data represent the mean + SEM of n = 3, unpaired two-tailed t test, (*) p < 0.05.
Figure 3: (A) IF images showing MYOG (red), MHC (green), and DAPI (blue) staining of RD and RD-TRPS1 -knockout (KO) cells, that either stably express empty vector (pLeGO) or re-express V5-TRPS1 . Cells were cultured for 14 days in differentiation medium (DM). Scale bar is 10 pm. (B) Quantification of MYOG positive nuclei from (A). Data represent the mean + SEM of n = 3, one-way ANOVA with Sidak’s multiple comparisons test, ns = not significant, (*) p < 0.05, (**) p < 0.01 . (C) Quantification of nuclei within devMHC positive cells from (A). Data represent the mean + SEM of n = 3, one-way ANOVA with Tukey’s multiple comparison test, (*) p < 0.05, (***) p < 0.001. (D) Experimental scheme for RD cell differentiation in TA muscle explants. RD cells stably expressing inducible shRNA (i-shRNA) were treated with doxycycline (DOX) for 2 days in growth medium (GM) followed by injection into TA muscle explants, which were cultured for additional 3 days in differentiation medium (DM) in the presence of DOX. TA explants were then prepared for IF analysis. (E) IF images showing devMHC (red), LAMIN A/C (green), Laminin (grey), and DAPI (blue) staining of TA muscle explant cross-sections from (D). Scale bar is 50 pm. (F) Quantification devMHC expressing nuclei within LAMIN A/C positive nuclei from (E). Data represent the mean + SEM of n = 3, one-way ANOVA and Holm-Sidak's multiple comparisons test, ns = not significant, (*) p < 0.05, (**) p < 0.01 . (G) Measurement of tumor volume. 107 RD cells stably expressing shRNA were subcutaneously injected into the flanks of NOD.SCID mice. Data represent the mean ± SEM of shRenilla n = 3, shTRPS1#1 n = 4, shTRPS1#2 n = 4 mice, two-way ANOVA Tukey's multiple comparisons test, (****) p < 0.0001 . (H) Images of RD xenograft tumors after dissection at day 52. (I) Quantification of tumor weight from (H). Data represent the mean + SEM of shRenilla n = 3, shTRPS1#1 n = 4, shTRPS1#2 n = 4, one-way ANOVA with Tukey’s multiple comparisons test, ns = not significant, (*) p < 0.05, (**) p < 0.01 . (J) Images of cross-sections from RD xenograft tumors from (H) stained with Hematoxylin & Eosin (H&E) and immunohistochemistry (IHC) for MYOG expression. Scale bar is 20 pm. (K) Quantification of MYOG positive nuclei from (J). Data represent the mean + SEM of shRenilla n = 3, shTRPS1#1 n = 4, RD-shTRPS1#2 n = 4, two-way ANOVA with Tukey's multiple comparisons test, ns = not significant, (**) p < 0.01 .
Figure 4: (A) Experimental scheme for transcriptomic analysis of RD cells expressing an inducible shRNA targeting TRPS1 . Cells were treated with doxycycline (DOX) in growth medium (GM) for 2 days and subsequently in differentiation medium (DM) for 10 days followed by RNA isolation for RNA-sequencing and RT-qPCR. (B) Heatmap of differentially expressed genes (DEGs) common for both i-shTRPS1 conditions in DM with p < 0.05 and log2FC > ± 0.5. (C) Gene set enrichment analysis (GSEA) comparing the DEGs of i-shTRPS1#1 or (D) i-shTRPS1#2 with i- shNT for the hallmark genes sets and (E) i-shTRPS1#1 or (F) i-shTRPS1#2 with i-shNT for GO terms (top 5 categories in supplemental figure S4C). (G) RT-qPCR analysis of CCND1, MYH3, and TNNC1 mRNA expression normalized to the housekeeper B2M in RD-i-shRNA cells at day 10 of culture in differentiation medium (DM) from (A). Data represent the mean + SEM of n = 3, two-way ANOVA with Dunnett’s multiple comparisons test, ns = not significant, (*) p < 0.05, (***) p < 0.001 , (****) p < 0.0001. (H) Experimental scheme for the immunofluorescence (IF) analysis of the differentiation status of RD-i-shRNA cells after continuous doxycycline (DOX) treatment or DOX removal for the last 4 days in DM. (I) IF images showing MHC (green) and Ki67 (red) staining of RD-i-shRNA cells from (H) at 14 days of culture in DM with continuous DOX treatment and (J) DOX removal for the last 4 days. Scale bar is 50 pm. (K) Quantification of nuclei within MHC positive cells from (I, J). Data represent the mean SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons test, ns = not significant, (****) p < 0.0001 . (L) Quantification of Ki67 positive nuclei from (I, J). Data represent the mean SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons test, ns = not significant, (**) p < 0.01 , (***) p < 0.001 .
Figure 5: (A) Experimental scheme for the analysis of early myogenic events in RD-i-shRNA cells. (B) Western blot analysis of TRPSI , MYOG and GAPDH expression in RD-i-shRNA cultured for 3 days in differentiation medium (DM) with doxycycline from (A). (C) Densitometric quantification of TRPSI normalized to GAPDH from (B). Data represent the mean + SEM of n = 3, one-way ANOVA with Tukey’s multiple comparisons test, ns = not significant, (***) p < 0.001 . (D) Densitometric quantification of MYOG protein expression normalized to GAPDH from (B). Data represent the mean + SEM of n = 3, one-way ANOVA with T ukey’s multiple comparisons test, ns = not significant, (**) p < 0.01 , (***) p < 0.001 . (E) RT-qPCR analysis of YOG and (F) MYOD1 mRNA expression normalized to the houskeeper B2M in RD-i-shRNA cells from (A). Data represent the mean + SEM of n = 3, two-way ANOVA with Dunnett's multiple comparisons test, comparisons to RD-i-shNT are indicated, (****) p < 0.0001.
Figure 6: (A) Experimental scheme of miRNA mimic transfection into RD cells in growth medium (GM) for analysis by Western blotting (WB). (B) Western blot analysis of TRPSI and GAPDH protein expression after miRNA mimic transfection from (A). (C) Densitometric quantification of TRPS1 protein expression normalized to GAPDH from (B). Data represent the mean + SEM of n = 3, unpaired two-tailed t-test, (****) p < 0.0001 . (D) Experimental scheme of miRNA inhibitor transfection into human myoblasts followed by Western blot (WB) analysis. (E) Western blot analysis of TRPS1 , MHC, and GAPDH protein expression in human myoblasts at day 5 of culture in differentiation medium (DM) after miRNA inhibitor (antagomiR) transfection from (D). (F) Densitometric quantification of TRPSI and (G) MHC protein expression normalized to GAPDH. Data represent the mean + SEM of n = 3, one-way ANOVA with T ukey's multiple comparisons test, ns = not significant, (*) p < 0.05, (**) p < 0.01 , (***) p < 0.001 . (H) Experimental scheme for miRNA mimic transfection and subsequent analysis by in RD-pLeGO and RD-V5-TRPS1 cells, for WB see supplementary figure S6G. (I) IF images showing MYOG (red, white) and DAPI (blue) staining of RD-pLeGO and RD-V5-TRPS1 cells after transfection with miRNA mimic for 2 days in GM, see (H). Scale bar is 50 pm. (J) Quantification of MYOG positive cells from (I). Data represent the mean + SEM of n = 3, two-way ANOVA with Sidak's multiple comparisons test, ns = not significant, (*) p < 0.05, (***) p < 0.001. (K) IF images showing MHC (green, white) and DAPI (blue) staining of RD-pLeGO and RD-V5-TRPS1 cells after transfection with miRNA mimic for 2 days in GM and additional 3 days in DM, see (H). Scale bar is 50 pm. (L) Quantification of nuclei within MHC+ positive cells from (K). Data represent the mean + SEM of n = 3, two-way ANOVA with Tukey’s multiple comparisons, ns = not significant, (***) p < 0.001 , (****) p < 0.0001. (M) Quantification of luciferase activity normalized to b-galactosidase after co-transfection of reporter constructs with miRNA mimics in RD cells for 48 hours (lower panel). Data represent the mean + SEM of n = 3, two-way ANOVA with Sidak's multiple comparisons test, (*) p < 0.05, (**) p < 0.01 . (N) Workflow of metabolic labeling of newly synthesized proteins with L-azidohomoalanine (AHA) and TRPS1 enrichment by immunoprecipitation (IP). Detection of metabolically labeled TRPS1 in non-targeting or miR-1 mimic transfected RD cells after 48 hours by Western blot using streptavidin-HRP including the whole cell lysate (WCL).
Figure 7: (A) Immunohistochemistry (IHC) staining of TRPS1 in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2) and ERMS cell line (RD) and ARMS cell line (RH-30). Scale bar is 50 pM. (B) Re-analysis of RNA-sequencing data by (Stewart et al., 2018) for TRPSI mRNA expression in human tumors and controls. FW21 (fetal week 21) quadriceps, human myoblast, human myotube, ERMS, ARMS. (C) Re-analysis of proteome data by (Stewart et al., 2018) for TRPSI protein expression in human tumors and controls. MT (myotube), ERMS, ARMS.
Figure 8: (F) IF images of C2C12 cells expressing empty vector (pLeGO) or V5-TRPS1 after 1 , 2, and 3 days in differentiation medium (DM) showing staining for MyoD (green), Myog (red), and DAPI (blue). Scale bar is 50 pm. (G) Quantification of MyoD positive (+)/Myog negative (-) and (H) MyoD positive (+)/Myog positive (+) cells from (F). Data represent the mean + SEM of n = 3, two-way ANOVA and Sidak’s multiple comparisons test, ns = not significant, (*) p < 0.05, (**) p < 0.01.
Figure 9: (A) CRISPR/Cas9 targeting strategy for TRPSI knockout in RD cells as previously described in (Elster et al., 2018). Indicated sequence of Exon 3 is AGCCCT7GAAGTCTCCGCAAAGAGCAGAGGCAGATGACCC (SEQ ID NO. 31), wherein GAAGT CT CCGCAAAGAGCAGAGG (SEQ ID NO. 32) is the sgRNA sequence including PAM (underlined) (B) Western blot analysis of TRPS1 and GAPDH expression in RD and RD-TRPS1- KO cells using antibodies to detect the N-terminus or (C) the C-terminus of TRPS1 . (D) Western blot analysis of TRPS1 , MHO, and GAPDH expression in RD-TRPS1-KO cells stably expressing empty vector (pLeGO) or V5-TRPS1 after 14 days in differentiation medium (DM). (E) Densitometric quantification of MHO normalized to GAPDH from (D). Data represent the mean + SEM of n = 3, unpaired two-tailed t test, (*) p < 0.05. (F) IF images showing Ki67 (red) and DAPI (blue) staining of RD and RD-TRPS1-KO cells stably expressing empty vector (pLeGO) or V5- TRPS1 in growth condition. Scale bar is 50 pm. (G) Quantification of Ki67 positive cells from (F). Data represent the mean + SEM of n = 3, one-way ANOVA with T ukey's multiple comparisons test, ns = not significant. (H) Western blot analysis of TRPS1 and GAPDH expression in RD-i- shRNA cells after treatment with EtOH or doxycycline (DOX) for 2 days in growth medium. (I) Western blot analysis of TRPS1 and GAPDH expression in RD cells stably expressing shRenilla or shTRPS1#1. (J) Densitometric quantification of TRPSI normalized to GAPDH from (I). Data represent the mean + SEM of n = 3, unpaired two-tailed t test, (**) p < 0.01 . (K) Western blot analysis of TRPSI and GAPDH expression in RD cells stably expressing shRenilla or shTRPS1#2. (L) Densitometric quantification of TRPSI normalized to GAPDH from (K). Data represent the mean + SEM of n = 3, unpaired two-tailed t test, (**) p < 0.01 . (M) Images showing RD-shRenilla and RD-shTRPS1#1 rhabdospheres in GFP and brightfield channels 3 days post seeding. Scale bar is 400 pm. (N) Quantification of rhabdosphere number from (M). Data represent the mean + SEM from n = 3, unpaired two-tailed t test, (**) p < 0.01 . (O) Western blot analyses of TRPSI and PARP (fl - full length, cl - cleaved) in xenograft tumor lysates. Figure 10: (D) IF images showing MHC (green) and Ki67 (red) staining of RD-i-shRNA cells at 10 days of culture in DM with doxycycline, related to figure 4H. Scale bar is 50 pm. (E) Quantification of nuclei within MHC positive cells from (D). Data represent the mean SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons test, ns = not significant, (***) p < 0.001 , (****) p < 0.0001 . (F) Quantification of Ki67 positive nuclei from (D). Data represent the mean SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons test, ns = not significant, (**) p < 0.01 , (***) p < 0.001 . (G) Western blot analysis of TRPS1 , MHC, and GAPDH expression in RD-i-shRNA cells after 14 days of culture in DM with doxycycline (DOX) or DOX removal for the last 4 days.
Figure 11 : (A) Homer known motif analysis of TRPS1 ChlP-sequencing results in RD cells showing top 15 motif enrichments, related to figure 5G. (B) ChlP-qPCR using anti-TRPS1 antibody or normal rabbit IgG and primers to amplify either the MYOG locus or U2 control region in RD-TRPS1-KO cells. Data represent the mean + SEM of n = 3, two-way ANOVA and Sidak's multiple comparisons test, ns = not significant. (C) Experimental scheme of inducible TRPS1 knockdown in RD cells combined with siRNA-mediated knockdown of MYOD1. (D) RT-qPCR analysis of MYOD1 and (E) MYOG mRNA expression normalized to the houskeeper B2M in RD- i-shRNA cells from (C). Data represent the mean + SEM of n = 3, two-way ANOVA with Sidak’s multiple comparisons test, ns = not significant, (*) p < 0.05, (***) p < 0.001 , (****) p < 0.0001 .
Figure 12: (B) Bright-field images of human skeletal muscle myoblasts at 5 days of differentiation after transfection with a non-targeting or miR-1 targeting antagomiR at 0 days and 3 days of differentiation, related to figure 6D. Scale bar is 200 pm. (C) IF images of TRPS1 (red, white) and DAPI (blue) staining of RD cells after transfection with siRNA and/or miRNA mimics for 3 days in differentiation medium demonstrating TRPS1 downregulation. Scale bar is 50 pm. (D) IF images of MYOG (red, white), MHC (green, white), and DAPI (blue) staining of RD cells in the respective conditions after 3 days in differentiation medium. Scale bar is 50 pm. (E) Quantification of MYOG positive nuclei and (F) nuclei within MHC-positive cells from (D). Data represent the mean + SEM of n = 3, one-way ANOVA with Tukey’s multiple comparisons test, ns = not significant, (****) p < 0.0001. (G) Western blot analysis of TRPS1 and GAPDH protein expression in RD-pLeGO or RD-V5-TRPS1 cells 2 days after transfection with non-targeting or miR-1 mimic, related to figure 6H. (H) RT-qPCR analysis of TRPS1 mRNA expression normalized to the housekeeper B2M in RD cells after miRNA mimic transfection for 2 days in growth medium. Data represent the mean + SEM of n = 3, two-way ANOVA with Sidak’s multiple comparisons test, ns = not significant.
