WO2023056139A9

WO2023056139A9 - Compositions and methods for treating a β-thalassemia disease

Info

Publication number: WO2023056139A9
Application number: PCT/US2022/075341
Authority: WO
Inventors: David I.K. Martin; Mark Dewitt; Mark C. Walters; Wendy J. MAGIS; Saravanabhavan Thangavel; Dario Boffelli
Original assignee: The Regents Of The University Of California; Children's Hospital & Research Center At Oakland
Priority date: 2021-10-01
Filing date: 2022-08-23
Publication date: 2024-03-21
Also published as: WO2023056139A1

Abstract

The present disclosure provides genome editing compositions comprising a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid, wherein the guide nucleic comprises a targeting sequence complementary to a nucleotide sequence in a human beta-globin (HBB) gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene. The present disclosure provides methods of correcting a human beta-globin gene mutation. The present disclosure provides methods and compositions for the treatment of β thalassemia, as well as kits for practicing the same.

Description

COMPOSITIONS AND METHODS FOR TREATING A Β-THALASSEMIA DISEASE CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This patent application claims the benefit of U.S. Provisional Application 63/251,229, filed on October 1, 2021, which application is incorporated herein by reference in its entirety. INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY SUBMITTED [0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “BERK- 450WO_SEQ_LIST” created on August 18, 2022 and having a size of 44 KB. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety. INTRODUCTION [0003] Beta-thalassemia (β‐thalassemia) is fatal genetic anemia caused by any of >300 mutations in or around the human β‐globin gene (HBB). It is endemic in a broad region from the Mediterranean to Southeast Asia, where allele prevalence is >3% in many highly populated countries (for example estimated at 3.9% in India). Treatment of homozygous β‐thalassemia requires frequent transfusions and iron chelation, and provision of optimal therapy to all (or even most) patients is beyond the capacity of many countries; consequently, death in early childhood is a common fate. In highly developed economies, lifetime treatment of the disease is extremely expensive, as well as burdensome to patient and family. A curative and broadly available therapy that would avoid the rigors and expense of the standard medical regimen has long been a goal. SUMMARY [0004] The present disclosure provides genome editing compositions comprising a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid, wherein the guide nucleic comprises a targeting sequence complementary to a nucleotide sequence in a human beta-globin (HBB) gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β- thalassemia-associate mutation in the HBB gene. The present disclosure provides methods of correcting an HBB gene mutation. The present disclosure provides methods and compositions for the treatment of β thalassemia, as well as kits for practicing the same. BRIEF DESCRIPTION OF THE DRAWINGS [0005] FIG.1 depicts a nucleotide sequence of a portion of a wild-type (wt) hemoglobin gene (SEQ ID NO:1); the nucleotide sequence of a hemoglobin gene showing β‐thalassemia mutations (box), the PAM motif (underlined) (SEQ ID NO:2); and the nucleotide sequence of an oligonucleotide donor that corrects the mutations (SEQ ID NO:3). [0006] FIG.2 provides the nucleotide sequence of a hemoglobin gene (SEQ ID NO:4). [0007] FIG.3A-3F provides amino acid sequences of Streptococcus pyogenes Cas9 (FIG.3A) (SEQ ID NO:5) and variants of Streptococcus pyogenes Cas9 (FIG.3B-3F) (SEQ ID NOs:6-10, respectively). [0008] FIG.4 provides an amino acid sequence of Staphylococcus aureus Cas9 (SEQ ID NO:11). [0009] FIG.5A-5C provide amino acid sequences of Francisella tularensis Cpf1 (FIG.5A) (SEQ ID NO:12), Acidaminococcus sp. BV3L6 Cpf1 (FIG.5B) (SEQ ID NO:13), and a variant Cpf1 (FIG. 5C) (SEQ ID NO:14). DEFINITIONS [0010] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, terms “polynucleotide” and “nucleic acid” encompass single-stranded DNA; double-stranded DNA; multi-stranded DNA; single-stranded RNA; double-stranded RNA; multi-stranded RNA; genomic DNA; cDNA; DNA-RNA hybrids; and a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. [0011] By "hybridizable" or “complementary” or “substantially complementary" it is meant that a nucleic acid (e.g. RNA, DNA) comprises a sequence of nucleotides that enables it to non- covalently bind, i.e. form Watson-Crick base pairs and/or G/U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) [DNA, RNA]. In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule (e.g., when a ssRNA target nucleic acid base pairs with a DNA PAM-containing oligonucleotide (also referred to herein as a “PAMmer”), when a DNA target nucleic acid base pairs with a guide RNA, etc.): guanine (G) can also base pair with uracil (U). For example, G/U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. Thus, in the context of this disclosure, a guanine (G) (e.g., of a protein-binding segment (dsRNA duplex) of a guide RNA molecule; of a target nucleic acid base pairing with a guide RNA and/or a PAM-containing oligonucleotide, etc.) is considered complementary to both a uracil (U) and to an adenine (A). For example, when a G/U base-pair can be made at a given nucleotide position of a protein-binding segment (e.g., dsRNA duplex) of a guide RNA molecule, the position is not considered to be non- complementary, but is instead considered to be complementary. [0012] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. complementarity over 35 or fewer, 30 or fewer, 25 or fewer, 22 or fewer, 20 or fewer, or 18 or fewer nucleotides) the position of mismatches can become important (see Sambrook et al., supra, 11.7-11.8). Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more). The temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementation. [0013] It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Exemplary methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). [0014] A “target nucleic acid” or “target segment” as used herein is a polynucleotide (e.g., RNA, DNA) that includes a "target site" or "target sequence." The terms “target site” or “target sequence” are used interchangeably herein to refer to a nucleic acid sequence present in a target nucleic acid to which a targeting segment of a guide RNA will bind, provided sufficient conditions for binding exist; and/or to which a region (segment) of a PAM-containing oligonucleotide (e.g., a specificity segment and/or an orientation segment) will bind. Suitable hybridization conditions include physiological conditions normally present in a cell. For a double stranded target nucleic acid, the strand of the target nucleic acid that is complementary to and hybridizes with the guide RNA is referred to as the “complementary strand”; while the strand of the target nucleic acid that is complementary to the “complementary strand” (and is therefore not complementary to the guide RNA) is referred to as the “noncomplementary strand” or “non-complementary strand”. In cases where the target nucleic acid is a single stranded target nucleic acid (e.g., single stranded DNA (ssDNA), single stranded RNA (ssRNA)), the guide RNA is complementary to and hybridizes with single stranded target nucleic acid. [0015] By “cleavage” it is meant the breakage of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. In certain embodiments, a complex comprising a guide nucleic acid (e.g., a guide RNA) and a Class 2 CRISPR-Cas effector protein is used for targeted cleavage of a single stranded target nucleic acid (e.g., dsDNA or ssDNA). [0016] “Nuclease” and “endonuclease” are used interchangeably herein to mean an enzyme which possesses catalytic activity for nucleic acid cleavage (e.g., ribonuclease activity) (ribonucleic acid cleavage), deoxyribonuclease activity (deoxyribonucleic acid cleavage), etc.). [0017] A nucleic acid molecule that binds to the Class 2 CRISPR effector protein and targets the protein to a specific location within the target nucleic acid is referred to herein as a “guide nucleic acid” (e.g., a guide RNA). A guide nucleic acid comprises two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein-binding segment”). By “segment” it is meant a segment/section/region of a nucleic acid molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule. A segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule. For example, in some cases the guide nucleic acid is one nucleic acid molecule (e.g., a single RNA molecule) and the protein-binding segment therefore comprises a region of that one molecule. In other cases, the protein-binding segment (described below) of a guide nucleic acid includes regions of two separate molecules that are hybridized along a region of complementarity (forming a dsRNA duplex). The definition of “segment,” unless otherwise specifically defined in a particular context, is not limited to a specific number of total base pairs, is not limited to any particular number of base pairs from a given nucleic acid molecule, is not limited to a particular number of separate molecules within a complex, and may include regions of nucleic acid molecules that are of any total length and may or may not include regions with complementarity to other molecules. [0018] In some cases, a subject nucleic acid (e.g., a guide nucleic acid, a nucleic acid comprising a nucleotide sequence encoding a guide nucleic acid; a nucleic acid encoding a Class 2 CRISPR- Cas effector protein; a PAM-containing oligonucleotide, etc.) comprises a modification or sequence (e.g., an additional segment at the 5’ and/or 3’ end) that provides for an additional desirable feature (e.g., modified or regulated stability; subcellular targeting; tracking, e.g., a fluorescent label; a binding site for a protein or protein complex; etc.). Non-limiting examples include: a 5’ cap (e.g., a 7-methylguanylate cap (m7G)); a 3’ polyadenylated tail (i.e., a 3’ poly(A) tail); a ribozyme sequence (e.g. to allow for self-cleavage and release of a mature molecule in a regulated fashion); a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and/or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin)); a modification or sequence that targets the nucleic acid to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.); a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA and/or RNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like); and combinations thereof. [0019] A guide nucleic acid and a Class 2 CRISPR-Cas effector protein form a complex (i.e., bind via non-covalent interactions). The guide nucleic acid provides target specificity to the complex by comprising a nucleotide sequence that is complementary to a sequence of a target nucleic acid. The protein of the complex provides the site-specific activity. In other words, the protein is guided to a target nucleic acid sequence (e.g. a target sequence in a chromosomal nucleic acid) by virtue of its association with the protein-binding segment of the guide nucleic acid. [0020] In some cases, a guide nucleic acid (e.g., a guide RNA) comprises two separate nucleic acid molecules: an “activator” and a “targeter” (see below) and is referred to herein as a “dual guide RNA”, a “double-molecule guide RNA”, a “dual guide RNA”, a “two-molecule guide RNA”, or simply “dgRNA.” In some cases, the guide RNA has an activator and a targeter (as are present in a dual guide RNA), where the activator and targeter are covalently linked to one another (e.g., via intervening nucleotides) and is referred to herein as a “single guide RNA”, a “single- molecule guide RNA,” or a “one-molecule guide RNA.” The term “guide RNA” is inclusive, referring to both dual guide RNAs (dgRNAs) and to single guide RNAs (sgRNAs). In some cases, a guide RNA is a DNA/RNA hybrid molecule. [0021] As used herein, “β thalassemia disease” (BTD) refers to a group of genetic disorders characterized by reduced or absent synthesis of the beta chains of hemoglobin. These disorders include, for example, thalassemia intermedia and thalassemia major (also referred to as “transfusion-dependent β-thalassemia”). BTD is a severe hemoglobinopathy that produces multisystem complications due to reduction of hemoglobin production. The classification of BTD as minor, intermedia or major is based on the mutations present in the HBB gene. BTD is the result of recessive mutations in the HBB gene. HBB gene mutations fall into two categories: deletion forms and non-deletion forms. Deletion of different sizes involving the HBB gene produce different syndromes such as (β^o) or hereditary persistence of fetal hemoglobin syndromes. Non-deletion, in general, involve a single base substitution or small insertions near or upstream of the HBB gene. Mutations can occur in the promoter regions preceding the beta- globin genes, in regions of the gene that contain signals regulating splicing of the gene transcript, in the coding regions of the gene, or in the untranslated portion of the gene transcript. Mutations are characterized as (β^o) if they prevent any formation of β globin chains, mutations are characterized as (β⁺) if they allow some β globin chain formation to occur. β Thalassemia minor is characterized by the heterozygous form (β⁺/ β or β^o/β) wherein only one of HBB alleles bears a mutation. Individuals with β-thalassemia minor have mild microcytic anemia. Detection usually involves lower than normal mean corpuscular volume value (<80 fL). Individuals that are diagnosed as β thalassemia intermedia can often manage a normal life but may need occasional transfusions, e.g., at times of illness or