WO2023043372A2 - Method for generating retinal ganglion cells - Google Patents

Abstract

The present invention relates to the field of cell differentiation. In particular, the invention relates to a method for generating retinal ganglion cells (RGCs), the method comprising the steps of: (a) overexpressing KLF7 in eye field progenitor cells; and (b) culturing the KLF7-overexpressed eye field progenitor cells in a medium under conditions suitable for RGC formation.

Description

METHOD FOR GENERATING RETINAL GANGLION CELLS

The present invention relates generally to the field of cell differentiation, in particular, the invention relates to a method for generating retinal ganglion cells (RGCs).

Glaucoma is one of the leading causes of blindness, and no cure currently exists for glaucoma. It is caused by increased pressure inside the eye. which leads to optic nerve damage. Optic nerves are made from the axon bundles of retinal ganglion cells. Therefore, the in-vitro culture of RGC cells is of great interest to the scientific community because of potential therapeutic implications in transplantation in glaucoma patients. However, the differentiation of RGCs from embryonic stem cells is rather problematic. There is a vast heterogeneity and difference in existing RGC differentiation protocols, with low percentage of RGCs generated.

There is therefore a need for a robust in-vitro method cf generating RGCs.

In one aspect, the present invention relates to a method for generating retinal ganglion cells (RGCs), the method comprising the steps of: (a) overexpressing KLF7 in eye field progenitor cells; and (b) culturing the KLF7-overexpressed eye field progenitor cells in a medium under conditions suitable for RGC formation.

The terms “overexpressed” or “overexpression” as used herein refers to an expression level of a gene in a cell that is greater than the level in a reference standard. One will appreciate that a reference standard can vary depending on the situation. For example, the reference standard can be a particular threshold established in the art that is considered to be a normal or typical expression level of the gene. In other embodiments, the reference standard can be the expression level of a gene in a control sample of cells that have not been engineered to overexpress the gene. In some embodiments, overexpression is at least twice, three, or four times the expression level of the reference standard. For example, a particular gene is considered to be overexpressed when its expression level in the cell is higher than the normal expression level of the same gene in a control cell that has not been genetically altered or genetically engineered. Levels of expression can be determined according to any of many acceptable protocols known in the art that measure the abundance of RNA such as using bioinformatics, quantitative or semi-quantitative polymerase chain reaction (PCR), immunofluorescence, RNA-fluorescence in situ hybridization (FISH) or northern blot. In other embodiments applicable to protein-coding genes, the expression can be quantified in terms of amount of target protein detected, such as by western blot. As will be described in detail later, overexpression may be achieved in any manner known to those skilled in the art. In general, overexpression can be achieved by increasing the transcription/translation of a gene, e.g., by increasing the copy number of the gene or altering or modifying regulatory sequences or sites associated with gene expression. For example, overexpression may be achieved by introducing one or more copies of a polynucleotide encoding a gene operably linked to a regulatory sequence (e.g., a promoter). For example, to achieve high expression levels, the gene may be operably linked to a strong constitutive promoter and/or a strong broad-spectrum expression (ubiquitous) promoter.

Overexpression may also be achieved by overexpressing a target gene endogenously within its native context. This may be done via transcriptional activation strategies, in which a nucleic acid sequence encoding a transcriptional activator protein is introduced into a cell, wherein the transcriptional activator protein is expressed, and wherein the transcriptional activator protein upregulates expression of the target gene. In one embodiment, overexpression of a target gene may be achieved by introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to the target gene, introducing into the cell a second foreign nucleic acid encoding an RNA guided nuclease-null DNA binding protein of a Type II CRISPR System that binds to the target gene and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the RNA guided nuclease-null DNA binding protein of a Type II CRISPR System, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the RNA guided nuclease-null DNA binding protein of a Type II CRISPR System and the transcriptional regulator protein or domain co-localize to the target gene and wherein the transcriptional regulator protein or domain regulates expression of the target gene.

In another embodiment, endogenous gene overexpression can be achieved by RNA activation (RNAa) using short double stranded RNAs which have been termed small activating RNAs (saRNAs) or antigene RNAs (agRNAs). saRNAs selectively activate gene expression through targeting promoter sequences. For example, saRNAs may interact with the promoter of the target gene and increase transcription by methylation of H3K4 and/or demethylation of H3K9. Notably, RNAa allows for the activation of endogenous gene expression in the absence of exogenous DNA.

The terms “eye field progenitor cell” and “eye progenitor cell” are used interchangeably. By “KLF7-overexpressed eye field progenitor cells”, it is meant to refer to eye field progenitor cells in which KLF7 has been overexpressed. In one embodiment, the step of overexpressing KLF7 in the method as described herein comprises introducing a polynucleotide sequence encoding KLF7 into the eye field progenitor cells.

The terms “introduce” or “introducing” in the context of introducing a moiety into a cell refers to any means for facilitating or effecting uptake or absorption of the moiety into the cell, as will be generally understood by those skilled in the art. The moiety to be introduced into a cell may include a polypeptide sequence, a vector or a synthetic modified RNA, among others. A moiety can be introduced into a cell, for example, by transfection, nucleofection, lipofection, electroporation (see, e.g., Wong and Neumann, Biochem. Biophys. Res. Commun. 107:584- 87 (1982)), microinjection, biolistics, and the like. Alternatively, a moiety can be introduced into a cell using a delivery system such as a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system.