Figure 13: (A) Immunoblot analysis of TRPS1 and GAPDH levels in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2), ERMS (RD, SMS-CTR), and ARMS cell lines (RH-30, RH-41). (B) RT-qPCR analysis of TRPS1 mRNA expression normalized to GAPDH. Data represent the mean + SEM of n = 3, one-way ANOVA and Dunnett’s multiple comparisons tests, ns = not significant, (*) p < 0.05. HSkM: human skeletal myoblast. (C) Immunoblot analysis of TRPS1 and GAPDH levels in human SMS-CTR cells cultured in growth medium (GM) or differentiation medium (DM). (D) Densitometric quantification ofTRPSI normalized to GAPDH from (C). Data represent the mean + SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons tests, ns = not significant. (E) RT-qPCR analysis of TRPS1 and (F) MYH3 mRNA expression normalized to GAPDH in human SMS-CTR cells cultured in growth medium (GM) or differentiation medium (DM). Data represent the mean + SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons tests, ns = not significant, (*) p < 0.05, (**) p < 0.01 . (G) Immunoblot analysis ofTRPSI and GAPDH levels in two independent human skeletal muscle myoblast lines (HSkM-1 , HSkM-2) and three ERMS (RD, SMS-CTR, JR1) cell lines. (H) RT-qPCR analysis of TRPS1 mRNA expression normalized to GAPDH in human myoblasts and ERMS cells cultured in growth medium. Data represent the mean + SEM of n = 3, one-way ANOVA and Dunnett’s multiple comparisons tests, ns = not significant, (*) p < 0.05, (***) p < 0.001. (I) IF images of MYOG (green, white) and DAPI (blue) staining of SMS-CTR cells after transfection with siRNA for 3 days in differentiation medium. Scale bar is 200 pm. (J) Quantification of MYOG+ nuclei from (I). Data represent the mean + SEM of n = 3, unpaired t test (**) p < 0.01 . (K) IF images of MYOG (green, white) and DAPI (blue) staining of JR1 cells after transfection with siRNA for 3 days in differentiation medium. Scale bar is 200 pm. (L) Quantification of MYOG+ nuclei from (K). Data represent the mean + SEM of n = 3, unpaired t test (**) p < 0.01 .
Figure 14: (A) Experimental scheme for immunofluorescence (IF) analysis of mouse juvenile tibialis anterior (TA) muscle cross-sections. P: postnatal day, M: months. (B) IF images showing Trpsl (green), Pax7 (red), Laminin (grey), and DAPI (blue) staining of TA cross-sections from (A). White arrows mark Trpsl +/Pax7+ nuclei and yellow arrowheads mark Trpsl -ZPax7+ nuclei. Scale bar is 10 pm. (C) Quantification of Trpsl +/Pax7+ nuclei from (B). Data represent the mean + SEM of P7 n = 6, P21 n = 5, and 2M n = 4 mice, one-way ANOVA with Tukey's multiple comparisons test, ns = not significant, (****) p < 0.0001. (D) Experimental scheme for cardiotoxin (CTX)-mediated injury of TA muscle. Hematoxylin & Eosin (H&E) and IF staining from the indicated time points in grey are shown in the supplemental figure S2A. (E) IF images of TA cross-sections from (D) at 5 days post injury (dpi) showing Trpsl (green), Laminin (grey), and DAPI (blue) together with Pax7 (red), Myodi (red), or devMHC (red), nuclei are marked by arrowhead. Scale bar is 5 pm. (F) Quantification of Trpsl + from Pax7+, Myodi +, or devMHC+ nuclei at 5 dpi from (E). Data represent the mean + SEM of n = 4 mice, one-way ANOVA with Tukey's multiple comparisons test, ns = not significant, (****) p < 0.0001. (G) Experimental scheme for the analysis of CTX-induced injury of TA muscles combined with injection of self-delivering siRNAs at day 3 and 5 post injury. (H) IF images at 10 dpi showing devMHC (red), Laminin (green), and DAPI (blue) staining of TA cross-sections from (G). Scale bar is 50 pm. (I) Quantification of devMHC+ myofibers within the regenerating area of TA muscle cross-sections from (H). Data represent the mean + SEM of n = 4 mice, unpaired two-tailed t test, (*) p < 0.05. (J) Experimental scheme for extensor digitorum longus (EDL) single myofiber isolation and culture combined with siRNA transfection. (K) IF images showing Myog (yellow, white) and DAPI (blue) staining of EDL myofiber-associated MuSC cluster after siRNA transfection and 72 hours of culture, related to (J). Scale bar is 20 pm.
Figure 15: (A) Experimental scheme for the analysis of early myogenic events in RD-i-shRNA cells. (B) Immunoblot (IB) analysis of TRPS1 , MYOG, MYOD1 and GAPDH levels in RD-i-shRNA cultured for 3 days in differentiation medium (DM) with doxycycline from (A). (C) Densitometric quantification of TRPS1 , (D) MYOG, and (E) MYOD1 normalized to GAPDH from (B). Data represent the mean + SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons tests, ns = not significant, (**) p < 0.01 , (***) p < 0.001. (F) IF images showing MYOG (red, white), MYOD1 (green, white), and DAPI (blue) staining of RD-i-shRNA cells after 3 days in differentiation medium from (A). Scale bar is 50 pm. (G) Quantification of MYOD1+ nuclei, (H) MYOD1+/MYOG+ nuclei, and (I) the percentage of MY0D1 +/MYOG+ nuclei from all MYOG+ nuclei from (F). Data represent the mean + SEM of n = 3, one-way ANOVA and Tukey’s multiple comparisons tests, ns = not significant, (*) p < 0.05, (**) p < 0.01 , (****) p < 0.0001. (J) RT-qPCR analysis of MYOG and (K) MYOD1 mRNA expression normalized to B2M in RD-i-shRNA cells from (A). Data represent the mean + SEM of n = 3, two-way ANOVA with Dunnett's multiple comparisons test, comparisons to RD-i-shNT are indicated, (****) p < 0.0001. (L) HOMER known motif analysis of TRPS1 binding sites identified by ChlP-sequencing of RD cells (top 15 ranks are listed in supplemental figure S5K). (M) Overlap of the genomic binding sites of the transcription factors (TF) TRPS1 and MYOD1 in RD cells. ChlP-seq data of MYOD1 genomic binding sites were obtained from (55). (N) IF images showing proximity ligation assay (PI_A) signal (red, white) and DAPI (blue) using anti-V5 and anti-MYOD1 antibodies in RD-TRPS1-KO cells stably expressing empty vector (pLeGO) or V5-TRPS1. (O) Quantification of PLA punctae per nucleus from (N). Data represent the mean + SEM of n = 3, two-way ANOVA and Sidak’s multiple comparisons tests, (****) p < 0.0001. (P) Integrated genomics viewer (IGV) showing TRPS1 ChlP- seq reads at the MYOG locus. H3K27ac marks were derived from published ChlP-seq data in RD cells from (84). (Q) ChlP-qPCR using anti-TRPS1 antibody or normal rabbit IgG and primers to amplify either the MYOG locus or U2 control region in RD cells. Data represent the mean + SEM of n = 3, two-way ANOVA and Sidak’s multiple comparisons tests, (****) p < 0.0001. (R) IGV showing the MYOG locus and a common binding site forTRPSI and MYOD1 marked in red. (S) ChlP-qPCR using an anti-MYOD1 antibody or normal mouse IgG and primers to amplify the MYOG locus or U2 control region in RD-i-shRNA cells treated with doxycycline for 2 days in GM and 3 days in DM. Data represent the mean + SEM of n = 3, two-way ANOVA and Sidak’s multiple comparisons tests, (*) p < 0.05.
Figure 16: (A) Images of tibialis anterior (T A) muscle cross-sections with Hematoxilin & Eosin (H&E) and immunofluorescence (IF) staining of Trpsl (red), Laminin (grey), and DAPI (blue) at the indicated days post injury (dpi) with cardiotoxin (CTX). Scale bar is 50 pm. (B) Quantification of the TA myofiber diameter within the regenerating area at 10 days post CTX-injury and siRNA injection at days 3 and 5 post injury. Data represent the mean + SEM of n = 4 mice, two-way ANOVA and Sidak’s multiple comparisons test, ns = not significant. (C) IF images of MuSC cluster of extensor digitorum longus (EDL) single myofiber after transfection with siRNA and culture for 72 hours stained for Pax7 (red), Myodi (green), and DAPI (blue). Scale bar is 10 pm. (D) Quantification of the number of Pax7+ and/or Myodi + cells per cluster from (C). Data represent mean + SEM of n = 8 mice, unpaired two-tailed t test, (**) p < 0.01 . (E) Quantification of the number of clusters per single EDL myofiber from (C). Data represent mean + SEM of n = 4 mice, unpaired two-tailed t test, ns = not significant. (F) Quantification of MuSC cluster composition from (C). Data represent mean + SEM of n = 8 mice, two-way ANOVA and Sidak’s multiple comparisons test, ns = not significant, (**) p < 0.01.
Figure 17: (A) Volcano plots with gene annotations for the top 25 DEGs sorted for padj with log2FC > 0.5_or log2FC < 0.5 from RD-i-shTRPS1#1 and (B) RD-i-shTRPS1#2 compared to RD-i- shNT, related to figure 3A. (C) Top 5 GSEA results, related to figure 3D-G. Size indicates the number of genes in the gene set. Enrichment score (ES) and normalized enrichment score (NES) represent to which degree this gene set is overrepresented at the top or the bottom of a ranked list of genes in the expression dataset. The nominal p-value (NOM p-val) indicates the statistical significance of the enrichment score. The false discovery rate (FDR) estimates the probability that the normalized enrichment score represents a false positive finding. Family-wise error rate (FWER) is a more conservatively estimated probability of a false positive normalized enrichment score. Rank at max indicates the position in the ranked list at which the maximum enrichment score occurred. Leading edge describes statistical parameters. (D) Top 10 table of Ingenuity Pathway Analysis (IPA) upstream regulatory factor prediction for RD-i-shTRPS1#1 or RD-i-shTRPS1#2 compared to RD-i-shNT gene sets in RD cells during differentiation. The myogenic factors MYOD1 and miR-1 are highlighted. (E) Experimental scheme for the immunoblot (IB) or immunofluorescence (IF) analysis of the differentiation status of RD-i-shRNA cells after continuous doxycycline (DOX) treatment or DOX removal for the last 4 days in DM. (F) Immunoblot analysis of TRPS1 , MHO, and GAPDH in RD-i-shRNA cells upon continuous doxycycline (DOX) treatment or DOX removal for the last 4 days of culture in differentiation medium.
Figure 18: The shown data suggest that the increased TRPS1 levels in ERMS cells cause enhanced tumor growth by repressing terminal myogenic differentiation. Furthermore, TRPS1 mRNA is a direct miR-1 target in RD cells and miR-1 deficiency contributes to the enhanced TRPS1 levels observed in ERMS. Moreover, TRPS1 was found to directly bind to the MYOG promoter, thereby affecting binding of MYOD1 and repressing MYOG transcription.
EXAMPLES
The following examples describe the treatment of rhabdomyosarcoma using inhibitors against TRPS1 without being limiting in scope. high and sustained in human
Figure imgf000033_0001
Figure imgf000033_0002
We first analyzed the expression levels of TRPSI in human RMS tumors and healthy skeletal muscle (SkM) control tissue by immunohistochemical analysis (IHC) using a RMS tissue micro array (TMA) (Fig.1A-C). Thereby we found TRPS1 protein to be mainly expressed in single cells of the embryonal rhabdomyosarcoma (ERMS) subtype while no control tissue displayed TRPS1 expression. Of note, we did observe differences in the frequency score between ERMS and ARMS samples and in the intensity score suggesting that a high proportion of ERMS tumors are characterized by a strong TRPS1 expression (Figure 1A-C).
To get further insights into the expression and function of TRPSI in RMS and myogenic differentiation, we examined TRPS1 expression in different human RMS cell lines and proliferating human skeletal muscle myoblasts (HSkM). Different from skeletal muscle crosssections, HSkM cells expressed low levels of TRPSI mRNA and protein hinting to expression of TRPS1 in proliferating cells. However, we found a very high expression of TRPSI in ERMS cell lines (RD and TE-671 ; ~5-10-fold enhanced compared to HSkMs), whereas ARMS cell lines (RH- 18, RH-30, and RH-41) showed a very low or no expression compared to human myoblasts and ERMS cells (Figure 1 D,E, and Figure 7A). These findings are supported by the re-analysis of publicly available RNA-seq and proteome RMS tumor expression data indicating that TRPSI expression is indeed increased in ERMS while it is reduced in ARMS (Figure 7B,C). Next, we asked how TRPSI expression is modulated during normal myogenic differentiation and after inducing differentiation of the ERMS model cell line RD cells. Therefore, we induced myogenic differentiation in human skeletal myoblasts and RD cells and monitored TRPS1 expression on the mRNA and protein level together with the differentiation marker myosin heavy chain (MHC) (Figure 1 F-H). Interestingly, we found TRPS1 levels to be reduced during myogenic differentiation of HSkMs coinciding with an expected increase in MHC. Of note, induction of RD cells did not reduce TRPS1 levels, we rather found a very slight increase. However, induction of myogenic differentiation is rather inefficient as evidenced by the very low expression levels of MHC as a marker for terminal differentiation (Figure 11-K).
Example 2: TRPS1 overexpression impairs myogenic differentiation