pregnancy, depending on the severity of their anemia and have the genetic background of β⁺/ β⁺ or β^o/β⁺. β thalassemia major is characterized by the individual carrying a mutation on each copy of the gene (β⁺/β⁺, β⁺/ β^o, or β^o/β^o) wherein there is a severe microcytic, hypochromic anemia which if left untreated causes splenomegaly and severe bone deformities from marrow expansion, and death from anemia and its complications. The untreated individual may progress to death before age 1 (1 year of age). [0022] Individuals with β Thalassemia may also have a hemoglobin E (HbE) allele. HbE alleles carry a single point mutation within the HBB gene, and produce a variant hemoglobin in which the β chain carries an amino acid change. At position 79 of the nucleic acid sequence of the HBB gene there is a point mutation from a GAG→AAG resulting in a change in the amino acid sequence from a glutamic acid to a lysine (E26K). The HbE mutation affects beta-globin gene expression, creating an alternate splicing site in the mRNA at codons 25-27 of the beta-globin gene. Through this mechanism, there is a moderate deficiency in normal beta-globin mRNA, and production of small amounts of anomalous beta-globin mRNA, which lead to reduced synthesis of the β chain of hemoglobin. Individuals that have both a HbE allele and a BTD-associated mutation have HbE/β Thalassemia which is considered a severe disease characterized by the same disease processes as BTD. [0023] As used herein, “stem cell mobilization agent” refers to any agent that facilitates or enhances the mobilization of hematopoietic stem/progenitor cells (HSPCs), e.g., from the bone marrow (BM) to the peripheral blood (PB). The mobilized HSPCs may be removed from the blood, preserved, frozen, and stored until the time of genetic manipulation, transplant, or reinfusion. As used herein, the term “hematopoietic stem/progenitor cells” refers to a heterogeneous population of cells including hematopoietic progenitor cells and hematopoietic stem cells. It is also contemplated herein that hematopoietic stem cells and/or hematopoietic progenitor cells are isolated and expanded ex vivo prior to transplantation. [0024] As used herein, the term “hematopoietic progenitor cells” encompasses pluripotent cells capable of differentiating into several cell types of the hematopoietic system, including, but not limited to, granulocytes, monocytes, erythrocytes, megakaryocytes, B-cells and T-cells. Hematopoietic progenitor cells are committed to differentiate into one or more of several hematopoietic cell lineages and generally do not self-renew. The term “hematopoietic progenitor cells” encompasses short term hematopoietic stem cells (ST-HSCs), multi-potent progenitor cells (MPPs), common myeloid progenitor cells (CMPs), granulocyte-monocyte progenitor cells (GMPs), and megakaryocyte-erythrocyte progenitor cells (MEPs). The term “hematopoietic progenitor cells” does not encompass hematopoietic stem cells capable of self-renewal (herein referred to as “hematopoietic stem cells”). The presence of hematopoietic progenitor cells can be determined functionally as colony forming unit cells (CFU-Cs) in complete methylcellulose assays, or phenotypically through the detection of cell surface markers using assays known to those of skill in the art. [0025] As used herein, the term “hematopoietic stem cell (HSC)” refers to a cell with multi-lineage hematopoietic differentiation potential and sustained self-renewal activity. “Self renewal” refers to the ability of a cell to divide and generate at least one daughter cell with the identical (e.g., self-renewing) characteristics of the parent cell. The second daughter cell may commit to a particular differentiation pathway. For example, a self-renewing hematopoietic stem cell divides and forms one daughter stem cell and another daughter cell committed to differentiation in the myeloid or lymphoid pathway. A committed progenitor cell has typically lost the self-renewal capacity, and upon cell division produces two daughter cells that display a more differentiated (i.e., restricted) phenotype. Hematopoietic stem cells have the ability to regenerate long term multi-lineage hematopoiesis (e.g., “long-term engraftment”) in individuals receiving a bone marrow or cord blood transplant. The hematopoietic stem cells used may be derived from any one or more of the following sources: fetal tissues, cord blood, bone marrow, peripheral blood, mobilized peripheral blood, and a stem cell line. Cells may be sorted, fractionated, treated to remove malignant cells, or otherwise manipulated (e.g., ex vivo) to treat the patient using any procedure acceptable to those skilled in the art of preparing cells for transplantation. If the cells used are derived from an immortalized stem cell line, further advantages would be realized in the ease of obtaining and preparation of cells in adequate quantities. [0026] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. [0027] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. [0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. [0029] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a HBB gene mutation” includes a plurality of such mutations and reference to “the genome editing composition” includes reference to one or more genome editing compositions and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation. [0030] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein. [0031] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. DETAILED DESCRIPTION [0032] The present disclosure provides a genome editing composition comprising a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid, wherein the guide nucleic comprises a targeting sequence complementary to a nucleotide sequence in a human beta-globin (HBB) gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β- thalassemia-associate mutation in the HBB gene. The present disclosure provides methods of correcting a human beta-globin gene mutation. The present disclosure provides methods and compositions for the treatment of β thalassemia, as well as kits for practicing the same. GENOME EDITING COMPOSITIONS [0033] The present disclosure provides compositions comprising a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide RNA, wherein the guide RNA comprises a sequence complementary to a nucleotide sequence in a human beta-globin (HBB) gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene. Gene editing polypeptides [0034] Any of a number of gene-editing polypeptides can be included in a composition of the present disclosure. Suitable gene-editing polypeptides include, e.g., Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR), Transcription activator-like effector nucleases (TALENs), and zinc finger nucleases (ZFN). [0035] Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are customizable DNA-binding proteins that comprise DNA-modifying enzymes. Both can be designed and targeted to specific sequences in a variety of organisms (Esvelt and Wang, Mol Syst Biol. (2013) 9: 641, which is incorporated by reference in its entirety). ZFNs and TALENs can be used to introduce a broad range of genetic modifications by inducing DNA double-strand breaks that stimulate error-prone nonhomologous end joining or homology-directed repair at specific genomic locations. The versatility of ZFNs and TALENs arises from the ability to customize the DNA-binding domain to recognize virtually any sequence. These DNA-binding modules can be combined with numerous effector domains to affect genomic structure and function, including nucleases, transcriptional activators and repressors, recombinases, transposases, DNA and histone methyltransferases, and histone acetyltransferases. Thus, the ability to execute genetic alterations depends largely on the DNA-binding specificity and affinity of designed zinc finger and TALEN proteins (Gaj et al., Trends in Biotechnology, (2013) 31(7):397-405). The following U.S. granted patents, incorporated by reference, describe the use of ZFNs and TALENs in mammalian cells, U.S. Pat. Nos.8,685,737 and 8,697,853. A megaTAL polypeptide can comprise a TALE DNA binding domain and an engineered meganuclease. See, e.g., WO 2004/067736 (homing endonuclease); Urnov et al. (2005) Nature 435:646 (ZFN); Mussolino et al. (2011) Nucle. Acids Res.39:9283 (TALE nuclease); Boissel et al. (2013) Nucl. Acids Res.42:2591 (MegaTAL). CRISPR-Cas effector polypeptides [0036] CRISPR-Cas effector polypeptides are suitable gene-editing polypeptides. A CRISPR-Cas effector polypeptide suitable for inclusion in a composition of the present disclosure is a class 2 CRISPR effector polypeptide, also referred to herein as a class 2 CRISPR-Cas effector polypeptide. For example, in some cases, the CRISPR/Cas effector polypeptide is a type II CRISPR/Cas effector polypeptide. In some cases, the type II CRISPR/Cas effector polypeptide is a Cas9 polypeptide. In some cases, the CRISPR/Cas effector polypeptide is a type V CRISPR/Cas effector polypeptide, e.g., a Cas12a, a Cas12b, a Cas12c, a Cas12d, or a Cas12e polypeptide. In some cases, the CRISPR/Cas effector polypeptide is a type VI CRISPR/Cas effector polypeptide, e.g., a Cas13a polypeptide, a Cas13b polypeptide, a Cas13c polypeptide, or a Cas13d polypeptide. In some cases, the CRISPR/Cas effector polypeptide is a Cas14 polypeptide. In some cases, the CRISPR/Cas effector polypeptide is a Cas14a polypeptide, a Cas14b polypeptide, or a Cas14c polypeptide. [0037] In some cases, a CRISPR-Cas effector polypeptide suitable for inclusion in a composition of the present disclosure is a Cas9 polypeptide. In some cases, a Cas9 polypeptide comprises an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more than 99%, amino acid sequence identity to the Streptococcus pyogenes Cas9 depicted in FIG.3A. In some cases, a Cas9 polypeptide comprises the amino acid sequence depicted in one of FIG.3A-3F. [0038] In some cases, the Cas9 polypeptide is a Staphylococcus aureus Cas9 (saCas9) polypeptide. In some cases, the saCas9 polypeptide comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, amino acid sequence identity to the saCas9 amino acid sequence depicted in FIG.4. [0039] In some cases, a suitable Cas9 polypeptide is a high-fidelity (HF) Cas9 polypeptide. Kleinstiver et al. (2016) Nature 529:490. For example, amino acids N497, R661, Q695, and Q926 of the amino acid sequence depicted in FIG.3A are substituted, e.g., with alanine. For example, an HF Cas9 polypeptide can comprise an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100%, amino acid sequence identity to the amino acid sequence depicted in FIG.3A, where amino acids N497, R661, Q695, and Q926 are substituted, e.g., with alanine. In some cases, a suitable Cas9 polypeptide exhibits altered PAM specificity. See, e.g., Kleinstiver et al. (2015) Nature 523:481. [0040] In some cases, a suitable CRISPR/Cas effector polypeptide is a type V CRISPR/Cas effector polypeptide. In some cases, a type V CRISPR/Cas effector polypeptide is a Cpf1 protein. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpf1 amino acid sequence depicted in FIG.5A, FIG.5B, or FIG. 5C. CRISPR-Cas guide nucleic acids [0041] As noted above, a composition of the present disclosure comprises an RNP complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid, wherein the guide nucleic comprises a targeting sequence complementary to a nucleotide sequence in an HBB gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associated mutation in the HBB gene. [0042] A nucleic acid that binds to a class 2 CRISPR-Cas endonuclease (e.g., a type II, a type V, or a type VI CRISPR-Cas protein) and targets the complex to a specific location within a target nucleic acid is referred to herein as a guide nucleic acid (e.g., a “guide RNA” or “CRISPR-Cas guide nucleic acid” or “CRISPR-Cas guide RNA”) A guide nucleic acid provides target specificity to the complex (the RNP complex) by including a targeting segment, which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid. [0043] A guide nucleic acid (can be said to include two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein-binding segment”). By “segment” it is meant a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule. A segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule. The “targeting segment” is also referred to herein as a “variable region” of a guide RNA. The “protein-binding segment” is also referred to herein as a “constant region” of a guide RNA. In some cases, the guide RNA is a Cas9 guide RNA. [0044] A targeting segment of a guide nucleic acid comprises a guide sequence. The “guide sequence” (also referred to as the “targeting sequence”) can be modified so that the guide RNA can target a CRISPR/Cas effector polypeptide to any desired sequence of any desired target nucleic acid, with the exception that the protospacer adjacent motif (PAM) sequence can be taken into account. A guide nucleic acid suitable for inclusion in a composition of the present disclosure comprises a targeting sequence complementary to a nucleotide sequence in an HBB gene, where the nucleotide sequence in the HBB gene comprises one or more β-thalassemia-associated mutations. [0045] In some cases, the guide RNA is a single-molecule (or “single guide”) guide RNA (an “sgRNA”). In some cases, the guide RNA is a dual-molecule (or “dual-guide”) guide RNA (“dgRNA”). [0046] In some cases, a guide nucleic acid (e.g., a sgRNA) has a total length of from 35 nucleotides (nt) to 150 nt. In some cases, a guide nucleic acid (e.g., a sgRNA) has a total length of from 35 nt to 40 nt, from 40 nt to 45 nt, from 45 nt to 50 nt, from 50 nt to 60 nt, from 60 nt to 70 nt, from 70 nt to 80 nt, from 80 nt to 90 nt, from 90 nt to 100 nt, from 100 nt to 