In various embodiments, the polynucleotide sequence encoding KLF7 is introduced into the eye field progenitor cells using a vector.

The terms “vector” and “expression vector” refer to a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell. An expression vector may be part of a plasmid, viral genome, or nucleic acid fragment. Typically, an expression vector includes a polynucleotide to be transcribed, operably linked to a promoter. Vectors may be viral or non-viral. A non-viral vector may comprise a plasmid, liposomes, nanoparticles, microbubble plus ultrasound, dendrimers, cationic magnetic nanoparticles, lipoplexes (lipid- based), inorganic molecules, etc. A viral vector may be of any kind, but in specific embodiments the viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector.

The terms “polynucleotide sequence”, "nucleotide sequence" and "nucleic acid sequence" are used interchangeably and refer to contiguous nucleic acid sequences. The sequence can be either single-stranded or double-stranded DNA or RNA (eg, mRNA). By “gene”, it is meant to include a polynucleotide sequence that expresses a specific protein. The polynucleotide sequence may include regions preceding and following the coding region involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons). The phrase “polynucleotide sequence encoding” refers to a nucleic acid coding sequence encoding a polypeptide or functional fragment thereof. For example, a polynucleotide sequence encoding KLF7 includes the gene KLF7. The coding sequence may further comprise start and end signals functionally linked to regulatory elements including promoters and polyadenylation signals capable of inducing expression in cells of the individual or mammal to which the nucleic acid is administered.

In one embodiment, the vector comprises a promoter operably linked to the polynucleotide sequence encoding KLF7.

As used herein, the term “promoter” refers to a region of DNA capable of binding an RNA polymerase in a cell (directly or through other promoter-bound proteins or substances) that initiates transcription of a gene. Within the promoter sequence may be found a transcription initiation site (conveniently defined, for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. A promoter may be a major promoter, a minor promoter or an alternative promoter. A major promoter is a promoter that is the most frequently used for the transcription of a gene. A promoter may be a constitutive promoter or an inducible promoter. As used herein, a “constitutive promoter” refers to an unregulated promoter that allows for continual transcription of its associated gene. The term “inducible promoter” as used herein refers to a promoter that can be regulated in the presence of inducers which may include certain biomolecules.

Promoters which may be used to control gene expression include, but are not limited to, SRa promoter (Takebe et al., Molec. and Cell. Bio. 8:466-472 (1988)), the human CMV immediate early promoter (Boshart et al., Cell 41 :521-530 (1985); Foecking et al., Gene 45:101-105 (1986)), the mouse CMV immediate early promoter, the SV40 early promoter region (Benoist, et al., Nature 290:304-310 (1981)), the Orgyia pseudotsugata immediate early promoter, the herpes thymidine kinase promoter (Wagner, et al., Proc. Natl. Acad. Sci. USA 78:1441-1445 (1981)) or the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)). Other acceptable promoters include the human CMV promoter, the human CMV5 promoter, the murine CMV promoter, the EF1a promoter (also known as EF1A promoter) or the SV40 promoter.

In one embodiment, the promoter is CAG promoter or EF1A promoter. Advantageously, these promoters were found to function well after transfection in eye field progenitor cells. As used herein, the term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one is affected by the other. For example, a polynucleotide sequence is said to be “operably linked” to a promoter if the two sequences are situated such that the promoter affects the expression of the polynucleotide sequence (i.e., the polynucleotide sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

The vector may be a plasmid. A plasmid typically comprises an origin for autonomous replication in a host cell, a selectable marker, a plurality of restriction enzyme cleavage sites, a suitable promoter sequence, and a transcription terminator, which are operably linked together. The target sequence encoding the polypeptide is operably linked to transcriptional and translational control sequences that provide for expression of the polypeptide in a host cell. A large number of suitable plasmids are known to those skilled in the art, and many are commercially available. Examples of suitable plasmids are provided by Sambrook et al, Molecular Cloning: A Laboratory Manual (2^nd Ed.), Vols.1-3, Cold Spring Harbor Laboratory (1989), and Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York (1997).

In a preferred embodiment, the vector is pCAG-KLF7. The plasmid pCAG-KLF7 includes the cytomegalovirus immediate-early enhancer/ chicken β-actin (CAG) promoter, the KLF7 open reading frame (ORF), the puromycin N-acetyltransferase (pac) gene and an ampicillin resistance gene.

In another embodiment, the vector is an episomal vector. The episomal vector may be an adeno-associated virus (AAV) vector.

As used herein, the term "adeno-associated virus" (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 1 1 , avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, Clade F AAV and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al, VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of other AAV serotypes and clades have been identified (see, e.g., Gao et al. (2004) J Virology 78:6381-6388 and Table 1). The genomic sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art. The term "AAV vector" as used herein means any vector that comprises or derives from components of AAV and is suitable to infect mammalian cells, including human cells, of any of a number of tissue types, whether in vitro or in vivo. The term "AAV vector" may be used to refer to an AAV type viral particle (or virion) comprising at least a nucleic acid molecule encoding a protein of interest. The terms “AAV vector” and “AAV plasmid” are used interchangeably. Cis-regulatory elements such as promoters and enhancers can be used to control AAV-mediated gene expression. In many cases, strong, constitutively active promoters are desired for high-level expression of the gene of interest. Commonly used promoters of this type include the CAG promoter, CMV promoter/enhancer, EF1a and SV40. In one embodiment, the AAV vector comprises the polynucleotide sequence encoding KLF7.