To determine if TRPS1 expression needs to be downregulated to allow myogenic differentiation, we first investigated the expression of TRPS1 during murine muscle development focusing on the postnatal stages when MuSCs turn from a proliferative to a quiescent state. Interestingly, TRPS1 was detected in ~70% of Pax7-positive MuSCs of the tibialis anterior (T A) muscles at the early postnatal stage P7 and the juvenile stage P21 , while only ~30% of MuSCs express TRPS1 in the adult stage (2 months). These observations suggest that expression of TRPS1 in MuSCs correlates with their proliferation status. To verify this further, we performed a cardiotoxin (CTX)- mediated injury of the TA muscle from adult mice, which leads to muscle damage coinciding with the activation and proliferation of MuSCs followed by myogenic differentiation to replace the damaged tissue. Interestingly, we found the highest expression of TRPS1 around day 5 post injury (5 dpi), a time point when MuSCs are highly proliferative. In resting skeletal muscle only very few TRPS1 positive MuSCs were identified (0 dpi) suggesting that TRPS1 is not expressed in quiescent MuSCs in mice and man (Fig.1 A, Fig. 8). However, expression of TRPS1 increased after injury with a peak around 5dpi, followed by a declined until regeneration was completed on day 21 post injury. Since TRPS1 expression was found to peak around 5dpi, we had a closer look on the cell types expressing TRPS1 at this 5dpi. Thereby, we found TRPS1 to be expressed in 98% of Pax7+ MuSCs and in all MyoD1 positive cells marking activated/proliferating MuSCs and proliferating myoblasts (100%). Of note, only a very small proportion of nuclei (5%) of newly formed myofibers marked by developmental MHC (devMHC) were positive for TRPSI , presumably nuclei which derive from myoblasts which just underwent the fusion event.
To examine the functional relevance of TRPS1 in regeneration of skeletal muscle, we in injected a self-delivering siRNAs into the damaged muscle at the peak of MuSC proliferation. Knockdown of TRPS1 during muscle regeneration led to a ~50% decrease in the number of devMHC expressing cells at day 10 post injury, a population of cells which represent a transient state of differentiation. This suggested to us that regeneration is enhanced, which is supported by the finding that the diameter of regenerating myofibers showed a trend towards bigger myofibers after knockdown of TRPS1. Since injection of a self-delivering siRNA might affect other cell types in addition to MuSCs, we cultured MuSCs on their adjacent myofibers from the extensor digitorum longus (EDL) for 72h after transfection with a siRNA targeting TRPS1 . Of note, in this system MuSCs can be interrogated in their endogenous niche without affects from other mononucleated cells. After 72h of culture clusters of myogenic cells are formed which arise from one MuSC. Knockdown of TRPS1 resulted in an increase in the size of clusters suggesting an increased ability to proliferate after reduction of TRPS1 level (8 vs 6 cells per cluster, si-TRPS1 vs si-scr). Of note, reduction of TRPSI levels did not result in enhanced activation of MuSCs as evidenced by a similar activation rate/number of cluster per myofiber. However, the composition of the cluster changed after knockdown of TRPSI with an increase in the percentage of myogenin positive cells representing further differentiated cells while other subpopulations were not affected. This suggests an increased ability of MuSCs to differentiate and/or upregulate myogenin expression after knockdown of TRPSI .
To mimick the expression of TRPSI in ERMS, we stably overexpressed human V5-TRPS1 in the mouse myoblast cell line C2C12 and induced myogenic differentiation. Strikingly, we found differentiation to be severely impaired evidenced by a reduction in the fusion index of over 50 % after 3 days in differentiation medium (DM) concomitant with a 50 % reduction in Myog+ cells (Figure 2M-P). The phenotypical impairment in differentiation was accompanied by a reduction of myog mRNA levels upon V5-TRPS1 overexpression suggesting that also Myog expression shows transcriptional deregulation (Figure 2Q). This is further accentuated by the fact that MyoD1 expression, a strong transcriptional inducer of Myog, was not impaired by V5-TRPS1 overexpression (Figure 8F-H).
Example 3: Sustained TRPS1 suppresses RD cell differentiation and promotes tumor growth in vivo
Next, we asked, whether the continuous TRPS1 expression in the human ERMS cells (RD cells) is causative for their impaired myogenic differentiation. Therefore, we generated RD-TRPS1- knockout (KO) cells using CRISPR/Cas9 as previously described (Figure 9A-C). As an additional control, we stably transfected RD-TRPS1-KO cells with either an empty vector control (pLeGO) or a plasmid expressing the exogenous V5-TRPS1 (Figure 9D). TRPS1 deficient RD cells displayed increased numbers of MYOG and MHC+ cells after 14 days in differentiating conditions while reexpression of V5-TRPS1 resulted in strongly impaired differentiation as observed in RD WT cells (Figure 3A-C). However, we did not observe changes in the number of proliferating cells (Ki67+ positive) of the different cell lines in growth condition, demonstrating an explicit function of TRPSI to suppress myogenic differentiation (Figure 9F,G). To test if loss or reduction of TRPSI levels in ERMS tumor cells in their in vivo location resembling a more physiological niche situation, we generated 2 independent RD cell lines which express a doxycycline 2 different inducible shRNA targeting TRPS1 (Figure 9H) and injected the cells into TA muscle explants from healthy mice and cultured them ex vivo for 3 days under differentiation inducing conditions. Indeed, we observed a ~3-fold increase in the amount myofibers expressing devMHC marking newly formed myofibers when we engrafted RD cells expressing a shRNA targeting TRPS1 (Figure 3D-F and Figure 9H). Of note, all newly formed myofibers displayed at least a contribution of RD cells as indicated by expression of human LAMIN A/C suggesting that reduction of TRPSI levels in ERMS tumors could increase their myogenic differentiation.
To test the oncogenic potential of RD cells, which stably express shRNAs targeting TRPS1 we first performed rhabdosphere assays followed by in vivo xenograft transplants (Figure 9I-L). Interestingly, TRPS1 knockdown led to a ~50 % reduction in rhabdosphere formation compared to shRenilla in vitro opening the hypothesis that also tumor growth in vivo might be reduced (Figure 9M,N). Therefore, we injected the respective RD cell lines in NOD/SCID mice and investigated the tumor growth (Figure 3G-I). Critically, RD cells expressing a control shRNA (shRenilla) developed subcutaneous large tumors (900 mm3) while RD cells expressing a shRNA targeting TRPS1 formed significantly smaller tumors (300 mm3). The difference in tumor volume was accompanied by a reduction in tumor weight by 50% (Figure 3G-I). Of note, the histological analysis of the tumors by H&E staining revealed a higher cytoplasmic proportion (eosinophil) in tumors derived from RD control cells compared to tumors formed from RD cells expressing a shRNA targeting TRPS1 , pointing towards enhanced myogenic differentiation. In line with this, we observed a ~3-fold increase in the number of MYOG positive nuclei in tumors derived from RD shTRPSI cells compared to RD shRenilla cells, supporting our hypothesis that reduction in TRPS1 levels improves myogenic differentiation in ERMS (Figure 3J,K). Additionally, no differences in the amount of cleaved PARP were detected in tumor lysates, excluding apoptosis as a tumor growth reducing mechanism (Figure 90).
Example 4: Aberrant TRPS1 expression in ERMS suppresses terminal myogenic differentiation
In order to identify the individual genes whose expression is perturbed due to the aberrant TRPS1 in RD cells during differentiation, we performed RNA-sequencing after acute doxycycline induced shRNA-mediated TRPS1 knockdown (Figure 4A). Thereby, we identified 45 genes which were differentially expressed in both cell lines expressing a shRNA targeting TRPS1. Thereof 37 genes were commonly upregulated and 7 genes commonly downregulated (Figure 4B). By Gene set enrichment analysis (GSEA) we identified an enrichment of the hallmark “Myogenesis” gene set as well as the gene ontology (GO) “contractile fiber” gene set for both of the TRPS1 knockdown expression datasets among the top 5 ranks (Figure 4C-F). Of note, muscle structural and contraction associated mRNAs, such as myosin heavy chain 3 (MHC3) and troponin C1 (TNNC1), as well as partial downregulation of cell cycle associated mRNAs, such as cycline D1 (CCND1) were found after reduction of TRPS1 levels during myogenic differentiation of RD cells (Figure 4G). These data suggest, that RD cells indeed had undergone transcriptional changes associated with terminal myogenic differentiation upon knockdown of TRPS1 further supporting our notion that aberrant TRPS1 expression is functionally linked to impaired myogenic differentiation.
To demonstrate the RD cells really undergo terminal myogenic differentiation upon reduction of TRPS1 levels, we took advantage of the reversibility of the doxycycline inducible shRNA system and removed doxycycline and thereby induction of the expression of the respective shRNAs after an initial differentiation period (Figure 4H). Interestingly, we observed a very similar induction of myogenic differentiation after reducing TRPS1 levels with the shRNAs compared to a general knockout including an increase in the MHC positive cells coinciding with a reduction in the amount of Ki67 positive cells (Fig.3A-C) (Figure 10D-F). Strikingly, these parameters of terminal myogenic differentiation were stable after doxycycline removal for the following 4 days in differentiation medium as compared to continuous doxycycline treatment suggesting that reduction in TRPS1 levels in differentiation are sufficient to induce terminal differentiation (Figure 4I-L). However, TRPS1 levels did not increase upon doxycycline removal (Figure 10G), suggesting that high TRPS1 expression levels are impairing myogenic differentiation but are not re-expressed in RD cells if myogenic differentiation has occurred. Example 6: miR-1 regulated TRPS1 expression in RD cells
After identifying the downstream targets of TRPS1 in RD cells, we wondered what causes the upregulation of TRPS1 in RD cells. Since miRNAs are known to be potent regulators of gene expression in ERMS, we focused on miRNAs and their ability to modulate TRPS1 expression in RD cells. Indeed, we identified miR-1 as a potential upstream regulator of TRPS1 (Figure 10H). Of note, potential miR-1 binding sites were identified within the 3’ untranslated region (UTR) of the TRPS1 mRNA using in silica prediction tools. Since miR-1 expression is strongly induced during myoblast differentiation, exerting pro-myogenic activity, and deregulation of miR-1 expression, is a common hallmark of RMS cells we tested whether miR-1 controls TRPS1 levels in RD cells and exerts similar effects in RD cells. Therefore, we transfected non-targeting (NT) or miR-1 miRNA mimics into RD cells and assessed TRPS1 protein expression after 2 days/48 hours (Figure 6A-C). We identified a strong reduction of TRPS1 protein levels (~80 %) after transfection of miR-1 mimic compared to non-targeting miRNA mimic suggesting that miR-1 indeed controls TRPS1 levels in RD cells (Figure 6B,C).
Next, we asked if miR-1 can also regulate TRPS1 expression during normal myogenic differentiation. Therefore, we transfected an antagomir targeting miR-1 into human myoblasts and monitored TRPS1 expression levels (Figure 6D). Accordingly, we found TRPS1 protein levels to be increased 2-fold compared to growth condition after miR-1 inhibitor treatment of human myoblasts, whereas non-targeting inhibitor treatment led to a ~50 % reduction of TRPS1 levels suggesting that miR-1 regulates TRPS1 levels in ERMS and myogenesis. This was accompanied by a reduction in MHC levels when miR-1 was inhibited (~30 %) which coincided with the expected morphological aberrations (Figure 6E-G and Suppl. Figure S6B). We then went on to characterize the miR-1 - TRPS1 signaling axis in more detail. Therefore, we performed experiments where we replenished miR-1 levels together with a reduction in TRPS1 levels in RD cells and investigated the ability to undergo myogenic differentiation. However, there we did not observe an additional improvement in myogenic differentiation of RD cells when we reduced TRPS1 levels in addition to replenishing the miR-1 levels based on MYOG and MHC expression (Figure 12C-F), suggesting that miR-1 and TRPS1 signaling axis are directly connected thereby affecting expression of shared trget genes, e.g. MYOG and MHC. Given the fact that miR-1 regulates up to ~60 targets in RD cells, we asked whether miR-1 can enhance myogenic differentiation in RD cells if TRPS1 levels are even more increased than normally. Therefore, we generated RD cells stably overexpressing V5-TRPS1 or an empty vector control together with the acute transfection of a miR-1 mimic or the respective control (Figure 12G). Overexpression of V5- TRPS1 in RD cells abrogated miR-1 induced induction of MYOG expression by ~30 % (Figure 6H-J). Subsequently, we observed a 30% reduction in the expression of MHC in V5-TRPS1 cells after transfection with the miR-1 mimetic (Figure 6K,L). These results demonstrate a role for TRPS1 as a critical downstream target of miR-1 , whose expression is required to be reduced for efficient terminal myogenic differentiation.