125 nt, or from 125 nt to 150 nt. [0047] The targeting segment of a guide nucleic acid (e.g., a sgRNA) can have a length of 7 or more nucleotides (nt) (e.g., 8 or more, 9 or more, 10 or more, 12 or more, 15 or more, 20 or more, 25 or more, 30 or more, or 40 or more nucleotides). In some cases, the targeting segment can have a length of from 7 to 100 nucleotides (nt) (e.g., from 7 to 80 nt, from 7 to 60 nt, from 7 to 40 nt, from 7 to 30 nt, from 7 to 25 nt, from 7 to 22 nt, from 7 to 20 nt, from 7 to 18 nt, from 8 to 80 nt, from 8 to 60 nt, from 8 to 40 nt, from 8 to 30 nt, from 8 to 25 nt, from 8 to 22 nt, from 8 to 20 nt, from 8 to 18 nt, from 10 to 100 nt, from 10 to 80 nt, from 10 to 60 nt, from 10 to 40 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 10 to 18 nt, from 12 to 100 nt, from 12 to 80 nt, from 12 to 60 nt, from 12 to 40 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 12 to 18 nt, from 14 to 100 nt, from 14 to 80 nt, from 14 to 60 nt, from 14 to 40 nt, from 14 to 30 nt, from 14 to 25 nt, from 14 to 22 nt, from 14 to 20 nt, from 14 to 18 nt, from 16 to 100 nt, from 16 to 80 nt, from 16 to 60 nt, from 16 to 40 nt, from 16 to 30 nt, from 16 to 25 nt, from 16 to 22 nt, from 16 to 20 nt, from 16 to 18 nt, from 18 to 100 nt, from 18 to 80 nt, from 18 to 60 nt, from 18 to 40 nt, from 18 to 30 nt, from 18 to 25 nt, from 18 to 22 nt, or from 18 to 20 nt). [0048] In some cases, a guide nucleic acid suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that hybridizes with a contiguous stretch of from about 7 nucleotides (nt) to about 50 nt (e.g, 7 nt, 8, nt, 9 nt, 10 nt, from 10 nt to 15 nt, from 15 nt to 20 nt, from 20 nt to 25 nt, from 25 nt to 30 nt, from 30 nt to 35 nt, from 35 nt to 40 nt, form 40 nt to 45 nt, or from 45 nt to 50 nt) of the HBB nucleotide sequence depicted in FIG.2, or the complement thereof. [0049] For example, in some cases, guide nucleic acid suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that hybridizes with a contiguous stretch of from about 7 nucleotides (nt) to about 50 nt (e.g, 7 nt, 8, nt, 9 nt, 10 nt, from 10 nt to 15 nt, from 15 nt to 20 nt, from 20 nt to 25 nt, from 25 nt to 30 nt, from 30 nt to 35 nt, from 35 nt to 40 nt, form 40 nt to 45 nt, or from 45 nt to 50 nt) of nucleotides 71 to 210 of the HBB nucleotide sequence depicted in FIG.2, or the complement thereof. [0050] In some cases, the guide RNA comprises the following nucleotide sequence: CGUGGAUGAAGUUGGUGGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:15). Donor nucleic acid [0051] A donor nucleic acid suitable for inclusion in a composition of the present disclosure is a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene. [0052] By a “donor nucleic acid” or “donor sequence” or “donor polynucleotide” or “donor template” it is meant a nucleic acid sequence to be inserted at the site cleaved by a CRISPR/Cas effector protein (e.g., after dsDNA cleavage, after nicking a target DNA, after dual nicking a target DNA, and the like). The donor polynucleotide can contain sufficient homology to a genomic sequence at the target site, e.g.70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequences flanking the target site, e.g. within about 50 bases or less of the target site, e.g. within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the target site, to support homology-directed repair between it and the genomic sequence to which it bears homology. Approximately 25, 50, 100, or 200 nucleotides, or more than 200 nucleotides, of sequence homology between a donor and a genomic sequence (or any integral value between 10 and 200 nucleotides, or more) can support homology-directed repair. Donor polynucleotides can be of any length, e.g.10 nucleotides or more, 50 nucleotides or more, 100 nucleotides or more, 250 nucleotides or more, 500 nucleotides or more, 1000 nucleotides or more, 5000 nucleotides or more, etc. [0053] The donor sequence is typically not identical to the genomic sequence that it replaces. Rather, the donor sequence may contain at least one or more single base changes, insertions, deletions, inversions or rearrangements with respect to the genomic sequence, so long as sufficient homology is present to support homology-directed repair (e.g., for gene correction, e.g., to convert a disease-causing base pair or a non disease-causing base pair). [0054] In some cases, the donor template DNA oligonucleotide has a length of from 50 nucleotides to 100 nucleotides. In some cases, the donor template DNA oligonucleotide has a length of from 50 nucleotides (nt) to 60 nt, from 60 nt to 70 nt, from 70 nt to 80 nt, form 80 nt to 90 nt, or from 90 nt to 100 nt. [0055] In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects a single β-thalassemia disease-associated mutation. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects two different β-thalassemia disease-associated mutations. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects three different β-thalassemia disease-associated mutations. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects four different β-thalassemia disease-associated mutations. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects one or more of the mutations depicted in Table 1, below. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects two or more of the mutations depicted in Table 1, below. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects three or more of the mutations depicted in Table 1, below. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects four or more of the mutations depicted in Table 1, below. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure comprises a nucleotide sequence that corrects the IVS I-1 (G>T) mutation, the IVS I-5 (G>C) mutation, and an HbE (CD26) mutation. In some cases, a donor template DNA oligonucleotide suitable for inclusion in a composition of the present disclosure does not include a nucleotide sequence that corrects a sickle cell disease-associated mutation. [0056] In some cases, the donor template DNA oligonucleotide has the nucleotide sequence depicted in FIG.1 and designated “ssODN”. [0057] In some cases, the donor template DNA oligonucleotide has the following nucleotide sequence 5’- CAAGAGTCTTCTCTGTCTCCACATGCCCAGTTTCTATTGGTCTCCTTAAACCTGTCTT GTAACCTTGATACCAACCTGCCCAGGGCTTCACCACCAACTTCATCCACGTTCACCT TGCCCCACAGGGC-3’ (SEQ ID NO:16). [0058] In some cases, the donor template DNA oligonucleotide alters a protospacer adjacent motif (PAM) thereby preventing re-cleavage of target nucleic acids that include the endogenous PAM sequence. In such instances, an HSC that has an allele that has been corrected for a β- thalassemia-disease-associated mutation in an HBB gene cannot be re-cleaved. In some cases, the donor template DNA oligonucleotide specifically prevents CRISPR-Cas effector polypeptide-mediated re-cleavage of a corrected HBB gene mutation using the same guide RNA. For example, where the endogenous PAM sequence is GAG or GAGG, the above-noted donor template DNA oligonucleotide modifies the PAM sequence. HSPCs [0059] In some cases, a composition of the present disclosure comprises: a) a RNP complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide RNA, wherein the guide RNA comprises a sequence complementary to a nucleotide sequence in an HBB gene; b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene; and c) HSPCs. The HSPCs can be obtained from an individual having a β-thalassemia disease. Such a composition can include from 10² to 10⁸ HSPCs. For example, in some cases, a composition of the present disclosure comprises from 10² to 10³, from 10³ to 10⁴, from 10⁴ to 10⁵, from 10⁵ to 10⁶, from 10⁶ to 10⁷, or from 10⁷ to 10⁸ HSPCs. Other components [0060] A composition of the present disclosure can comprise (in addition to: a) a RNP complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide RNA, wherein the guide RNA comprises a sequence complementary to a nucleotide sequence in an HBB gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene) one or more of: a salt, e.g., NaCl, MgCl₂, KCl, MgSO₄, etc.; a buffering agent, e.g., a Tris buffer, N-(2- Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N- Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N-tris[Hydroxymethyl]methyl-3- aminopropanesulfonic acid (TAPS), etc.; a solubilizing agent; a detergent, e.g., a non-ionic detergent such as Tween-20, etc.; a protease inhibitor; glycerol; and the like. [0061] The composition may comprise a pharmaceutically acceptable excipient, a variety of which are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been amply described in a variety of publications, including, for example, “Remington: The Science and Practice of Pharmacy”, 19^th Ed. (1995), or latest edition, Mack Publishing Co; A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., eds 7^th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3^rd ed. Amer. Pharmaceutical Assoc. [0062] The genome editing compositions may comprise other components, such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, glucose, sucrose, magnesium, carbonate, and the like. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, hydrochloride, sulfate salts, solvates (e.g., mixed ionic salts, water, organics), hydrates (e.g., water), and the like. M^{ETHODS OF} M^{ODIFYING A} H^{UMAN BETA}-^GLOBIN G^ENE [0063] The present disclosure provides a method of correcting a β-thalassemia disease (BTD)- associated mutation in an HBB gene in the genome of a hematopoietic stem cell (HSC). The method generally involves contacting a starting population of HSCs in vitro with a composition of the present disclosure (e.g., a composition comprising: a) a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; and ii) a guide RNA wherein the guide RNA comprises a sequence complementary to a nucleotide sequence in an HBB gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction of at least one β-thalassemia-associated mutation in the HBB gene), thereby generating an in vitro corrected population of HSCs comprising at least one corrected BTD-associated HBB gene mutation. The starting population of HSCs are obtained from an individual having a beta-thalassemia disease-associated mutation in an HBB gene. [0064] In some cases, at least 5%, e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more than 90%, of the HSCs in the corrected population of HSCs comprises at least one HBB allele having a corrected BTD-associated mutation, e.g., where the corrected BTD-associated mutation (corrected HBB allele) provides for production of functional hemoglobin at functional levels. As used herein, the terms “corrected” and “edited” are used interchangeably. As used herein, the terms “human beta-globin gene” may be used interchangeably with “human beta-globin allele.” In some cases, an HBB allele comprises a β thalassemia mutation, referred to herein as “a β thalassemia allele” or “BTD allele.” A “corrected BTD allele” or “corrected HBB allele” refers to an HBB allele in which one or more BTD- associated mutations have been corrected, such that the one or more BTD-associated mutation(s) are no longer present in the allele. A “corrected BTD-associated mutation” may be used interchangeably with “a corrected HBB allele.” An HBB allele comprising a corrected BTD allele may refer to an HBB allele comprising a corrected BTD-associated mutation or an HBB allele having no BTD-associated mutations. A corrected HBB allele can provide for production of functional hemoglobin and/or production of functional hemoglobin at functional levels. [0065] The starting population of cells can be HSPCs that comprise HSCs. Thus, in some cases, a subject method comprises contacting a starting population of HPSCs in vitro with a composition of the present disclosure (e.g., a composition comprising: a) an RNP complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; and ii) a guide RNA wherein the guide RNA comprises a sequence complementary to a nucleotide sequence in an HBB gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction of at least one β-thalassemia-associated mutation in the HBB gene), thereby generating an in vitro corrected population of HSPCs comprising at least one corrected BTD- associated HBB gene mutation. [0066] In some cases, at least 5%, e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more than 90%, of the HSPCs in the corrected population of HSPCs comprises at least one HBB allele having a corrected BTD-associated mutation, e.g., where the corrected BTD-associated mutation (corrected HBB allele) provides for production of functional hemoglobin at functional levels. [0067] Aspects of the methods include obtaining HSCs (e.g., obtaining a population of HSPCs that comprise HSCs) from an individual having an HBB gene comprising one or more BTD- associated mutations. In some cases, the HSPCs comprise human CD34⁺ stem and progenitor cells. Various BTD-associated mutations may be suitable for editing (correction) using the subject methods. Suitable BTD-associated mutations are set out in Tables 1 and 2, below. In some cases, the BTD-associated mutation is a G to T, a G to A, or a G to C substitution at InterVening Sequence (IVS) I-1 of the HBB gene. In some cases, the BTD-associated mutation is a G to T, a G to A, or a G to C substitution at IVS I-5 of the HBB gene. In some cases, the HSCs are obtained from an individual who is homozygous for a BTD-associated mutation. In some cases, HSPCs are obtained from an individual who is heterozygous for a BTD-associated mutation. In some cases, the HSPCs are obtained from an individual who has a HbE allele in addition to having a BTD-associated mutation. [0068] Table 1: Non-limiting example mutations that are correctable using the methods disclosed herein. Table 1