In another embodiment, the step of overexpressing KLF7 in the method as described herein comprises introducing a synthetic modified RNA encoding KLF7 into the eye field progenitor cells.

As used herein, the term “synthetic modified RNA” is meant to include a nucleic acid molecule encoding a polypeptide to be expressed in a host cell, which comprises at least one modified nucleoside and has at least the following characteristics as the term is used herein: (i) it can be generated by in vitro transcription and is not isolated from a cell; (ii) it is translatable in vivo in a mammalian (and preferably human) cell; and (iii) it does not provoke or provokes a significantly reduced innate immune response or interferon response in a cell to which it is introduced or contacted relative to a synthetic, non-modified RNA of the same sequence. The modifications to the nucleoside may include nucleoside methylation to endow the synthetic modified RNA with high stability and reduced stimulation of innate immunity. For example, uridine can be replaced with a similar nucleoside such as pseudouridine (ψ ) or N1-methyl- pseudouridine (m1 ψ ), and cytosine can be replaced by 5-methylcytosine.

The synthetic modified RNA may be introduced into the eye field progenitor cells by transfection. Methods of transfection include physical treatments (electroporation, nanoparticles, magnetofection), and chemical-based transfection methods. Chemical-based transfection methods include, but are not limited to, cyclodextrin, polymers, liposomes, and nanoparticles. In some embodiments, cationic lipids or mixtures thereof can be used to transfect the synthetic modified RNA described herein, into a cell.

In various embodiments, the eye field progenitor cells are generated from pluripotent stem cells. In one embodiment, the eye field progenitor cells are generated from pluripotent stem cells by culturing the pluripotent stem cells with a WNT inhibitor. Examples of WNT inhibitors include XAV939 and IWR1. XAV939 may be used at a concentration of about 1 μM. In one embodiment, the WNT inhibitor is IWR1. In one embodiment, IWR1 is present at a concentration of about 4 μM. Advantageously, the use of IWR1 increases the percentage of RGCs generated by during differentiation. For example, the use of IWR1 may result in 50% of cells being RGCs at the end of differentiation, whereas the use of XAV939 may result in 40% of cells being RGCs at the end of differentiation. The pluripotent stem cells may also be cultured with bFGF to generate the eye field progenitor cells. bFGF may be used at a concentration of about 20 ng/ml.

The term “stem cells” as used herein refers to cells capable of self-renewal and that are capable of differentiating into more specialised cells. As used herein, stem cells may include embryonic stem cells or induced pluripotent stem cells. The pluripotent stem cells as used herein may include but are not limited to human and non-human primate stem cells. Human pluripotent stem cells may include human embryonic stem cells or human induced pluripotent stem cells. In some embodiments, the pluripotent stem cells as used herein may be human embryonic stem cells, human induced pluripotent stem cells, adult stem cells or primate induced pluripotent stem cells. In a preferred embodiment, the pluripotent stem cells are ESCs, more preferably human ESCs. By “embryoid bodies” (EBs), it is meant to include three- dimensional aggregates of pluripotent stem cells.

The term “differentiating” or “differentiation” as used herein refers to the developmental process by which a cell has progressed further down a developmental pathway than its immediate precursor cell. A differentiated cell is a cell of a more specialised cell type derived from a cell of a less specialised cell type in a cellular differentiation process. A differentiated cell is one that has taken on a more committed position within the lineage of the cell.

In one embodiment, the overexpression of KLF7 in the method as described herein comprises expressing KLF7 at a level that is at least 2 times, at least 3 times or at least 4 times of a reference expression level of KLF7. The reference expression level may be a normal or typical expression level of the gene. For example, the reference expression level can be the expression level of a gene in a control sample of cells that have not been engineered to overexpress the gene.

The KLF7-overexpressed eye field progenitor cells obtained from step (a) of the method as described herein may be cultured in a medium under conditions suitable for retinal ganglion cell (RGC) formation. It would be generally understood by a person skilled in the art that the eye field progenitor cells may be further differentiated into RGC progenitor cells (also known as RGC precursor cells) and subsequently to RGCs. Eye field progenitor cells are known to have higher expression of SIX3/6, PAX6, LHX2, and OTX2 compared to the rest of cell types in the eye during retinal development. RGC progenitor ceils are known to have a higher gene expression of ATOH7 compared to the rest of the cell types in the eye during retinal development. RGCs are known to have higher gene expression of POU4F1 , POU4F2, and ISL1 during retinal development compared to other cell types in the eye. in particular; the RGC progenitor cells obtained with KLF7 overexpression may have at least 1.18 times higher expression of EBF1 and EBF3 compared to known RGC progenitor cell populations, with a significance level of p<0.01 using one-sided Wilcoxon rank-sum test. The RGCs obtained with KLF7 overexpression of the present disclosure may have at least 1.18 times higher expression of SREBP2 compared to known RGC populations, with a significance level of p<0.01 using one-sided Wilcoxon rank-sum test.