Next, we asked if miR-1 can indeed directly affect TRPS1 expression on the protein level. Therefore, we performed a miRNA reporter assay, which is based on a luciferase reporter gene containing various regions of the TRPS1 mRNA 3’UTR, which can be tested for sensitivity to miR- 1 regulation (Figure 6M). Transfection of RD cells with the miR-1 mimic led to reduced luciferase activity when the co-transfected reporter plasmids contained either the large fragment of TRPS1 3’UTR2 or the isolated miR-1 seed region. No changes in luciferase activity were observed after miR-1 mimic co-transfection with reporter constructs containing no 3’UTR, TRPS1 3’UTR1 fragment, or the mutated seed region. Thus, miR-1 can directly interact with a seed region within the human 3’UTR of TRPS1 mRNA. Since the TRPS1 mRNA levels were found to be unchanged after miR-1 mimic transfection of RD cells (Figure 12H), the ability of miR-1 to regulate TRPS1 protein synthesis was analyzed using a metabolic labeling approach. The approach which is based on incorporation of the amino acid analog AHA, which can be biotinylated by Click-IT and used for detection of nascent proteins (Figure 6N). We detected a reduced amount of nascent TRPS1 protein in RD cells which were transfected with the miR-1 mimic, suggesting that miR-1 targets TRPS1 to regulate its expression by translational control.
In conclusion, this novel miR-1 - TRPS1 - MYOG axis is deregulated in RD cells. Loss of miR-1 expression contributes to increased TRPS1 protein levels in ERMS and impairment of myogenic differentiation, at least in part, through suppression of MYOG transcription, thus, promoting tumor growth.
Example 7: Reduction of TRPS1 levels in other ERMS cell lines result in enhanced myogenic differentiation
We next examined whether reduction of TRPS1 levels in other ERMS model cell lines would also result in enhanced myogenic differentiation. Therefore, we first determined TRPS1 mRNA expression and TRPS1 protein levels in two additional ERMS lines, SMS-CTR and JR1 , confirming aberrantly high TRPS1 protein and mRNA levels compared to human skeletal myoblasts (Fig. 13 G, H). We then tested whether a single transfection with siRNA targeting TRPS1 would be sufficient to induce myogenic differentiation in SMS-CTR and JR1 cells. Indeed, reduction of TRPS1 expression enhanced myogenic differentiation measured by an increase in the percentage of MYOG+ nuclei in both cell lines (Fig. 13; J-L). These data suggest that TRPS1 is one of the main causes for impaired terminal myogenic differentiation in ERMS cells and that reduction of TRPS1 levels in ERMS cells permits myogenic differentiation.
Example 8: Dynamic Trpsl expression in MuSCs is required for proper myogenic differentiation
To determine if reduction of TRPS1 levels is a prerequisite for myogenic differentiation, we first investigated the expression of Trpsl during murine muscle development focusing on the postnatal stages when MuSCs switch from a proliferative to a quiescent state (Figure 14A). Interestingly, Trpsl protein was detected in 68 % and 74 % of Pax7+ MuSCs of the tibialis anterior (TA) muscles at the early postnatal stage P7 and the juvenile stage P21 , respectively, while only 29 % of MuSCs were positive for Trpsl in the adult stage (2 months) (Figure 14B,C). These observations suggest that Trpsl protein is found rather in proliferating than in quiescent MuSCs. To investigate this further, we performed a cardiotoxin (CTX)-mediated injury of the TA muscle from adult mice, which leads to muscle damage accompanied by the activation and proliferation of MuSCs followed by myogenic differentiation to replace the damaged tissue. Interestingly, we found the highest abundance of Trpsl around day 5 post injury (5 dpi), a time point when MuSCs are highly proliferative (Figure 16A), followed by a decline until regeneration was completed at day 21 post injury (Figure 14D and. Figure 16A). Since Trpsl levels peaked around 5 dpi, we had a closer look on the cell types expressing Trpsl at this specific time point. Thereby, we found that in 95 % of Pax7+ MuSCs also contained Trpsl protein while all Myod1 + cells (100%) representing activated/proliferating MuSCs and myoblasts were positive for Trpsi . Remarkably, only a very small proportion of nuclei (10 %) of newly formed myofibers, marked by developmental MHC (devMHC), contained Trpsi protein, presumably nuclei derived from myoblasts which just underwent myogenic fusion (Figure 14D-F). These data demonstrate that Trpsi abundance is reduced during normal myogenic differentiation and that only very few Trpsi + MuSCs were identified in resting skeletal muscle suggesting that Trpsi is rather found in proliferating but not in quiescent MuSCs. Of note, the data obtained in mice are in line with the results observed in human skeletal muscle suggesting that TRPSI function is conserved in mice or humans (Figure 1A, Figure 16A).
Example 9: TRPS1 binds to the MYOG promoter impairing induction of MYOG expression in RD cells
We then sought to reveal how TRPSI mediates suppression of terminal myogenic differentiation. MYOG is a known inducer of myogenic differentiation described to be sufficient to overcome the impaired myogenic differentiation of RMS cells. We identified MYOD1 , a well-known transcriptional inducer of MYOG expression during myogenic differentiation as a potential activated upstream regulator in RD cells when TRPS1 levels were experimentally reduced (Figure 17D). Indeed, we identified a -2.5-fold increase in MYOG protein levels upon reduction of TRPS1 expression while, unexpectedly, we did not observe changes in MYOD1 protein levels (Figure 15A-E). In line with these data, immunofluorescence experiments demonstrated a similar percentage of MYOD1 + nuclei in all conditions (-62 %), and a -2-fold increase of MYOD1+/MYOG+ nuclei in RD cells (21 % i-shNT; 49 % i-shTRPS1#1 ; 38 % i-shTRPS#2) upon reduction of TRPS1 expression while almost all cells positive for MYOG were also positive for MYOD1 (-99 %) (Figure 15F-I). Consistently, we found a -2.5-fold increase in MYOG mRNA after knockdown of TRPS1 at day 2 and day 3 of differentiation reflecting the time point of early myogenic differentiation (Figure 15J). However, we did not observe corresponding changes in MY0D1 mRNA levels (Figure 15K). Together, these data suggest that TRPS1 is a negative regulator of MYOG mRNA transcription potentially binding to a regulatory region of the MYOG gene, either together with or independent of MYOD1 .
To determine the genomic binding sites of TRPS1 in RD cells, we performed ChlP-sequencing (ChlP- seq) experiments using parental RD cells and RD-TRPS1-KO cells as controls, which we generated by CRISPR/Cas9 as previously described (40). Of note, RD-TRPS1-KO cells recapitulated the phenotype we observed after reducing TRPS1 expression using shRNA mediated approaches displaying increased presence of markers of myogenic differentiation, such as MYOG and MHC (Fig.9 and Figure 3). Indeed, we identified GATA-related binding motifs within TRPS1 binding sites in RD cells by HOMER known motif analysis including a previously described TRPS1 binding motif (40). Among them, a substantial subset of TRPS1 binding sites contained motifs of the myogenic regulatory factors MYOG (26 %) and MYOD1 (21 %) (Figure 15L). This prompted us to compare the newly identified TRPS1 binding sites with already published MYOD1 binding sites (55). Thereby we identified 3859 genomic binding sites, which are shared between TRPS1 and MYOD1 in RD cells. This accounts for ~1 Z4 of all TRPS1 binding sites and ~1/14 of all MYOD1 binding sites (Figure 15M). Next, we validated the nuclear co-localization of TRPS1 and MYOD1 by proximity ligation assays (PLA) (Figure 15N,O) and a direct binding of TRPS1 to the MYOG locus by confirmatory ChlP-qPCR experiments (Figure 15P,Q). Thereby, we identified an enrichment of endogenous TRPS1 at the MYOG locus compared to the negative control region U2 when using an anti-TRPS1 antibody. Interestingly, TRPS1 and MYOD1 share an overlapping binding site at the MYOG promoter suggesting that TRPS1 binding might affect the ability of MYOD1 to bind to the MYOG promoter and thereby impair expression of MYOG (Figure 15R). Consequently, we performed ChlP-qPCR of the MYOG promoter in cells with normal or reduced TRPS1 levels using an anti-MYOD1 antibody. Indeed, we determined an increased binding of MYOD1 to the MYOG promoter when TRPS1 expression were reduced (Figure 15S), probably allowing an increased transcriptional activation of MYOG.
Example 10: Dynamic expression levels of TrpsI during myogenic differentiation
To examine the relevance of TrpsI for functional regeneration of skeletal muscle, we injured the TA muscle of adult mice with cardiotoxin (CTX) and injected a self-delivering siRNA targeting Trpsl into the damaged muscle at the peak of MuSC proliferation, at 3 and 5 days post injury respectively (Figure 14G). The knockdown of Trpsl led to a decrease in the percentage of devMHC+ myofibers at 10 dpi from 53 % in muscles injected with si-scr compared to 30 % in muscles injected with si- Trpsl (Figure 141-1,1). In addition, we found a trend towards larger diameters of regenerating myofibers after knockdown of Trpsl, suggesting enhanced/faster myogenic differentiation and thereby regeneration (Figure 16B). Since injection of a self-delivering siRNA might affect other cell types in addition to MuSCs, we cultured MuSCs on their adjacent myofibers from the extensor digitorum longus (EDL) muscle for 72 hours after transfection with a siRNA targeting Trpsl (Figure 14J). Of note, in this established model system, MuSCs can be investigated in their endogenous niche without effects from other mononucleated cells (49, 50). After 72 hours of culture, clusters of myogenic cells are formed, which arise from one MuSC. Knockdown of Trpsl resulted in an increased number of cells per cluster (6 si-scr; 8 si-Trps1) suggesting a negative regulation of cell proliferation by Trpsl (Figure 16C,D). However, reduction of Trpsl levels did not result in enhanced activation of MuSCs per se as evidenced by a similar number of clusters per myofiber (Figure 16E). Interestingly, detected changes in the cluster composition after knockdown of Trpsl. In particular, we identified an increase in the percentage of Myog+ cells representing a cell population that is further differentiated. This coincided with a reduction in the population of Pax7+/Myod1 + cells, representing committed myoblasts (Figure 14K, Fig.2 and Figure 16F). This suggests that reduction of Trpsl levels in MuSCs results in an increased ability to proliferate and differentiate.
Example 11 : Reduction of TRPSI levels in ERMS cell lines allow terminal myogenic differentiation
Redduction of Trpsl levels in skeletal muscle led to increased expression of myogenic differentiation markers and enhanced regeneration. In order to show that reduction of TRPS1 levels in RD cells would reinstate the transcriptional regulation of genes important for terminal myogenic differentiation, we first performed RNA-seq of RD cells after acute doxycycline induced shRNA-mediated reduction of TRPS1 levels using two independent shRNAs targeting TRPS1 (Figure 4A, C-F, Figure 17A,B). Thereby we identified an intersection of 45 protein coding genes, which were differentially expressed (log2FC > 0.5 or log2FC < -0.5, padj < 0.05) in both RD cell lines expressing a shRNA targeting TRPS1 compared to a non-targeting control shRNA. Out of the 45 identified genes 36 were commonly upregulated while 7 genes were commonly downregulated (Figure 4B). By Gene Set Enrichment Analysis (GSEA) we identified an enrichment of the hallmark gene set “Myogenesis” as well as the gene ontology (GO) gene set “contractile fiber” among the top 5 ranks for both datasets with reduced TRPS1 expression (Figure 4C-F and Figure 17C). Accordingly, we observed an increase in the mRNAs of genes associated with muscle structure and contraction, such as myosin heavy chain 3 (MHC3) and troponin C1 (TNNC1) supporting our notion that reduction of TRPS1 levels indeed permits terminal myogenic differentiation in ERMS. This was accompanied by a reduction in the levels of mRNAs associated with cell cycle genes, such as Cyclin D1 (CCND1) (Figure 4G). Immunofluorescence analysis further demonstrated that RD cells with reduced TRPS1 levels displayed a strong increase in the formation of well aligned, myotube-like, MHC+ structures coinciding with a reduction in the percentage of proliferating cells (Figure 10D-F).
Next, we asked whether a temporal reduction of TRPS1 expression is sufficient to allow terminal myogenic differentiation. Therefore, we took advantage of the reversibility of the doxycycline inducible shRNA system. After an initial differentiation period under doxycycline induced expression of the shRNAs, we cultured the RD cells for an additional four days without doxycycline and assayed terminal myogenic differentiation. Indeed, we found that parameters such as an increase in the percentage of MHC+ cells, and a reduction in the percentage of Ki67+ nuclei upon TRPS1 knockdown were stable after doxycycline removal as compared to continuous doxycycline treatment (Figure 17E-F). This suggests that a reduction of TRPS1 expression during the early phases of terminal myogenic differentiation is sufficient for the formation of myotube-like structures and reduced proliferation making TRPS1 a promising candidate for treatment of ERMS. Interestingly, we did not observe a regain of TRPS1 expression after doxycycline removal suggesting that most cells underwent terminal myogenic differentiation and therefore do not express TRPS1 anymore.
The analysis of the transcriptomic datasets indicated an activated miR-1 and MY0D1 signature upon reduced TRPS1 expression suggesting miR-1 and MYOD1 to be potential upstream regulators of the observed gene expression changes (Figure 17D).
Discussion of Examples