IVS = InterVening Sequence; CD = Codon [0069] Table 2 Non-deletional HBB mutations associated with β thalassemia

[0070] In addition to the BTD-associated mutations listed above, other BTD-associated may be corrected using a method of the present disclosure. Examples of other BTD-associated mutations that may be corrected using the methods disclosed herein are found within relevant databases. Examples of relevant databases that contain BTD-associated mutations, include without limitation, the IthaGenes database disclosed in Kountouris et al. PLoS One.2014; 9(7): e103020, the HBVAR database disclosed in Hum Mutat.2002 Mar;19(3):225-33, etc. [0071] In some cases, a method of the present disclosure comprises contacting a starting population of HSCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSCs comprising at least one corrected BTD-associated HBB gene mutation. In some cases, a method of the present disclosure comprises: a) obtaining a sample from an individual having a BTD-associated mutation in an HBB allele, where the sample comprises a starting population of HSCs; and b) contacting the starting population of HSCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSCs comprising at least one corrected BTD-associated HBB gene mutation. [0072] In some cases, a method of the present disclosure comprises contacting a starting population of HSPCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSPCs comprising at least one corrected BTD-associated HBB gene mutation. In some cases, a method of the present disclosure comprises: a) obtaining a sample from an individual having a BTD-associated mutation in an HBB allele, where the sample comprises a starting population of HSPCs; and b) contacting the starting population of HSPCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSPCs comprising at least one corrected BTD-associated HBB gene mutation. [0073] In some cases, a method of the present disclosure comprises, before the contacting step, administering stem cell mobilization agent to an individual having a BTD-associated mutation in an HBB allele. Thus, in some cases, a method of the present disclosure comprises: a) administering a stem cell mobilization agent to an individual having a BTD-associated mutation in an HBB allele; and b) contacting a starting population of HSCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSCs comprising at least one corrected BTD-associated HBB gene mutation, where the starting population of HSCs is obtained from the individual. In some cases, a method of the present disclosure comprises: a) administering a stem cell mobilization agent to an individual having a BTD-associated mutation in an HBB allele; b) obtaining a sample from the individual, where the sample comprises a starting population of HSCs; and c) contacting the starting population of HSCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSCs comprising at least one corrected BTD-associated HBB gene mutation. [0074] In some cases, a method of the present disclosure comprises, before the contacting step, administering stem cell mobilization agent to an individual having a BTD-associated mutation in an HBB allele. Thus, in some cases, a method of the present disclosure comprises: a) administering a stem cell mobilization agent to an individual having a BTD-associated mutation in an HBB allele; and b) contacting a starting population of HSPCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSPCs comprising at least one corrected BTD-associated HBB gene mutation, where the starting population of HSPCs is obtained from the individual. In some cases, a method of the present disclosure comprises: a) administering a stem cell mobilization agent to an individual having a BTD-associated mutation in an HBB allele; b) obtaining a sample from the individual, where the sample comprises a starting population of HSCs; and c) contacting the starting population of HSPCs in vitro with a composition of the present disclosure, thereby generating an in vitro corrected population of HSPCs comprising at least one corrected BTD-associated HBB gene mutation. [0075] The stem cell mobilization agent may be used to increase the number of HSCs in a sample obtained from the individual. In some cases, the HSCs may comprise CD34⁺ HSPCs. In some cases, the stem cell mobilization agent is a small molecule. In some instances, the stem cell mobilization agent is a cytokine. Suitable stem cell mobilization agents include, but are not limited to, AMD3465, NIBR 1816, TG-0054, G-CSF, GM-CSF, SDF- 1, and SCF. In some cases, the stem cell mobilization agent is plerixafor. Plerixafor is a macrocyclic compound and a bicyclam derivative having the structure:

Structure 1 1,4-Bis((1,4,8,11-tetraazacyclotetradecan-1-yl)methyl)benzene [0076] An effective amount of the stem cell mobilization agent can vary and may depend on the stem cell mobilization agent. In some cases, an effective amount is the amount effective to mobilize from about 10⁵ CD34⁺ HSPCs to about 10⁸ CD34⁺ HSPCs. Where the stem cell mobilization agent is plerixafor, an effective amount to mobilize the requisite amount of CD34⁺ HSPCs can range from about 200 μg to about 300 μg (e.g., from about 200 μg to about 220 μg, from about 220 μg to about 240 µg, from about 240 μg to about 250 μg, or from about 250 μg to about 300 μg. In some cases, 240 μg plerixafor is administered to an individual by a subcutaneous injection 5 – 10 hours before HSPC harvesting by apheresis. In some cases, the target yield for this procedure is 10 x 10⁶ CD34⁺ cells/kg recipient weight. In some cases, the apheresis procedure is performed for up to 2 consecutive days. In some cases, an effective amount is the amount effective to mobilize from about 10⁵ HSPCs to 10⁸ HSPCs, such as, e.g., from 10⁵ to 10⁶ HSPCs, from 10⁶ to 10⁷ HSPCs, from 10⁷ to 10⁸ HSPCs, or more than 10⁸ HSPCs. The mobilized stem cells may be collected, thereby generating an in vitro population of CD34⁺ HSPCs. The in vitro population of HSPCs can include from 10⁵ to 10⁸ cells such as, e.g., from 10⁵ to 10⁶ cells, from 10⁶ to 10⁷ cells, from 10⁷ to 10⁸ cells, or more than 10⁸ cells. The in vitro population of CD34⁺ HSPCs may be cultured for a period of time before the population is contacted with a genome editing composition, as described below. In some cases, the in vitro population of unedited HSPCs may be cultured for 1 hour (hr) to 80 hours (hrs) such as, e.g., for 1 hr to 72 hrs, for 1 hr to 48 hrs, for 1 hr to 24 hrs, for 1 hr to 10 hrs, for 1 hr to 5 hrs, or for 1 hr to 2 hrs. The culture media may include the following: growth factors, cytokines, adhesion mediators, minerals, among other factors. Additional culture parameters that may be suitable are described in Frisch, B. J., & Calvi, L. M. (2014). Hematopoietic Stem Cell Cultures and Assays. Methods in Molecular Biology (Clifton, N.J.), 1130, 315–324.; Potter, H., & Heller, R. (2003). Transfection by Electroporation. Current Protocols in Molecular Biology / Edited by Frederick M. Ausubel et al., CHAPTER, Unit–9.3. _[0077] The in vitro population of CD34⁺ HSPCs may be isolated or purified from a sample by any known method. In certain embodiments, the HSPCs may be magnetically labeled and separated from a sample with use of a magnetic field generated by a magnetic field source, e.g., a permanent magnet or an electromagnet. The HSPCs may be labeled with magnetic particles such as, e.g., ferromagnetic, superparamagnetic or paramagnetic solid phases such as colloidal particles, microspheres, nanoparticles, or beads. The particles may be used in suspension or in a lyophilized state. In certain embodiments, the magnetically labeled cells are separated from a sample in a magnetic activated cell separation (MACS^®) system. The technique of magnetic activated cell sorting can involve coupling a cell surface with magnetic particles the size of cellular macromolecules. The cells may be passed through a magnetizable matrix in a strong magnetic field. Labeled cells may stick to the matrix and can be separated form unlabeled cells, which flow through. The magnetic labeled cells can be eluted when the column is demagnetized by removal from the magnetic field. In some instances, the system includes a magnetic separator, i.e., an apparatus containing one or magnets, e.g., one or more permanent magnets, and configured to hold one or more magnetic separation columns. The separation columns for use with the magnetic separator include columns that may be filled with a paramagnetic material, e.g., iron spheres, to amplify the magnetic field of the magnetic separator. The magnetic field retains magnetically labeled cells that pass through the column placed in a separator. In some instances, the separator may be a MACS separator, e.g., CliniMACS^® separator, MiniMACS^TM separator, MidiMACS^TM separator, etc. In some instances, the column may be a MACS column, e.g., MACS^® MS column, MACS^® LS Column, etc. [0078] Aspects of the methods include contacting the in vitro population of CD34⁺ HSPCs with a genome editing composition of the present disclosure. The number of HSPCs in the in vitro population for contacting with a gene editing composition may range from 10⁵ to 5 x 10⁹ cells such as, e.g., from 10⁵ to 10⁶ cells from 10⁶ to 10⁷ cells, from 10⁷ to 10⁸ cells, from 10⁸ cells to 5 x 10⁸ cells, from 5 x 10⁸ cells to 10⁹ cells, from 10⁹ cells to 2 x 10⁹ cells, or from 2 x 10⁹ cells to 5 x 10⁹ cells. The genome editing composition may include an RNP complex comprising a class 2 CRISPR-Cas effector polypeptide or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide. The RNP complex may further comprise a guide RNA or a nucleic acid comprising a nucleotide sequence encoding the guide RNA. The genome editing composition may further include a donor template DNA oligonucleotide (e.g., a single- stranded donor template DNA oligonucleotide, as described below) comprising a nucleotide sequence that provides for correction of the BTD-associated mutations in the HBB gene. The contacting may include combining, incubating, or mixing the genome editing composition with the in vitro population of CD34⁺ HSPCs. In some cases, the genome editing composition may be introduced into a cell, e.g., an HSPC. The genome editing composition may be introduced into a cell by any known method in the art such as, e.g., electroporation. A class 2 CRISPR effector polypeptide or nucleic acid encoding the class 2 CRISPR effector polypeptide may be introduced inside a cell. [0079] In some cases, the CRISPR-Cas effector polypeptide cleaves 10-30 bp from an HBB gene. For example, the CRISPR-Cas effector polypeptide may cleave from 10-15 bp, 15-20 bp, 20-25 bp, or 25-30 bp from an HBB gene. In some cases, the site of cleavage of the CRISPR-Cas effector polypeptide is located at the site of the HbE mutation. [0080] The in vitro HSC population may be contacted with any suitable amount of the genome editing composition or components of the genome editing composition. In some cases, the amount of the RNP complex ranges from 10 pmol to 150 pmol per 10⁵ cells such as, e.g., from 50 pmol to 125 pmol, from 55 pmol to 120 pmol, from 60 pmol to 115 pmol, from 65 pmol to 110 pmol, from 70 pmol to 100 pmol, or from 75 pmol to 90 pmol per 10⁵ cells. In some cases, the amount of the ssDNA donor template ranges from 10 pmol to 150 pmol per 10⁵ cells such as, e.g., from 60 pmol to 140 pmol, from 70 pmol to 130 pmol, from 80 pmol to 120 pmol, from 90 pmol to 110 pmol, or 100 pmol to 105 pmol per 10⁵ cells. In some cases, e.g., for electroporation, the RNP complex, the ssDNA donor template, and the in vitro HSCs are in a volume of from 1 µL to 30 µL; for example, the volume can range from 1 µL to 25 µL, from 5 µL to 20 µL, or from 10µL to 20 µL. Volumes for clinical-scale gene-editing range from about 1 mL to about 100 mL (e.g., from about 1 mL to about 2 mL, from about 2 mL to about 5 mL, from about 5 mL to about 10 mL, from about 10 mL to about 25 mL, from about 25 mL to about 50 mL, from about 60 mL to about 75 mL, or from about 75 mL to about 100 mL). For example, a gene-editing composition suitable for use in a clinical setting with from about 10⁸ cells to about 10⁹ cells comprises e.g., from about 2 μM to about 5 µM ssDNA donor, from about 2 μM to about 5 µM Cas9, and from about 2 μM to about 5 µM RNA in from 1 mL to about 100 mL (e.g., from about 1 mL to about 2 mL, from about 2 mL to about 5 mL, from about 5 mL to about 10 mL, from about 10 mL to about 25 mL, from about 25 mL to about 50 mL, from about 60 mL to about 75 mL, or from about 75 mL to about 100 mL) of solution. [0081] The contacting may occur under conditions suitable for gene editing to occur, e.g., for enzymatic cleavage to occur, for correction of the BTD-associated mutations to occur, for generation of the in vitro corrected population to occur. In some cases, the contacting occurs after culturing the in vitro population of unedited HSCs. In some cases, the contacting to produce an in vitro corrected population of HSCs occurs for a period of time that is less than 1 hour; for example, the contacting may occur for a period of time that is less than 45 min, less than 30 min, less than 20 min, less than 10 min, less than 5 min, or less than 1 min. In some instances, the contacting occurs at room temperature. A variety of other reagents may be included in the generation of the in vitro corrected population of HSCs. These include reagents such as nuclease inhibitors, protease inhibitors, solubilizing agents, and the like. The mixture of components can be added in any order that provides for the in vitro corrected population of HSCs. In some cases, the in vitro population of unedited HSCs (the “starting population”) is contacted with a gene editing composition and subjected to electroporation. In some cases, a mixture for use in electroporation, i.e., “an electroporation mixture,” includes any suitable electroporation buffer, Cas9 buffer (150 mM KCl, 50 mM HEPES pH 7.5, 10-50% glycerol), and gene editing components (e.g., Cas9 protein, a guide RNA, and an ssDNA HDR donor). In some cases, the volume of the electroporation mixture ranges from 20 µL to 100 µL; for example, the volume of the electroporation mixture can range from 20 µL to 50 µL, from 50 µL to 75 µL, or from 75 µL to 100 µL. In some cases, the volume of the electroporation mixture ranges from 1 mL to about 100 mL (e.g., from about 1 mL to about 2 mL, from about 2 mL to about 5 mL, from about 5 mL to about 10 mL, from about 10 mL to about 25 mL, from about 25 mL to about 50 mL, from about 60 mL to about 75 mL, or from about 75 mL to about 100 mL). Electroporation protocols for introducing gene editing components in cells are well known in the art. See, e.g., Potter, H., & Heller, R. (2003). Transfection by Electroporation. Current Protocols in Molecular Biology / Edited by Frederick M. Ausubel ... [et al.], CHAPTER, Unit–9.3;and Jacobi et al. (2017). Simplified CRISPR tools for efficient genome editing and streamlined protocols for their delivery into mammalian cells and mouse zygotes. Methods, 121-122, 16-28. doi:10.1016/j.ymeth.2017.03.021. [0082] After electroporation has occurred, the in vitro corrected population of HSCs (or HSPCs) may be cultured in vitro for a period of time. The in vitro corrected population of HSCs (or HSPCs) may be cultured for a period of time ranging from 0 days to 7 days such as, e.g., from 0 days to 6 days, from 0 days to 5 days, from 0 days to 4 days, from 0 days to 3 days, from 0 hours (hr) to 48 hrs, from 0 hr to 24 hrs, from 0 hr to 10 hrs, from 0 hr to 5 hrs, or from 0 hr to 2 hrs. The in vitro corrected population of HSCs (or HSPCs) may be cultured in the presence of any suitable factors to promote the growth and expansion of the in vitro corrected population of HSCs (or HSPCs), e.g., HSCs (or HSPCs) in the in vitro corrected population of HSCs (or HSPCs), including, but not limited to, the following: growth factors, adhesion mediators, minerals, cytokines (e.g., stem cell factor (SCF), Flt-3 ligand, thrombopoietin (TPO)), IL-3, IL-6, G-CSF, and animal-free stem cell culture media (e.g., SFEM II from StemCell Technologies; X-VIVO™ 15 (chemically defined, serum-free hematopoietic cell culture medium) from Lonza; and the like) among other factors. Additional culture parameters that may be suitable are described in Frisch, B. J., & Calvi, L. M. (2014). Hematopoietic Stem Cell Cultures and Assays. Methods in Molecular Biology (Clifton, N.J.), 1130, 315–324.; Potter, H., & Heller, R. (2003). Transfection by Electroporation. Current Protocols in Molecular Biology / Edited by Frederick M. Ausubel ... [et Al.], CHAPTER, Unit–9.3; and Jacobi, A. M., Rettig, G. R., Turk, R., Collingwood, M. A., Zeiner, S. A., Quadros, R. M., ... Behlke, M. A. (2017). Simplified CRISPR tools for efficient genome editing and streamlined protocols for their delivery into mammalian cells and mouse zygotes. Methods, 121-122, 16-28. doi:10.1016/j.ymeth.2017.03.021. [0083] The contacting may generate an in vitro corrected population of cells (HSCs or HSPCs). As used herein, the term “in vitro corrected population of HSCs” refers to an in vitro population of genome editing composition-contacted HSCs. The term “in vitro population” may be used interchangeably with “in vitro corrected population of HSCs.” As used herein, the term “in vitro corrected population of HSPCs” refers to an in vitro population of genome editing composition- contacted HSPCs. The term “in vitro population” may be used interchangeably with “in vitro corrected population of HSPCs.” [0084] The cells of the in vitro corrected population of cells (HSCs or HSPCs) may include viable HSCs capable of engraftment and long-term self-renewal. The in vitro corrected population of cells may include three populations of cells: 1) a population of cells that have two non-corrected HBB alleles with BTD-associated mutations; 2) a population of cells that have one HBB allele with a BTD-associated mutation that has been corrected, and the other HBB allele with an uncorrected BTD-associated mutation; and 3) a population of cells that have two HBB alleles with BTD- associated mutations that have been corrected. The in vitro corrected population of cells may include the following percentages of the three populations of cells as described above: (90% of the total cells have two non-corrected HBB alleles, 5% of the total cells have one corrected allele, 5% of the total cells have two corrected alleles); (80% of the total cells have two non- corrected HBB alleles, 10% of the total cells have one corrected allele, 10% of the total cells have two corrected alleles); (70% of the total cells have two non-corrected HBB alleles, 15% of the total cells have one corrected allele, 15% of the total cells have two corrected alleles); (60% of the total cells have two non-corrected HBB alleles, 20% of the total cells have one corrected allele, 20% of the total cells have two corrected alleles); (50% of the total cells have two non- corrected HBB alleles, 25% of the total cells have one corrected allele, 25% of the total cells have two corrected alleles); (40% of the total cells have two non-corrected HBB alleles, 30% of the total cells have one corrected allele, 30% of the total cells have two corrected alleles); (30% of the total cells have two non-corrected HBB alleles, 35% of the total cells have one corrected allele, 35% of the total cells have two corrected alleles); (20% of the total cells have two non- corrected HBB alleles, 40% of the total cells have one corrected allele, 40% of the total cells have two corrected alleles); (10% of the total cells have two non-corrected HBB alleles, 45% of the total cells have one corrected allele, 45% of the total cells have two corrected alleles); (0% of the total cells have two non-corrected HBB alleles, 50% of the total cells have one corrected allele, 50% of the total cells have two corrected alleles). [0085] In certain embodiments, 2% to 95% of cells of the in vitro corrected population of cells (HSCs or HSPCs) comprise two non-corrected BTD-associated mutations after a period of time such as, e.g., 2% to 90% of cells, 2% to 80% of cells, 2% to 70% of cells, 2% to 60% of cells, 2% to 50% of cells, 2% to 40% of cells, 2% to 30% of cells, or 2% to 20% of cells. In certain embodiments, 2% to 95% of cells of the in vitro corrected population of HSCs comprise two corrected BTD- associated mutations after a period of time such as, e.g., 2% to 90% of cells, 2% to 80% of cells, 2% to 70% of cells, 2% to 60% of cells, 2% to 50% of cells, 2% to 40% of cells, 2% to 30% of cells, or 2% to 20% of cells. In certain embodiments, 2% to 95% of cells from the in vitro corrected population of HSCs comprise at least one corrected BTD-associated mutations after a period of time such as, e.g., 2% to 90% of cells, 2% to 80% of cells, 2% to 70% of cells, 2% to 60% of cells, 2% to 50% of cells, 2% to 40% of cells, 2% to 30% of cells, or 2% to 20% of cells. In some cases, at least 2% of the HBB alleles with BTD-associated mutations have been corrected; for example at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more than 50%, of the HBB alleles in the in vitro corrected population of HSCs have a corrected BTD-associated mutation. In some cases, 2% to 60% of the BTD-associated mutations in the in vitro corrected population of HSCs have been corrected; for example, 2% to 50%, 2% to 40%, 2% to 30%, 2% to 25%, 2% to 20%, or 2% to 10% of the BTD-associated mutations in the in vitro corrected population of HSCs have been corrected. In some cases, the in vitro corrected population of HSCs includes a population of HSCs with at least one HBB allele with a BTD-associated mutation that has been corrected. An HBB allele with a “corrected BTD-associated mutation” encodes a polypeptide subunit for forming HbA. The in vitro corrected population of HSCs may be cultured for a period of time before the population is administered to an individual, as described below. In some cases, the in vitro corrected population of HSCs (comprising edited HSCs) may be cultured for 0 days to 7 days such as, e.g., from 0 days to 6 days, from 0 days to 5 days, from 0 days to 4 days, from 0 days to 3 days, from 0 hours (hr) to 48 hrs, from 0 hr to 24 hrs, from 0 hr to 10 hrs, from 0 hr to 5 hrs, or from 0 hr to 2 hrs. The culture medium may include any suitable factors to promote the growth and expansion of HSCs, as described above. [0086] In some cases, the in vitro corrected population of HSCs includes a population of HSCs having at least one corrected BTD-associated mutation that remains corrected for a period of time after contacting the in vitro corrected population of HSCs with the genome editing composition. The period of time may be for at least one month following said contacting, for at least 6 months following said contacting, for at least 1 year following said contacting, or for at least 2 years following said contacting. The at least one corrected BTD-associated mutation may remain permanently corrected after said contacting. In some cases, 2% to 20% of HSCs in the in vitro corrected population of HSCs comprise at least one corrected BTD-associated mutation that remains corrected for a period of time; for example, 2% to 25% of HSCs, 2% to 30% of HSCs, 2% to 35% of HSCs, 2% to 40% of HSCs, 2% to 45% of HSCs, 2% to 50%, or 50% or more of HSCs in the in vitro population comprise at least one corrected BTD-associated mutation that remains corrected for a period of time after said administering . [0087] Aspects of the methods further include cryopreserving the in vitro corrected population of cells (HSCs or HSPCs) after the contacting with the genome editing composition has occurred, e.g., after genome editing has occurred, after correction of the BTD-associated mutations has occurred, etc. In some cases, the in vitro corrected population of HSCs may be cryopreserved from 0 hr to 30 hr after the contacting has occurred; for example, the in vitro corrected population of HSCs may be cryopreserved from 0 hr to 24 hr, from 0 hr to 12 hr, or from 0 hr to 6 hr after the contacting has occurred. Any known method used to successfully cryopreserve HSCs may be applied. The in vitro corrected population of HSCs may be preserved in any standard cryopreservation solution. Accordingly, using cryopreservation, the stem cells can be maintained such that once it is determined that a subject or individual is in need of stem cell transplantation, the stem cells can be thawed and transplanted back into the subject. The use of one or more HSC modulators, for example PGE2, during cryopreservation techniques may enhance the HSC population. [0088] In some cases, the cryopreserved cells are thawed just prior to administration to an individual in need thereof (e.g., an individual having BTD). For example, in some cases, the cryopreserved in vitro corrected population of HSCs is thawed from 5 minutes to 4 hours (e.g., from 5 minutes to 10 minutes, from 10 minutes to 30 minutes, from 30 minutes to 60 minutes, from 1 hour to 2 hours, or from 2 hours to 4 hours) prior to administration to an individual in need thereof (e.g., an individual having BTD). Mutating a PAM [0089] To generate a corrected population of HSCs of the present disclosure, a donor template oligonucleotide is integrated into the genome of a cell, which for the purposes of the present disclosure is typically a HSC. The donor template oligonucleotide can be any desired length, but will comprise a HBB coding sequence. In some cases, the donor template DNA oligonucleotide is from 50 to 100 base pairs (bp) in length. For example, the donor templated DNA oligonucleotide may be from 50-60 bp, 60-70 bp, 80-90 bp or from 90-100 bp. [0090] A feature that renders the target sequence functional (such that it can be recognized and cleaved by a CRISPR-Cas-guide RNA complex) is that it is adjacent to a protospacer adjacent motif (PAM), also referred to as a “PAM sequence.” Once a nucleic acid is integrated into the genome (when generating a corrected population of HSCs), the CRISPR-Cas target sequence is adjacent to a PAM. The PAM can be present at that position in the genome prior to the integration (e.g., the donor template oligonucleotide can be integrated such that the CRISPR-Cas target sequence is inserted next to the PAM that was already present in the genome. In some cases, the integration of donor template DNA oligonucleotide into the genome of an HSC alters the PAM sequence thereby preventing CRISPR-Cas-mediated re-cleavage such that an allele that has been corrected for an HBB gene mutation cannot be cleaved a second time. In some cases, the donor template DNA oligonucleotide specifically prevents Cas9 re-cleavage of a corrected HBB gene mutation. In some cases, the altered PAM sequence may be used as means of selecting HSCs that have been corrected (e.g., a corrected population of HSCs). Nucleic acid modifications [0091] In some embodiments, a subject nucleic acid (e.g., a guide RNA) has one or more modifications, e.g., a base modification, a backbone modification, a sugar modification, etc., to provide the nucleic acid with a new or enhanced feature (e.g., improved stability). A nucleoside is a base- sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', the 3', or the 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are suitable. In addition, linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage. [0092] The guide RNA of the subject methods may include one or more modifications at or near the 5’ end. In some cases, the first three nucleotides at the 5’ end and/or the 3’ end of the guide RNA include nucleic acid modifications. In some instances, nucleic acid modifications at the 5’ end and/or the 3’ end of the guide RNA include three 2′-OMe 3′-phosphorothioates (3xMS). [0093] In some cases, the guide RNA comprises a phosphonoacetate (PACE) or thiophosphonoacetate (thioPACE) modification. In some cases, the guide RNA comprises 2′-O-methyl and 3′ thioPACE modifications. See, e.g., Threlfall et al. (2012) Org. Biomol. Chem.10:746. [0094] Suitable nucleic acid modifications include, but are not limited to: 2’Omethyl modified nucleotides, 2’ Fluoro modified nucleotides, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, nucleotides with phosphorothioate linkages, and a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). Additional details and additional modifications are described below. [0095] A 2'-O-Methyl modified nucleotide (also referred to as 2'-O-Methyl RNA) is a naturally occurring modification of RNA found in tRNA and other small RNAs that arises as a post- transcriptional modification. Oligonucleotides can be directly synthesized that contain 2'-O- Methyl RNA. This modification increases Tm of RNA:RNA duplexes but results in only small changes in RNA:DNA stability. It is stable with respect to attack by single-stranded ribonucleases and is typically 5 to 10-fold less susceptible to DNases than DNA. It is commonly used in antisense oligos as a means to increase stability and binding affinity to the target message. [0096] 2’ Fluoro modified nucleotides (e.g., 2' Fluoro bases) have a fluorine modified ribose which increases binding affinity (Tm) and also confers some relative nuclease resistance when compared to native RNA. These modifications are commonly employed in ribozymes and siRNAs to improve stability in serum or other biological fluids. [0097] LNA bases have a modification to the ribose backbone that locks the base in the C3'-endo position, which favors RNA A-type helix duplex geometry. This modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertions can be placed in an oligo at any position except the 3'-end. Due to the large increase in Tm conferred by LNAs, they also can cause an increase in primer dimer formation as well as self-hairpin formation. In some cases, the number of LNAs incorporated into a single oligo is 10 bases or less. [0098] The phosphorothioate (PS) bond (i.e., a phosphorothioate linkage) substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of a nucleic acid (e.g., an oligo). This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3-5 nucleotides at the 5'- or 3'-end of the oligo to inhibit exonuclease degradation. Including phosphorothioate bonds within the oligo (e.g., throughout the entire oligo) can help reduce attack by endonucleases as well. [0099] In some cases, a nucleic acid (e.g., a guide RNA, etc.) has one or more nucleotides that are 2'-O- Methyl modified nucleotides. In some embodiments, a subject nucleic acid (e.g., a guide RNA, etc.) has one or more 2’ Fluoro modified nucleotides. In some cases, a subject nucleic acid (e.g., a guide RNA, etc.) has one or more LNA bases. In some cases, a subject nucleic acid (e.g., a guide RNA, etc.) has one or more nucleotides that are linked by a phosphorothioate bond (i.e., the subject nucleic acid has one or more phosphorothioate linkages). In some embodiments, a subject nucleic acid (e.g., a guide RNA, etc.) has a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). [00100] In some cases, a subject nucleic acid has a combination of modified nucleotides. For example, a nucleic acid can have a 5’ cap (e.g., a 7-methylguanylate cap (m7G)) in addition to having one or more nucleotides with other modifications (e.g., a 2'-O-Methyl nucleotide and/or a 2’ Fluoro modified nucleotide and/or a LNA base and/or a phosphorothioate linkage). A nucleic acid can have any combination of modifications. For example, a subject nucleic acid can have any combination of the above-described modifications. [00101] In some cases, a subject nucleic acid has one or more nucleotides that are 2'-O-Methyl modified nucleotides. In cases embodiments, a subject nucleic acid has one or more 2’ Fluoro modified nucleotides. In some cases, a subject nucleic acid has one or more LNA bases. In some cases, a subject nucleic acid has one or more nucleotides that are linked by a phosphorothioate bond (i.e., the subject nucleic acid has one or more phosphorothioate linkages). In some cases, a subject nucleic acid has a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). [00102] In some cases, a subject nucleic acid has a combination of modified nucleotides. For example, a subject nucleic acid can have a 5’ cap (e.g., a 7-methylguanylate cap (m7G)) in addition to having one or more nucleotides with other modifications (e.g., a 2'-O-Methyl nucleotide and/or a 2’ Fluoro modified nucleotide and/or a LNA base and/or a phosphorothioate linkage). A subject nucleic acid can have any combination of modifications. For example, a subject nucleic acid can have any combination of the above-described modifications. Modified backbones and modified internucleoside linkages [00103] Examples of suitable nucleic acids containing modifications include nucleic acids containing modified backbones or non-natural internucleoside linkages. Nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. [00104] Suitable modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included. [00105] In some cases, a nucleic acid comprises one or more phosphorothioate and/or heteroatom internucleoside linkages, in particular -CH₂-NH-O-CH₂-, -CH₂-N(CH₃)-O-CH₂- (known as a methylene (methylimino) or MMI backbone), -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)- N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- (wherein the native phosphodiester internucleotide linkage is represented as -O-P(=O)(OH)-O-CH2-). MMI type internucleoside linkages are disclosed in the above referenced U.S. Pat. No.5,489,677. Suitable amide internucleoside linkages are disclosed in t U.S. Pat. No.5,602,240. [00106] Also suitable are nucleic acids having morpholino backbone structures as described in, e.g., U.S. Pat. No.5,034,506. For example, in some embodiments, a subject nucleic acid comprises a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non-phosphodiester internucleoside linkage replaces a phosphodiester linkage. [00107] Suitable modified polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. M^{ETHODS OF} T^REATING β ^THALASSEMIA D^ISEASE [00108] The present disclosure provides a method of treating a β thalassemia disease (BTD) in an individual. The method may include a) modifying an HBB gene in the genome of HSCs (or HSPCs) obtained from the individual according to any embodiment of the subject methods, thereby generating an in vitro corrected population of HSCs (or HSPCs); and b) administering the in vitro corrected population of HSCs to the individual, thereby treating the BTD in the individual. The term “treated individual” as used herein may refer to an individual to whom an in vitro corrected population of HSCs has been administered. [00109] The administration of the in vitro corrected population of HSCs (or HSPCs) to an individual produces an engrafted population. The administering may include, e.g., infusing the in vitro corrected population of HSCs into an individual, engrafting the in vitro corrected population of HSCs into an individual, transplanting the in vitro corrected population of HSCs into an individual, etc. The administering of the in vitro corrected population of HSCs may occur after ablation of the bone marrow in an individual. By “engrafted population” is meant a population of transplanted cells such as a population of cells including, e.g., cells of the administered in vitro corrected population of HSCs, cells derived from the administered in vitro corrected population of HSCs, etc. The engrafted population may include three populations of cells: 1) a population of cells that have two non-corrected HBB alleles with BTD-associated mutations; 2) a population of cells that have one HBB allele with an BTD-associated mutations that has been corrected, and another HBB allele with a BTD-associated mutation that has not been corrected; and 3) a population of cells that have two HBB alleles with BTD-associated mutations that have been corrected. In some cases, the populations of cells having either one or two non-corrected HBB alleles include cells where one or both HBB alleles have been knocked out. The knockout of one or more HBB alleles may be due to non-homologous end joining (NHEJ) where small insertions or deletions (indels) are inserted at the site of cleavage, where the indels cause functional disruption through introduction of non-specific mutations at the cleavage location. The engrafted population includes viable HSCs capable of long-term self-renewal. In some cases, the percentage of the HBB alleles with BTD-associated mutations that have been corrected in the engrafted population is at least 2%, e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more than 50%. In some cases, at least 2% of the HBB alleles with BTD-associated mutations have been corrected; for example at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more than 50%, of the HBB alleles in the engrafted population have a corrected BTD-associated mutations. A HBB allele with a “corrected BTD-associated mutation” encodes a polypeptide subunit for forming HbA. [00110] The corrected BTD alleles in the in vitro corrected population of HSCs (or HSPCs) may be maintained in the engrafted population after administering the in vitro corrected population of HSCs to an individual. The administering may include infusing any suitable dose or effective amount of the in vitro corrected population of HSCs, e.g., a dose suitable to produce an engrafted population into an individual. In certain embodiments, the administering may include a dose of any suitable amount of an in vitro corrected population of HSCs, e.g., a thawed in vitro corrected population of HSCs previously cryopreserved, as described above. In some cases, a single dose of the in vitro corrected population of HSCs is administered. In some cases, the method includes administering an effective amount of at least 10⁶ to 10⁷ cells from the in vitro corrected population of HSCs. In some cases, the method comprises administering from about 5 x 10⁵ to about 10⁷ HSPCs per kilogram of body weight of the individual, such as, e.g., from about 5 x 10⁵ to about 10⁶, from about 10⁶ to about 5 x 10⁶, or from about 10⁶ to about 10⁷ corrected HSPCs from the in vitro corrected population of HSPCs per kilogram of body weight of the individual. In some cases, the method includes administering an effective amount of cells/kg ranging from 1.5 x 10⁶ to 1 x 10⁷ cells from the in vitro corrected population of HSCs /kg of body weight, 2 x 10⁶ cells from the in vitro corrected population of HSCs /kg of body weight to 3 x 10⁶ cells from the in vitro corrected population of HSCs /kg of body weight, or 5 x 10⁶ cells from the in vitro corrected population of HSCs /kg to 1 x 10⁷ cells from the in vitro corrected population of HSCs /kg of body weight. In some cases, from about 0.5 x 10⁶ cells/kg to about 20 x 10⁶ cells/kg are harvested from a patient; these harvested cells are used to generate an in vitro corrected population of HSCs, suitable for re-introduction into the patient, of about 3 x 10⁶ cells/kg. [00111] Any suitable percentage of cells, e.g., bone marrow cells, in the engrafted population may have zero, one, or two corrected BTD-associated mutations after a period of time, e.g., after the administering of the in vitro corrected population of HSCs to an individual, and/or any suitable percentage of the total BTD-associated mutations may be corrected after a period of time. The period of time may range from 1 day to 6 months after administration, from 6 months to 12 months after administration, from 1 year to 2 years after administration, or for a period of time after administration that lasts up to the years in the individual’s lifespan. In some cases, the period of time is at least one month following said administering, at least 6 months following said administering, at least 1 year following said administering, or at least 2 years following said administering. [00112] In some cases, the method provides for circulating red blood cells (RBCs) in the individual that are derived from HSCs that include zero, one, or two corrected BTD-associated mutations after a period of time. The period of time may range from 1 day to 6 months after administration, from 6 months to 12 months after administration, from 1 year to 2 years after administration, or for a period of time after administration that lasts up to the years in the individual’s lifespan. In some cases, the period of time is at least one month following said administering, at least 6 months following said administering, at least 1 year following said administering, or at least 2 years following said administering. [00113] The methods of treating may provide the reduction of adverse symptoms associated with β thalassemia disease (BTD) after a period of time after administering the in vitro corrected population of HSCs. The period of time may range from 30 days to 6 months after administration, from 6 months to 12 months after administration, from 1 year to 2 years after administration, or for a period of time after administration that lasts up to the years in the individual’s lifespan. In some cases, the period of time is at least one month following said administering, at least 6 months following said administering, at least 1 year following said administering, or at least 2 years following said administering. In some cases, the methods result in the reduction of the clinical presentation of BTD. In some cases, the methods result in the reduction in the frequency of the clinical presentation of BTD. In some cases, the methods result in the reduction in the severity of the clinical presentation of BTD. The methods may result in the elimination or prevention of the clinical presentation of BTD. In some cases, the methods result in the reduction in severity of symptoms of anemia in a treated individual by 2% to 95% compared to the severity in the individual before treatment or in an untreated individual such as, e.g., by 5% to 90%, by 10% to 80%, by 20% to 70%, by 30% to 60%, or by 40% to 50%. In some cases, the methods result in the reduction in the number of RBC transfusions to a treated individual by 2% to 95% compared to the number of transfusions to the individual before treatment or to an untreated individual such as, e.g., by 5% to 90%, by 10% to 80%, by 20% to 70%, by 30% to 60%, or by 40% to 50%. KITS [00114] Aspects of the present disclosure include a kit for treating β thalassemia disease (BTD) in an individual. The kit may include A) a stem cell mobilization agent that provides for mobilization of hematopoietic stem cells; and B) a genome-editing composition of the present disclosure (e.g., a genome-editing composition comprising: a) a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR /Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; and ii) a guide RNA; and b) a donor DNA template comprising a nucleotide sequence that provides for correction of an BTD-associated mutation in an HBB gene). [00115] Where desired, the kits may further include one or more additional components that find use in a method of the present disclosure, where such additional components include, e.g., reagents, buffers, etc. Any or all of the kit components may be present in sterile packaging, as desired. In some cases, one or more kit components may be present in a container, e.g., a sterile container, such as a syringe. In some cases, the stem cell mobilization agent is plerixafor. In some cases, the class 2 CRISPR-Cas effector polypeptide is a type II CRISPR/Cas effector polypeptide, as described above. The guide RNA may include any suitable guide RNA, as described above. The donor DNA template can include any suitable donor DNA template, as described above. [00116] In addition to the above-mentioned components, a subject kit may further include instructions for using the components of the kit, e.g., to practice the subject methods. The instructions may be recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging), etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g., a portable flash drive, CD-ROM, diskette, Hard Disk Drive (HDD) etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, the means for obtaining the instructions is recorded on a suitable substrate. MODIFIED HEMATOPOIETIC STEM CELLS [00117] The present disclosure provides a modified HSC, where the modified HSC comprises: a) at least one corrected BTD-associated mutation in an HBB gene; and b) a mutated PAM in the HBB gene, where the PAM is mutated such that the HBB allele containing the mutated PAM is not cleaved by a CRISPR-Cas polypeptide. Examples of Non-Limiting Aspects of the Disclosure [00118] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the are provided below. As will be apparent to those of skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below: [00119] Aspect 1. A genome editing composition, the composition comprising: a) a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid wherein the guide nucleic acid comprises a sequence complementary to a nucleotide sequence in a human beta-globin (HBB) gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene. [00120] Aspect 2. The composition of aspect 1, wherein the CRISPR-Cas effector polypeptide is a type II, a type V, or a type VI CRISPR-Cas effector polypeptide. [00121] Aspect 3. The composition of aspect 1, wherein the CRISPR-Cas effector polypeptide is a type II CRISPR-Cas effector polypeptide. [00122] Aspect 4. The composition of aspect 3, wherein the type II CRISPR-Cas effector polypeptide is a Cas9 polypeptide. [00123] Aspect 5. The composition of any one of aspects 1-4, wherein the donor template DNA oligonucleotide is a single-stranded DNA oligonucleotide. [00124] Aspect 6. The composition of any one of aspects 1-5, wherein the donor template DNA oligonucleotide is from 50 to 90 base pairs (bp) in length. [00125] Aspect 7. The composition of any one of aspects 1-6, wherein the donor template DNA oligonucleotide sequence comprises a sequence that alters a protospacer adjacent motif (PAM) in the HBB gene. [00126] Aspect 8. The composition of any one of aspects 1-7, wherein the donor template DNA oligonucleotide comprises: a) the nucleotide sequence depicted in FIG.1 as “ssODN”; or b) 5’- CAAGAGTCTTCTCTGTCTCCACATGCCCAGTTTCTATTGGTCTCCTTAAACCTGTCTT GTAACCTTGATACCAACCTGCCCAGGGCTTCACCACCAACTTCATCCACGTTCACCT TGCCCCACAGGGC-3’ (SEQ ID NO:16). [00127] Aspect 9. The composition of any one of aspects 1-8, wherein the guide nucleic acid is a single-molecule guide RNA (sgRNA). [00128] Aspect 10. The composition of any one of aspects 1-9, wherein the guide nucleic acid comprises one or more nucleic acid modifications. [00129] Aspect 11. The composition of aspect 10, wherein the nucleic acid modifications comprise one or more of a modified nucleobase, a modified backbone or non-natural internucleoside linkage, a modified sugar moiety, a Locked Nucleic Acid, or a Peptide Nucleic acid. [00130] Aspect 12. The composition of aspect 11, wherein the guide nucleic acid comprises 2′- O-methyl and 3′ thioPACE modifications. [00131] Aspect 13. The composition of any one of aspects 1-12, wherein the guide nucleic acid comprises the following nucleotide sequence CGUGGAUGAAGUUGGUGGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:15). [00132] Aspect 14. The composition of any one of aspects 1-3, comprising hematopoietic stem cells. [00133] Aspect 15. A method of correcting a β-thalassemia disease-associated mutation in a human β-globin (HBB) gene, the method comprising contacting a starting population of hematopoietic stem cells (HSCs) with the composition of any one of aspects 1-14, thereby generating a corrected population of HSCs comprising at least one corrected beta-thalassemia- associated HBB gene mutation. [00134] Aspect 16. The method of aspect 15, wherein the HSCs comprise human CD34⁺ stem and progenitor cells (HSPCs). [00135] Aspect 17. The method of aspect 15 or aspect 16, wherein the HBB gene mutation is selected from IVS I-5 (G→C), CD 22-24 (-7 bp), CD 26 (GAG→TAG), CD 29 (C→T), IVS I(- 3bp), IVS I-1 (G→C), IVSI-5 (G→T), CD 26 (GAG→AAG), CD 24 (-G, +CAG), CD 26 (+T), CD 30 (G→C), IVS I (-1), IVS I-2 (T→G), IVS I-5 (G→A), IVS I-1 (G→T), CD 24 (GGT→GGA [Gly→Gly]), CD 27 GCC→TCC [Ala→Ser]), IVS I-1 (G→A), IVS I-2 (T→C) IVSI-6 (T→C), CD 20/21 (-TGGA), CD 25/26/ (+T), CD 27/28 (+C), IVS I-1 (G→T), IVS I-2 (T→A), and IVS I-7 (A→T). [00136] Aspect 18. The method of any one of aspects 15-17, wherein the HSCs comprise both the IVS I-5 and the IVS I-1 mutations. [00137] Aspect 19. The method of any one of aspects 14-18, wherein two or more beta- thalassemia-associated mutations are corrected. [00138] Aspect 20. A method of treating β-thalassemia, the method comprising: a) contacting hematopoietic stem cells (HSCs) or hematopoietic stem/progenitor cells (HSPCs with the composition of any one of aspects 1-14, wherein the HSCs or HSPCs are obtained from an individual with β-thalassemia, wherein said contacting generates a corrected population of HSCs or HSPCs comprising at least one corrected beta-thalassemia-associated mutation in a human β- globin (HBB) gene; and b) administering the corrected population of HSCs or HSPCs to the individual from whom the HSCs or HSPCs were obtained, thereby treating the β-thalassemia in the individual. [00139] Aspect 21. The method of aspect 20, wherein the HSCs or HSPCs comprise human CD34⁺ stem and progenitor cells. [00140] Aspect 22. The method of aspect 19 or aspect 20, further comprising administering to the individual a stem cell mobilization agent, wherein said stem cell mobilization agent is administered to the individual before the HSCs or HSPCs are obtained from the individual. [00141] Aspect 23. The method of aspect 22, wherein the stem cell mobilization agent is granulocyte colony stimulating factor (G-CSF) or plerixafor. [00142] Aspect 24. The method of any one of aspects 15-23, wherein only 1 allele of a mutated HBB gene is corrected. [00143] Aspect 25. The method of any one of aspects 15-14, wherein 5-50% of the HBB alleles within the population are corrected. [00144] Aspect 26. A donor template DNA oligonucleotide comprising a nucleotide sequence that provides for correction at least two β-thalassemia-associate mutations in a human beta- globin gene. [00145] Aspect 27. A kit for treating β-thalassemia in an individual, the kit comprising: _[00146] a) a stem cell mobilization agent that provides for mobilization of human CD34⁺ stem and progenitor cells (HSPCs); and b) the composition of any one of aspects 1-24. [00147] Aspect 28. A modified hematopoietic stem cell (HSC), the modified HSC comprising: a) at least one corrected beta-thalassemia-associated mutation in a human β-globin (HBB) gene; and b) a mutated protospacer adjacent motif (PAM) in the HBB gene. EXAMPLES [00148] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c., subcutaneous(ly); and the like. Example 1 MATERIALS AND METHODS [00149] A stock of human CD34+ HSPCs that are compound heterozygotes, carrying the IVS I‐ 1(G>T) and IVS I‐5 (G>C) mutations was started with. IVS I‐5, a splice junction mutation, accounts for ~50% of all β‐thalassemia (β-thal) mutations in India, and a similar if not higher proportion in Pakistan and Bangladesh. Since β‐thalassemia cases are typically compound heterozygotes, most β‐thal cases in South Asia are likely to have one or more IVS‐I‐5 alleles. There are more than 15,000 cases of transfusion‐dependent ß‐thal born in South Asia each year: reagents and protocols that would correct IVS I‐5 alone would have a very substantial impact. Based on this insight, a correction strategy for IVS I‐5 was developed. Of note, the IVS I‐1 mutation is only 5 bases away from IVS I‐5. [00150] A research‐grade wild‐type Streptococcus pyogenes Cas9 was used. Candidate guide RNAs predicted to cleave close to the mutation site in K562 cells were screened, which resemble early hematopoietic progenitors. Selection of gRNAs is currently restricted by the requirement for a protospacer adjacent motif (PAM). One guide RNA that cleaves 21 bp from IVS I‐5, and 16 bp from IVS I‐1 was identified, with high efficiency, and it was selected for further work. [00151] The above-mentioned guide RNA was selected to screen oligonucleotide donor templates (which also introduce a mutation that ablates the PAM motif and prevents recleavage of an edited allele). β^{IVS I‐ 5}/β^{IVS I‐1} HSPCs were expanded and were screened to identify donor templates, and 70 base single‐stranded donor was identified as a candidate. Using PCR amplification and deep (Illumina) sequencing was used to establish that the gRNA/donor combination results in correction of the mutant genotype in ~20% of HBB alleles within the HSPC population. [00152] The Cas9 RNP/ssODN set that was used is capable of correcting either the IVS I‐5 or the IVS I‐1 mutation in cells carrying both mutations, with correction efficiency for each of ~10%; correction of either mutation and it is effectively curative, as ß‐thalassemia is a recessive disorder. [00153] FIG.1 depicts an edited HBB gene region showing β‐thalassemia mutations (gray box), the PAM motif (underlined), and the (partial) sequence of the oligonucleotide donor. Note that the mutations do not occur on the same allele: in the cells in this example, each allele is mutant at one site and wild type at the other. Cleavage by Cas9 occurs at the site of the HbE mutation. [00154] Cells (as noted above; human CD34+ HSPCs that are compound heterozygotes, carrying the IVS I‐1(G>T) and IVS I‐5 (G>C) mutations) were thawed from cryopreservation and cultured in SFEM/CC110 (Stem Cell Technologies) for 48 hours prior to electroporation. Just prior to electroporation, cells were pelleted at 100 x g for 10 minutes, and resuspended to 1- 3x10⁴ cells/µL in Lonza P3 buffer; during the electroporation procedure, cells did not remain in P3 for longer than 20 minutes. While cells were in the centrifuge, the Cas9 RNP/ssDNA mixture was prepared (10.6 µM sgRNA, 8.8 µM Cas9 protein, and 11.8 µM ssDNA, in Cas9 RNP buffer (20 mM HEPES pH 7.50, 150 mM KCl, 1 mM MgCl₂, 10% glycerol, 1 mM TCEP). [00155] The RNP/ssDNA was mixed with cells at an 0.375:1 ratio (i.e.30 µL RNP/ssDNA mix to 80 µL CD34+ cells). The mixture was then placed in a Lonza Nucleofector cuvette (20 µL “S” or 100 µL “L”) and electroporated using Lonza electroporation code ER100 on a Lonza 4D Nucleofector. Immediately after electroporation, at least 2 volumes of SFEM/CC110 were layered on top of cells for 5-10 minutes before gently transferring cells to a culture dish. Cells were counted using Trypan blue exclusion after electroporation. Cells were cultured overnight before cryopreservation. Genomic DNA was extracted from cells after culture for at least one day after electroporation. A PCR amplicon from the edited region of HBB or OT1 was generated using primers flanking the edited region. The amplicon was used to generate libraries for deep sequencing (e.g. by Illumina), and sequenced on an appropriate sequencer. RESULTS [00156] Once editing and HDR-mediated correction occur, it is no longer possible to distinguish the two mutant alleles: either allele will have a mutant PAM motif but no ß-thalassemia mutation. In this example, 19.3% of sequenced alleles had a mutant PAM but no β-thalassemia mutation. Assessment of the proportions of uncorrected alleles indicated that the efficiency of correction of the two mutations was approximately the same. [00157] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

Claims

CLAIMS What is claimed is: 1. A genome editing composition, the composition comprising: a) a ribonucleoprotein (RNP) complex comprising: i) a class 2 CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR-Cas effector polypeptide; ii) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid wherein the guide nucleic acid comprises a sequence complementary to a nucleotide sequence in a human beta-globin (HBB) gene; and b) a donor DNA template oligonucleotide comprising a nucleotide sequence that provides for correction at least one β-thalassemia-associate mutation in the HBB gene.

2. The composition of claim 1, wherein the CRISPR-Cas effector polypeptide is a type II, a type V, or a type VI CRISPR-Cas effector polypeptide.

3. The composition of claim 1, wherein the CRISPR-Cas effector polypeptide is a type II CRISPR-Cas effector polypeptide.

4. The composition of claim 3, wherein the type II CRISPR-Cas effector polypeptide is a Cas9 polypeptide.

5. The composition of any one of claims 1-4, wherein the donor template DNA oligonucleotide is a single-stranded DNA oligonucleotide.

6. The composition of any one of claims 1-5, wherein the donor template DNA oligonucleotide is from 50 to 90 base pairs (bp) in length.

7. The composition of any one of claims 1-6, wherein the donor template DNA oligonucleotide sequence comprises a sequence that alters a protospacer adjacent motif (PAM) in the HBB gene.

8 The composition of any one of claims 1-7, wherein the donor template DNA oligonucleotide comprises: a) the nucleotide sequence depicted in FIG.1 as “ssODN”; or b) 5’- CAAGAGTCTTCTCTGTCTCCACATGCCCAGTTTCTATTGGTCTCCTTAAACCTGTCTTGTAAC CTTGATACCAACCTGCCCAGGGCTTCACCACCAACTTCATCCACGTTCACCTTGCCCCACAG GGC-3’ (SEQ ID NO:16).

9. The composition of any one of claims 1-8, wherein the guide nucleic acid is a single- molecule guide RNA (sgRNA).

10. The composition of any one of claims 1-9, wherein the guide nucleic acid comprises one or more nucleic acid modifications.

11. The composition of claim 10, wherein the nucleic acid modifications comprise one or more of a modified nucleobase, a modified backbone or non-natural internucleoside linkage, a modified sugar moiety, a Locked Nucleic Acid, or a Peptide Nucleic acid.

12. The composition of claim 11, wherein the modified nucleobase is a 2′-O-methyl 3′thioPACE modified nucleobase.

13. The composition of any one of claims 1-12, wherein the guide nucleic acid comprises the following nucleotide sequence CGUGGAUGAAGUUGGUGGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:15).

14. The composition of any one of claims 1-3, comprising hematopoietic stem cells.

15. A method of correcting a β-thalassemia disease-associated mutation in a human β-globin (HBB) gene, the method comprising contacting a starting population of hematopoietic stem cells (HSCs) with the composition of any of claims 1-14, thereby generating a corrected population of HSCs comprising at least one corrected beta-thalassemia-associated HBB gene mutation.

16. The method of claim 15, wherein the HSCs comprise human CD34⁺ stem and progenitor cells (HSPCs).

17. The method of claim 15 or claim 16, wherein the HBB gene mutation is selected from IVS I-5 (G→C), CD 22-24 (-7 bp), CD 26 (GAG→TAG), CD 29 (C→T), IVS I(-3bp), IVS I-1 (G→C), IVSI-5 (G→T), CD 26 (GAG→AAG), CD 24 (-G, +CAG), CD 26 (+T), CD 30 (G→C), IVS I (-1), IVS I-2 (T→G), IVS I-5 (G→A), IVS I-1 (G→T), CD 24 (GGT→GGA [Gly→Gly]), CD 27 GCC→TCC [Ala→Ser]), IVS I-1 (G→A), IVS I-2 (T→C) IVSI-6 (T→C), CD 20/21 (-TGGA), CD 25/26/ (+T), CD 27/28 (+C), IVS I-1 (G→T), IVS I-2 (T→A), and IVS I-7 (A→T).

18. The method of any one of claims 15-17, wherein the HSCs comprise both the IVS I-5 and the IVS I-1 mutations.

19. The method of any one of claims 14-18, wherein two or more beta-thalassemia- associated mutations are corrected.

20. A method of treating β-thalassemia, the method comprising: a) contacting hematopoietic stem cells (HSCs) with the composition of any of claims 1- 14, wherein the HSCs are obtained from an individual with β-thalassemia, wherein said contacting generates a corrected population of HSCs comprising at least one corrected beta-thalassemia-associated mutation in a human β-globin (HBB) gene; and b) administering the corrected population of HSCs to the individual from whom the HSCs were obtained, thereby treating the β-thalassemia in the individual.

21. The method of claim 20, wherein the HSCs comprise human CD34⁺ stem and progenitor cells.

22. The method of claim 19 or 20, further comprising administering to the individual a stem cell mobilization agent, wherein said stem cell mobilization agent is administered to the individual before the HSCs are obtained from the individual.

23. The method of claim 22, wherein the stem cell mobilization agent is granulocyte colony stimulating factor (G-CSF) or plerixafor.

24. The method of any one of claims 15-23, wherein only 1 allele of a mutated HBB gene is corrected.

25. The method of any one of claims 15-14, wherein 5-50% of the HBB alleles within the population are corrected.

26. A donor template DNA oligonucleotide comprising a nucleotide sequence that provides for correction at least two β-thalassemia-associate mutations in a human beta-globin gene.

27. A kit for treating β-thalassemia in an individual, the kit comprising: a) a stem cell mobilization agent that provides for mobilization of human CD34⁺ stem and progenitor cells (HSPCs); and b) the composition of any one of claims 1-24.

28. A modified hematopoietic stem cell (HSC), the modified HSC comprising: a) at least one corrected beta-thalassemia-associated mutation in a human β-globin (HBB) gene; and b) a mutated protospacer adjacent motif (PAM) in the HBB gene.