An example of a suitable medium to be used in step (b) of the method as described herein is N2B27 medium, in one embodiment, the medium comprises a Notch inhibitor such as N~(N~ [3,5-difluorophenacetyl]-L-alanyi)-S-phenylglycine t-butyl ester (DAPT) to push RGC progenitor cells towards RGC fate. DAPT may be present at a concentration of about 4 μM. The medium may further comprise brain-derived neurotrophic factor (BDNF). BDNF may be present at a concentration of about 50 ng/ml.

In various embodiments, step (b) of the method as described herein comprises culturing the KLF7-overexpressed eye field progenitor cells in a medium comprising N2/B27, bFGF, N-(N- [3,5-difluorophenacetyi]~L~aianyl)-S-phenyigiycine t-butyl ester (DAPT) or (brain-derived neurotrophic factor (BDNF).

The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

Any document referred to herein is hereby incorporated by reference in its entirety.

In order that the present invention may be fully understood and readily put into practical effect, there shall now be described by way of non-limitative examples only preferred embodiments of the present invention, the description being with reference to the accompanying illustrative figures. In the Figures:

Figure 1 shows the transcription factor (TF) network in the various neural and glial cell types of the human eye. TFs that belong to the same module (shown in the same colour) were clustered together. The correlation matrix of the TFs involved in forming the 13 different TF modules in the human eye was shown in the corner. Dotted circle shows that KLF7 is present in RGC module in the whole eye network.

Figure 2 shows the differentiation of H9 cells into retinal ganglion cells (RGCs). A) Protocol used for differentiation for retinal ganglion cells. B) Cell culture images at different stages of differentiation. Scale bars- 100 μM. C) Shows the schematic for differentiation with time points and media conditions used in accordance with the present embodiments. D) Immunofluorescence at Day 32 of differentiation showed that POU4F2 and POU4F1 are localised in the spherical neuron regions. Similarly, TUJ 1 and KLF7 are also localised in similar areas. Scale bar is 200 μM. E) shows the single cell RNA sequencing of RGCs during differentiation using IWR1 from Day 15 to Day 33. The proportion of ceils labelled RGCs (both RGCI and RGCII) increase to 50% at Day 26 and Day 33.

Figure 3 shows the current-voltage profile and intrinsic membrane properties of firing RGCs. A) Exemplar traces of a firing RGC showing the voltage sensitive current evoked from holding potential of -70 mV to different test potential ranging from -90 mV to 50 mV with 10 mV increment. B) Current voltage profile of peak inward sodium current and outward potassium current density. Data presented are mean ± SEM. The current density for each cell was obtained by normalizing the peak current (pA) against the cell capacitance (pF) prior to averaging. The number of cells recorded are indicated in the parentheses. C) Current clamp recording of a firing RGC with injection of increasingly positive current. D) The frequency of action potential with current injection for firing cells. E) Exemplar picture of an RGC being recorded.

Figure 4 shows the significant difference in the voltage sensitive current density (absolute current normalized against the cell capacitance) between firing and non-firing neurons. * p<0.05, **p<0.01 unpaired Student t-test (2-tails).

Figure 5 shows that knockdown (KD) of KLF7 delays maturation. A) Schematic for Knockdown experiments. B) KLF7 shRNAs transfection show knockdown in the levels of KLF7 expressing cells. C) The average expression KLF7 across decreases in KLF7 KD cells. D) Markers used to annotate cell types in differentiating RGC ceils. E) scRNAseq of shEV and shKLF7 RGC cells during day 18 of differentiation. F) Differentially expressed genes across different ceil types in shKLF7 and shEV libraries. The genes which have a dot behind them are the members of TFs specific to RGCs.

Figure 6 shows that overexpression of KLF7 drives cells towards RGC lineage in accordance with the present disclosure. A) Schematic for overexpression studies. B) pCAG KLF7 increased the proportion of cells expressing KLF7. C) KLF7 overexpression (OE) increased K.LF7. D) Markers’ average expression for annotation of cell types in differentiating RGC cells. E) scRNA.seq of pCAG-EV and pCAG-KLF7 RGC cells during day 18 of differentiation. This data was obtained using single cell RNA sequencing using 10x Genomics 3 prime RNA sequencing protocol and RNA sequencing bioinformatics analysis. Dotted rectangles shows the increase in RGC cells. F) Differentially expressed genes across different cell types in KLF7-OE and EV-OE libraries. This data was obtained using single cell RNA. sequencing using 10x Genomics 3 prime RNA sequencing protocol and RNA sequencing bioinformatics analysis. The genes that have a dot behind them are the TFs specific to RGCs.

Figure 7 shows the preparation of single-cell transcriptome atlas of the human eye. A) Overview of single-cell RNA-seq libraries prepared from different sources. Postmortem human and pig eyes were enzymatically dissociated, and single cells were isolated. Approximately 50,000 single cells across the human eye of six individuals using droplet-based scRNA-seq platform were profiled. B) tSNE plot visualisation of human eye cell-types coloured by 16 different transcriptionally distinct clusters. C) Heatmap of differentially expressed genes (DEGs) used to classify cell types for each cluster. The top 5 genes were selected using the one-sided Wilcoxon rank-sum test (p-value < 0.01 & |avg-og2FCI > 0.25), and ranked based on their p-values within each identified cell type. Scaled expression levels for each cell are colour-coded. D) tSNE plots showing expression of selected marker genes depicting major classes of cells in the human eye. Scaled expression levels for each cell are colour-coded and overlaid onto the t-SNE plot E) GO analysis of DEGs associated with distinct clusters. Metascape calculated the statistical significance of each GO term enrichment (p-value) based on the accumulative hypergeometric distribution.