Deregulated myogenic differentiation of RMS causes uncontrolled tumor cell proliferation, yet, the underlying molecular mechanisms are diverse, not least due to various oncogenic mechanisms within specific tumor subtypes. Here we show that TRPS1 , a transcriptional repressor, is upregulated in human ERMS and prevents terminal myogenic differentiation of RD cells through repression of MYOG, thereby promoting RD cell tumor growth in vivo. Furthermore, we identified TRPS1 as a direct downstream target of miR-1 , which lacks expression in RD cells, erroneously sustaining TRPS1 expression. Our data also suggest a consistent role of TRPS1 as a negative regulator of myogenic differentiation of muscle stem cells in physiological contexts, such as mouse juvenile muscle growth and muscle regeneration.
TRPS1 expression was identified in human RMS tumors and RMS cell lines. The embryonal subtype showed consistently higher expression compared to the alveolar subtype. Another possibility to explain the higher TRPS1 expression in ERMS could be the heterogeneous source of cells of origin for both RMS subtypes. Several studies have noted that the RMS tumors of the embryonal subtype may arise at an earlier stage of the myogenic lineage, such as muscle stem cells, and the alveolar subtype eventually develops at a later myogenic stage, e.g. from myoblasts and myocytes, reflecting differences in TRPS1 expression before oncogenic transformation. Importantly, in ERMS, e.g. in RD cells, the balancing function of TRPS1 to regulate myogenic differentiation is exploited by aberrant upregulation of its protein levels. Indeed, we could demonstrate that TRPS1 reduction promotes terminal myogenic differentiation of RD cells, finally reducing xenograft tumor growth in mice. Consistently, we found MYOG upregulation upon TRPS1 depletion, which was paralleled by downregulation of the cell cycle gene CCND1 and proliferation marker Ki67. Interestingly, MYOG expression is considered low in ERMS, fitting to increased TRPS1 levels in ERMS tumors.
Our results further suggest that increased TRPS1 expression in RD cells is causally linked to miR-1 misexpression. We provide experimental evidence that TRPS1 is a direct target of miR-1 , which controls its protein levels through post-transcriptional regulation. Of note, we did not observe downregulation of TRPSI mRNA after miR-1 transfection for 48 hours measured by RT- qPCR approach, suggesting that the observed effects on TRPS1 protein expression are mediated by translational control. In fact, metabolic labeling of newly synthesized proteins revealed reduced levels of nascent TRPS1 protein after miR-1 mimic transfection in RD cells. Overexpression of V5-TRPS1 diminished the ability of miR-1 to induce MYOG and subsequent upregulation of MHO in RD cells, which identifies an interrelated miR-1 - TRPS1 - MYOG axis. Thus, the lack of miR-1 expression is a contributing but not limiting mechanism leading to increased TRPS1 protein levels in RD cells. Increased TRPS1 mRNA levels compared to human myoblasts might be caused by dysregulation of additional upstream pathways. BMP/GDF5 signaling controlled TRPS1 expression in kidneys and chondrocytes.
In conclusion, TRPS1 prevents terminal myogenic differentiation of RD cells. Lack of miR-1 expression contributes to elevated expression of TRPSI , which could refine the embryonal subtype pathomechanism. These findings may help explore novel therapeutic options targeting the miR-1 - TRPS1 - MYOG axis to induce differentiation of embryonal RMS and improve treatment outcomes and quality of life for the patients.
Material and Methods of the Examples
Cell culture
Human embryonal rhabdomyosarcoma RD cells and human alveolar rhabdomyosarcoma RH-30 cells were purchased from ATCC and DSMZ, respectively, and cultured in DMEM supplemented with 10 % FBS and penicillin/streptomycin. SMS-CTR and JR1 cells were generously provided by Peter Houghton and Janet Shipley and cultured in DMEM supplemented with 10 % FBS and penicillin-streptomycinsupplemented with 2 % HS (Thermo Fisher Scientific #26050-088) and 1 % Penicillin-Streptomycin (Thermo Fisher Scientific #15140122)).
Human 293T/Lenti-X cells were purchased from ATCC and cultured in DMEM supplemented with 10 % FBS and penicillin/streptomycin. Mouse C2C12 myoblasts were purchased from ATCC and cultured in DMEM supplemented with 10 % FBS and penicillin/streptomycin. Human skeletal muscle myoblasts were either purchased from GIBCO or described in (von Maltzahn et al., 2013) and cultured on collagen-coated cell culture dishes in F12/DMEM supplemented with 20 % FBS and penicillin/streptomycin. Cells were maintained in a humidified incubator at 37 °C and 5 % CO2. TE-671 , RH-18, RH-41 protein lysates and RNA extracts were a kind gift from Prof. S. Hashemolhosseini. Generation of TRPS1 knockout RD cells
CRISPR-mediated TRPS1 knockout in RD cells was performed as recently described (Elster et al., 2018). TRPS1 knockout was validated by absence of the TRPS1 protein using antibodies that recognize both, TRPS1 N-terminus and C-terminus. Genomic DNA from RD cells was isolated and the region flanking the sgRNA targeting site was amplified by PCR. The amplicon was cloned into pJet and subjected to Sanger sequencing, revealing frameshifts leading to premature stop codons.
Lentivirus infection
To generate stable transgene expressing cell lines, cells were infected by lentivirus as described by others (Elster et al., 2018). Briefly, mouse C2C12 myoblasts, human ERMS RD cells, and human ERMS RD-TRPS1-KO cells were generated expressing either empty vector (pLeGO) or human V5-tagged TRPS1 . The construct for TRPS1 overexpression was generated by PCR amplification. Likewise, human ERMS RD cells stably expressing control shRNA (shRenilla) or TRPS1 targeting shRNAs (shTRPS1#1 , shTRPS1#2) were generated. shTRPS1#1 (SEQ ID NO. 29):
TGCTGTTGACAGTGAGCGACAGGACAAGATAACAGTCAAATAGTGAAGCCACAGATGTATTT GACTGTTATCTTGTCCTGCTGCCTACTGCCTCGGA shTRPS1#2 (SEQ ID NO. 30):
TGCTGTTGACAGTGAGCGAAAAGTTGATAGAAGTACTCAATAGTGAAGCCACAGATGTATTG AGTACTTCTATCAACTTTCTGCCTACTGCCTCGGA
For acute shRNA-mediated TRPS1 knockdown in human ERMS RD cells, non-targeting shRNA (i-shNT, sequence) or the same TRPS1 -targeting shRNAs were expressed from a tetracycline inducible promotor from plasmid after lentiviral infection (i-shTRPS1#1 , i-shTRPS1#2).
Transient transfections and cell treatments siRNAs were purchased from Dharmacon (see below) and were was transfected using the RNAiMax (Invitrogen) reagent in a 1 :3 ratio. miRNA mimics and miRNA inhibitors (Thermo Fisher Scientific) were transfected using the RNAiMax (Invitrogen) reagent in a 1 :3 ratio.
Acute TRPS1 knockdown in RD-i-shRNA cells was induced by supplementing the growth medium with 1 pg/ml doxycycline (Sigma).
Immunohistochemistry (IHC)
Rhabdomyosarcoma tissue micro arrays (TMA) were purchased from US Biomax. TRPS1 was detected using an anti-TRPS1 antibody following standard immunohistochemistry (IHC) protocols. Briefly, specimens were deparaffinized, antigen retrieval, blocking and antibody incubations as well as DAB substrate incubation were performed. Hematoxylin was used as nuclear counterstain. The IHC staining was analyzed by light microscopy using a Zeiss microscope. RNA isolation and RT-qPCR
Total RNA was isolated by chloroform-phenol extraction using a commercially available Trizol- Reagent. RNA was than reverse transcribed into cDNA. Quantification of cDNA by RT-qPCR was performed on a Agilent real-time cycler detection system + MX pro software. For gene expression analysis, at least 3 independent biological replicates (cDNAs) were measured in technical duplicates or triplicates. The obtained Ct-values of target genes and housekeeping genes were used to calculate relative expression according to the 2AddCt formula.
RNA-sequencing
RNA was isolated from RD-i-shRNA cells, which were treated with doxycycline 1 pg/ml in growth medium for 2 days and differentiation medium for 10 days. The quality of 1 pg total RNA was checked using an Agilent Bioanalyzer 2000 and a RNA 6000 nano. cDNA libraries were prepared using a NEBNext Ultra II directional mRNA Kit and sequenced using the HiSeq2500 (Illumina). Samples were mapped with STAR to the H. sapiens genome (GRCh38) with the Ensembl genome annotation (Release 99). For each annotated gene, reads that map uniquely to one genomic position were counted with Featurecounts. Quality assessment was done with MultiQC. Differentially expressed genes (DEGs) were analyzed using the Ingenuity Pathway Analysis (IPA, Quiagen) and Gene Set Enrichment Analysis (GSEA, Broad Institute) software.
ChlP-sequencing and ChlP-qPCR
ChlP-sequencing was performed as previously described (Elster et al., 2018). Briefly, RD and RD-TRPS1-KO cells were fixed in 1 % glutaraldehyde for 10 minutes. Nuclei were released using hypotonic buffer with protease inhibitors and lysed in ChIP lysis buffer. The chromatin was sonified in 1 .5 ml thin-walled reaction tubes (Diagenode) using a Bioruptor (Diagenode) with 60 cycles (30 sec ON, 30 sec OFF), yielding chromatin fragment sizes of approximately 200 bp. For immunoprecipitation, 500 pg chromatin was incubated with 10 pg of a anti-TRPS1 antibody, raised in rabbit and validated in Elster et al., 2018, or control IgG coupled to magnetic protein A dynabeads, for 6 hours at 4 °C. DNA libraries for sequencing were prepared according to the manufacturer's instructions using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) and Dual Index Primers (NEBNext Multiplex Oligos for Illumina, NEB). The samples were purified using magnetic beads, the quality was checked with an Agilent Bioanalyzer 2100 and nextgeneration sequencing was performed using a HiSeq2500 (Illumina). Processing of raw data and bioinformatic analysis were performed as described in (Elster et al., 2018), revealing data that can visualize TRPS1 peaks across the genome (IGV) and the HOMER motif analysis table. H3K27ac and MYOD1 ChlP-Seq data in RD cells was retrieved from Gryder et al. (GSE84628) and MacQuarrie et al. (GSE50413), respectively.
ChlP-qPCR was performed using the SimpleChIP® Plus Sonication Chromatin IP Kit (CST) according to the manufacturer's instructions. Briefly, cells were cross-linked as described above. Nuclei were extracted and lysed using the kit's components. For chromatin immunoprecipitation 2 pg of antibody or respective IgG control were incubated together with 10 pg cross-linked and sheared chromatin overnight at 4 °C under constant rotation. Subsequently, magnetic beads were added to the samples followed by incubation at 4 °C under constant rotation for two hours. IPs were then washed and eluted using the kit's components. DNA was purified using spin columns and quantified by qPCR assay.
Protein isolation and Western blot
Proteins were obtained by cell lysis using RIPA buffer containing PhosSTOP and Protease STOP inhibitors (Roche). Cleared protein lysates were separated on Bis-Tris gels by SDS-PAGE and transferred on PVDF membranes. Membranes were blocked in 5 % skim milk in TBS-T and incubated with primary and secondary antibodies dissolved in blocking reagent. Protein bands were visualized on a LAS camera system (ECL Imager) using the ECL-detection Kit (Pierce). For densitometric quantification of protein bands, FIJI software was used. Target protein expression was normalized to GAPDH from at least 3 independent biological replicates (3 protein lysates).
Mouse husbandry
Wildtype C57BL/6 mice were either bred in house or purchased by Janvier (Source). NOD.SCID mice were purchased by Janvier. Upon arrival, mice had a one week acclimatization time. All mice were housed at the animal facility of the Leibniz-lnstitute on Aging - Fritz Lipmann Institute under specific-pathogen-free (SPF) conditions. The mice were maintained in groups of 2-5 mice in individually ventilated cages (IVC) with nesting material and enrichment, 12 hours day-night cycles, 20 - 24 °C , 40 - 70 % humidity, 17-fold air change; and received standard chow and water ad libitum according to the directive 2010/63 EU and GV SOLAS. The mice were checked daily by animal caretakers. Animal experiments reported in this study were aproaved by the “Thuringer Landesamt fur erbraucherschutz”, Bad Langensalza (FLI-17-005, FLI-18-001 , 03- 048-16).
Immunofluorescence
Muscle cross-sections were prepared and immunofluorescence (IF) staining was performed according to known protocols. Of note, to detect devMHC by IF the samples must not be PFA fixated. Images were captured using Zeiss Observer Z1 microscopes. IF for cultured cells followed principally the same steps.
TA muscle explants
The lower hindlimbs of NOD.SCID mice were isolated from the knee to the ankle, and all tissue but the TA muscle attached to the bone were removed. Beforehand, RD-i-shRNA cells were treated with 1 pg/ml doxycycline in growth medium for 48 hours. 50,000 RD-i-shRNA cells were then injected into the isolated TA explants and cultured further in a12-well plate with doxycycline containing differentiation medium for 72 hours. TA explants were then further processed for cross-sectioning and IF staining.
Xenografts
107 RD cells, stably expressing control shRNA (shRenilla) or two different shRNAs targeting TRPS1 (shTRPS1#1 , shTRPS1#2), were injected in 250 pl matrigekmedium (1 :1) subcutaneously into the flanks of 2-months old NOD.SCID mice. Tumor growth was continuously measured using a caliper. After dissection, tumors were weighted, PFA fixated, paraffine embedded, and sectioned using a microtome. Depraffinization and standard H&E histological analysis was carried out using an automated slide stainer (Leica). Tumor sections were subjected to IHC staining using an anti-MYOG antibody and nuclei were counterstained using DAPI.
Rhabdosphere growth
RD-shRenilla and RD-shTRPS1#1 cells were grown in serum-free medium on ultra-low attachment plates following known protocols. After 10 passages, spheres were dissociated using Accutase and 20000 cells were seeded into 12-well, cultured for 3 days and the number of spheres per well was counted. miRNA reporter assay
Luciferase vectors for miRNA reporter assays were constructed with the commercial kits following the manufacturer's instructions. The TRPS1 3’UTR fragments UTR1 and UTR2 were PCR amplified from RD genomic DNA. miR-1 seed regions within the TRPS1 3’UTR, either wildtype or mutated were generated by DNA oligonucleotide annealing. Inserts were ligated to Spel and Mlu\ digested pMIR-REPORT luciferase vector.
150,000 RD cells were seeded in 24-well plates filled with 0.5 ml growth medium and incubated over night at 37 °C. The cells were then transfected with 0.5 pg of the reporter vectors (pMIR- REPORT and pbeta-GAL) together with the miRNA mimics (1 nM final) using Lipofectamine 2000 according to the manufacturer's instruction.
12 Hours post transfection, cells were washed once in PBS and then lysed in reporter lysis buffer (Promega) according to the manufacturer's instruction. 20 pl lysate were added to a white 96-well plate with a flat closed bottom and firefly luciferase activity was measured at RT using firefly luciferase substrate solution in a plate reading luminometer (Mithras) with injector function. The measurement was set up as following: injection of 100 pl luciferase substrate solution, 2 sec shaking/delay time, 10 sec measurement. For measurement of p-Galactosidase activity, 30 pl of lysate, 20 pl 1x reporter lysis buffer and 50 pl 2x assay buffer were mixed in a 96-well plate and incubated at 37 °C for 30 min. The absorbance was measured at 405 nm and was used for normalization of luciferase activity.
Metabolic labeling
RD cells were transfected with miR-NT or miR-1 miRNA mimic. 43 hours post transfection the cells were starved for 1 hour with methionine-free medium (Gibco, 21013-024). The medium was then replaced with methionine-free medium supplemented with 200 pM AHA (L- azidohomoalanine) (Invitrogen), an amino acid analog, and cells were incubated for 4 hours at 37 °C. Whole cell protein lysates were prepared and immunoprecipitation (IP) was performed using 2 pg anti-TRPS1 antibody (Abeam, ab209664) for 200 pg total protein. A Click-IT reaction was performed to biotinylate the incorporated AHA following the manufacturer's instructions (Invitrogen, C33372) and the beads were then washed and eluted. The IP eluates as well as input protein samples were subjected to Western blotting as described in chapter 4.2.11. For detection of biotinylated TRPS1 protein in the IP samples, a streptavidin-HRP conjugate was used. siRNAs The siRNAs used to transfect cells were purchased from Dharmacon as ON TARGETplus SMARTpool (4 different siRNAs against the target or non-targeting control), solubilized in 1x siRNA buffer (Dharmacon) at a concentration of 20 pM and stored at -20 °C. The siRNA used for in vivo injection was purchased from Dharmacon as Accell SMARTpool, a modification allowing self-delivery without transfection reagent, solubilized and stored as described above.
Table 1. siRNAs used in the examples.
Figure imgf000047_0001
miRNA mimics and miRNA inhibitors
Human m/rVana™ miRNA mimics or inhibitors (antagomiRs) were purchased from Thermo Fisher Scientific, solubilized in DEPC-H2O at a concentration of 50 pM and stored at -80 °C. Table 2. miRNA mimics and inhibitors.
Figure imgf000048_0001
References
Ahrens, H.E., H. Henze, S.C. Schuler, M. Schmidt, S.S. Huttner, and J. von Maltzahn. 2019. Analyzing Satellite Cell Function During Skeletal Muscle Regeneration by Cardiotoxin Injury and Injection of Self-delivering siRNA In Vivo. J Vis Exp.
Annavarapu, S.R., S. Cialfi, C. Dominici, G.K. Kokai, S. Uccini, S. Ceccarelli, H.P. McDowell, and T.R. Helliwell. 2013. Characterization of Wnt/beta-catenin signaling in rhabdomyosarcoma. Lab Invest. 93:1090-1099.
Barr, F.G., N. Galili, J. Holick, J.A. Biegel, G. Rovera, and B.S. Emanuel. 1993. Rearrangement of the PAX3 paired box gene in the paediatric solid tumour alveolar rhabdomyosarcoma. Nat Genet. 3:113-117.
Braun, T., E. Bober, B. Winter, N. Rosenthal, and H.H. Arnold. 1990. Myf-6, a new member of the human gene family of myogenic determination factors: evidence for a gene cluster on chromosome 12. EMBO J. 9:821-831.
Braun, T., G. Buschhausen-Denker, E. Bober, E. Tannich, and H.H. Arnold. 1989. A novel human muscle factor related to but distinct from MyoD1 induces myogenic conversion in 10T1/2 fibroblasts. EMBO J. 8:701-709.
Chang, G.T., S.C. Gamble, M. Jhamai, R. Wait, C.L. Bevan, and A.O. Brinkmann. 2007. Proteomic analysis of proteins regulated by TRPS1 transcription factor in DU 145 prostate cancer cells. Biochim Biophys Acta. 1774:575-582.
Conti, B., K.K. Slemmons, R. Rota, and C.M. Linardic. 2016. Recent Insights into Notch Signaling in Embryonal Rhabdomyosarcoma. Curr Drug Targets. 17:1235-1244.
Cornelissen, L.M., A.P. Drenth, E. van der Burg, R. de Bruijn, C.E.J. Pritchard, I. J. Huijbers, W. Zwart, and J. Jonkers. 2020. TRPS1 acts as a context-dependent regulator of mammary epithelial cell growth/differentiation and breast cancer development. Genes Dev. 34:179-193.
Davis, R.J., C.M. D'Cruz, M.A. Lovell, J.A. Biegel, and F.G. Barr. 1994. Fusion of PAX7 to FKHR by the variant t(1 ; 13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer Res. 54:2869-2872.
Davis, R.L., H. Weintraub, and A.B. Lassar. 1987. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell. 51 :987-1000.
Deato, M.D., M.T. Marr, T. Sottero, C. Inouye, P. Hu, and R. Tjian. 2008. MyoD targets TAF3/TRF3 to activate myogenin transcription. Mol Cell. 32:96-105.
Edmondson, D.G., and E.N. Olson. 1989. A gene with homology to the myc similarity region of MyoD1 is expressed during myogenesis and is sufficient to activate the muscle differentiation program. Genes Dev. 3:628-640.
Enterline, H.T., and R.C. Horn, Jr. 1958. Alveolar rhabdomyosarcoma; a distinctive tumor type.
Am J Clin Pathol. 29:356-366. Elster, D., M. Tollot, K. Schlegelmilch, A. Ori, A. Rosenwald, E. Sahai, and B. von Eyss. 2018.
TRPS1 shapes YAP/TEAD-dependent transcription in breast cancer cells. Nat Commun. 9:3115.
Gai, Z., G. Zhou, S. Itoh, Y. Morimoto, H. Tanishima, I. Hatamura, K. Uetani, M. Ito, and Y. Muragaki. 2009. Trpsl functions downstream of Bmp7 in kidney development. J Am Soc Nephrol. 20:2403-2411.
Gryder, B.E., M.E. Yohe, H.C. Chou, X. Zhang, J. Marques, M. Wachtel, B. Schaefer, N. Sen, Y. Song, A. Gualtieri, S. Pomella, R. Rota, A. Cleveland, X. Wen, S. Sindiri, J.S. Wei, F.G. Barr, S. Das, T. Andresson, R. Guha, M. Lai-Nag, M. Ferrer, J.F. Shern, K. Zhao, C.J. Thomas, and J. Khan. 2017. PAX3-FOXO1 Establishes Myogenic Super Enhancers and Confers BET Bromodomain Vulnerability. Cancer Discov. 7:884-899.
Hinterberger, T.J., D.A. Sassoon, S.J. Rhodes, and S.F. Konieczny. 1991. Expression of the muscle regulatory factor MRF4 during somite and skeletal myofiber development. Dev Biol. 147:144-156
Huttner, S.S., H.E. Ahrens, M. Schmidt, H. Henze, M.J. Jung, S.C. Schuler, and J. von Maltzahn. 2019. Isolation and Culture of Individual Myofibers and Their Adjacent Muscle Stem Cells from Aged and Adult Skeletal Muscle. Methods Mol Biol. 2045:25-36.
Hu, P., K.G. Geles, J.H. Paik, R.A. DePinho, and R. Tjian. 2008. Codependent activators direct myoblast-specific MyoD transcription. Dev Cell. 15:534-546.
Keller, C., B.R. Arenkiel, C.M. Coffin, N. El-Bardeesy, R.A. DePinho, and M.R. Capecchi. 2004. Alveolar rhabdomyosarcomas in conditional Pax3:Fkhr mice: cooperativity of Ink4a/ARF and Trp53 loss of function. Genes Dev. 18:2614-2626.
Lassar, A.B., R.L. Davis, W.E. Wright, T. Kadesch, C. Murre, A. Voronova, D. Baltimore, and H. Weintraub. 1991. Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell. 66:305-315.
Lazure, F., D.M. Blackburn, A.H. Corchado, K. Sahinyan, N. Karam, A. Sharanek, D. Nguyen, C. Lepper, H.S. Najafabadi, T.J. Perkins, A. Jahani-Asl, and V.D. Soleimani. 2020. Myf6/MRF4 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool. EMBO Rep:e49499.
Macquarrie, K.L., Z. Yao, J.M. Young, Y. Cao, and S.J. Tapscott. 2012. miR-206 integrates multiple components of differentiation pathways to control the transition from growth to differentiation in rhabdomyosarcoma cells. Skelet Muscle. 2:7
Makawita, S., M. Ho, A.D. Durbin, P.S. Thorner, D. Malkin, and G.R. Somers. 2009. Expression of insulin-like growth factor pathway proteins in rhabdomyosarcoma: IGF-2 expression is associated with translocation-negative tumors. Pediatr Dev Pathol. 12:127-135.
Martins, A.S., D. Olmos, E. Missiaglia, and J. Shipley. 2011 . Targeting the insulin-like growth factor pathway in rhabdomyosarcomas: rationale and future perspectives. Sarcoma. 2011 :209736. Massari, M.E., and C. Murre. 2000. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol Cell Biol. 20:429-440.
McKinnell, I.W., J. Ishibashi, F. Le Grand, V.G. Punch, G.C. Addicks, J.F. Greenblatt, F.J. Dilworth, and M.A. Rudnicki. 2008. Pax7 activates myogenic genes by recruitment of a histone methyltransferase complex. Nat Cell Biol. 10:77-84.
Miner, J.H., and B. Wold. 1990. Herculin, a fourth member of the MyoD family of myogenic regulatory genes. Proc Natl Acad Sci U S A. 87:1089-1093.
Mohamed, A.D., A.M. Tremblay, G.l. Murray, and H. Wackerhage. 2015. The Hippo signal transduction pathway in soft tissue sarcomas. Biochim Biophys Acta. 1856:121-129.
Rudzinski, E.R., J.R. Anderson, D.S. Hawkins, S.X. Skapek, D.M. Parham, and L.A. Teot. 2015. The World Health Organization Classification of Skeletal Muscle Tumors in Pediatric Rhabdomyosarcoma: A Report From the Children's Oncology Group. Arch Pathol Lab Med. 139:1281-1287.
Saab, R., S.L. Spunt, and S.X. Skapek. 2011 . Myogenesis and rhabdomyosarcoma the Jekyll and Hyde of skeletal muscle. Curr Top Dev Biol. 94:197-234.
Skapek, S.X., A. Ferrari, A.A. Gupta, P.J. Lupo, E. Butler, J. Shipley, F.G. Barr, and D.S. Hawkins. 2019. Rhabdomyosarcoma. Nat Rev Dis Primers. 5:1.
Enterline, H.T., and R.C. Horn, Jr. 1958. Alveolar rhabdomyosarcoma; a distinctive tumor type. Am J Clin Pathol. 29:356-366.
Keller, C., B.R. Arenkiel, C.M. Coffin, N. El-Bardeesy, R.A. DePinho, and M.R. Capecchi. 2004. Alveolar rhabdomyosarcomas in conditional Pax3:Fkhr mice: cooperativity of Ink4a/ARF and Trp53 loss of function. Genes Dev. 18:2614-2626.
Patton, R.B., and R.C. Horn, Jr. 1962. Rhabdomyosarcoma: clinical and pathological features and comparison with human fetal and embryonal skeletal muscle. Surgery. 52:572-584.
Rhodes, S.J., and S.F. Konieczny. 1989. Identification of MRF4: a new member of the muscle regulatory factor gene family. Genes Dev. 3:2050-2061 .
Rudzinski, E.R., J.R. Anderson, D.S. Hawkins, S.X. Skapek, D.M. Parham, and L.A. Teot. 2015. The World Health Organization Classification of Skeletal Muscle Tumors in Pediatric Rhabdomyosarcoma: A Report From the Children's Oncology Group. Arch Pathol Lab Med. 139:1281-1287.
Saab, R., S.L. Spunt, and S.X. Skapek. 2011 . Myogenesis and rhabdomyosarcoma the Jekyll and Hyde of skeletal muscle. Curr Top Dev Biol. 94:197-234.
Seki, M., R. Nishimura, K. Yoshida, T. Shimamura, Y. Shiraishi, Y. Sato, M. Kato, K. Chiba, H. Tanaka, N. Hoshino, G. Nagae, Y. Shiozawa, Y. Okuno, H. Hosoi, Y. Tanaka, H. Okita, M. Miyachi, R. Souzaki, T. Taguchi, K. Koh, R. Hanada, K. Kato, Y. Nomura, M. Akiyama, A. Oka, T. Igarashi, S. Miyano, H. Aburatani, Y. Hayashi, S. Ogawa, and J. Takita. 2015. Integrated genetic and epigenetic analysis defines novel molecular subgroups in rhabdomyosarcoma. Nat Commun. 6:7557. Shern, J.F., L. Chen, J. Chmielecki, J.S. Wei, R. Patidar, M. Rosenberg, L. Ambrogio, D. Auclair, J. Wang, Y.K. Song, C. Tolman, L. Hurd, H. Liao, S. Zhang, D. Bogen, A.S. Brohl, S. Sindiri, D. Catchpoole, T. Badgett, G. Getz, J. Mora, J.R. Anderson, S.X. Skapek, F.G. Barr, M. Meyerson, D.S. Hawkins, and J. Khan. 2014. Comprehensive genomic analysis of rhabdomyosarcoma reveals a landscape of alterations affecting a common genetic axis in fusion-positive and fusionnegative tumors. Cancer Discov. 4:216-231 .
Sorensen, P.H., J.C. Lynch, S.J. Qualman, R. Tirabosco, J.F. Lim, H.M. Maurer, J.A. Bridge, W.M. Crist, T.J. Triche, and F.G. Barr. 2002. PAX3-FKHR and PAX7-FKHR gene fusions are prognostic indicators in alveolar rhabdomyosarcoma: a report from the children's oncology group. J Clin Oncol. 20:2672-2679.
Tapscott, S.J., R.L. Davis, M.J. Thayer, P.F. Cheng, H. Weintraub, and A.B. Lassar. 1988. MyoD1 : a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science. 242:405-411. von Maltzahn, J., A.E. Jones, R.J. Parks, and M.A. Rudnicki. 2013. Pax7 is critical for the normal function of satellite cells in adult skeletal muscle. Proc Natl Acad Sci U S A. 110:16474-16479.
Williamson, D., E. Missiaglia, A. de Reynies, G. Pierron, B. Thuille, G. Palenzuela, K. Thway, D. Orbach, M. Lae, P. Freneaux, K. Pritchard-Jones, O. Oberlin, J. Shipley, and O. Delattre. 2010. Fusion gene-negative alveolar rhabdomyosarcoma is clinically and molecularly indistinguishable from embryonal rhabdomyosarcoma. J Clin Oncol. 28:2151-2158.
Wright, W.E., D.A. Sassoon, and V.K. Lin. 1989. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell. 56:607-617.
Xia, S.J., D.D. Holder, B.R. Pawel, C. Zhang, and F.G. Barr. 2009. High expression of the PAX3- FKHR oncoprotein is required to promote tumorigenesis of human myoblasts. Am J Pathol. 175:2600-2608.
Zhan, S., D.N. Shapiro, and L.J. Helman. 1994. Activation of an imprinted allele of the insulin-like growth factor II gene implicated in rhabdomyosarcoma. J Clin Invest. 94:445-448.
Zibat, A., E. Missiaglia, A. Rosenberger, K. Pritchard-Jones, J. Shipley, H. Hahn, and S. Fulda.
2010. Activation of the hedgehog pathway confers a poor prognosis in embryonal and fusion gene-negative alveolar rhabdomyosarcoma. Oncogene. 29:6323-6330.