Figure 8 shows a meta-analysis of retinal cells with different donors and species. A) Highlighted region of the eye was selected for single-cell analyses. B) tSNE plot visualisation of cells obtained from human retina. 10 transcriptionally distinct clusters were observed in the neural retina of eye. C) Patterns of gene expression as determined by scCoGAPS algorithm in retinal cell-types of the human eye. The correlation of each pattern to human retinal cell types is colour-coded. D) Pattern 17 shows a high correlation to Muller glial cells across species. E) Bubble plot showing expression levels of the top 20 genes by gene weight of pattern 17. The size of each circie is proportioned to the percentage of celis expressing the gene, and its intensity depicts the average transcript count within expressing ceiis. F) Correlation of human pattern 17 with resting Muller glial ceiis and Muller giiai ceiis activated after injury in zebrafish. G) The patterns of gene expression in zebrafish Muiier giiai ceiis which are activated after injury. H) Respective GO of the patterns in Fig 8G. Metascape caicuiated the statisticai significance of each GO term enrichment (p-vaiue) based on the accumulative hypergeometric distribution. I) List of genes that are common between human pattern 17 and zebrafish pattern 78.

Figure 9 shows the reconstruction of transcriptional regulons that are active in different neural/giial ceil types of the human eye. A) Violin plots showing activities of the identified transcription factor modules scores in each ceil type. Rows correspond to ceil types obtained from different doners, while columns correspond to TF modules specific to a particular ceil type. B) - C) The representative bubble plot for M1 module (B) and M5 module (C) are specific for RGCs and PRs, respectively. Rows correspond to ceil types from different donors, and columns correspond to the TFs that are part of each module. D) Regulon activity of selected modules visualised on tSNE plot. Scaled scores for each ceil are colour-coded.

Figure 10 shows that KLF7 acts as a driver for RGC maturation. A) GO analysis of TFs and their targets specific to Ml modules. Metascape caicuiated the statistical significance of each GO term enrichment (p-value) based on the accumulative hypergeometric distribution. B) Representative RNA FISH images of the RGOspecific TFs KLF7. n=2 technical replicates, immunofluorescence of the KLF7 with TUJ1 was also shown in the non-human primate retina. n=2 technical replicates. Scale bar = 20 um.

Figure 1 1 shows data quality post-processing and pig single-cell atlas. A) Proportion of cell types present in each tissue. B) Proportion of cell cycle phases in each ceil type. C) Bubble plot showing expression of Y chromosome and maternal X chromosome-linked genes. Rows contain the donor names, while columns represent genes. D) Scatter plot showing normalized expression values of OPN1 LWOPN1MW (x-axis) and OPN1SW (y-axis) for all cone cells identified in each donor. E) Percentages of cone cells having either S or L/M wavelength cones. F) Enriched phenotype ontologies in DEGs of Rod PR or Melanocytes. The phenotypic ontology was obtained from modPheEA. Fisher’s exact tests were applied to obtain a p-value for each phenotype based on the null hypothesis. G) Information about doners whose eye ceiis were used for scRNA-seq experiments. H) tSNE plot visualization of pig retina, RPE and iris cells. Figure 12 shows characterization of ceil types among retina across donor/species. A.) Bobbie plot showing expression of canonical markers specific for distinct cell-types in neural retinal layers of the eye. The size of each circle is proportional to the percentage of cells expressing the gene, and its intensity depicts the average transcript count within expressing ceils. B) Bubble plot showing expression of novel markers specific for distinct cell types in neural retinal layers of the eye. The size of each circle is proportional to the percentage of cells expressing the gene, and its intensity depicts the average transcript count within expressing cells. C) Comparison of the expression of cone cell markers between our study and Lukowski, S. W. &t al. A single-cell transcriptome atlas of the adult human retina. Embo j 38, e100811, doi:10.15252/embj.2018100811 (2019) and Menon, M. et a/. Single-cell transcriptomic atlas of the human retina identifies cell types associated with age-related macular degeneration. Nat Common 10, 4902, doi:10.1038/s41467-019-12780-8 (2019). D) The patterns of gene expression in human retinal cells projected into cross-species retinal cell types. E) - K) Specificity of Pattern 13 in Amacrine cells, Pattern 24 in Cone cells, Pattern 34 for Cone bipolar cells, Pattern 4 for Horizontal cells, Pattern 2 for RGC ceils, Pattern 71 for Rod cells, and Pattern 6 for Rod bipolar cells across species.

Figure 13 shows characterization of transcription factor modules of all cell types of eye. A) Schematic describing the method to generate cell type-specific TF module. B) Transcription factor markers specific in neural/glial cells of eye presented in tabular format. C)~ E) Bubble plot showing expression of TPs grouped by the identified modules in sclera/'choroid cells (C), corneal cells (D) and iris cells (E) in the eye. The size of each circle is proportional to the percentage of cells expressing the gene, and its intensity depicts the average transcript count within expressing cells.