Claims

1. A Tricho-Rhino-Phalangeal Syndrome Type I Protein (TRPS1) inhibitor for use in the treatment of a rhabdomyosarcoma, preferably in a human subject.
2. The TRPS1 inhibitor for use according to claim 1 , wherein the rhabdomyosarcoma is an embryonal rhabdomyosarcoma (EMRS).
3. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor reduces TRPS1 levels in rhabdomyosarcoma cells, for example by reducing TRPS1 mRNA transcription or TRPS1 protein translation.
4. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor is a TRPS1 -suppressive oligonucleotide, such as an antisense oligonucleotide, a microRNA (miR), an shRNA, an siRNA, or a guide-RNA in conjunction with an RNA-guided endonuclease, or a nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide, such as an expression plasmid encoding a TRPS1- suppressive oligonucleotide.
5. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor is a self-delivering siRNA.
6. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor comprises or consists of miR-1 .
7. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor inhibits proliferation of rhabdomyosarcoma cells.
8. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor induces myogenic differentiation of rhabdomyosarcoma cells.
9. The TRPS1 inhibitor for use according to the preceding claim, wherein the differentiation of rhabdomyosarcoma cells leads to formation of functional muscle cells.
10. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the rhabdomyosarcoma is associated with TRPS1 expression, which is preferably identified by analyzing rhabdomyosarcoma cells for TRPSI expression.
11 . The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the TRPS1 inhibitor is administered transiently or constantly.
12. The TRPS1 inhibitor for use according to any one of the preceding claims, wherein the treatment further comprises (simultaneous or sequential) administration of one or more other antitumor therapies.
13. A TRPS1-suppressive oligonucleotide for use in the treatment of a rhabdomyosarcoma, preferably a rhabdomyosarcoma associated with TRPS1 expression, wherein the TRPS1- suppressive oligonucleotide is preferably a TRPS1 -specific antisense oligonucleotide, microRNA (miR), shRNA, siRNA, or guide-RNA in conjunction with an RNA-guided endonuclease. A nucleic acid molecule suitable for expression of a TRPS1 -suppressive oligonucleotide for use in the treatment of a rhabdomyosarcoma, preferably a rhabdomyosarcoma associated with TRPS1 expression.
PCT/EP2022/078144 2021-10-08 2022-10-10 Trps1 inhibitor for use in the treatment of rhabdomyosarcoma WO2023057653A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP21201612.5 2021-10-08
EP21201612 2021-10-08

Publications (1)

Publication Number Publication Date
WO2023057653A1 true WO2023057653A1 (en) 2023-04-13

Family

ID=78086302

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2022/078144 WO2023057653A1 (en) 2021-10-08 2022-10-10 Trps1 inhibitor for use in the treatment of rhabdomyosarcoma

Country Status (1)

Country Link
WO (1) WO2023057653A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080051342A1 (en) * 2005-05-27 2008-02-28 Christiano Angela M TRPS1-mediated modulation of hair growth
US20120059159A1 (en) 2009-05-25 2012-03-08 Carola Ponzetto Differentiation therapy for sarcomas
US20140289882A1 (en) * 2011-07-19 2014-09-25 Oregon Health And Science University Compositions and methods for re-programming cells without genetic modification for repairing cartilage damage
CN109609644A (en) 2019-01-21 2019-04-12 上海市东方医院（同济大学附属东方医院） Application of PAX3-FKHR and ACTA1 genes in preventing and treating rhabdomyosarcoma
WO2021101929A1 (en) * 2019-11-18 2021-05-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Inhibitors of histone demethylases (pfi-63 and pfi-90) for the treatment of cancer and for the inhibition of histone demethylase in cells

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080051342A1 (en) * 2005-05-27 2008-02-28 Christiano Angela M TRPS1-mediated modulation of hair growth
US20120059159A1 (en) 2009-05-25 2012-03-08 Carola Ponzetto Differentiation therapy for sarcomas
US20140289882A1 (en) * 2011-07-19 2014-09-25 Oregon Health And Science University Compositions and methods for re-programming cells without genetic modification for repairing cartilage damage
CN109609644A (en) 2019-01-21 2019-04-12 上海市东方医院（同济大学附属东方医院） Application of PAX3-FKHR and ACTA1 genes in preventing and treating rhabdomyosarcoma
WO2021101929A1 (en) * 2019-11-18 2021-05-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Inhibitors of histone demethylases (pfi-63 and pfi-90) for the treatment of cancer and for the inhibition of histone demethylase in cells

Non-Patent Citations (69)