Figure 14 shows an understanding of the role of KLF7 in RGC maturation. A) RNA FISH of PBX1 and SREBF2 showing the localization in INL layer and GCL layer respectively. n=2 technical replicates. Immunostaining of PBX1 and SREBF2 with TUJ1 in non-human primate samples. n=2 technical replicates. Scale bar = 20 pm. B) - C) PCA-dimension reduction of expression profiles of 31 genes in M1-M9 modules, showing sufficient segregation between different cell types of the retina across species. D) - E) PCA-di mansion reduction of expression profiles of randomly selected 31 TFs as a negative control. F) Checking conservation of TFs by plotting pairwise correlation across species. METHODS AMD MATERIALS

Human ESCs (H9 [WA09, P35-50], WiCell. Madison, VVi , USA.) were cultured and maintained in mTeSRI media (Stemcell Technologies) in Matrigel (Coming life sciences) coated plates.

The protocol for RGC differentiation was adapted from Lee ef al. Defined Conditions for Differentiation of Functional Retinal Ganglion Celis From Human Pluripotent Stem Celis. Invest Ophthalmol Vis Set 59, 3531-3542, doi:10.1167/iovs.17-23439 (2018), which is herein incorporated by reference in its entirety.

Embryoid bodies were created by dissociating H9 cells, which were 80 % confluent with Accutase (Invitrogen) and resuspending them with mTeSRI with 10 μM Y-27632 (Sigma Aldrich) in 96 well ultra-low attachment plates (Corning Costar).

To induce eye field progenitor ceils, embryoid bodies were cultured for 4 days in suspension with 5 μM dorsomorphin (Sigma Aldrich), 5 μM SB431542 (Sigma-Aldrich), 0.5 to 1 μM XAV939 (XAV; StemCeil Technologies), and 10 ng/mL insulin-like growth factor-1 (IGF-1 ; Peprotech) in MEM/F12 medium (Invitrogen) supplemented with 20% Knockout-Serum Replacement (Invitrogen), 1 x nonessential amino acids (invitrogen) and 0.1 mM beta- mercaptoethanol (Sigma-Aldrich).

The embryoid body were transferred to Matrigel (BD Biosciences)-coated dishes and cultured in N2 medium containing DMEM/F12 and 1x N2 (Invitrogen) supplemented with 2 pL/mL insulin (Sigma-Aldrich), 1 μM XAV, and 60 ng/mL bFGF for 4 days.

After four days, neural rosettes appear at the centre of EB colonies and were removed by pipetting. Such clumps of cells were plated onto Matrigel-coated dishes after pipetting slowly. After that, cells were then cultured in N2B27 medium containing DMEM/F12, 1x N2, and 1 x B27 without vitamin A (invitrogen) added with 20 ng/mL bFGF.

After the ceils become confluent, the cells were treated with Accutase (Invitrogen) to get single cells after dissociation. These cells are re-plated onto new Matrigel-coated dishes in N2B27 medium.

The media was changed everyday and cells were passaged every 2 to 3 days for further expansion. For differentiation toward RGCs, cells were seeded onto Matrigel-coated dishes and cultured in N2B27 medium added with 4 μM with N-(N-[3,5"difluorophenacetyl]-L-alanyl)- S-phenylglycine t-butyl ester (DAPT; Sigma-Aldrich) for 10 days. Brain-derived neurotrophic factor (BDNF; Stemceil Technologies) was added beginning on day 16 help with neuron survival.

For transient transfection of eye field progenitor cells, KLF7 open reading frame (ORF) was cloned into pCAG-puro plasmids. pCAG plasmids were created from original construct pCAG- FLAG-puro-PTPIP51 (1-470) from Addgene. K.LF7 was cloned using restriction enzymes Xhol and Notl. First, 1 μg of pCAG-KLF7 plasmids was added to 180 μl of OptiMEM media (Thermofisher Technologies). it was mixed thoroughly by pipetting and incubated for 5 minutes at room temperature. Eugene HD (Promega) (4 μl) was added to 1 μg of plasmid and mixed and let it stay at room temperature for 10 minutes. The mixture was then added to eye field progenitor cells that were cultured in N2/B27 supplemented with 20 ng/'pi bFGF. After transfection, media was changed 24 hours later to a media comprising N2/B27 added with DAPT. The cells could be cultured till maturation after this step.

Generation of AAV vector encoding KLF7 pAAV-Ef1a-mCherry-IRES-Cre (Phasmid #55632) from Addgene is used to done KLF7 into AAV plasmids. The Cre region in the plasmid would be replaced by KLF7 using Takara Bio^:s In-Fusion seamless cloning. The construct would be packaged with the help ef pAdDeltaFS (helper plasmid) and pAAV2/9n (AAV packaging plasmid expressing Rep/Cap genes) (Plasmid #112865).

Generation of synthetic modified RNA encoding KLF7

KLF7 is cloned into pcR4Biunt-TOPO vector using a Zero Blunt PCR cloning Kit (Thermofisher Technologies). pcR4Blunt-TOPO has T7 promoter site before insert. The pcR4Blunt-TOPO KLF7 is linearized with a restriction enzyme digestion (Spel). Modified RNA is synthesized by using HiScribe T7 ARCA mRNA Kit (NEB Biosystems) in linearized pcR4Biunt-TOPO KLF7 vector. The mRNAs are then purified by MEGAciear Transcription Clean-Up Kit (Thermofisher Technologies). The purified mRNAs are transfected to ceils using cationic lipids (Lipofectamine).

For transient transfection of RGC cells, shKLF7I and shKLF7II shRNAs were cloned in pSUPER puromycin plasmids. One microgram of plasmids was added to 180 ul of OptiMEM media (Thermofisher Technologies). It was mixed thoroughly by pipetting and incubated for 5 minutes at room temperature. 4 ul of Fugene HD (Promega) was added to 1 ug of plasmid and mixed and incubated at room temperature for 10 minutes. The mixture was then added to differentiating Retinal ganglion ceil culture that was four days post addition of DART. The cells were treated with 0.15 uM of puromycin after 24 hours of treatment. The cells were harvested after 48 hours of transfection for single-cell RNA.seq analysis. For overexpression studies, KLF7 ORF was cloned into pCAG-puro plasmids. The cells were transfected into RGC cells before DART treatment and allowed to mature into RGC cells for six days and then harvested for single-cell RNAseq. The target sequences for shKLF7l is GCTAGTTATAGTATATTCCA and shKLFTII is GCCTTGAATTGGAACGCTA.

Advantageously, the method of the present invention comprising the step of overexpressing KLF7 results in the efficient generation of RGCs. As shown in Figure 6E, in the presence of KLF7 overexpression, RGC progenitor cells are shown to have higher expression of RGC markers and higher percentages of RGC-like cells.

EXAMPLES

The present disclosure provides a method of directing lineage of progenitor ceils towards RGC cell formation by overexpressing novel transcription factors. The present disclosure also provides a transcriptional factor landscape specific to adult RGC cells. As an example, overexpression of KLF7 during differentiation is shown to accelerate early progenitor cells towards RGC lineage. Overexpression of KLF7 in progenitor cells shows an increase in expression of TFs specific to RGCs, such as EBF1 and EBF3.

The retina from several human donors was sequenced and a pipeline was made to understand transcriptional regulons active in different cell types. The Reguion activity score computed from SCENIC was combined with gene imputation scores calculated from MAGIC to create a pairwise correlation of TFs active in cell types (Fig 1). As a result, 13 modules that are specific to cell types in the retina were found (Fig 1). For example, module M1 is specific to Retinal ganglion cells. Using this map, one TF, KLF7, was selected to assess its role in retinal ganglion cell differentiation.

WNT signalling inhibitors like XAV939 were used to initiate the process of RGC differentiation. It helped in inducing the cells towards retinal lineage and assisted in the expression of eye field TFs. After mechanically isolating neural rosette structures at day 8 of differentiation, the cells were allowed to expand. The notch signalling pathway was inhibited by DART treatment in the culture. It helped to push eye progenitor cells towards RGC lineage. The maturation of neurons was achieved by long term culture in BDNF supplementation in the media (Fig 2a).

Cell culture images show how axon bundle like ceils are generated at day 32 during differentiation. Our RGC culture is heterogeneous. Mesenchymal cells can be observed at the background of neurondike cells in day 32 culture (Fig 2b). To validate the ceils that were derived were RGC, immunofluorescence was also done with markers like POU4F2, POU4F1 , and TUJ1. It was found that POU4F2 and POU4F1 were exclusively localised in the neuronal spheres at day 32 of differentiation. The protocol according to the present embodiments (Fig. 2c), which was modified from Lee et a/. Defined Conditions for Differentiation of Functional Retinal Ganglion Cells From Human Pluripotent Stem Cells. Invest Ophthalmol Vis Sci 59, 3531-3542, doi:10.1167/iovs.17-23439 (2018), shows that 4 uM IWR1 may be used as an alternative to 1 uM XAV939 during culture from day 1-4. Also, it shows the timing at Day 12 where KLF7 overexpression is carried out during differentiation. Immunofluorescence was also done with KLF7 to find its localisation in the culture and it was found that KLF7 also localised in the neuronal spheres like region of culture (Fig 2d).

One of the ways of determining if the RGCs generated are functional or not is by performing patch ciamp electrophysiology experiments. Functional RGC show distinct voltage profile compared to non-functional RGCs. The retinal ganglion cells (RGCs) were recorded with the internal solution (pipette solution) containing (in mM) 130 K-gluconate, 10 KCi, 5 EGTA, 10 HEPES, 1 MgCl₂, 0.5 Na₃GTP, 4 Mg-ATP, 10 Na-phoshocreatine pH 7.4 (adjusted with KOH) and external solution containing (in mM): 10 Glucose, 125 NaCI, 25 NaHCO₃, 1.25 NaH₂PO_4.2H₂O, 2.5 KCi, 1.8 CaCl₂, 1 MgCl₂ pH 7.4 (300-310 mOsm). Whole cell recording are performed with multiclamp 2008 and 700b amplifier (Molecular Device), low-pass filtered at 1 kHz and the series resistance was typically < 10 MQ after > 50% compensation. The P/4 protocol was used to subtract online the leak and capacitive transients.

From the patch clamp electrophysiology experiments of RGCs generated using conventional methods, it was found that at least 52.3% of RGCs are firing neurons that present a voltage profile similar to functional RGCs.

Knockdown experiments were performed in cells that were driven to RGC lineage (Fig 5a). Successful knockdown (KD) was achieved by shRNA transfection. Two constructs, shKLFT7 I and shKLF7 II, were used to show up to a 40% decrease in KLF7 expressing cells (Fig 5b). The average expression of KLF7 decreased in KD cells (Fig 5c). Since ceils were still in the process of differentiation, mature RGC markers are lowly expressed. However, markers like POU4F1 and EBF3, which act as markers for maturing RGC. are present in cells (Fig 5d). Cells expressing ONECUT1 , ONECUT2, EBF3 are designated as RGC precursor cells because ONECUT TFs are expressed in developing RGCs. As a result of the knockdown of KLF7, drastic differences can be seen in the proportion of cells that are destined to be RGCs (Fig 5e). Also, genes like POU4F1 , IRX2 and EBF3, which comprise the transcription factors specific to RGC, were downreguiated after KD. In RGC precursor cells, decreased expression of EBF1 , RGC specific TF, was observed (Fig 5f).

KLF7 was also overexpressed during the early window of differentiation (Fig 6a), which aimed to verify whether the acceleration of RGC differentiation can be achieved by KLF7 alone. KLF7 was overexpressed using the pCAG vector system. It increased the proportion of cells expressing KLF7 (Fig 6b) and increased the average expression of KLF7 (Fig 6c). it was annotated using the markers listed In Fig 6d. Expectedly, the early differentiation window did net yield many mature RGCs. However, the proportion of RGC like ceils was increased after KLF7 GE (Fig 6e). Even at Day 18, the proportion cf RGCHike cells is 2.57 times higher compared to control (OE-EV). Moreover, KLF7 OE also increased the expression of RGC TFs, like EBF3, SREBF2 and EBF1 in RGC precursor cells (Fig 6f). SOX4 and SOO11 function to regulate the development of retinal ganglion cells. They have been shown to play an intermediate role between A.toh7 and Pou4f2 in the hierarchy of RGC development. It can be seen that the expression of SOX4 and SOX11 is higher in RGC precursor ceils after KLF7 overexpression (Fig 6f). Those changes hint that KLF7 has a role in biasing ceil fate towards RGCs during retinogenesis.

Figures 7 to 14 show data as a background to how the present inventors focused on KLF7 and RGCs to arrive at the present invention. Figure 7 shows from the resuits of sequencing both the anterior and posterior regions of eye to find the diversity of ceii types within the eye. After annotating the ceii types with markers, the ceiis were studied in detaii. in Figure 8, an analysis was done on the retina of humans and cross-species analyses were carried out with pig, zebrafish, macaque, and mice. These analyses allowed for the identification of conserved gene patterns across species. Figure 9 describes the transcription factors that are specific to a ceil type in a human eye. This transcription factor network allowed for the identification of crucial factors that might help in generating better cell types during differentiation. Figure 11 is evidence of the shows the high quality of data obtained from the present dataset. The Quality control metrics shows that the number of genes expressed was of decent quality. Figure 12 shows how the retina samples from the present datasets are similar to previously public retina single cell RN,4seq datasets. Figure 13 shows the characterization of transcription factors active in cell types across different tissues of the eye. Figure 14 shows how the transcription factors are conserved across species. One of the targets, KLF7, is shown to be conserved across mice, macaque and humans.

While embodiments of the invention have been particularly shown and described with reference to specific embodiments, it should be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims. The scope of the invention is thus indicated by the appended claims and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced.

Claims

1. A method for generating retinal ganglion cells (RGCs), the method comprising the steps of:

(a) overexpressing KLF7 in eye field progenitor cells; and

(b) culturing the KLF7-overexpressed eye field progenitor cells in a medium under conditions suitable for RGC formation.

2. The method of claim 1, wherein the step of overexpressing KLF7 comprises introducing a polynucleotide sequence encoding KLF7 into the eye field progenitor cells.

3. The method of claim 2, wherein the polynucleotide sequence encoding KLF7 is introduced into the eye field progenitor cells using a vector.

4. The method of claim 3, wherein the vector comprises a promoter operably linked to the polynucleotide sequence encoding KLF7.

5. The method of claim 4, wherein the promoter is CAG promoter or EF1A promoter.

6. The method of any one of claims 3 to 5, wherein the vector is pCAG-KLF7.

7. The method of claims 4 or 5, wherein the vector is an episomal vector.

8. The method of claim 7, wherein the episomal vector is an adeno-associated virus (AAV) vector.

9. The method of claims 1 or 2, wherein the step of overexpressing KLF7 comprises introducing a synthetic modified RNA encoding KLF7 into the eye field progenitor cells.

10. The method of any one of claims 1 to 9, wherein the eye field progenitor cells are generated from pluripotent stem cells.

11. The method of claim 10, wherein the pluripotent stem cells are embryonic stem cells (ESCs).

12. The method of claims 10 or 11 , wherein the pluripotent stem cells are cultured with a WNT inhibitor.

13. The method of claim 12, wherein the WNT inhibitor is IWR1.

14. The method of claim 13, wherein IWR1 is present at a concentration of about 4 μM.

15. The method of any one of claims 1 to 14, wherein overexpressing KLF7 comprises expressing KLF7 at a level that is at least 2 times, at least 3 times or at least 4 times of a reference expression level of KLF7.

16. The method of any one of claims 1 to 15, wherein step (b) comprises culturing the KLF7-overexpressed eye field progenitor cells in a medium comprising N2/B27, bFGF, N-(N- [3,5-difluorophenacetyl]-L-alanyl)-S-phenylglycine t-butyl ester (DAPT) or (brain-derived neurotrophic factor (BDNF).