* Cited by examiner, † Cited by third party
Title
"Antibodies: A Laboratory Manual", 8 January 1955, COLD SPRING HARBOR LABORATORY PRESS
"Oligonucleotide Synthesis: A Practical Approach", 1984, IRL PRESS
"Using Antibodies: A Laboratory Manual: Portable Protocol NO", 1999, COLD SPRING HARBOR LABORATORY PRESS
AHRENS, H.E.H. HENZES.C. SCHULERM. SCHMIDTS.S. HUTTNERJ. VON MALTZAHN: "Analyzing Satellite Cell Function During Skeletal Muscle Regeneration by Cardiotoxin Injury and Injection of Self-delivering siRNA In Vivo", J VIS EXP, 2019
ANNAVARAPU, S.R.S. CIALFIC. DOMINICIG.K. KOKAIS. UCCINIS. CECCARELLIH.P. MCDOWELLT.R. HELLIWELL: "Characterization of Wnt/beta-catenin signaling in rhabdomyosarcoma", LAB INVEST, vol. 93, 2013, pages 1090 - 1099
AUSUBEL, F. M. ET AL.: "Current Protocols in Molecular Biology", 1995, JOHN WILEY & SONS
B. ROEJ. CRABTREEA. KAHN: "DNA Isolation and Sequencing: Essential Techniques", 1996, JOHN WILEY & SONS
BARR, F.G.N. GALILIJ. HOLICKJ.A. BIEGELG. ROVERAB.S. EMANUEL: "Rearrangement of the PAX3 paired box gene in the paediatric solid tumour alveolar rhabdomyosarcoma", NAT GENET., vol. 3, 1993, pages 113 - 117
BARRANGOU R ET AL., NAT BIOTECHNOL., vol. 34, no. 9, 8 September 2016 (2016-09-08), pages 933 - 941
BRAUN, T.E. BOBERB. WINTERN. ROSENTHALH.H. ARNOLD: "Myf-6, a new member of the human gene family of myogenic determination factors: evidence for a gene cluster on chromosome 12", EMBO J., vol. 9, 1990, pages 821 - 831, XP002939900
BRAUN, T.G. BUSCHHAUSEN-DENKERE. BOBERE. TANNICHH.H. ARNOLD: "A novel human muscle factor related to but distinct from MyoD1 induces myogenic conversion in 10T1/2 fibroblasts", EMBO J., vol. 8, 1989, pages 701 - 709, XP055699201
CEBRIAN-SERRANO A ET AL., MAMM GENOME, vol. 28, no. 7, 2017, pages 247 - 261
CHANG G T G ET AL: "Proteomic analysis of proteins regulated by TRPS1 transcription factor in DU145 prostate cancer cells", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - PROTEINS & PROTEOMICS, ELSEVIER, NETHERLANDS, vol. 1774, no. 5, 1 May 2007 (2007-05-01), pages 575 - 582, XP023906025, ISSN: 1570-9639, [retrieved on 20070505], DOI: 10.1016/J.BBAPAP.2007.03.011 *
CHANG, G.T.S.C. GAMBLEM. JHAMAIR. WAITC.L. BEVANA.O. BRINKMANN: "Proteomic analysis of proteins regulated by TRPS1 transcription factor in DU145 prostate cancer cells", BIOCHIM BIOPHYS ACTA, vol. 1774, 2007, pages 575 - 582, XP023906025, DOI: 10.1016/j.bbapap.2007.03.011
CONTI, B.K.K. SLEMMONSR. ROTAC.M. LINARDIC: "Recent Insights into Notch Signaling in Embryonal Rhabdomyosarcoma", CURR DRUG TARGETS, vol. 17, 2016, pages 1235 - 1244
CORNELISSEN, L.M.A.P. DRENTHE. VAN DER BURGR. DE BRUIJNC.E.J. PRITCHARDI.J. HUIJBERSW. ZWARTJ. JONKERS: "TRPS1 acts as a context-dependent regulator of mammary epithelial cell growth/differentiation and breast cancer development", GENES DEV, vol. 34, 2020, pages 179 - 193
D. M. J. LILLEYJ. E. DAHLBERG: "Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology", 1992, ACADEMIC PRESS
DAVIS, R.JC.M. D'CRUZM.A. LOVELLJ.A. BIEGELF.G. BARR.: "Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma", CANCER RES., vol. 54, 1994, pages 2869 - 2872
DAVIS, R.L.H. WEINTRAUBA.B. LASSAR: "Expression of a single transfected cDNA converts fibroblasts to myoblasts", CELL, vol. 51, 1987, pages 987 - 1000, XP027461749, DOI: 10.1016/0092-8674(87)90585-X
DEATO, M.D.M.T. MARRT. SOTTEROC. INOUYEP. HUR. TJIAN: "MyoD targets TAF3/TRF3 to activate myogenin transcription", MOL CELL, vol. 32, 2008, pages 96 - 105
DELTCHEVA, E ET AL., NATURE, vol. 471, 2011, pages 602 - 607
EDMONDSON, D.G.E.N. OLSON: "A gene with homology to the myc similarity region of MyoD1 is expressed during myogenesis and is sufficient to activate the muscle differentiation program", GENES DEV, vol. 3, 1989, pages 628 - 640
ELSTER, D.M. TOLLOTK. SCHLEGELMILCHA. ORIA. ROSENWALDE. SAHAIB. VON EYSS: "TRPS1 shapes YAP/TEAD-dependent transcription in breast cancer cells", NAT COMMUN, vol. 9, 2018, pages 3115
ENTERLINE, H.T.R.C. HORN, JR.: "Alveolar rhabdomyosarcoma; a distinctive tumor type", AM J CLIN PATHOL, vol. 29, 1958, pages 356 - 366
FINERAN, PC, VIROLOGY, vol. 434, 2012, pages 202 - 209
GAI, Z.G. ZHOUS. ITOHY. MORIMOTOH. TANISHIMAI. HATAMURAK. UETANIM. ITOY. MURAGAKI: "Trps1 functions downstream of Bmp7 in kidney development", J AM SOC NEPHROL, vol. 20, 2009, pages 2403 - 2411
GARNEAU, JE ET AL., NATURE, vol. 468, 2010, pages 67 - 71
GRYDER, B.EM.E. YOHEH.C. CHOUX. ZHANGJ. MARQUESM. WACHTELB. SCHAEFERN. SENY. SONGA. GUALTIERI: "PAX3-FOX01 Establishes Myogenic Super Enhancers and Confers BET Bromodomain Vulnerability", CANCER DISCOV, vol. 7, 2017, pages 884 - 899
HINTERBERGER, T.J.D.A. SASSOONS.J. RHODESS.F. KONIECZNY: "Expression of the muscle regulatory factor MRF4 during somite and skeletal myofiber development", DEV BIOL, vol. 147, 1991, pages 144 - 156
HORVATH, P ET AL., SCIENCE, vol. 327, 2010, pages 167 - 170
HU, P.K.G. GELESJ.H. PAIKR.A. DEPINHOR. TJIAN: "Codependent activators direct myoblast-specific MyoD transcription", DEV CELL, vol. 15, 2008, pages 534 - 546
HÜTTNER SÖREN S. ET AL: "Sustained TRPS1 expression in embryonal rhabdomyosarcoma promotes tumor growth through suppression of myogenic differentiation", 9TH GSCN CONFERENCE, 6 October 2021 (2021-10-06), XP093018477, Retrieved from the Internet <URL:https://gscn-conferences.org/Portals/2/Documents/Conference_2021/GSCN_Programmheft_2021_complete_web.pdf?ver=2021-09-30-204051-173> *
HUTTNER, S.S.H.E. AHRENSM. SCHMIDTH. HENZEM.J. JUNGS.C. SCHULERJ. VON MALTZAHN: "Isolation and Culture of Individual Myofibers and Their Adjacent Muscle Stem Cells from Aged and Adult Skeletal Muscle", METHODS MOL BIOL, vol. 2045, 2019, pages 25 - 36
JINEK, M ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
KELLER, C.B.R. ARENKIELC.M. COFFINN. EL-BARDEESYR.A. DEPINHOM.R. CAPECCHI.: "Alveolar rhabdomyosarcomas in conditional Pax3:Fkhr mice: cooperativity of Ink4a/ARF and Trp53 loss of function", GENES DEV, vol. 18, 2004, pages 2614 - 2626
LASSAR, A.BR.L. DAVISW.E. WRIGHTT. KADESCHC. MURREA. VORONOVAD. BALTIMOREH. WEINTRAUB: "Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo", CELL, vol. 66, 1991, pages 305 - 315, XP024246396, DOI: 10.1016/0092-8674(91)90620-E
LAZURE, F.D.M. BLACKBURNA.H. CORCHADOK. SAHINYANN. KARAMA. SHARANEKD. NGUYENC. LEPPERH.S. NAJAFABADIT.J. PERKINS: "Myf6/MRF4 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool", EMBO REP, 2020, pages e49499
LI LIHUA ET AL: "Downregulation of microRNAs miR-1, -206 and -29 stabilizes PAX3 and CCND2 expression in rhabdomyosarcoma", vol. 92, no. 4, 1 April 2012 (2012-04-01), The United States and Canadian Academy of Pathology, Inc., pages 571 - 583, XP055907519, ISSN: 0023-6837, Retrieved from the Internet <URL:https://www.nature.com/articles/labinvest201210.pdf> DOI: 10.1038/labinvest.2012.10 *
MACQUARRIE, K.L.Z. YAOJ.M. YOUNGY. CAOS.J. TAPSCOTT: "miR-206 integrates multiple components of differentiation pathways to control the transition from growth to differentiation in rhabdomyosarcoma cells", SKELET MUSCLE, vol. 2, 2012, pages 7, XP021133859, DOI: 10.1186/2044-5040-2-7
MAEDER ML ET AL., MOL THER, vol. 24, no. 3, March 2016 (2016-03-01), pages 430 - 46
MAKAROVA KS ET AL., NAT REV MICROBIOL, vol. 13, no. 11, November 2015 (2015-11-01), pages 722 - 36
MAKAWITA, SM. HOA.D. DURBINP.S. THORNERD. MALKING.R. SOMERS.: "Expression of insulin-like growth factor pathway proteins in rhabdomyosarcoma: IGF-2 expression is associated with translocation-negative tumors", PEDIATR DEV PATHOL., vol. 12, 2009, pages 127 - 135
MARINE IMBERT ET AL.: "Viral Vector-Mediated Antisense Therapy for Genetic Diseases", GENES (BASEL, vol. 8, no. 2, February 2017 (2017-02-01), pages 51
MARTINS, A.S.D. OLMOSE. MISSIAGLIAJ. SHIPLEY.: "Targeting the insulin-like growth factor pathway in rhabdomyosarcomas: rationale and future perspectives", SARCOMA, 2011, pages 209736
MASSARI, M.E.C. MURRE: "Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms", MOL CELL BIOL, vol. 20, 2000, pages 429 - 440
MCKINNELL, I.WJ. ISHIBASHIF. LE GRANDV.G. PUNCHG.C. ADDICKSJ.F. GREENBLATTF.J. DILWORTHM.A. RUDNICKI: "Pax7 activates myogenic genes by recruitment of a histone methyltransferase complex", NAT CELL BIOL, vol. 10, 2008, pages 77 - 84
MINER, J.H.B. WOLD: "Herculin, a fourth member of the MyoD family of myogenic regulatory genes.", PROC NATL ACAD SCI USA., vol. 87, 1990, pages 1089 - 1093
MOHAMED, A.D.A.M. TREMBLAYG.I. MURRAYH. WACKERHAGE: "The Hippo signal transduction pathway in soft tissue sarcomas", BIOCHIM BIOPHYS ACTA, vol. 1856, 2015, pages 121 - 129, XP009508560, DOI: 10.1016/j.bbcan.2015.05.006
MOORE ET AL., METHODS MOL BIOL., vol. 629, 2010, pages 141 - 158
PATTON, R.BR.C. HORN, JR.: "Rhabdomyosarcoma: clinical and pathological features and comparison with human fetal and embryonal skeletal muscle", SURGERY, vol. 52, 1962, pages 572 - 584
PRABHAVATHI B. FERNANDES: "Handbook of Drug Screening, edited by Ramakrishna Seethala", 2001, MARCEL DEKKER
RHODES, S.J.S.F. KONIECZNY: "Identification of MRF4: a new member of the muscle regulatory factor gene family", GENES DEV, vol. 3, 1989, pages 2050 - 2061
RUDZINSKI, E.R.J.R. ANDERSOND.S. HAWKINSS.X. SKAPEKD.M. PARHAML.A. TEOT: "The World Health Organization Classification of Skeletal Muscle Tumors in Pediatric Rhabdomyosarcoma: A Report From the Children's Oncology Group", ARCH PATHOL LAB MED, vol. 139, 2015, pages 1281 - 1287
SAAB, R.S.L. SPUNTS.X. SKAPEK: "Myogenesis and rhabdomyosarcoma the Jekyll and Hyde of skeletal muscle", CURR TOP DEV BIOL, vol. 94, 2011, pages 197 - 234
SAAB, R.S.L. SPUNTS.X. SKAPEK: "Myogenesis and rhabdomyosarcoma the Jekyll and Hyde of skeletal muscle", CURR TOP DEV BIOL., vol. 94, 2011, pages 197 - 234
SEKI, M., R. NISHIMURA, K. YOSHIDA, T. SHIMAMURA, Y. SHIRAISHI, Y. SATO, M. KATO, K. CHIBA, H. TANAKA, N. HOSHINO, G. NAGAE, Y. SH: "Integrated genetic and epigenetic analysis defines novel molecular subgroups in rhabdomyosarcoma", NAT COMMUN, vol. 6, 2015, pages 7557
SHERN, J.F.L. CHENJ. CHMIELECKIJ.S. WEIR. PATIDARM. ROSENBERGL. AMBROGIOD. AUCLAIRJ. WANGY.K. SONG: "Comprehensive genomic analysis of rhabdomyosarcoma reveals a landscape of alterations affecting a common genetic axis in fusion-positive and fusion-negative tumors", CANCER DISCOV, vol. 4, 2014, pages 216 - 231
SKAPEK, S.X.A. FERRARIA.A. GUPTAP.J. LUPOE. BUTLERJ. SHIPLEYF.G. BARRD.S. HAWKINS: "Rhabdomyosarcoma", NAT REV DIS PRIMERS, vol. 5, 2019, pages 1, XP036668611, DOI: 10.1038/s41572-018-0051-2
SORENSEN, P.H.J.C. LYNCHS.J. QUALMANR. TIRABOSCOJ.F. LIMH.M. MAURERJ.A. BRIDGEW.M. CRISTT.J. TRICHEF.G. BARR: "PAX3-FKHR and PAX7-FKHR gene fusions are prognostic indicators in alveolar rhabdomyosarcoma: a report from the children's oncology group", J CLIN ONCOL, vol. 20, 2002, pages 2672 - 2679
TAPSCOTT, S.J.R.L. DAVISM.J. THAYERP.F. CHENGH. WEINTRAUBA.B. LASSAR: "MyoD1: a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts", SCIENCE, vol. 242, 1988, pages 405 - 411, XP055698977, DOI: 10.1126/science.3175662
THOMAS C. ROBERTSROBERT LANGERMATTHEW J. A. WOOD: "Advances in oligonucleotide drug delivery", NATURE REVIEWS DRUG DISCOVERY, vol. 19, 2020, pages 673 - 694, XP037256878, DOI: 10.1038/s41573-020-0075-7
VON MALTZAHN, J.A.E. JONESR.J. PARKSM.A. RUDNICKI: "Pax7 is critical for the normal function of satellite cells in adult skeletal muscle", PROC NATL ACAD SCI USA., vol. 110, 2013, pages 16474 - 16479
WIEDENHEFT, B ET AL., NATURE, vol. 482, 2012, pages 331 - 338
WILLIAMSON, D.E. MISSIAGLIAA. DE REYNIESG. PIERRONB. THUILLEG. PALENZUELAK. THWAYD. ORBACHM. LAEP. FRENEAUX: "Fusion gene-negative alveolar rhabdomyosarcoma is clinically and molecularly indistinguishable from embryonal rhabdomyosarcoma", J CLIN ONCOL, vol. 28, 2010, pages 2151 - 2158
WRIGHT, W.E.D.A. SASSOONV.K. LIN: "Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD", CELL, vol. 56, 1989, pages 607 - 617, XP023884097, DOI: 10.1016/0092-8674(89)90583-7
XIA, S.J.D.D. HOLDERB.R. PAWELC. ZHANGF.G. BARR.: "High expression of the PAX3-FKHR oncoprotein is required to promote tumorigenesis of human myoblasts", AM J PATHOL, vol. 175, 2009, pages 2600 - 2608
YUAN ET AL., NUCL. ACIDS. RES., vol. 32, 2004, pages W130 - W134
ZHAN, S.D.N. SHAPIROL.J. HELMAN: "Activation of an imprinted allele of the insulin-like growth factor II gene implicated in rhabdomyosarcoma", J CLIN INVEST, vol. 94, 1994, pages 445 - 448
ZIBAT, A.E. MISSIAGLIAA. ROSENBERGERK. PRITCHARD-JONESJ. SHIPLEYH. HAHNS. FULDA: "Activation of the hedgehog pathway confers a poor prognosis in embryonal and fusion gene-negative alveolar rhabdomyosarcoma", ONCOGENE, vol. 29, 2010, pages 6323 - 6330, XP037742993, DOI: 10.1038/onc.2010.368

Similar Documents

Publication Publication Date Title
Yang et al. Dysregulation of p53-RBM25-mediated circAMOTL1L biogenesis contributes to prostate cancer progression through the circAMOTL1L-miR-193a-5p-Pcdha pathway
Chen et al. Malat1 regulates myogenic differentiation and muscle regeneration through modulating MyoD transcriptional activity
US10407734B2 (en) Compositions and methods of using transposons
CN106715695B (en) micro-RNAs for therapy and diagnosis and compositions comprising same
Taulli et al. Failure to downregulate the BAF53a subunit of the SWI/SNF chromatin remodeling complex contributes to the differentiation block in rhabdomyosarcoma
JP2019512489A (en) MicroRNA and method of using the same
Liu et al. IGF2BP1 over-expression in skin squamous cell carcinoma cells is essential for cell growth
Guo et al. MiR-302a inhibits the tumorigenicity of ovarian cancer cells by suppression of SDC1
Li et al. Long non-coding RNA LncKdm2b regulates cortical neuronal differentiation by cis-activating Kdm2b
Wang et al. Developmental cytoplasmic-to-nuclear translocation of RNA-binding protein HuR is required for adult neurogenesis
Afrang et al. A critical role for miR-184 in the fate determination of oligodendrocytes
WO2013131000A1 (en) Emt-inducing transcription factors cooperate with sox9
EP3040414B1 (en) Biomolecular group related to cell anti-aging
Ikenaka et al. SMN promotes mitochondrial metabolic maturation during myogenesis by regulating the MYOD-miRNA axis
US11118182B2 (en) Modulators of human KAI1 metastasis suppressor gene, methods and uses thereof
Tamagawa et al. MicroRNA 200b promotes mesenchymal‑to‑epithelial transition in anaplastic thyroid carcinoma
WO2023057653A1 (en) Trps1 inhibitor for use in the treatment of rhabdomyosarcoma
US11965162B2 (en) MicroRNA and inhibitors thereof and methods of treatment
KR102120659B1 (en) Use of microRNA-1236 as a diagnostic marker and therapeutic agent of granulosa cell tumor or Endometrial cancer
US9889141B2 (en) Combined inhibition of the vitamin D receptor and poly(ADP) ribose polymerase (PARP) in the treatment of cancer
Tan et al. Nonsense‐mediated mRNA decay suppresses injury‐induced muscle regeneration via inhibiting MyoD transcriptional activity
Zhu RNA pull-down-confocal nanoscanning (RP-CONA), a novel method for studying RNA/protein interactions in cell extracts that detected potential drugs for Parkinson’s disease targeting RNA/HuR complexes
Tavakoli et al. A critical role for miR-184 in the fate determination of oligodendrocytes.
Lu et al. Long Non-Coding RNA SNHG19 Promotes Breast Cancer Progression by Regulating miR-299-5p
Liu The Role of Mir-218 in Breast Cancer Bone Metastasis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22802535

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE