WO2023042944A1 - Composition for preventing, ameliorating, or treating gastric cancer - Google Patents

Composition for preventing, ameliorating, or treating gastric cancer Download PDF

Info

Publication number
WO2023042944A1
WO2023042944A1 PCT/KR2021/012879 KR2021012879W WO2023042944A1 WO 2023042944 A1 WO2023042944 A1 WO 2023042944A1 KR 2021012879 W KR2021012879 W KR 2021012879W WO 2023042944 A1 WO2023042944 A1 WO 2023042944A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
composition
present
protein
pharmaceutically acceptable
Prior art date
Application number
PCT/KR2021/012879
Other languages
French (fr)
Korean (ko)
Inventor
정재호
김재우
황성순
윤보경
황라희
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to PCT/KR2021/012879 priority Critical patent/WO2023042944A1/en
Publication of WO2023042944A1 publication Critical patent/WO2023042944A1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/47064-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4709Non-condensed quinolines and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • One object of the present invention is to provide a composition for determining the suitability of a cancer therapeutic agent.
  • Another object of the present invention is to provide a composition for diagnosis of gastric cancer.
  • Another object of the present invention is to provide a diagnostic device for gastric cancer.
  • Another object of the present invention is to provide a composition for preventing, improving or treating cancer and a method for preventing, improving or treating cancer.
  • the "oligopeptide” is a peptide composed of 2 to 20 amino acids and may include a dipeptide, tripeptide, tetrapeptide and pentapeptide, but is not limited thereto.
  • the companion diagnostics is a test that selects a subject for a target therapeutic agent in advance, and is performed by examining the genetic characteristics of the subject, more specifically, the level of expression of a gene or protein, the presence or absence of a specific gene, etc. It can be. This can provide essential information for effective use of the target drug, and can monitor the response during future treatment by predicting or treating the subject's drug reactivity, drug sensitivity, and the possibility of drug side effects through accompanying diagnosis. there is. Recently, in the field of anticancer drugs, companion diagnostics for personalized treatment are in the limelight.
  • the efficiency of cancer treatment can be increased or the side effects of the treatment can be reduced, and furthermore, the economic effect of preventing unnecessary medical expenses is also achieved. can be expected
  • the candidate drug for cancer treatment may include mefloquine, and the mefloquine is [2,8-bis(trifluoromethyl)quinolin-4-yl]-piperidine represented by Formula 3 below -2-yl methanol ([2,8-bis(trifluoromethyl)quinolin-4-yl]-piperidin-2-yl methanol). It may also include a pharmaceutically acceptable salt of mefloquine, preferably mefloquine hydrochloride, but is not limited thereto.
  • cancer refers to or refers to a physiological condition typically characterized by unregulated cell growth in mammals.
  • the cancer is gastric cancer, thyroid cancer, parathyroid cancer, ovarian cancer, colon cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, and Hodgkin's lymphoma.
  • the "diagnosis” means to confirm the presence or characteristics of a pathological state, and for the purpose of the present invention, the diagnosis may be to predict the possibility of gastric cancer onset, growth, progression, or metastasis, or It may be to differentiate subtypes of gastric cancer.
  • composition according to the present invention When using the composition according to the present invention, it is possible to select a subject suitable for a drug capable of inhibiting caveolin-1-mediated endocytosis based on the genetic characteristics of gastric cancer patients, and furthermore, the composition according to the present invention is applied to the selected subject.
  • Gastric cancer particularly intractable gastric cancer, can be very effectively prevented, improved, or treated by administering.
  • FIG. 2 is a view showing the results of performing Cav1 immunofluorescence staining after an uptake test of tetramethylrhodamine-labeled high-molecular dextrin (TMR-DEX, Invitrogen) on a gastric cancer cell line of a stem-like subtype according to an embodiment of the present invention.
  • TMR-DEX tetramethylrhodamine-labeled high-molecular dextrin
  • FIGS. 8A and 8B are diagrams showing the results of confirming the cell proliferation effect when chloroquine is treated with GA326, an organoid derived from an intestinal subtype patient, and GA077, an organoid derived from a refractory patient, according to an embodiment of the present invention.
  • 10a to 10d are views confirming the tumor growth inhibitory effect upon treatment with chloroquine in a xenograft mouse model of a refractory gastric cancer cell line according to an embodiment of the present invention.
  • Another embodiment of the present invention relates to a gastric cancer diagnosis device including a measuring unit for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
  • a measuring unit for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same including a measuring unit for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
  • MKN1, HS746T a cell line having human-derived gastric cancer stem cell characteristics, from the Korean Cell Line Bank (KCRB).
  • SNU668, human-derived gastric cancer cell line SNU601, YCC7 and NCIN87 cells were obtained.
  • MKN1, SNU668, SNU601, and NCIN87 were prepared in RPMI1640 medium containing 10% fetal bovine serum (FBS), 2mM L-glutamine, 100 U/ml penicillin, and 100 ⁇ g/ml streptomycin according to the guidelines of the Korean Cell Line Bank.
  • FBS fetal bovine serum
  • 2mM L-glutamine 100 U/ml penicillin
  • streptomycin 100 ⁇ g/ml streptomycin
  • genome analysis of gastric cancer cell lines was performed to compare at the mRNA level, and based on the genome data of patients divided according to a clinically verified classification system, they were classified into intestinal molecular subtypes and intractable subtypes.
  • the genome analysis data was normalized with TPM, and the transcript expression of genes forming caveolin-1 and caveola complexes was shown on a heat map as TPM values (see FIG. 1c).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

A composition according to the present invention can very effectively prevent, ameliorate, or treat gastric cancer, specifically intractable gastric cancer, by screening a subject with suitable generic characteristics for a drug capable of suppressing caveolin-1-mediated endocytosis, and administering the drug into the screened subject.

Description

위암의 예방, 개선 또는 치료용 조성물Composition for preventing, improving or treating gastric cancer
본 발명은 위암의 예방, 개선 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for preventing, improving or treating gastric cancer.
암 (Cancer)이란 조직을 이루고 있는 세포가 비 정상적으로 무제한 증식하여 종양이 형성되도록 하고, 그에 따라 장기가 정상적인 기능을 수행할 수 없도록 하여 개체의 생명을 위협할 수 있는 매우 치명적인 질환이다. 2017 년 한국인 사망 원인 1 위가 악성 신생물(암)이었으며, 전체 사망자 중에서 27.6 %가 암으로 인해 사망하였다. 특히 위암 (gastric cancer; GC)은 세계에서 세 번째로 흔한 치명적인 암으로 인종, 성별 및 지역에 따라 암의 발생 부위에 있어서 차이가 있지만, 최근 분자 유전체 기술을 통해 분자적 특성에 따라 위암의 유형을 분류할 수 있게 되었다. Cancer is a very fatal disease that can threaten the life of an individual by allowing cells constituting tissues to proliferate abnormally and indefinitely to form tumors, thereby preventing organs from performing normal functions. The number one cause of death in Koreans in 2017 was malignant neoplasm (cancer), and 27.6% of all deaths were due to cancer. In particular, gastric cancer (GC) is the third most common fatal cancer in the world. Although there are differences in the site of cancer occurrence depending on race, gender, and region, recent molecular genomic technology has been able to classify gastric cancer types according to molecular characteristics. can be classified.
위암의 생물학적으로 관련된 하위 유형 중 특히 줄기 유사 특성을 가진 유형은 치료가 어려운 악성인 생물학적 특성을 가지며 표준 치료 화학 요법에 대한 무반응으로 인해 최악의 예후가 나타나며, 면역 체크 포인트 봉쇄 요법도 줄기 유사 암 아형에 대해 효과가 없는 것으로 확인되는 등의 문제점이 있다. Among the biologically related subtypes of gastric cancer, especially those with stem-like characteristics, have malignant biological characteristics that are difficult to treat and have the worst prognosis due to non-response to standard treatment chemotherapy, and immune checkpoint blockade therapy is also a stem-like cancer There are problems such as being found to be ineffective against subtypes.
이에 본 발명자들은 줄기 유사 아형 위암의 유전적, 대사적 특성에 따라 난치성 위암을 효과적으로 치료할 수 있는 암 치료용 약물을 발굴하기에 이르렀다.Accordingly, the present inventors have discovered a drug for cancer treatment that can effectively treat intractable gastric cancer according to the genetic and metabolic characteristics of stem-like subtype gastric cancer.
본 발명의 일 목적은 암 치료제의 적합성 판별용 조성물을 제공하는 것이다.One object of the present invention is to provide a composition for determining the suitability of a cancer therapeutic agent.
본 발명의 다른 목적은 암 치료제의 적합성 판별용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for determining the suitability of a cancer therapeutic agent.
본 발명의 또 다른 목적은 암 치료제 적합성에 관한 정보를 제공하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for providing information regarding the suitability of cancer therapeutics.
본 발명의 또 다른 목적은 위암의 진단용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for diagnosis of gastric cancer.
본 발명의 또 다른 목적은 위암의 진단용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for diagnosing gastric cancer.
본 발명의 또 다른 목적은 위암의 진단에 관한 정보를 제공하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for providing information on the diagnosis of gastric cancer.
본 발명의 또 다른 목적은 위암의 진단 기기를 제공하는 것이다.Another object of the present invention is to provide a diagnostic device for gastric cancer.
본 발명의 또 다른 목적은 암의 예방, 개선 또는 치료용 조성물 및 암의 예방, 개선 또는 치료 방법을 제공하는 것이다.Another object of the present invention is to provide a composition for preventing, improving or treating cancer and a method for preventing, improving or treating cancer.
본 발명의 또 다른 목적은 암 치료제 적용을 위한 대상체를 동반 진단하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for accompanying diagnosis of a subject for application of a cancer treatment.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세 사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, numerous specific details are set forth, such as specific forms, compositions and processes, etc., in order to provide a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, the appearances of "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, particular features, forms, compositions, or properties may be combined in one or more embodiments in any suitable way.
명세서 내에 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다. Unless there is a specific definition within the specification, all scientific and technical terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention belongs.
본 발명의 일 구현 예에 따르면, 암 치료제의 적합성 판별용 조성물에 관한 것이다.According to one embodiment of the present invention, it relates to a composition for determining the suitability of a cancer treatment agent.
본 발명에서 상기 판별용 조성물은 카베올린-1(Caveolin-1; Cav1) 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제를 포함할 수 있다. In the present invention, the composition for discrimination may include an agent for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
본 발명의 상기 카베올린-1 단백질은 인간 CAV1 유전자에 의해 코딩되는 단백질로서, 상기 유전자에 의해 암호화된 스캐폴딩 단백질은 대다수의 세포 유형에서 발견되는 카베올라 원형질막(caveolae plasma)의 주요 구성요소이다. 상기 단백질은 인테그린을 Ras-ERK 경로에 연결하고, 세포 주기의 진행을 촉진하는 시작 단계인 티로신키나제 FYN에 인테그린 소단위를 연결한다. 이 유전자는 종양 억제 유전자의 후보이며, Ras-p42/44 MAP 키나제 캐스케이드의 음성 조절자로도 알려져 있다. 상기 카베올린-1의 아미노산 서열 및 이를 암호화하는 핵산 염기 서열은 각각 서열번호 1과 서열번호 2로 표시될 수 있으나, 이에 제한되는 것은 아니다.The caveolin-1 protein of the present invention is a protein encoded by the human CAV1 gene, and the scaffolding protein encoded by the gene is a major component of the caveolae plasma found in most cell types. The protein links integrins to the Ras-ERK pathway and links integrin subunits to tyrosine kinase FYN, an initiating step that promotes cell cycle progression. This gene is a candidate tumor suppressor gene and is also known as a negative regulator of the Ras-p42/44 MAP kinase cascade. The amino acid sequence of caveolin-1 and the nucleic acid base sequence encoding the same may be represented by SEQ ID NO: 1 and SEQ ID NO: 2, respectively, but are not limited thereto.
본 발명의 상기 카베올린-1 단백질이 존재하는 수준을 측정하는 제제는 카베올린-1 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA (peptide nucleic acid) 및 앱타머 (aptamer)로 이루어진 군에서 선택된 적어도 하나를 포함할 수 있으나, 이에 제한되는 것은 아니다.The agent for measuring the level of the caveolin-1 protein of the present invention is composed of an antibody, oligopeptide, ligand, peptide nucleic acid (PNA) and aptamer that bind specifically to the caveolin-1 protein. It may include at least one selected from the group, but is not limited thereto.
본 발명의 상기 "항체"는 카베올린-1 단백질에 특이적으로 결합할 수 있는 단백질 분자를 의미하며, 상기 항체의 형태는 특별히 제한되지 않지만 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이라면, 항체의 일부인 경우라도 포함될 수 있고, 모든 종류의 면역 글로불린 항체가 포함될 수 있다. 또한, 인간화 항체 등의 특수 항체가 포함될 수 있고, 상기 항체는 2 개의 전체 길이의 경쇄 및 2 개의 전체 길이의 중쇄를 가지는 완전한 형태 뿐 만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2, Fv 등이 해당될 수 있으나, 이에 제한되는 것은 아니다.The "antibody" of the present invention refers to a protein molecule capable of specifically binding to the caveolin-1 protein, and the form of the antibody is not particularly limited, but polyclonal antibody, monoclonal antibody, or antigen binding. If it has, it may be included even if it is part of an antibody, and all types of immunoglobulin antibodies may be included. In addition, special antibodies such as humanized antibodies may be included, and the antibodies include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and may include Fab, F(ab'), F(ab') 2, Fv, etc., but is not limited thereto.
본 발명에서 상기 "올리고펩타이드"는 펩타이드로 2 내지 20 개의 아미노산으로 구성되며 디 펩티드, 트리 펩티드, 테트라 펩티드 및 펜타 펩티드를 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "oligopeptide" is a peptide composed of 2 to 20 amino acids and may include a dipeptide, tripeptide, tetrapeptide and pentapeptide, but is not limited thereto.
본 발명에 상기 "PNA (Peptide Nucleic Acid)"는 인공적으로 합성된, DNA 또는 RNA와 비슷한 중합체를 가리키며, 1991 년 덴마크 코펜하겐 대학교의 Nielsen, Egholm, Berg와 Buchardt 교수에 의해 처음으로 소개되었다. DNA는 인산-리보스당 골격을 갖는데 반해, PNA는 펩타이드 결합에 의해 연결된 반복된 N-(2-아미노에틸)-글리신 골격을 가지며, 이로 인해 DNA 또는 RNA에 대한 결합력과 안정성이 크게 증가되어 분자 생물학, 진단 분석 및 안티센스 치료법에 사용되고 있다. PNA는 문헌[Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500]에 상세하게 개시되어 있다.In the present invention, the "PNA (Peptide Nucleic Acid)" refers to an artificially synthesized polymer similar to DNA or RNA, and was first introduced in 1991 by Professors Nielsen, Egholm, Berg and Buchardt of the University of Copenhagen, Denmark. Whereas DNA has a phosphate-ribose backbone, PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases the binding force and stability to DNA or RNA, and is thus used in molecular biology. , diagnostic assays and antisense therapies. PNA is described by Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500.
본 발명의 상기 "앱타머"는 단일 가닥 올리고 뉴클레오티드를 의미하는 것으로, 카베올린-1 단백질에 대한 결합 활성을 갖는 핵산 분자를 말한다. 상기 앱타머는 그 염기 서열에 따라 다양한 3 차원 구조를 가질 수 있으며, 항원-항체 반응과 같이 특정 물질에 대하여 높은 친화력을 가질 수 있다. 앱타머는 소정의 표적 분자에 결합함으로써 소정의 표적 분자의 활성을 저해할 수 있다. 상기 앱타머는 RNA, DNA, 변형된 핵산 또는 이들의 혼합물일 수 있으며, 그 형태가 직쇄상 또는 환상일 수 있다.The "aptamer" of the present invention refers to a single-stranded oligonucleotide, and refers to a nucleic acid molecule having binding activity to the caveolin-1 protein. The aptamer may have various three-dimensional structures according to its base sequence, and may have high affinity for a specific substance, such as an antigen-antibody reaction. An aptamer can inhibit the activity of a given target molecule by binding to the given target molecule. The aptamer may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be linear or cyclic in shape.
본 발명의 상기 카베올린-1 단백질을 암호화하는 유전자의 발현 수준을 측정하는 제제는 상기 카베올린-1 단백질을 암호화하는 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1 종 이상을 포함할 수 있으나, 이에 제한되는 것은 아니다.The agent for measuring the expression level of the gene encoding the caveolin-1 protein of the present invention is one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically binds to the gene encoding the caveolin-1 protein It may include the above, but is not limited thereto.
본 발명에서 상기 "프라이머"는 표적 유전자 서열을 인지하는 단편으로서, 정방향 및 역방향의 프라이머 쌍을 포함하나, 바람직하게는, 특이성 및 민감성을 가지는 분석 결과를 제공하는 프라이머 쌍이다. 프라이머의 핵산 서열이 시료 내 존재하는 비-표적 서열과 불일치하는 서열이어서, 상보적인 프라이머 결합 부위를 함유하는 표적 유전자 서열만 증폭하고 비특이적 증폭을 유발하지 않는 프라이머일 때, 높은 특이성이 부여될 수 있다.In the present invention, the "primer" is a fragment that recognizes a target gene sequence, and includes a forward and reverse primer pair, preferably a primer pair that provides an analysis result having specificity and sensitivity. High specificity can be imparted when the nucleic acid sequence of the primer is a sequence that is inconsistent with the non-target sequence present in the sample, so that the primer amplifies only the target gene sequence containing a complementary primer binding site and does not cause non-specific amplification. .
본 발명에서 상기 "프로브"란 시료 내의 검출하고자 하는 표적 물질과 특이적으로 결합할 수 있는 물질을 의미하며, 상기 결합을 통하여 특이적으로 시료 내의 표적 물질의 존재를 확인할 수 있는 물질을 의미한다. 프로브의 종류는 당 업계에서 통상적으로 사용되는 물질로서 제한은 없으나, 바람직하게는 PNA (peptide nucleic acid), LNA (locked nucleic acid), 펩타이드, 폴리펩타이드, 단백질, RNA 또는 DNA일 수 있으며, 가장 바람직하게는 PNA이다. 보다 구체적으로, 상기 프로브는 바이오 물질로서 생물에서 유래되거나 이와 유사한 것 또는 생체 외에서 제조된 것을 포함하는 것으로, 예를 들어, 효소, 단백질, 항체, 미생물, 동식물 세포 및 기관, 신경세포, DNA, 및 RNA일 수 있으며, DNA는 cDNA, 게놈 DNA, 올리고뉴클레오타이드를 포함하며, RNA는 게놈 RNA, mRNA, 올리고뉴클레오타이드를 포함하며, 단백질의 예로는 항체, 항원, 효소, 펩타이드 등을 포함할 수 있다.In the present invention, the "probe" means a substance that can specifically bind to a target substance to be detected in a sample, and means a substance that can specifically confirm the presence of a target substance in a sample through the binding. The type of probe is not limited as a material commonly used in the art, but preferably may be peptide nucleic acid (PNA), locked nucleic acid (LNA), peptide, polypeptide, protein, RNA or DNA, and most preferably Most likely it is PNA. More specifically, the probe is a biomaterial, including one derived from or similar to a living organism or manufactured in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, nerve cells, DNA, and It may be RNA, DNA includes cDNA, genomic DNA, and oligonucleotides, RNA includes genomic RNA, mRNA, and oligonucleotides, and examples of proteins may include antibodies, antigens, enzymes, peptides, and the like.
본 발명에서 상기 "LNA (Locked nucleic acids)"란, 2'-O, 4'-C 메틸렌 브릿지를 포함하는 핵산 아날로그를 의미한다 [J Weiler, J Hunziker and J Hall Gene Therapy (2006) 13, 496.502]. LNA 뉴클레오사이드는 DNA와 RNA의 일반적 핵산 염기를 포함하며, Watson-Crick 염기 쌍 규칙에 따라 염기 쌍을 형성할 수 있다. 하지만, 메틸렌 브릿지로 인한 분자의 'locking'으로 인해, LNA는 Watson-Crick 결합에서 이상적 형상을 형성하지 못하게 된다. LNA가 DNA 또는 RNA 올리고뉴클레오티드에 포함되면, LNA는 보다 빠르게 상보적 뉴클레오티드 사슬과 쌍을 이루어 이중 나선의 안정성을 높일 수 있다. In the present invention, the "LNA (Locked nucleic acids)" means a nucleic acid analog containing a 2'-O, 4'-C methylene bridge [J Weiler, J Hunziker and J Hall Gene Therapy (2006) 13, 496.502 ]. LNA nucleosides contain the common nucleic acid bases of DNA and RNA, and can base pair according to the Watson-Crick base pairing rules. However, due to molecular 'locking' due to the methylene bridge, the LNA does not form an ideal shape in the Watson-Crick bond. When LNAs are included in DNA or RNA oligonucleotides, they can more rapidly pair with complementary nucleotide chains to increase the stability of the double helix.
본 발명에서 상기 "안티센스"는 안티센스 올리고머가 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열과 혼성화되어, 표적 서열 내에서 전형적으로 mRNA와 RNA 올리고머 헤테로이중체의 형성을 허용하는, 뉴클레오티드 염기의 서열 및 서브유닛간 백본을 갖는 올리고머를 의미한다. 올리고머는 표적 서열에 대한 정확한 서열 상보성 또는 근사 상보성을 가질 수 있다.In the present invention, the "antisense" refers to a sequence of nucleotide bases in which an antisense oligomer is hybridized with a target sequence in RNA by Watson-Crick base pairing, allowing the formation of a heteroduplex of mRNA and RNA oligomers in the target sequence, and It refers to an oligomer having an inter-subunit backbone. Oligomers may have exact sequence complementarity or near complementarity to the target sequence.
본 발명에 따른 카베올린-1 단백질이나, 이들을 암호화하는 유전자의 정보는 공지되어 있으므로, 당업자라면 이를 바탕으로 상기 단백질을 암호화하는 유전자에 특이적으로 결합하는 프라이머, 프로브 또는 안티센스 뉴클레오티드를 용이하게 디자인할 수 있을 것이다.Since information on the caveolin-1 protein according to the present invention or the gene encoding them is known, those skilled in the art can easily design primers, probes, or antisense nucleotides specifically binding to the gene encoding the protein based on this information. You will be able to.
본 발명의 상기 판별용 조성물은, 목적하는 개체로부터 분리된 생물학적 시료에서 측정된 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준을 대조군과 비교하여 그 발현 수준의 증감 여부를 확인함으로써, 암 치료제의 적합성 여부룰 진단할 수 있다. The composition for discrimination of the present invention compares the expression level of the caveolin-1 protein or the gene encoding it measured in a biological sample isolated from a subject of interest to a control group and confirms whether the expression level is increased or decreased, thereby treating cancer suitability can be diagnosed.
본 발명에서 상기 "판별"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미하며, 보다 상세하게는 병리 상태의 존재 또는 특징을 확인함으로써 치료제 적합성을 판정하는 것으로서, 특히는 맞춤형 치료에 적용하기 위한 동반 진단(Companion Diagnostics) 목적으로 대상 환자를 사전에 선별하여 특정 치료제의 치료 효과가 좋게 나타날 가능성이 높은지 여부를 판정하는 것을 말한다. In the present invention, the "determination" means to confirm the presence or characteristics of a pathological state, and more specifically, to determine the suitability of a therapeutic agent by confirming the existence or characteristics of a pathological state, in particular, accompanies for application to customized treatment Companion Diagnostics refers to pre-selecting target patients for the purpose of diagnosis and determining whether or not there is a high possibility that a specific treatment will have a good treatment effect.
본 발명에서 상기 동반 진단(Companion Diagnostics)이란 표적 치료제의 대상체를 사전에 선별하는 검사로서, 대상체의 유전적 특성, 보다 구체적으로 유전자 또는 단백질의 발현 정도, 특정 유전자의 존부 등을 검사하는 방식으로 수행될 수 있다. 이는 표적 약물을 효과적으로 사용하기 위해 필수적인 정보를 제공할 수 있으며, 동반 진단을 통해 대상체의 약물 반응성, 약물 민감도, 약물 부작용 발생 가능성 등을 예측 또는 치료함으로써 향후 수행될 치료 시 반응의 모니터링을 수행할 수 있다. 최근 항암 신약 분야에서 개개인의 맞춤 치료를 위한 동반 진단이 각광 받고 있는 실정이다.In the present invention, the companion diagnostics is a test that selects a subject for a target therapeutic agent in advance, and is performed by examining the genetic characteristics of the subject, more specifically, the level of expression of a gene or protein, the presence or absence of a specific gene, etc. It can be. This can provide essential information for effective use of the target drug, and can monitor the response during future treatment by predicting or treating the subject's drug reactivity, drug sensitivity, and the possibility of drug side effects through accompanying diagnosis. there is. Recently, in the field of anticancer drugs, companion diagnostics for personalized treatment are in the limelight.
본 발명의 조성물을 이용할 경우 암 치료제의 처방 전에 환자의 약물 반응성을 미리 선별함으로써, 암 치료의 효율성을 증대시키거나 치료제의 부작용을 감소시킬 수 있으며, 더 나아가 불필요한 의료비 지출을 막을 수 있는 경제적 효과 또한 기대할 수 있다.In the case of using the composition of the present invention, by pre-selecting the patient's drug reactivity before prescribing a cancer treatment, the efficiency of cancer treatment can be increased or the side effects of the treatment can be reduced, and furthermore, the economic effect of preventing unnecessary medical expenses is also achieved. can be expected
본 발명에서 상기 암 치료제는 암 세포의 증식 억제, 암 세포의 침윤 또는 전이 억제하는 후보 약물을 의미하며, 암 외의 다른 질환을 예방 또는 치료하기 위한 약물에 해당할지라도 암과 관련된 질환의 예방 또는 치료 효과가 예견되는 약물에 해당한다면 이에 포함될 수 있으며, 바람직하게는 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나일 수 있으나, 암과 관련된 질환의 예방 또는 치료 효과가 예견되는 약물이라면 이에 제한되는 것은 아니다.In the present invention, the cancer therapeutic agent refers to a candidate drug that inhibits proliferation of cancer cells, invasion or metastasis of cancer cells, and prevents or treats cancer-related diseases even if it corresponds to drugs for preventing or treating diseases other than cancer. It may be included therein if it corresponds to a drug for which the effect is expected, preferably chloroquine (Chloroquine) or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; may be at least one selected from the group consisting of, but is not limited thereto as long as it is a drug that is expected to have a preventive or therapeutic effect on cancer-related diseases.
본 발명에서 상기 암 치료제 후보 약물은 클로로퀸(Chloroquine)을 포함할 수 있고, 상기 클로로퀸은 하기 화학식 1로 표시되는 4-N-[7-클로로퀴놀린-4-일]-1-N,1-N-디에틸펜탄-1,4-디아민(4-N-[7-chloroquinolin-4-yl]-1-N,1-N-diethylpentane-1,4-diamine)일 수 있다. 또한, 클로로퀸의 약학적으로 허용 가능한 염을 포함할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the candidate drug for cancer treatment may include chloroquine, and the chloroquine is 4-N-[7-chloroquinolin-4-yl]-1-N,1-N represented by Formula 1 below -Diethylpentane-1,4-diamine (4-N-[7-chloroquinolin-4-yl]-1-N,1-N-diethylpentane-1,4-diamine). In addition, it may include a pharmaceutically acceptable salt of chloroquine, but is not limited thereto.
[화학식 1][Formula 1]
Figure PCTKR2021012879-appb-img-000001
Figure PCTKR2021012879-appb-img-000001
본 발명에서 상기 암 치료제 후보 약물은 하이드록시클로로퀸(Hydroxychloroquine)을 포함할 수 있고, 상기 하이드록시클로로퀸은 하기 화학식 2로 표시되는 2-[4-[(7-클로로퀴놀린-4-일)아미노]펜틸-에틸아미노]에탄올 (2-[4-[(7-chloroquinolin-4-yl)amino]pentyl-ethylamino]ethanol)일 수 있다. 또한 하이드록시클로로퀸의 약학적으로 허용 가능한 염을 포함할 수 있으며, 바람직하게는 하이드록시클로로퀸 황산염(Chloroquine sulfate)을 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the cancer drug candidate may include hydroxychloroquine, and the hydroxychloroquine is 2-[4-[(7-chloroquinolin-4-yl)amino] represented by Formula 2 below. pentyl-ethylamino]ethanol (2-[4-[(7-chloroquinolin-4-yl)amino]pentyl-ethylamino]ethanol). It may also include a pharmaceutically acceptable salt of hydroxychloroquine, preferably hydroxychloroquine sulfate, but is not limited thereto.
[화학식 2][Formula 2]
Figure PCTKR2021012879-appb-img-000002
Figure PCTKR2021012879-appb-img-000002
본 발명에서 상기 암 치료제 후보 약물은 메플로퀸(Mefloquine)을 포함할 수 있고, 상기 메플로퀸은 하기 화학식 3으로 표시되는 [2,8-비스(트리플루오로메틸)퀴놀린-4-일]-피페리딘-2-일 메탄올 ([2,8-bis(trifluoromethyl)quinolin-4-yl]-piperidin-2-yl methanol)일 수 있다. 또한 메플로퀸의 약학적으로 허용 가능한 염을 포함할 수 있으며, 바람직하게는 메플로퀸 염화수소(Mefloquine hydrochloride)를 포함할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the candidate drug for cancer treatment may include mefloquine, and the mefloquine is [2,8-bis(trifluoromethyl)quinolin-4-yl]-piperidine represented by Formula 3 below -2-yl methanol ([2,8-bis(trifluoromethyl)quinolin-4-yl]-piperidin-2-yl methanol). It may also include a pharmaceutically acceptable salt of mefloquine, preferably mefloquine hydrochloride, but is not limited thereto.
[화학식 3][Formula 3]
Figure PCTKR2021012879-appb-img-000003
Figure PCTKR2021012879-appb-img-000003
본 발명에서 상기 약학적으로 허용 가능한 염은 산 또는 염기의 부가염, 및 이의 입체화학적 이성질체를 포함할 수 있다. 예를 들면, 화합물은 유기산 또는 무기산의 부가염의 형태로 있을 수 있다. 염은 환자에 투여되었을 때에 환자에서 바람직한 효과를 갖는 것으로, 그들의 모화합물의 활성을 유지하는 임의의 염들을 포함하지만, 이에 특별히 한정되는 것은 아닐 수 있다. 이러한 염들은 무기염 및 유기염, 예컨대 아세트산, 질산, 아스파트산, 술폰산, 설퓨릭산, 말레산, 글루탐산, 포름산, 숙신산, 인산, 프탈산, 탄닌산, 타르타르산, 히드로브롬산, 프로피온산, 벤젠술폰산, 벤조산, 스테아르산, 락트산, 비카르본산, 비설퓨릭산, 비타르타르산, 옥살산, 부틸산, 칼슘 이데트, 카르보닉산, 클로로벤조산, 시트르산, 이데트산, 톨루엔술폰산, 푸마르산, 글루셉트산, 에실린산, 파모익산, 글루코닉산, 메틸질산, 말론산, 염산, 히드로요도익산, 히드록시나프톨산, 이세티온산, 락토비오닉산, 만델산, 점액산, 나프실릭산, 뮤코닉산, p-니트로메탄술폰산, 헥사믹산, 판토테닉산, 모노히드로겐인산, 디히드로겐인산, 살리실산, 술파민산, 술파닐린산, 메탄술폰산의 염 등을 포함할 수 있다. 염기의 부가염은 알칼리 금속 또는 알칼리 토금속의 염, 예컨대 암모늄, 리튬, 나트륨, 칼륨, 마그네슘, 칼슘 등의 염; 유기 염기를 갖는 염, 예컨대 벤자틴, N-메틸-D-글루카민, 하이드라바민 등의 염; 및 아미노산을 갖는 염, 예컨대 아르기닌, 리신 등을 포함할 수 있다. 또한, 이들 염들은 적정 염기 또는 산으로 처리함으로써 유리된 형태로 전환될 수 있다.In the present invention, the pharmaceutically acceptable salts may include acid or base addition salts, and stereochemical isomers thereof. For example, the compounds may be in the form of addition salts of organic or inorganic acids. Salts have desirable effects on patients when administered to patients, and include any salts that retain the activity of their parent compound, but may not be particularly limited thereto. These salts include inorganic and organic salts such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, Benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idete, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluseptic acid, ecilin Acid, pamoic acid, gluconic acid, methyl nitric acid, malonic acid, hydrochloric acid, hydroiodoic acid, hydroxynaphtholic acid, isethionic acid, lactobionic acid, mandelic acid, mucoic acid, napsylic acid, muconic acid, p -It may include salts of nitromethanesulfonic acid, hexamic acid, pantothenic acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, salicylic acid, sulfamic acid, sulfanilic acid, methanesulfonic acid, and the like. Addition salts of bases include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium and the like; salts with organic bases such as benzathine, N-methyl-D-glucamine, hydrabamine and the like; and salts with amino acids such as arginine, lysine, and the like. Also, these salts can be converted to the free form by treatment with an appropriate base or acid.
본 발명의 목적상 상기 암 치료제 적합성 판별용 조성물은 암, 특히는 위암으로 바람직하게는 줄기 유사 아형 위암과 관련한 새로운 타깃 마커로 카베올린-1을 이용함으로써 Cav1 매개 세포 내 이입을 억제하는 기전의 치료제 적합성을 판별할 수 있어 줄기 유사 아형 위암 환자의 선별을 통해 치료 효과를 극대화할 수 있는 대상체의 선별에 효과적이다.For the purpose of the present invention, the composition for determining the suitability of the cancer therapeutic agent uses caveolin-1 as a new target marker related to cancer, particularly gastric cancer, preferably stem-like subtype gastric cancer, thereby inhibiting Cav1-mediated endocytosis. Since suitability can be determined, it is effective in selecting a subject that can maximize the treatment effect through the selection of patients with stem-like subtype gastric cancer.
본 발명에서 상기 "대상체"는 인간을 포함하는 포유 동물로, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "subject" is a mammal including humans, for example, humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cows, horses, pigs, sheep and goats. It may be selected from, but may be preferably a human, but is not limited thereto.
본 발명에서 상기 암은 포유류에서 전형적으로 조절되지 않는 세포 성장으로 특징 지어진 생리적 상태를 나타내거나 가리킨다. 본 발명에서 상기 암은 위암, 갑상선암, 부갑상선암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 적어도 하나일 수 있으나, 바람직하게는 위암일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, cancer refers to or refers to a physiological condition typically characterized by unregulated cell growth in mammals. In the present invention, the cancer is gastric cancer, thyroid cancer, parathyroid cancer, ovarian cancer, colon cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, and Hodgkin's lymphoma. , blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma , adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervous system tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. It may be at least one selected from, but may preferably be gastric cancer, but is not limited thereto.
본 발명의 다른 구현 예에 따르면, 본 발명의 상기 암 치료제의 적합성 판별용 키트에 관한 것이다.According to another embodiment of the present invention, it relates to a kit for determining the suitability of the cancer therapeutic agent of the present invention.
본 발명의 상기 키트는 본 발명의 상기 조성물을 사용하여 목적하는 개체에서 대조군에 비하여 카베올린-1 단백질 또는 이를 암호화하는 유전자가 높은 수준으로 존재하는 경우, 암 치료제 적합성이 있는 것으로 예측할 수 있다. 바람직하게는, 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 대조군에 비하여 높은 수준으로 존재하는 경우에 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나에 해당하는 후보 약물의 치료 적합성이 있는 것으로 예측할 수 있다.The kit of the present invention can be predicted to be suitable for cancer treatment when the caveolin-1 protein or the gene encoding it is present at a higher level in a target subject using the composition of the present invention than a control group. Preferably, when the expression level of the caveolin-1 protein or the gene encoding it is higher than that of the control group, chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; it can be predicted that there is therapeutic suitability of at least one candidate drug selected from the group consisting of.
본 발명에서 상기 "대조군"은 정상 대조군에서의 해당 바이오 마커 단백질 또는 상기 단백질을 암호화하는 유전자의 발현 수준이거나, 위 관련 질환 환자 유래의 생물학적 시료에서 해당 마커 단백질 또는 이를 암호화하는 유전자의 발현 수준의 평균 값 또는 중앙 값이거나, 암 환자로 바람직하게는 위암 외의 타 암종 환자 유래의 생물학적 시료에서 해당 마커 단백질 또는 이를 암호화하는 유전자의 발현 수준의 평균 값 또는 중앙 값일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "control group" is the expression level of the corresponding biomarker protein or the gene encoding the protein in a normal control group, or the average expression level of the corresponding marker protein or the gene encoding the same in a biological sample derived from a patient with gastric disease. It may be a value or a median value, or an average value or a median value of the expression level of the corresponding marker protein or a gene encoding the marker protein in biological samples derived from cancer patients, preferably from patients with other types of cancer other than gastric cancer, but is not limited thereto.
본 발명의 상기 키트는 본 발명의 상기 조성물을 사용하여 목적하는 개체에서 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군보다 높은 경우, 상기 목적하는 개체가 암 치료제 적합성이 있는 것으로 예측할 수 있다.The kit of the present invention, using the composition of the present invention, predicts that the target subject is suitable for cancer treatment when the expression level of the caveolin-1 protein or the gene encoding it is higher than a normal control in the target subject. can
본 발명의 상기 판별용 키트에서, 카베올린-1 단백질 또는 이를 암호화하는 유전자, 암, 암 치료제 등에 관한 기재는 판별용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다. In the kit for discrimination of the present invention, the description of the caveolin-1 protein or the gene encoding it, cancer, cancer treatment, etc. is the same as that described in the composition for discrimination, so it is omitted in order to avoid excessive complexity in the present specification.
본 발명의 상기 키트는 RT-PCR 키트, DNA 칩 키트, ELISA 키트, 단백질 칩 키트, 래피드(Rapid) 키트 또는 MRM(Multiple reaction monitoring) 키트 등 일 수 있으나, 이에 제한되는 것은 아니다.The kit of the present invention may be an RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a Rapid kit, or a Multiple Reaction Monitoring (MRM) kit, but is not limited thereto.
본 발명의 상기 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 더 포함할 수 있다. 예를 들면, 본 발명에서 상기 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 더 포함할 수 있다. 역전사 중합효소반응 키트는 마커 단백질을 코딩하는 유전자에 대해 특이적인 프라이머 쌍을 포함한다. 프라이머는 상기 유전자의 핵산 서열에 특이적인 서열을 가지는 뉴클레오티드로써, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp의 길이를 가질 수 있다. 또한 대조군 유전자의 핵산 서열에 특이적인 프라이머를 포함할 수 있다. 그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 용기, 반응 완충액 (pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNase 억제제 DEPC-수 (DEPC-water), 멸균수 등을 포함할 수 있다.The kit of the present invention may further include one or more other component compositions, solutions or devices suitable for the assay method. For example, in the present invention, the kit may further include essential elements necessary for carrying out the reverse transcription polymerase reaction. The reverse transcription polymerase reaction kit contains a pair of primers specific for a gene encoding a marker protein. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of the gene, and may have a length of about 7 bp to 50 bp, more preferably about 10 bp to 30 bp. In addition, a primer specific for the nucleic acid sequence of the control gene may be included. Other reverse transcription polymerase reaction kits contain a test tube or other suitable container, reaction buffer (with varying pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase and RNase inhibitor DEPC. -Water (DEPC-water), sterilized water, etc. may be included.
또한, 본 발명의 판별용 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함할 수 있다. DNA 칩 키트는 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드(oligonucleotide)가 부착되어 있는 기판, 및 형광표지 프로브를 제작하기 위한 시약, 제제, 효소 등을 포함할 수 있다. 또한 기판은 대조군 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드를 포함할 수 있다.In addition, the kit for discrimination of the present invention may include essential elements required to perform DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotides corresponding to genes or fragments thereof are attached, and reagents, reagents, enzymes, and the like for producing fluorescently labeled probes. In addition, the substrate may include a cDNA or oligonucleotide corresponding to a control gene or a fragment thereof.
또한, 본 발명의 판별용 키트는 ELISA를 수행하기 위해 필요한 필수 요소를 포함할 수 있다. ELISA 키트는 상기 단백질에 대해 특이적인 항체를 포함한다. 항체는 마커 단백질에 대한 특이성 및 친화성이 높고 다른 단백질에 대한 교차 반응성이 거의 없는 항체로, 단클론 항체, 다클론 항체 또는 재조합 항체이다. 또한, ELISA 키트는 대조군 단백질에 특이적인 항체를 포함할 수 있다. 그 외 ELISA 키트는 결합된 항체를 검출할 수 있는 시약, 예를 들면, 표지된 2 차 항체, 발색단 (chromophores), 효소 (예: 항체와 컨주게이트됨) 및 그의 기질 또는 항체와 결합할 수 있는 다른 물질 등을 포함할 수 있다.In addition, the kit for discrimination of the present invention may include essential elements necessary for performing ELISA. ELISA kits contain antibodies specific for the protein. An antibody is an antibody that has high specificity and affinity for a marker protein and little cross-reactivity to other proteins, and is a monoclonal antibody, polyclonal antibody, or recombinant antibody. Additionally, the ELISA kit may include antibodies specific for a control protein. Other ELISA kits include reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes (eg, conjugated with antibodies) and substrates thereof or those capable of binding the antibody. may contain other substances and the like.
본 발명의 판별용 키트에서 항원-항체 결합반응을 위한 고정체로는 니트로셀룰로오즈 막, PVDF 막, 폴리비닐 (polyvinyl) 수지 또는 폴리스티렌 (polystyrene) 수지로 합성된 웰 플레이트 (Well plate), 유리로 된 슬라이드 글래스 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.In the kit for discrimination of the present invention, the fixture for the antigen-antibody binding reaction includes a nitrocellulose film, a PVDF film, a well plate made of polyvinyl resin or polystyrene resin, and a glass slide. Glass or the like may be used, but is not limited thereto.
또한, 본 발명의 판별용 키트에서 2 차 항체의 표지체는 발색 반응을 하는 통상의 발색제가 바람직하며, HRP (horseradish peroxidase), 염기성 탈인산화효소 (alkaline phosphatase), 콜로이드 골드 (coloid gold), FITC (폴리 L-라이신-플루오르세인 아이소티오시아네이트), RITC (로다민-B-아이소티오시아네이트) 등의 형광 물질 (fluorescein) 및 색소 (dye) 등의 표지체가 사용될 수 있으나, 이에 제한되는 것은 아니다.In addition, the marker of the secondary antibody in the kit for discrimination of the present invention is preferably a conventional coloring agent that reacts with color, and HRP (horseradish peroxidase), basic dephosphorylation enzyme (alkaline phosphatase), colloid gold, FITC (Poly L-lysine-fluorscein isothiocyanate), RITC (rhodamine-B-isothiocyanate), and other fluorescent substances (fluorescein) and dyes (dyes) may be used, but are not limited thereto no.
또한, 본 발명의 판별용 키트에서 발색을 유도하기 위한 발색 기질은 발색 반응을 하는 표지체에 따라 사용하는 것이 바람직하며, TMB (3,3',5,5'-테트라메틸 베지딘), ABTS [2,2'-아지노-비스(3-에틸벤조티아졸린-6-설폰산)], OPD (o-페닐렌다이아민) 등을 사용할 수 있다. 이때, 발색 기질은 완충 용액 (0.1 M NaAc, pH 5.5)에 용해된 상태로 제공되는 것이 더욱 바람직하다. TMB와 같은 발색 기질은 이차 항체 접합체의 표지체로 사용된 HRP에 의해 분해되어 발색 침적체를 생성하고, 이 발색 침적체의 침적 정도를 육안으로 확인함으로써 상기 마커 단백질들의 존재 유무를 검출한다.In addition, it is preferable to use a chromogenic substrate for inducing color development in the kit for discrimination of the present invention according to a label that produces a color reaction, such as TMB (3,3',5,5'-tetramethyl bezidine), ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)], OPD (o-phenylenediamine), etc. can be used. At this time, it is more preferable that the chromogenic substrate is provided in a state dissolved in a buffer solution (0.1 M NaAc, pH 5.5). A chromogenic substrate such as TMB is degraded by HRP used as a marker for the secondary antibody conjugate to generate chromogenic deposits, and the presence or absence of the marker proteins is detected by visually checking the degree of chromogenic deposits.
본 발명의 판별용 키트에서 세척액은 인산염 완충 용액, NaCl 및 트윈 20 (Tween 20)을 포함하는 것이 바람직하며, 0.02 M 인산염 완충 용액, 0.13 M NaCl, 및 0.05 % 트윈 20으로 구성된 완충 용액 (PBST)이 더욱 바람직하다. 세척액은 항원-항체 결합 반응 후 항원-항체 결합체에 2 차 항체를 반응시킨 다음 적당량을 고정체에 첨가하여 3 내지 6 회 세척한다. 반응 정지 용액은 황산 용액 (H2SO4)이 바람직하게 사용될 수 있다.In the kit for discrimination of the present invention, the washing solution preferably includes a phosphate buffer solution, NaCl and Tween 20, and a buffer solution (PBST) composed of 0.02 M phosphate buffer solution, 0.13 M NaCl, and 0.05% Tween 20 this is more preferable After the antigen-antibody binding reaction, the washing solution reacts with the antigen-antibody conjugate with a secondary antibody, and then an appropriate amount is added to the stationary body and washed 3 to 6 times. As the solution for stopping the reaction, a sulfuric acid solution (H 2 SO 4 ) may be preferably used.
본 발명의 또 다른 구현 예에 따르면, 암 치료제 적합성에 관한 정보를 제공하는 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method for providing information on suitability for cancer treatment.
본 발명의 상기 방법은 목적하는 개체로부터 분리된 생물학적 시료에서, 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함한다.The method of the present invention includes measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest.
본 발명의 상기 방법은 목적하는 개체로부터 분리된 생물학적 시료에서, 암 치료제 적합 여부를 선별하기 위한 것일 수 있다. The method of the present invention may be for screening whether a biological sample isolated from a subject of interest is suitable for a cancer treatment.
본 발명에서 상기 "목적하는 개체"란 인간을 포함하는 포유 동물로, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "object of interest" refers to mammals including humans, such as humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cows, horses, pigs, sheep and goats. It may be selected from the group consisting of, and may preferably be a human, but is not limited thereto.
본 발명에서 상기 "인간"은 암이 발병하였거나 발병 가능성이 높은 것으로 의심되는 자로, 암 질환의 적절한 치료가 필요하거나 예상되는 환자를 의미하는 것일 수 있고, 바람직하게는 위암의 적절한 치료가 필요하거나 예상되는 환자일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "human" may refer to a person who has developed cancer or is suspected of having a high possibility of developing cancer, and may mean a patient who needs or is expected to receive appropriate treatment for cancer disease, preferably needs or is expected to receive appropriate treatment for gastric cancer. It may be a patient who becomes, but is not limited thereto.
본 발명의 상기 "생물학적 시료"는 암 질환이 발생한 환자이거나 암 질환의 발병이 의심되는 개체로부터 얻어지거나 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 예를 들면, 전혈 (whole blood), 백혈구 (leukocytes), 말초혈액 단핵 세포 (peripheral blood mononuclear cells), 백혈구 연층 (buffy coat), 혈장 (plasma) 및 혈청 (serum)을 포함하는 혈액, 객담 (sputum), 눈물 (tears), 점액 (mucus), 세비액 (nasal washes), 비강 흡인물 (nasal aspirate), 호흡 (breath), 소변 (urine), 정액 (semen), 침 (saliva), 복강 세척액 (peritoneal washings), 골반 내 유체액 (pelvic fluids), 낭종액 (cystic fluid), 뇌척수막 액 (meningeal fluid), 양수 (amniotic fluid), 선액 (glandular fluid), 췌장액 (pancreatic fluid), 림프액 (lymph fluid), 흉수 (pleural fluid), 유두 흡인물 (nipple aspirate), 기관지 흡인물 (bronchial aspirate), 활액 (synovial fluid), 관절 흡인물 (joint aspirate), 기관 분비물 (organ secretions), 세포 (cell), 세포 추출물 (cell extract) 또는 뇌척수액 (cerebrospinal fluid)을 포함할 수 있으나, 이에 제한되는 것은 아니다.The "biological sample" of the present invention refers to any material, biological fluid, tissue, or cell obtained from or derived from a patient with a cancer disease or a subject suspected of having a cancer disease, for example, whole blood Whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, blood including plasma and serum, sputum, tears ), mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, pelvis Pelvic fluids, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid ), nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cell, cell extract Or cerebrospinal fluid (cerebrospinal fluid) may be included, but is not limited thereto.
본 발명의 상기 단백질이 존재하는 수준을 측정하는 단계는 본 발명의 상기 조성물을 이용하여 단백질 칩 분석, 면역 측정법, 리간드 바인딩 어세이, MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, 방사선 면역 분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 보체 고정 분석법, 2차원 전기영동 분석, 액상 크로마토그래피-질량분석 (liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), 웨스턴 블랏팅 또는 ELISA (enzyme linked immunosorbentassay)에 의해 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.The step of measuring the level of the protein present in the present invention includes protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) using the composition of the present invention. Analysis, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, Oukteroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional By electrophoretic analysis, liquid chromatography-Mass Spectrometry (LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blotting or ELISA (enzyme linked immunosorbentassay) It may be performed, but is not limited thereto.
본 발명의 상기 단백질을 암호화하는 유전자의 발현 수준을 측정하는 단계는 본 발명의 상기 조성물을 이용하여 역전사 중합효소반응 (RT-PCR), 경쟁적 역전사 중합효소반응 (Competitive RT-PCR), 실시간 역전사 중합효소반응 (Real-time RT-PCR), RNase 보호 분석법 (RNase protection assay; RPA), 노던 블랏팅 (Northern blotting) 또는 DNA 칩에 의해 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.The step of measuring the expression level of the gene encoding the protein of the present invention is reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerization using the composition of the present invention It may be performed by real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or DNA chip, but is not limited thereto.
본 발명의 상기 방법은 상기 생물학적 시료에서 측정된 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군에 비하여 높을 경우 상기 목적하는 개체에게 암 치료제 적합성이 있는 것으로 예측할 수 있다. 보다 바람직하게는, 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군보다 높은 경우에 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나의 암 치료제 적합성이 있는 것으로 예측할 수 있다.According to the method of the present invention, when the expression level of the caveolin-1 protein or the gene encoding the same measured in the biological sample is higher than that of the normal control group, it can be predicted that the subject has suitability for cancer treatment. More preferably, when the expression level of the caveolin-1 protein or the gene encoding it is higher than that of the normal control, chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; it can be predicted that there is at least one cancer therapeutic agent suitability selected from the group consisting of.
본 발명에서 상기 암은 위암, 갑상선암, 부갑상선암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 적어도 하나일 수 있으나, 바람직하게는 위암일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the cancer is gastric cancer, thyroid cancer, parathyroid cancer, ovarian cancer, colon cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, and Hodgkin's lymphoma. , blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma , adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervous system tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. It may be at least one selected from, but may preferably be gastric cancer, but is not limited thereto.
본 발명의 상기 암 치료제 적합성에 관한 정보를 제공하는 방법에서, 카베올린-1 단백질 또는 이를 암호화하는 유전자, 발현 수준을 측정하는 제제, 암, 암 치료제, 대조군 등에 대한 기재는 판별용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the method for providing information on the suitability of the cancer therapeutic agent of the present invention, the caveolin-1 protein or the gene encoding it, the agent for measuring the expression level, the description of cancer, cancer therapeutic agent, control group, etc. are described in the composition for discrimination are the same, and are omitted in order to avoid excessive complexity of the present specification.
본 발명의 또 다른 구현 예에 따르면, 위암의 진단용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for diagnosis of gastric cancer.
본 발명에서 상기 진단용 조성물은 카베올린-1(Caveolin-1; Cav1) 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제를 포함할 수 있다. In the present invention, the diagnostic composition may include an agent for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
본 발명의 상기 카베올린-1 단백질이 존재하는 수준을 측정하는 제제는 카베올린-1 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA (peptide nucleic acid) 및 앱타머 (aptamer)로 이루어진 군에서 선택된 적어도 하나를 포함할 수 있으나, 이에 제한되는 것은 아니다.The agent for measuring the level of the caveolin-1 protein of the present invention is composed of an antibody, oligopeptide, ligand, peptide nucleic acid (PNA) and aptamer that bind specifically to the caveolin-1 protein. It may include at least one selected from the group, but is not limited thereto.
본 발명의 상기 카베올린-1 단백질을 암호화하는 유전자의 발현 수준을 측정하는 제제는 상기 카베올린-1 단백질을 암호화하는 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1 종 이상을 포함할 수 있으나, 이에 제한되는 것은 아니다.The agent for measuring the expression level of the gene encoding the caveolin-1 protein of the present invention is one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically binds to the gene encoding the caveolin-1 protein It may include the above, but is not limited thereto.
본 발명의 상기 진단용 조성물에서, 카베올린-1 단백질 또는 이를 암호화하는 유전자, 발현 수준을 측정하는 제제 등에 관한 기재는 판별용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다. In the diagnostic composition of the present invention, the description of the caveolin-1 protein or the gene encoding it, the agent for measuring the expression level, etc. are the same as those described in the composition for discrimination, and thus are omitted in order to avoid excessive complexity in the present specification.
본 발명의 상기 진단용 조성물은, 목적하는 개체로부터 분리된 생물학적 시료에서 측정된 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준을 대조군과 비교하여 그 발현 수준의 증감 여부를 확인함으로써, 위암, 특히는 위암의 아형을 진단할 수 있다. The diagnostic composition of the present invention compares the expression level of the caveolin-1 protein or the gene encoding it measured in a biological sample isolated from a subject of interest to a control group and confirms whether the expression level is increased or decreased, thereby preventing gastric cancer, particularly can diagnose subtypes of gastric cancer.
본 발명에서 상기 "진단"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미하며, 본 발명의 목적상, 상기 진단은 위암의 발병, 성장, 진행 또는 전이 등의 가능성을 예측하는 것일 수 있고, 혹은 위암의 세분화된 아형을 구별하는 것일 수 있다. In the present invention, the "diagnosis" means to confirm the presence or characteristics of a pathological state, and for the purpose of the present invention, the diagnosis may be to predict the possibility of gastric cancer onset, growth, progression, or metastasis, or It may be to differentiate subtypes of gastric cancer.
본 발명에서 상기 위암의 아형은 위(gastric), 염증(inflammatory), 장(intestinal), 혼합(mixed) 및 줄기 유사(stem-like)로 이루어진 군에서 선택된 적어도 하나의 아형에 해당하는 것일 수 있으며, 바람직하게는 줄기 유사 아형 위암일 수 있다.In the present invention, the subtype of gastric cancer may correspond to at least one subtype selected from the group consisting of gastric, inflammatory, intestinal, mixed and stem-like, , preferably stem-like subtype gastric cancer.
본 발명의 또 다른 구현 예에 따르면, 본 발명의 상기 진단용 조성물을 포함하는 위암의 진단용 키트에 관한 것이다.According to another embodiment of the present invention, it relates to a kit for diagnosis of gastric cancer comprising the composition for diagnosis of the present invention.
본 발명에서 상기 키트는 RT-PCR 키트, DNA 칩 키트, ELISA 키트, 단백질 칩 키트, 래피드(rapid) 키트 또는 MRM(Multiple reaction monitoring) 키트일 수 있다. In the present invention, the kit may be a RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit.
본 발명의 상기 진단용 키트에서, 키트 등에 관한 기재는 상기에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다. In the diagnostic kit of the present invention, the description of the kit and the like is the same as described above, and is omitted in order to avoid excessive complexity of the present specification.
본 발명의 또 다른 구현 예에 따르면, 위암의 진단에 관한 정보를 제공하는 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method for providing information on the diagnosis of gastric cancer.
본 발명의 상기 방법은 목적하는 개체로부터 분리된 생물학적 시료에서, 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함할 수 있다. The method of the present invention may include measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest.
본 발명의 상기 정보를 제공하는 방법에서, 위암, 카베올린-1, 목적하는 개체, 생물학적 시료 등에 관한 기재는 상기에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the method for providing the above information of the present invention, descriptions of gastric cancer, caveolin-1, target object, biological sample, etc. are the same as described above, and thus are omitted to avoid excessive complexity of the present specification.
본 발명의 또 다른 구현 예에 따르면, 위암의 진단 기기에 관한 것이다. According to another embodiment of the present invention, it relates to a device for diagnosing gastric cancer.
본 발명의 상기 진단 기기의 측정부는 목적하는 개체로부터 얻어진 생물학적 시료에 대하여 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정할 수 있다.The measurement unit of the diagnostic device of the present invention may measure the expression level of the caveolin-1 (Cav1) protein or the gene encoding the same with respect to a biological sample obtained from a subject of interest.
본 발명에서 상기 목적하는 개체는, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the object of interest may be selected from the group consisting of humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cows, horses, pigs, sheep and goats, and is preferably a human. It may be, but is not limited thereto.
본 발명에서 상기 생물학적 시료는 전혈 (whole blood), 백혈구 (leukocytes), 말초혈액 단핵 세포 (peripheral blood mononuclear cells), 백혈구 연층 (buffy coat), 혈장 (plasma), 혈청 (serum), 객담 (sputum), 눈물 (tears), 점액 (mucus), 세비액 (nasal washes), 비강 흡인물 (nasal aspirate), 호흡 (breath), 소변 (urine), 정액 (semen), 침 (saliva), 복강 세척액 (peritoneal washings), 복수 (ascites), 낭종액 (cystic fluid), 뇌척수막 액 (meningeal fluid), 양수 (amniotic fluid), 선액 (glandular fluid), 췌장액 (pancreatic fluid), 림프액 (lymph fluid), 흉수 (pleural fluid), 유두 흡인물 (nipple aspirate), 기관지 흡인물 (bronchial aspirate), 활액 (synovial fluid), 관절 흡인물 (joint aspirate), 기관 분비물 (organ secretions), 세포 (cell), 세포 추출물 (cell extract) 및 뇌척수액 (cerebrospinal fluid) 등으로 이루어진 군에서 선택된 1 종 이상일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the biological sample is whole blood, leukocytes, peripheral blood mononuclear cells, leukocyte buffy coat, plasma, serum, sputum , tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings), ascites, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid ), nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cell, cell extract And it may be at least one selected from the group consisting of cerebrospinal fluid, etc., but is not limited thereto.
본 발명의 상기 진단 기기의 측정부에서 이용하는 제제는 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제일 수 있다. 보다 구체적으로, 상기 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA (peptide nucleic acid) 및 앱타머 (aptamer)로 이루어진 군에서 선택된 1 종 이상을 포함할 수 있으며, 상기 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1 종 이상을 포함할 수 있다.The agent used in the measuring unit of the diagnostic device of the present invention may be an agent for measuring the expression level of caveolin-1 protein or a gene encoding the same. More specifically, it may include at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNA (peptide nucleic acid) and aptamers that specifically bind to the protein, and specific to the gene It may include at least one selected from the group consisting of primers, probes, and antisense nucleotides that bind to.
본 발명의 상기 측정부에서 상기 제제를 이용하여 상기 단백질 또는 유전자의 발현 정도를 확인함으로써 위암, 보다 바람직하게는 위암의 아형을 예측할 수 있다.Gastric cancer, more preferably gastric cancer subtype, can be predicted by checking the expression level of the protein or gene using the agent in the measurement unit of the present invention.
본 발명의 상기 진단 기기는, 상기 측정부에서 얻어진 상기 단백질 또는 유전자의 발현 정도로부터 상기 목적하는 개체의 위암의 아형을 예측하여 출력하는 검출부를 추가로 더 포함할 수 있다.The diagnostic device of the present invention may further include a detection unit that predicts and outputs the subtype of gastric cancer of the subject from the expression level of the protein or gene obtained from the measurement unit.
본 발명에서 상기 검출부는, 상기 측정부에서 얻어진 상기 단백질 또는 유전자의 발현 정도의 범주에 따라 위암에 관한 정보를 생성하여 분류함으로써 위암, 보다 바람직하게는 위암의 아형을 진단할 수 있다.In the present invention, the detection unit generates and classifies gastric cancer information according to the category of the expression level of the protein or gene obtained by the measurement unit, thereby diagnosing gastric cancer, more preferably, a subtype of gastric cancer.
본 발명의 일 예시에서, 상기 검출부는 상기 측정부에서 측정된 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군에 비하여 높을 경우 상기 목적하는 개체에게 줄기 유사 아형의 위암의 발병 또는 발병 가능성이 높은 것으로 예측하여 출력할 수 있다.In one example of the present invention, the detecting unit develops or develops stem-like subtype gastric cancer in the target subject when the expression level of the caveolin-1 protein or the gene encoding it measured by the measuring unit is higher than that of a normal control group. It can be predicted and output with a high probability.
본 발명의 상기 진단 기기에서, 카베올린-1, 위암 아형, 대조군 등에 관한 기재는 상기에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the diagnostic device of the present invention, descriptions of caveolin-1, gastric cancer subtypes, controls, etc. are the same as described above, and are omitted to avoid excessive complexity in the present specification.
본 발명의 또 다른 구현 예에 따르면, 암의 예방, 개선 또는 치료용 조성물에 관한 것이다. According to another embodiment of the present invention, it relates to a composition for preventing, improving or treating cancer.
본 발명의 상기 조성물은 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함할 수 있다.The composition of the present invention is chloroquine (Chloroquine) or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; may contain at least one selected from the group consisting of an active ingredient.
본 발명의 일 구체 예에서 상기 클로로퀸(Chloroquine)은 4-N-[7-클로로퀴놀린-4-일]-1-N,1-N-디에틸펜탄-1,4-디아민(4-N-[7-chloroquinolin-4-yl]-1-N,1-N-diethylpentane-1,4-diamine)으로 하기 화학식 1로 표시되는 화합물일 수 있다. In one embodiment of the present invention, the chloroquine (Chloroquine) is 4-N- [7-chloroquinolin-4-yl] -1-N, 1-N-diethylpentane-1,4-diamine (4-N- [7-chloroquinolin-4-yl] -1-N,1-N-diethylpentane-1,4-diamine) and may be a compound represented by Formula 1 below.
[화학식 1][Formula 1]
Figure PCTKR2021012879-appb-img-000004
Figure PCTKR2021012879-appb-img-000004
본 발명의 다른 구체 예에서 상기 하이드록시클로로퀸(Hydroxychloroquine)은 2-[4-[(7-클로로퀴놀린-4-일)아미노]펜틸-에틸아미노]에탄올 (2-[4-[(7-chloroquinolin-4-yl)amino]pentyl-ethylamino]ethanol)로 하기 화학식 2로 표시되는 화합물일 수 있다. In another embodiment of the present invention, the hydroxychloroquine is 2-[4-[(7-chloroquinolin-4-yl)amino]pentyl-ethylamino]ethanol (2-[4-[(7-chloroquinolin -4-yl)amino]pentyl-ethylamino]ethanol) and may be a compound represented by Formula 2 below.
[화학식 2][Formula 2]
Figure PCTKR2021012879-appb-img-000005
Figure PCTKR2021012879-appb-img-000005
본 발명의 또 다른 구체 예에서 상기 메플로퀸(Mefloquine)은 [2,8-비스(트리플루오로메틸)퀴놀린-4-일]-피페리딘-2-일 메탄올 ([2,8-bis(trifluoromethyl)quinolin-4-yl]-piperidin-2-yl methanol)로 하기 화학식 3으로 표시되는 화합물일 수 있다. In another embodiment of the present invention, the mefloquine is [2,8-bis (trifluoromethyl) quinolin-4-yl] -piperidin-2-yl methanol ([2,8-bis (trifluoromethyl ) Quinolin-4-yl] -piperidin-2-yl methanol) and may be a compound represented by Formula 3 below.
[화학식 3][Formula 3]
Figure PCTKR2021012879-appb-img-000006
Figure PCTKR2021012879-appb-img-000006
본 발명의 상기 화학식 1 내지 3으로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염은 암 세포 및 암 줄기세포의 성장을 매우 효과적으로 억제할 수 있다. 본 발명의 상기 조성물은 제어되지 않은 세포의 자가세포사멸 (apoptosis)을 유도하고, 세포 성장을 억제함으로써 암의 성장을 억제할 수 있어 암의 예방, 개선 또는 치료에 매우 효과적으로 사용될 수 있다.The compounds represented by Chemical Formulas 1 to 3 or pharmaceutically acceptable salts thereof of the present invention can very effectively inhibit the growth of cancer cells and cancer stem cells. The composition of the present invention induces uncontrolled apoptosis of cells and suppresses the growth of cancer by inhibiting cell growth, so it can be used very effectively for the prevention, improvement or treatment of cancer.
본 발명의 상기 약학적으로 허용 가능한 염은 산 또는 염기의 부가염, 및 이의 입체화학적 이성질체를 포함할 수 있다. 예를 들면, 화합물은 유기산 또는 무기산의 부가염의 형태로 있을 수 있다. 염은 환자에 투여되었을 때에 환자에서 바람직한 효과를 갖는 것으로, 그들의 모화합물의 활성을 유지하는 임의의 염들을 포함하지만, 이에 특별히 한정되는 것은 아니다. 이러한 염들은 무기염 및 유기염, 예컨대 아세트산, 질산, 아스파트산, 술폰산, 설퓨릭산, 말레산, 글루탐산, 포름산, 숙신산, 인산, 프탈산, 탄닌산, 타르타르산, 히드로브롬산, 프로피온산, 벤젠술폰산, 벤조산, 스테아르산, 락트산, 비카르본산, 비설퓨릭산, 비타르타르산, 옥살산, 부틸산, 칼슘 이데트, 카르보닉산, 클로로벤조산, 시트르산, 이데트산, 톨루엔술폰산, 푸마르산, 글루셉트산, 에실린산, 파모익산, 글루코닉산, 메틸질산, 말론산, 염산, 히드로요도익산, 히드록시나프톨산, 이세티온산, 락토비오닉산, 만델산, 점액산, 나프실릭산, 뮤코닉산, p-니트로메탄술폰산, 헥사믹산, 판토테닉산, 모노히드로겐인산, 디히드로겐인산, 살리실산, 술파민산, 술파닐린산, 메탄술폰산의 염 등을 포함할 수 있다. 염기의 부가염은 알칼리 금속 또는 알칼리 토금속의 염, 예컨대 암모늄, 리튬, 나트륨, 칼륨, 마그네슘, 칼슘 등의 염; 유기 염기를 갖는 염, 예컨대 벤자틴, N-메틸-D-글루카민, 하이드라바민 등의 염; 및 아미노산을 갖는 염, 예컨대 아르기닌, 리신 등을 포함할 수 있다. 또한, 이들 염들은 적정 염기 또는 산으로 처리함으로써 유리된 형태로 전환될 수 있다.The pharmaceutically acceptable salts of the present invention may include acid or base addition salts, and stereochemical isomers thereof. For example, the compounds may be in the form of addition salts of organic or inorganic acids. Salts have desirable effects in patients when administered to patients, and include, but are not particularly limited to, any salts that retain the activity of their parent compound. These salts include inorganic and organic salts such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, Benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idete, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluseptic acid, ecilin Acid, pamoic acid, gluconic acid, methyl nitric acid, malonic acid, hydrochloric acid, hydroiodoic acid, hydroxynaphtholic acid, isethionic acid, lactobionic acid, mandelic acid, mucoic acid, napsylic acid, muconic acid, p -It may include salts of nitromethanesulfonic acid, hexamic acid, pantothenic acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, salicylic acid, sulfamic acid, sulfanilic acid, methanesulfonic acid, and the like. Addition salts of bases include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium and the like; salts with organic bases such as benzathine, N-methyl-D-glucamine, hydrabamine and the like; and salts with amino acids such as arginine, lysine, and the like. Also, these salts can be converted to the free form by treatment with an appropriate base or acid.
본 발명의 조성물에서 예방, 개선 또는 치료의 대상이 되는 질환으로는 목적하는 개체에서 발병 되었거나 발병될 가능성이 있는 암일 수 있다.Diseases to be prevented, improved, or treated in the composition of the present invention may be cancers that have occurred or are likely to develop in the target subject.
본 발명에서 상기 "목적하는 개체"란 인간을 포함하는 포유 동물로, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "object of interest" refers to mammals including humans, such as humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cows, horses, pigs, sheep and goats. It may be selected from the group consisting of, and may preferably be a human, but is not limited thereto.
본 발명에서 상기 "인간"은 암이 발생하였거나 그 발생이 의심되는 자로, 암의 적절한 치료가 필요하거나 예상되는 환자를 의미하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "human" may refer to a person who has developed or is suspected of having cancer, and may mean a patient who needs or is expected to receive appropriate treatment for cancer, but is not limited thereto.
본 발명에서 상기 예방 또는 치료의 대상이 되는 질환으로 상기 "암"은 위암, 갑상선암, 부갑상선암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종일 수 있고, 바람직하게는 위암일 수 있으나, 종양의 분화 및/또는 증식 등 암의 진행이 본 발명에서 기술하는 암 세포 또는 암 줄기세포에 의존적인 암의 종류라면 이에 제한되지 않는다.In the present invention, the disease to be prevented or treated, and the "cancer" refers to gastric cancer, thyroid cancer, parathyroid cancer, ovarian cancer, colon cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, Gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, Vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteric cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervous system tumor, primary CNS lymphoma, It may be a spinal cord tumor, brainstem glioma or pituitary adenoma, preferably gastric cancer, but the type of cancer in which cancer progression, such as tumor differentiation and/or proliferation, is dependent on the cancer cells or cancer stem cells described in the present invention. If so, it is not limited to this.
본 발명의 상기 위암은 위(gastric), 염증(inflammatory), 장(intestinal), 혼합(mixed) 및 줄기 유사(stem-like)로 이루어진 군에서 선택된 적어도 하나의 아형에 해당하는 것일 수 있으며, 바람직하게는 줄기 유사 아형 위암일 수 있다.The gastric cancer of the present invention may correspond to at least one subtype selected from the group consisting of gastric, inflammatory, intestinal, mixed, and stem-like, preferably. It may be stem-like subtype gastric cancer.
본 발명의 상기 "예방"이란, 본 발명의 상기 조성물을 이용하여 암 세포의 제어되지 않은 성장 등에 의해 발생되는 증상을 차단하거나, 그 증상을 억제 또는 지연시키는 행위라면 제한없이 포함될 수 있다.The "prevention" of the present invention may be included without limitation as long as it is an act of blocking, suppressing or delaying symptoms caused by uncontrolled growth of cancer cells by using the composition of the present invention.
본 발명의 상기 "개선"이란, 본 발명의 상기 조성물을 이용하여 암 세포의 제어되지 않은 성장 등에 의해 발생되는 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다.The "improvement" of the present invention may include without limitation any action that improves or benefits symptoms caused by uncontrolled growth of cancer cells by using the composition of the present invention.
본 발명의 상기 "치료"란, 본 발명의 상기 조성물을 이용하여 암 세포의 제어되지 않은 성장 등에 의해 발생된 증상이 호전되거나 이롭게 되는 행위라면 제한없이 포함될 수 있다.The "treatment" of the present invention may be included without limitation as long as symptoms caused by uncontrolled growth of cancer cells are improved or beneficial by using the composition of the present invention.
본 발명의 상기 암의 예방, 개선 또는 치료용 조성물은 약학적 조성물 또는 식품 조성물의 용도로 사용될 수 있으나, 이에 제한되는 것은 아니다.The composition for preventing, improving or treating cancer of the present invention may be used as a pharmaceutical composition or a food composition, but is not limited thereto.
본 발명에 있어서, 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. In the present invention, the pharmaceutical composition may be in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be intended for humans.
본 발명의 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서 (elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.The pharmaceutical composition of the present invention is not limited to these, but is formulated according to conventional methods into oral formulations such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories and sterile injection solutions. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, flavors, etc. for oral administration, and buffers, preservatives, and painless agents for injections. A topical, solubilizing agent, isotonic agent, stabilizer, etc. may be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. may be used. The formulation of the pharmaceutical composition of the present invention may be variously prepared by mixing with the above-described pharmaceutically acceptable carrier. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in unit dosage ampoules or multiple dosage forms. there is. In addition, it may be formulated into solutions, suspensions, tablets, capsules, sustained-release preparations, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.On the other hand, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used. In addition, fillers, anti-coagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, and the like may be further included.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. The route of administration of the pharmaceutical composition according to the present invention is, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intracapsular, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
본 발명의 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1 일 0.0001 내지 50 mg/kg 또는 0.001 내지 50 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.The pharmaceutical composition of the present invention depends on various factors including the activity of the specific compound used, age, body weight, general health, sex, diet, administration time, route of administration, excretion rate, drug combination and severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may be variously varied, and the dosage of the pharmaceutical composition varies depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and is 0.0001 to 50 mg per day. /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated into a pill, dragee, capsule, liquid, gel, syrup, slurry, or suspension.
또한, 본 발명에서 상기 암의 예방, 개선 또는 치료용 조성물은 추가로 다른 항암제와 병용하여 투여할 수 있다. 이와 같이, 다른 항암제와 병용하는 경우에는 암의 성장 또는 전이를 더욱 효과적으로 억제함으로써 암의 예방 또는 치료에 현저한 효과가 발휘되도록 할 수 있다.In addition, the composition for preventing, improving or treating cancer in the present invention may be administered in combination with other anticancer agents. In this way, when used in combination with other anticancer agents, it is possible to exert a remarkable effect in preventing or treating cancer by more effectively suppressing cancer growth or metastasis.
본 발명의 상기 항암제는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 소라페닙, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 카페시타빈, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈블라스틴, 이다루비신, 미토마이신, 블레로마이신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 올라파립, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴, 5FU, 보리노스텟, 엔티노스텟 및 카르무스틴으로 이루어진 군으로부터 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.The anticancer agent of the present invention is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cedi ranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, viscum album, asparaginase, tretinoin, hydroxyl Carbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomabtucetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, nitric acid Holmium chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, fludabine, eno Citabine, flutamide, capecitabine, decitabine, mercaptopurine, thioguanine, cladribine, carmophor, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide , vinblastine, idarubicin, mitomycin, bleromycin, dactinomycin, pirarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophos Pamid, melpharan, altretmin, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exmestane, aminoglutecimid, anagrelide, olaparib , navelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, 5FU, vorinostat, entinostat and carmustine It may be at least one selected, but is not limited thereto.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 대상체에게 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는 조성물을 약학적으로 유효한 양으로 투여하는 단계를 포함하는 암의 예방 또는 치료 방법에 관한 것이다. According to another embodiment of the present invention, chloroquine or a pharmaceutically acceptable salt thereof to a subject in need of administration; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; It relates to a method for preventing or treating cancer comprising administering a pharmaceutically effective amount of a composition containing at least one selected from the group consisting of as an active ingredient. .
본 발명에서 상기 "투여"는 임의의 적절한 방법으로 대상체에 소정의 본 발명의 화합물을 제공하는 것을 의미한다. In the present invention, the "administration" means providing a given compound of the present invention to a subject by any suitable method.
본 발명에서 상기 투여가 필요한 "대상체"는 포유동물 및 비-포유동물을 모두 포함할 수 있다. 여기서, 상기 포유동물의 예로는 인간, 비-인간 영장류, 예컨대 침팬지, 다른 유인원 또는 원숭이 종; 축산 동물, 예컨대 소, 말, 양, 염소, 돼지; 사육 동물, 예컨대 토끼, 개 또는 고양이; 실험 동물, 예를 들어 설치류, 예컨대 래트, 마우스 또는 기니아 피그 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 본 발명에서 상기 비-포유동물의 예로는 조류 또는 어류 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "subject" in need of the administration may include both mammals and non-mammals. Here, examples of the mammal include humans, non-human primates such as chimpanzees, other apes or monkey species; livestock animals such as cattle, horses, sheep, goats, pigs; domesticated animals such as rabbits, dogs or cats; Laboratory animals, such as rodents, such as rats, mice, or guinea pigs may be included, but are not limited thereto. In addition, examples of the non-mammals in the present invention may include birds or fish, but are not limited thereto.
본 발명에서 상기와 같이 투여되는 화합물의 제제는 특별히 제한하지 않으며, 고체 형태의 제제, 액체 형태의 제제 또는 흡인용 에어로졸 제제로 투여될 수 있으며, 사용하기 바로 전에 경구 또는 비경구 투여용 액체 형태 제제로 전환되도록 의도되는 고체 형태 제제로 투여될 수 있고, 예를 들면, 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 투여될 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the formulation of the compound administered as described above is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and a liquid formulation for oral or parenteral administration immediately before use. It can be administered in solid form preparations intended to be converted into, for example, oral formulations such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories and sterile injection solutions. However, it is not limited thereto.
또한, 본 발명에서 상기 투여 시 본 발명의 화합물과 함께 약학적으로 허용 가능한 담체를 추가로 투여할 수 있다. 여기서, 상기 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 화합물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.In addition, in the present invention, a pharmaceutically acceptable carrier may be additionally administered together with the compound of the present invention during the administration. Here, the pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a colorant, a flavoring agent, etc. for oral administration, and in the case of an injection, a buffer, Preservatives, analgesics, solubilizers, tonicity agents, stabilizers, etc. may be mixed and used, and in the case of topical administration, bases, excipients, lubricants, preservatives, etc. may be used. Formulations of the compound of the present invention can be variously prepared by mixing with the pharmaceutically acceptable carriers described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in unit dosage ampoules or multiple dosage forms. there is. In addition, it may be formulated into solutions, suspensions, tablets, capsules, sustained-release preparations, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.On the other hand, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used. In addition, fillers, anti-coagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, and the like may be further included.
본 발명에 따른 화합물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. Routes of administration of the compounds according to the present invention are, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or work included. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intracapsular, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
본 발명에서, "약학적으로 유효한 양"은 바람직한 생물학적 결과를 제공하기 위한 작용제의 충분한 양을 지칭한다. 상기 결과는 질환의 징후, 증상 또는 원인의 감소 및/또는 완화, 또는 생물계의 임의의 다른 바람직한 변화일 수 있다. 예를 들어, 치료 용도를 위한 "유효량"은 질환에서 임상적으로 유의한 감소를 제공하는데 요구되는, 본 발명에 개시된 화합물의 양이다. 임의의 개별적인 경우에서 적절한 "효과적인" 양은 일상적인 실험을 사용하여 당업자에 의해 결정될 수 있다. 따라서, 표현 "유효량"은 일반적으로 활성 물질이 치료 효과를 갖는 양을 지칭한다. 본 발명의 경우에, 활성 물질은 암 세포 또는 암 종양구의 성장 억제제이자, 암의 예방, 개선 또는 치료제이다.In the present invention, "pharmaceutically effective amount" refers to a sufficient amount of an agent to provide a desired biological result. The result may be reduction and/or alleviation of the signs, symptoms or causes of a disease, or any other desirable change in a biological system. For example, an “effective amount” for therapeutic use is the amount of a compound disclosed herein required to provide a clinically significant reduction in disease. An "effective" amount suitable in any individual case can be determined by one skilled in the art using routine experimentation. Thus, the expression “effective amount” generally refers to an amount of an active substance that has a therapeutic effect. In the case of the present invention, the active substance is a growth inhibitor of cancer cells or cancer tumor cells, and a preventive, ameliorative, or therapeutic agent for cancer.
본 발명의 화합물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 화합물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 100mg/kg 또는 0.001 내지 100mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 화합물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.The compounds of the present invention vary depending on a number of factors, including the activity of the specific compound used, age, body weight, general health, sex, dosage, time of administration, route of administration, excretion rate, drug formulation, and severity of the specific disease to be prevented or treated. The dosage of the compound may vary, depending on the patient's condition, body weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and is 0.0001 to 100 mg/kg or 0.001 to 0.001 mg/kg per day. It can be administered at 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way. The compound according to the present invention may be formulated as a pill, dragee, capsule, liquid, gel, syrup, slurry, or suspension.
본 발명의 화합물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The compounds of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers.
또한, 본 발명의 화합물은 다른 항암제와도 추가로 병용하여 사용될 수 있으며, 이때 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 소라페닙, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 케페시타빈, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 올라파립, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴, 보리노스텟, 엔티노스텟, 펜포민, 메트포민, 탈라조파립 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 사용할 수 있으나, 이에 제한되는 것은 아니다.In addition, the compound of the present invention may be further used in combination with other anticancer agents, wherein the anticancer agents include nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, and bande Tanib, Nirotinib, Semasanib, Bosutinib, Axitinib, Cediranib, Lestaurtinib, Trastuzumab, Gefitinib, Bortezomib, Sunitinib, Carboplatin, Sorafenib, Bevacizumab, Cisplatin, cetuximab, viscum album, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumabozogamicin, ibritumomabtucetan, heptaplatin, methylaminolevulinic acid , Amsacrine, Alemtuzumab, Procarbazine, Alprostadil, Holmium Nitrate Chitosan, Gemcitabine, Doxifluridine, Pemetrexed, Tegapur, Capecitabine, Gimeracin, Oteracil, Azacity Dean, methotrexate, uracil, cytarabine, fluorouracil, fludabine, enocitabine, flutamide, kefecitabine, decitabine, mercaptopurine, thioguanine, cladribine, carmophor, raltitrexed, Docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin , daunorubicin, dactinomycin, pirarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melpharan, altretmin, daka bazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exmestane, aminoglutesimide, anagrelide, olaparib, navelbine, fadrazole, tamoxifen, toremy At least one selected from the group consisting of pen, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, vorinostat, entinostat, phenformin, metformin, thalazoparib, and carmustine Can be used, but is not limited thereto.
본 발명의 또 다른 구현 예에 따르면, 암 치료제 적용을 위한 대상체를 동반 진단하는 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method of accompanying diagnosis for a cancer treatment application.
본 발명에서 상기 방법은 목적하는 개체로부터 분리된 생물학적 시료에서 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함할 수 있다.In the present invention, the method may include measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest.
본 발명에서 상기 대상체는 목적하는 개체와 혼용하여 사용될 수 있으며, 상기 목적하는 개체는 인간을 포함하는 포유 동물로, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the subject may be used interchangeably with a subject of interest, and the subject of interest may be a mammal including a human, for example, a human, rat, mouse, guinea pig, hamster, rabbit, monkey, dog, cat , may be selected from the group consisting of cows, horses, pigs, sheep and goats, preferably human, but is not limited thereto.
본 발명에서 상기 "인간"은 암이 발병하였거나 발병 가능성이 높은 것으로 의심되는 자로, 암 질환의 적절한 치료가 필요하거나 예상되는 환자를 의미하는 것일 수 있고, 바람직하게는 위암의 적절한 치료가 필요하거나 예상되는 환자일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "human" may refer to a person who has developed cancer or is suspected of having a high possibility of developing cancer, and may mean a patient who needs or is expected to receive appropriate treatment for cancer disease, preferably needs or is expected to receive appropriate treatment for gastric cancer. It may be a patient who becomes, but is not limited thereto.
본 발명의 상기 "생물학적 시료"는 암 질환이 발생한 환자이거나 암 질환의 발병이 의심되는 개체로부터 얻어지거나 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 예를 들면, 전혈 (whole blood), 백혈구 (leukocytes), 말초혈액 단핵 세포 (peripheral blood mononuclear cells), 백혈구 연층 (buffy coat), 혈장 (plasma) 및 혈청 (serum)을 포함하는 혈액, 객담 (sputum), 눈물 (tears), 점액 (mucus), 세비액 (nasal washes), 비강 흡인물 (nasal aspirate), 호흡 (breath), 소변 (urine), 정액 (semen), 침 (saliva), 복강 세척액 (peritoneal washings), 골반 내 유체액 (pelvic fluids), 낭종액 (cystic fluid), 뇌척수막 액 (meningeal fluid), 양수 (amniotic fluid), 선액 (glandular fluid), 췌장액 (pancreatic fluid), 림프액 (lymph fluid), 흉수 (pleural fluid), 유두 흡인물 (nipple aspirate), 기관지 흡인물 (bronchial aspirate), 활액 (synovial fluid), 관절 흡인물 (joint aspirate), 기관 분비물 (organ secretions), 세포 (cell), 세포 추출물 (cell extract) 또는 뇌척수액 (cerebrospinal fluid)을 포함할 수 있으나, 이에 제한되는 것은 아니다.The "biological sample" of the present invention refers to any material, biological fluid, tissue, or cell obtained from or derived from a patient with a cancer disease or a subject suspected of having a cancer disease, for example, whole blood Whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, blood including plasma and serum, sputum, tears ), mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, pelvis Pelvic fluids, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid ), nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cell, cell extract Or cerebrospinal fluid (cerebrospinal fluid) may be included, but is not limited thereto.
본 발명의 상기 암 치료제는 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나일 수 있으나, 암과 관련된 질환의 예방 또는 치료 효과가 예견되는 약물이라면 이에 제한되는 것은 아니다.The cancer treatment agent of the present invention is chloroquine (Chloroquine) or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; may be at least one selected from the group consisting of, but is not limited thereto as long as it is a drug that is expected to have a preventive or therapeutic effect on cancer-related diseases.
본 발명에서 카베올린-1의 바이오 마커를 이용한 사전 동반 진단(Companion Diagnostics)은 상기 암 치료제를 적용하였을 시 약물 반응성이 높아 암과 관련된 질환의 예방 또는 치료 효율성이 좋을 것으로 예견되는 대상체를 미리 선별할 수 있고, 대상체의 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정함으로써 상기 치료제를 효과적으로 사용하기 위한 필수적인 정보를 제공할 수 있다. In the present invention, Companion Diagnostics using the biomarker of caveolin-1 can select in advance a subject predicted to be effective in preventing or treating cancer-related diseases due to high drug reactivity when the cancer treatment is applied. In addition, by measuring the expression level of the subject's caveolin-1 protein or the gene encoding it, essential information for the effective use of the therapeutic agent can be provided.
본 발명의 동반 진단하는 방법은 상기에서 측정된 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군에 비하여 높은 개체를 선별하는 단계를 추가로 포함할 수 있다. The accompanying diagnosis method of the present invention may further include selecting an individual whose expression level of the caveolin-1 protein measured above or the gene encoding the same is higher than that of a normal control group.
본 발명에서 상기 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군에 비하여 높은 개체는 카베올린-1 매개 세포내 이입 작용을 억제하는 효과가 있는 치료제 효율이 높을 것으로 예측되므로, 본 발명의 암의 예방 또는 치료용 조성물의 투여를 통해 암, 바람직하게는 위암, 가장 바람직하게는 줄기 유사 아형 위암을 효과적으로 예방 또는 치료할 수 있다. In the present invention, an individual having a higher expression level of the caveolin-1 protein or a gene encoding the same is expected to have a higher therapeutic efficiency for inhibiting the caveolin-1-mediated endocytosis, and thus the present invention Cancer, preferably gastric cancer, most preferably stem-like subtype gastric cancer can be effectively prevented or treated through administration of the composition for preventing or treating cancer.
본 발명의 상기 방법에서, 카베올린-1 단백질 또는 이를 암호화하는 유전자, 암, 암 치료제 종류, 동반 진단 등에 관한 기재는 암 치료제의 적합성 판별용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the above method of the present invention, the description of the caveolin-1 protein or the gene encoding it, the cancer, the type of cancer therapeutic agent, accompanying diagnosis, etc. is the same as that described in the composition for determining the suitability of the cancer therapeutic agent, thereby avoiding the excessive complexity of the present specification. omitted to avoid
본 발명의 동반 진단하는 방법을 이용할 경우 암 치료제의 처방 전에 환자의 약물 반응성을 미리 선별함으로써, 암 치료의 효율성을 증대시키거나 치료제의 부작용을 감소시킬 수 있으며, 더 나아가 불필요한 의료비 지출을 막을 수 있는 경제적 효과가 기대된다.When using the companion diagnosis method of the present invention, by pre-screening the patient's drug reactivity before prescribing a cancer treatment, the efficiency of cancer treatment can be increased or the side effects of the treatment can be reduced, and furthermore, unnecessary medical expenses can be prevented. Economic effects are expected.
본 발명에 따른 조성물을 이용하는 경우 위암 환자의 유전적 특성으로부터 카베올린-1 매개 세포내 이입 작용을 억제할 수 있는 약물에 적합한 대상체를 선별할 수 있으며, 더 나아가 선별된 대상체에게 본 발명에 따른 조성물을 투여함으로써 위암, 특히는 난치성 위암을 매우 효과적으로 예방, 개선 또는 치료할 수 있다.When using the composition according to the present invention, it is possible to select a subject suitable for a drug capable of inhibiting caveolin-1-mediated endocytosis based on the genetic characteristics of gastric cancer patients, and furthermore, the composition according to the present invention is applied to the selected subject. Gastric cancer, particularly intractable gastric cancer, can be very effectively prevented, improved, or treated by administering.
도 1a는 본 발명의 일 실시예에 따른 위암 환자들의 전사체 분석을 통하여 위암 5가지 하위 아형에서 나타나는 Cav1 및 Cav2 발현 정도를 비교 확인한 결과를 나타낸 도이다.1A is a diagram showing the results of comparing and confirming the expression levels of Cav1 and Cav2 in five subtypes of gastric cancer through transcriptome analysis of gastric cancer patients according to an embodiment of the present invention.
도 1b는 본 발명의 일 실시예에 따른 위암 세포주에서의 Cav1 발현 정도를 확인하기 위하여 웨스턴 블랏을 수행한 결과를 나타낸 도이다. 1B is a diagram showing the results of Western blotting to confirm the level of Cav1 expression in gastric cancer cell lines according to an embodiment of the present invention.
도 1c는 본 발명의 일 실시예에 따른 마이크로 어레이 분석을 통하여 위암 하위 아형에서 나타나는 Cav1, Cav2 및 카베올라 복합체 구성 유전자들의 전사체 발현 정도를 비교 확인한 결과를 나타낸 도이다.FIG. 1C is a diagram showing the result of comparative confirmation of transcript expression levels of Cav1, Cav2, and caveola complex constituent genes in subtypes of gastric cancer through microarray analysis according to an embodiment of the present invention.
도 2는 본 발명의 일 실시예에 따른 줄기 유사 아형의 위암 세포주에 테트라메틸로다민으로 표지된 고분자 덱스트린(TMR-DEX, Invitrogen)의 흡수 시험 후 Cav1 면역 형광 염색을 시행한 결과를 나타낸 도이다.2 is a view showing the results of performing Cav1 immunofluorescence staining after an uptake test of tetramethylrhodamine-labeled high-molecular dextrin (TMR-DEX, Invitrogen) on a gastric cancer cell line of a stem-like subtype according to an embodiment of the present invention. .
도 3은 본 발명의 일 실시예에 따른 난치성 위암 세포주인 HS746T와 장 분자 아형의 세포주인 NCIN87에서 테트라메틸로다민 표지 고분자 덱스트린 흡수 시험을 시행한 결과를 나타낸 도이다.3 is a diagram showing the results of a tetramethylrhodamine-labeled dextrin absorption test in HS746T, a refractory gastric cancer cell line, and NCIN87, a cell line of the intestinal molecular subtype, according to an embodiment of the present invention.
도 4는 본 발명의 일 실시예에 따른 난치성 위암 세포주인 HS746T에 대조군 및 카베올린-1 siRNA 처리 후 Zeiss LSM-780 microscope (Carl Zeiss)으로 세포 내로 이입된 덱스트란의 형광 신호를 탐지한 결과를 확인한 도이다.Figure 4 shows the results of detecting fluorescence signals of dextran transfected into cells with a Zeiss LSM-780 microscope (Carl Zeiss) after treatment with control and caveolin-1 siRNA in HS746T, a refractory gastric cancer cell line according to an embodiment of the present invention. It is also confirmed.
도 5는 본 발명의 일 실시예에 따른 줄기 유사 아형의 위암 세포주인 HS746T, MKN1 및 SNU668에 대조군 및 카베올린-1 siRNA 처리 후 생존 세포의 수를 세포 생존 능력 측정 방법을 통해 확인한 결과를 나타낸 도이다.5 is a diagram showing the results of confirming the number of viable cells after treatment with control and caveolin-1 siRNA in gastric cancer cell lines of stem-like subtypes, HS746T, MKN1, and SNU668, according to an embodiment of the present invention, through a method for measuring cell viability; am.
도 6은 본 발명의 일 실시예에 따른 난치성 위암 세포주인 HS746T에 클로로퀸(Chloroquine, Sigma)을 처리한 후 Zeiss LSM-780 microscope (Carl Zeiss)으로 세포 내로 이입된 덱스트란의 형광 신호를 탐지한 결과를 확인한 도이다.6 is a result of detecting fluorescence signals of dextran transfected into cells with a Zeiss LSM-780 microscope (Carl Zeiss) after treating HS746T, an intractable gastric cancer cell line, with chloroquine (Sigma) according to an embodiment of the present invention. is also confirmed.
도 7a 내지 도 7c는 본 발명의 일 실시예에 따른 장 분자 아형 위암 세포주인 NCIN87과 난치성 위암 세포주인 HS746T에 클로로퀸의 처리 시 세포 증식의 정도를 비교 분석한 결과를 나타낸 도이다.7a to 7c are diagrams showing the results of comparative analysis of the degree of cell proliferation upon treatment with chloroquine in NCIN87, an intestinal molecular subtype gastric cancer cell line, and HS746T, a refractory gastric cancer cell line, according to an embodiment of the present invention.
도 8a 및 도 8b는 본 발명의 일 실시예에 따른 장 분자 아형 환자 유래 오가노이드인 GA326과 난치성 환자 유래 오가노이드인 GA077에 클로로퀸 처리 시 세포 증식 효과를 확인한 결과를 나타낸 도이다.8A and 8B are diagrams showing the results of confirming the cell proliferation effect when chloroquine is treated with GA326, an organoid derived from an intestinal subtype patient, and GA077, an organoid derived from a refractory patient, according to an embodiment of the present invention.
도 9a 내지 도 9d는 본 발명의 일 실시예에 따른 난치성 위암 세포주의 이종이식 마우스 모델에 클로로퀸 처리 시 종양의 생성 억제 효과를 확인한 도이다. 9a to 9d are views confirming the effect of inhibiting tumor formation when chloroquine is treated in a xenograft mouse model of a refractory gastric cancer cell line according to an embodiment of the present invention.
도 10a 내지 도 10d는 본 발명의 일 실시예에 따른 난치성 위암 세포주의 이종이식 마우스 모델에 클로로퀸 처리 시 종양의 성장 억제 효과를 확인한 도이다.10a to 10d are views confirming the tumor growth inhibitory effect upon treatment with chloroquine in a xenograft mouse model of a refractory gastric cancer cell line according to an embodiment of the present invention.
본 발명의 일 구현 예에서는 카베올린-1(Caveolin-1; Cav1) 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제를 포함하는 암 치료제의 적합성 판별용 조성물에 관한 것이다.One embodiment of the present invention relates to a composition for determining the suitability of a cancer therapeutic agent comprising an agent for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
본 발명의 다른 구현 예에서는 상기 암 치료제의 적합성 판별용 조성물을 포함하는 암 치료제의 적합성 판별용 키트에 관한 것이다.Another embodiment of the present invention relates to a kit for determining the suitability of a cancer therapeutic agent including the composition for determining the suitability of the cancer therapeutic agent.
본 발명의 또 다른 구현 예에서는 목적하는 개체로부터 분리된 생물학적 시료에서 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함하는 암 치료제 적합성에 관한 정보를 제공하는 방법에 관한 것이다.In another embodiment of the present invention, it relates to the suitability of a cancer treatment comprising measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest. It is about how to present information.
본 발명의 또 다른 구현 예에서는 카베올린-1(Caveolin-1; Cav1) 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제를 포함하는 위암의 진단용 조성물에 관한 것이다.Another embodiment of the present invention relates to a composition for diagnosis of gastric cancer comprising an agent for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
본 발명의 또 다른 구현 예에서는 상기 위암의 진단용 조성물을 포함하는 위암의 진단용 키트에 관한 것이다.Another embodiment of the present invention relates to a kit for diagnosing gastric cancer comprising the composition for diagnosing gastric cancer.
본 발명의 또 다른 구현 예에서는 목적하는 개체로부터 분리된 생물학적 시료에서 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함하는 위암의 진단에 관한 정보를 제공하는 방법에 관한 것이다.In another embodiment of the present invention, it relates to the diagnosis of gastric cancer comprising measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest. It is about how to present information.
본 발명의 또 다른 구현 예에서는 카베올린-1(Caveolin-1; Cav1) 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 측정부를 포함하는 위암의 진단 기기에 관한 것이다.Another embodiment of the present invention relates to a gastric cancer diagnosis device including a measuring unit for measuring the expression level of Caveolin-1 (Cav1) protein or a gene encoding the same.
본 발명의 또 다른 구현 예에서는 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는 암의 예방, 개선 또는 치료용 조성물에 관한 것이다.In another embodiment of the present invention, chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; it relates to a composition for preventing, improving or treating cancer comprising at least one selected from the group consisting of as an active ingredient.
본 발명의 또 다른 구현 예에서는 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는 암의 예방, 개선 또는 치료 방법에 이용하기 위한 약학 조성물에 관한 것이다.In another embodiment of the present invention, chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; relates to a pharmaceutical composition for use in a method for preventing, improving or treating cancer comprising at least one selected from the group consisting of as an active ingredient.
본 발명의 또 다른 구현 예에서는 투여가 필요한 대상체에게 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는 조성물을 약학적으로 유효한 양으로 투여하는 단계를 포함하는 암의 예방 또는 치료 방법에 관한 것이다.In another embodiment of the present invention, chloroquine or a pharmaceutically acceptable salt thereof is administered to a subject in need; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; It relates to a method for preventing or treating cancer comprising administering a pharmaceutically effective amount of a composition containing at least one selected from the group consisting of as an active ingredient. .
본 발명의 또 다른 구현 예에서는 목적하는 개체로부터 분리된 생물학적 시료에서 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함하는 암 치료제 적용을 위한 대상체를 동반 진단하는 방법에 관한 것이다.In another embodiment of the present invention, for application to a cancer treatment comprising measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest. It relates to a method of co-diagnosing a subject.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
준비예 1: 위암 환자의 샘플 수집Preparation Example 1: Sample collection from gastric cancer patients
본 연구는 연세대학교 의과대학 평가위원회 (Institutional Review Board; IRB)의 승인을 얻어 모든 실험을 수행하였으며, 모든 샘플은 환자로부터 서면 동의를 얻은 후 수집되었다. 위암 환자는 임상적으로 검증된 분류 체계에 따라 5가지 하위 아형인 위(gastric), 염증성(inflammatory), 장 분자(intestinal), 혼합(mixed) 및 줄기 유사(stem-like) 아형으로 나누어 이하의 실험을 수행하였다. In this study, all experiments were performed with the approval of the Institutional Review Board (IRB) of Yonsei University College of Medicine, and all samples were collected after obtaining written consent from the patients. Gastric cancer patients are divided into five subtypes according to a clinically validated classification system: gastric, inflammatory, intestinal, mixed, and stem-like. An experiment was conducted.
준비예 2: 세포주의 배양Preparation Example 2: Cultivation of cell lines
본 발명에 따른 실시예에서 암 세포 또는 암 줄기세포의 성장 또는 전이 억제능을 확인하기 위해 본 발명자들은 한국 세포주 은행 (Korean Cell Line Bank; KCRB)으로부터 인간 유래 위암 줄기세포 특성을 갖는 세포주인 MKN1, HS746T 및 SNU668, 인간 유래 위암 세포주인 SNU601, YCC7 및 NCIN87 세포를 수득하였다. 상기 각 세포주는 한국 세포주 은행의 가이드에 따라 MKN1, SNU668, SNU601, NCIN87은 10 % 소 태아 혈청 (FBS), 2mM L- 글루타민, 100 U/ml 페니실린 및 100 μg/ml 스트렙토 마이신이 함유된 RPMI1640 배지에서 배양하였으며, HS746T, YCC7은 10 % FBS, 2mM L- 글루타민, 100 U/ml 페니실린 및 100 μg/ml 스트렙토 마이신을 포함하는 DMEM 배지에서 배양하였다. 모든 세포주는 37 ℃, 5 % CO2 인큐베이터에서 배양되었으며 마이코플라즈마 오염 테스트 후 실험에 이용하였다.In order to confirm the ability to inhibit the growth or metastasis of cancer cells or cancer stem cells in the examples according to the present invention, the present inventors used MKN1, HS746T, a cell line having human-derived gastric cancer stem cell characteristics, from the Korean Cell Line Bank (KCRB). and SNU668, human-derived gastric cancer cell line SNU601, YCC7 and NCIN87 cells were obtained. MKN1, SNU668, SNU601, and NCIN87 were prepared in RPMI1640 medium containing 10% fetal bovine serum (FBS), 2mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin according to the guidelines of the Korean Cell Line Bank. HS746T and YCC7 were cultured in DMEM medium containing 10% FBS, 2mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. All cell lines were cultured in an incubator at 37 °C and 5% CO 2 , and were used for experiments after testing for mycoplasma contamination.
실시예 1: 위암 아형에 따른 전사체 분석Example 1: Transcriptome analysis according to gastric cancer subtypes
연세 암 센터에서 치료 목적의 위 절제술(curative intent gastrectomy)을 받은 위암 환자로부터 신선한 냉동 종양 조직을 확보하고 임상 데이터를 일치시켰다. 위암 환자는 임상적으로 검증된 분류 체계에 따라 5 가지 하위 아형 (위, 염증, 장, 혼합, 줄기 유사(난치성))으로 나누었으며 Cav1, Cav2 유전자의 발현을 그래프로 나타내었다(도 1a 참조). 전사체 분석 데이터를 살펴보면 다른 위암 아형에 비해 줄기 유사 아형인 난치성 위암(stem-like gastric cancer) 환자들에게서 Cav2와 비교하여 Cav1의 발현이 현저히 증가한 모습을 확인할 수 있다.We obtained fresh frozen tumor tissue from gastric cancer patients who underwent curative intent gastrectomy at Yonsei Cancer Center and matched the clinical data. Gastric cancer patients were divided into 5 subtypes (gastric, inflammatory, intestinal, mixed, stem-like (refractory)) according to a clinically validated classification system, and the expression of Cav1 and Cav2 genes was graphed (see Fig. 1a). . Looking at the transcriptome analysis data, it can be seen that the expression of Cav1 is significantly increased compared to Cav2 in patients with stem-like gastric cancer, which is a stem-like subtype, compared to other gastric cancer subtypes.
각 세포주는 프로테아제 저해제 혼합액(genedepot)을 포함한 EBC200(200 mM NaCl, 50 mM Tris-HCl(pH 8.0), 0.5 % NP-40) 세포 용해액으로 용해하였으며 BCA 어세이(pierce)를 통해 정량한 후 동량의 단백질을 SDS-PAGE 진행하여 PVDF 멤브레인(biorad)에 트랜스퍼하였다. 멤브레인은 5% 스킴 밀크(BD difco)로 상온에서 한 시간 블록킹시켜 각각 GLS 항체(abcam)는 1:2000, b-액틴 항체(Santa Cruz Biotechnology)는 1:5000로 5 % 스킴 밀크에 희석하여 4 ℃에서 하룻밤 유지했다. 2 차 항체는 5 % 스킴 밀크에 희석하여 상온에서 한 시간 진행한 후 LAS 4000 mini (Fujifilm)을 통해 결과를 확인하여 도 1b에 나타내었다.Each cell line was lysed with EBC200 (200 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.5% NP-40) cell lysate containing protease inhibitor mixture (genedepot), and after quantification through BCA assay (pierce) The same amount of protein was subjected to SDS-PAGE and transferred to a PVDF membrane (biorad). The membrane was blocked with 5% skim milk (BD difco) for one hour at room temperature, diluted 1:2000 for GLS antibody (abcam) and 1:5000 for b-actin antibody (Santa Cruz Biotechnology) in 5% skim milk, respectively, and It was kept overnight at °C. After diluting the secondary antibody in 5% skim milk and proceeding at room temperature for one hour, the results were confirmed through LAS 4000 mini (Fujifilm) and are shown in FIG. 1B.
위암 세포주에서 카베올린-1에 대해 웨스턴 블랏을 진행한 결과, 위암 아형 중 줄기 유사 아형(stem-like) 세포주인 HS747T, MKN1 및 SNU668에서 장 분자 아형(intestinal) 세포주인 SNU601, YCC7 및 NCIN87 보다 카베올린-1의 발현 정도가 특이적으로 높게 나타나는 것을 확인하였다. As a result of western blotting on caveolin-1 in gastric cancer cell lines, stem-like cell lines HS747T, MKN1 and SNU668 among gastric cancer subtypes showed higher caveolin-1 than intestinal molecular subtypes SNU601, YCC7 and NCIN87. It was confirmed that the expression level of olin-1 was specifically high.
또한, mRNA 레벨에서 비교하고자 위암 세포주의 유전체 분석을 시행하였고, 임상적으로 검증된 분류 체계에 따라 나누어진 환자의 유전체 데이터를 기반으로 장 분자 아형과 난치성 아형으로 분류하였다. 유전체 분석 데이터는 TPM으로 정규화를 진행하였으며, 카베올린-1과 카베올라 복합체를 형성하는 유전자들의 전사체 발현을 TPM 값으로 히트맵에 나타내었다(도 1c 참조). In addition, genome analysis of gastric cancer cell lines was performed to compare at the mRNA level, and based on the genome data of patients divided according to a clinically verified classification system, they were classified into intestinal molecular subtypes and intractable subtypes. The genome analysis data was normalized with TPM, and the transcript expression of genes forming caveolin-1 and caveola complexes was shown on a heat map as TPM values (see FIG. 1c).
위암 세포주의 마이크로 어레이 데이터를 분석한 결과, 줄기 유사 아형인 난치성 위암 세포주에서 카베올린-1과 카베올라 복합체 구성 유전자들의 전사체의 발현이 더 높은 것을 확인하였다.As a result of analyzing microarray data of gastric cancer cell lines, it was confirmed that expression of transcripts of caveolin-1 and caveola complex constituent genes was higher in the refractory gastric cancer cell line, which is a stem-like subtype.
실시예 2: 카베올린-1(Cav1) 매개 세포내 이입 대사 기전 확인Example 2: Confirmation of caveolin-1 (Cav1)-mediated endocytosis metabolism mechanism
커버 슬라이드가 깔린 12 웰 플레이트에 한 웰당 15,000 개의 HS746T을 분주한 뒤 다음날 세럼(Serum) 결핍(starvation) 배지(gibco)에 2 시간 배양 후, 1 mg/ml의 테트라메틸로다민 표지 고분자 덱스트란(Tetramethylrhodamine-Dextran, Invitrogen)을 추가하였다. 30 분 후, 세포를 PBS으로 세척한 뒤 3.7 % PFA (paraformaldehyde)을 함유한 PBS로 10 분간 고정하였고, 0.2 % Triton-100을 함유한 PBS를 20 분 동안 처리하여 세포막을 투과 시켜주었다. 이후 1 % BSA (bovine serum albumin)를 함유한 PBS를 1 시간 처리해 주었고 Caveolin-1 항체와(Abcam, ab2910) 4 ℃에서 24 시간 반응시킨 후 형광 2 차 항체와 1 시간 2 차 반응을 시켜주었고 핵을 염색하기 위해 DAPI 시약을 사용하였다. Zeiss LSM-780 microscope (Carl Zeiss)으로 Cav1의 형광 신호와 세포 내로 이입된 덱스트란의 형광 신호를 탐지하였다. 이후 데이터는 Airyscan processing (ZEN2.3 software, Carl Zeiss)으로 분석하여 그 결과를 도 2에 나타내었다.After dispensing 15,000 HS746T per well in a 12-well plate with a cover slide, incubate for 2 hours in serum starvation medium (gibco) the next day, 1 mg/ml tetramethylrhodamine-labeled polymer dextran ( Tetramethylrhodamine-Dextran, Invitrogen) was added. After 30 minutes, the cells were washed with PBS, fixed with PBS containing 3.7% PFA (paraformaldehyde) for 10 minutes, and treated with PBS containing 0.2% Triton-100 for 20 minutes to permeate the cell membrane. Then, PBS containing 1% BSA (bovine serum albumin) was treated for 1 hour, reacted with Caveolin-1 antibody (Abcam, ab2910) at 4 ° C for 24 hours, and then with a fluorescent secondary antibody for 1 hour. DAPI reagent was used for staining. The fluorescence signal of Cav1 and the fluorescence signal of dextran translocated into cells were detected with a Zeiss LSM-780 microscope (Carl Zeiss). After that, the data was analyzed by Airyscan processing (ZEN2.3 software, Carl Zeiss), and the results are shown in FIG. 2.
도 2를 참조하면, 난치성 위암 세포주인 HS746T에 테트라메틸로다민으로 표지된 고분자 덱스트린(TMR-DEX, Invitrogen)의 흡수 시험 후 Cav1 면역 형광 염색을 시행한 결과 TMR-DEX와 Cav1의 형광 신호가 겹치는 것을 확인하였다. Referring to FIG. 2, after an absorption test of tetramethylrhodamine-labeled polymeric dextrin (TMR-DEX, Invitrogen) in HS746T, a refractory gastric cancer cell line, Cav1 immunofluorescence staining was performed. As a result, the fluorescence signals of TMR-DEX and Cav1 overlapped. confirmed that
또한, 위암 아형에 따른 작용을 비교하고자 난치성 위암 세포주인 HS746T와 장 분자 아형의 세포주인 NCIN87에서 상기와 같은 추가 실험을 시행한 결과 줄기 유사 아형의 위암 세포주에서 덱스트린의 세포내 이입이 더 높게 나타나는 것을 알 수 있었다. 이를 통하여 난치성 위암 세포주에서의 특이적으로 높은 Cav1 발현은 암 세포의 세포 내 이입 대사 기전과 관련이 있음을 확인할 수 있었다(도 3 참조).In addition, in order to compare the effects according to gastric cancer subtypes, additional experiments as described above were conducted in HS746T, a refractory gastric cancer cell line, and NCIN87, a cell line of intestinal molecular subtype. Could know. Through this, it was confirmed that the specific high expression of Cav1 in the refractory gastric cancer cell line was related to the endocytosis metabolic mechanism of cancer cells (see FIG. 3).
실시예 3: 카베올린-1 억제 시 효과 확인Example 3: Confirmation of effect upon inhibition of caveolin-1
3.1 세포내 이입 기전 억제3.1 Inhibition of endocytosis mechanisms
세포 형광 실험용 플레이트(Glass bottom plate)에 한 웰당 15,000 개의 HS746T을 분주한 뒤 다음 날 제조사의 권장 방법에 따라 Viromer BLUE 시약(VB-01LB-01, OriGene)을 이용해 세포내 대조군(control) siRNA (Santa Cruz, sc-37007) 또는 카베올린-1 siRNA(Santa Cruz, sc-29241)을 주입시켜 cav1의 발현을 억제시켰다. 48 시간 후 세럼 결핍 배지에 2 시간 배양하여, 1 mg/ml의 테트라메틸로다민 표지 고분자 덱스트란 (Tetramethylrhodamine-Dextran, Invitrogen)을 추가하였다. 이후 30 분 뒤 배지를 교체해 주었고, Zeiss LSM-780 microscope (Carl Zeiss)으로 세포 내로 이입된 덱스트란의 형광 신호를 탐지하였다. 이후 데이터는 Airyscan processing (ZEN2.3 software, Carl Zeiss)으로 분석하였다.After dispensing 15,000 HS746T per well in a cell fluorescence test plate (Glass bottom plate), the next day, intracellular control siRNA (Santa Cruz, sc-37007) or caveolin-1 siRNA (Santa Cruz, sc-29241) was injected to suppress cav1 expression. After 48 hours, the cells were cultured in a serum-deficient medium for 2 hours, and 1 mg/ml of tetramethylrhodamine-labeled dextran (Tetramethylrhodamine-Dextran, Invitrogen) was added. After 30 minutes, the medium was replaced, and the fluorescence signal of the dextran introduced into the cells was detected using a Zeiss LSM-780 microscope (Carl Zeiss). Data were then analyzed by Airyscan processing (ZEN2.3 software, Carl Zeiss).
그 결과, 난치성 위암 세포주(줄기 유사 아형)의 Cav1 발현을 억제시킬 경우 세포내 이입 기전이 현저히 억제되는 것을 확인할 수 있었다(도 4 참조).As a result, it was confirmed that the endocytosis mechanism was remarkably suppressed when the expression of Cav1 in the refractory gastric cancer cell line (stem-like subtype) was inhibited (see FIG. 4 ).
3.2 줄기 유사 아형 위암 특이적 세포 사멸 효과3.2 Stem-like subtype gastric cancer-specific apoptotic effect
12 웰 플레이트에 한 웰당 15,000개의 HS746T, MKN1, SNU668을 분주한 뒤 다음날 10 % 소 태아 혈청 (FBS), 100 U/ml 페니실린 및 100 μg/ml 스트렙토 마이신이 함유된 배지(gibco)에 다음날 제조사의 권장 방법에 따라 Viromer BLUE 시약(VB-01LB-01, OriGene)을 이용해 세포내 대조군 siRNA (Santa Cruz, sc-37007) 또는 카베올린-1 siRNA (Santa Cruz, sc-29241)을 각각 주입시켰다. 처리 직후부터 24 시간 간격으로 0 시간, 24 시간, 48 시간, 72 시간 마다 세포 배양 배지를 제거하고 인산완충생리식염수(Phosphate-buffered saline; PBS)로 세척하였고, 0.025 % 트립신 용액 (Trypsin/EDTA Solution, Thermo Fisher)으로 세포를 재 부양 시켰다. 이후 튜브에 옮겨 배지를 추가한 후 3,000 rpm으로 3 분 동안 원심 분리하여 세포만을 침전시켰다. 그 후 자동 세포 계수기 키트(AccuChip Kit, ADAM™)와 ADAM-MC cell counter를 제조사의 권장 방법에 따라 이용하여 살아있는 세포의 수를 측정하였다.After dispensing 15,000 HS746T, MKN1, and SNU668 per well in a 12-well plate, the next day, the manufacturer's medium (gibco) containing 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin was added. According to the recommended method, intracellular control siRNA (Santa Cruz, sc-37007) or caveolin-1 siRNA (Santa Cruz, sc-29241) was injected using Viromer BLUE reagent (VB-01LB-01, OriGene), respectively. Immediately after treatment, the cell culture medium was removed at 0, 24, 48, and 72 hour intervals at 24-hour intervals, washed with Phosphate-buffered saline (PBS), and 0.025% trypsin solution (Trypsin/EDTA Solution). , Thermo Fisher), and cells were resuspended. Thereafter, the cells were transferred to a tube, medium was added, and centrifugation was performed at 3,000 rpm for 3 minutes to precipitate only the cells. Then, the number of live cells was measured using an automatic cell counter kit (AccuChip Kit, ADAM™) and an ADAM-MC cell counter according to the manufacturer's recommended method.
도 5를 살펴보면, 난치성 위암 세포주인 MKN1, HS746T 및 SNU668 모두에서 대조군 대비 Cav1 억제를 시킨 경우 세포 내 이입을 억제되어 매우 효과적으로 세포 사멸이 유도된 것을 확인하였다.Referring to FIG. 5, it was confirmed that in all of the refractory gastric cancer cell lines MKN1, HS746T and SNU668, when Cav1 was inhibited compared to the control group, endocytosis was inhibited and apoptosis was very effectively induced.
실시예 4: 클로로퀸 계열 약물의 Cav1 매개 세포내 이입 억제 기전 확인Example 4: Confirmation of Cav1-mediated endocytosis inhibition mechanism of chloroquine-based drugs
세포 형광 실험용 플레이트(Glass bottom plate)에 한 웰당 15,000 개의 HS746T을 분주한 뒤 다음 날 10 % 소 태아 혈청 (FBS), 100 U/ml 페니실린 및 100 μg/ml 스트렙토 마이신이 함유된 배지(gibco)에 클로로퀸(Chloroquine, Sigma)을 25 ug/ml의 농도로 처리하였다. 48 시간 후 세럼 결핍 배지에 2 시간 배양한 뒤 1 mg/ml의 테트라메틸로다민 표지 고분자 덱스트란(Tetramethylrhodamine-Dextran, Invitrogen)을 추가하였다. 30 분 뒤 배지를 교체해 주었고, Zeiss LSM-780 microscope (Carl Zeiss)으로 세포 내로 이입된 덱스트란의 형광 신호를 탐지하였다. 이후 데이터는 Airyscan processing (ZEN2.3 software, Carl Zeiss)으로 분석되었다.After dispensing 15,000 HS746T per well in a cell fluorescence test plate (Glass bottom plate), the next day, 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin were added to a medium (gibco). Chloroquine (Sigma) was treated at a concentration of 25 ug/ml. After 48 hours, after culturing for 2 hours in a serum-deficient medium, 1 mg/ml of tetramethylrhodamine-labeled dextran (Tetramethylrhodamine-Dextran, Invitrogen) was added. After 30 minutes, the medium was replaced, and the fluorescence signal of the dextran introduced into the cells was detected using a Zeiss LSM-780 microscope (Carl Zeiss). Data were then analyzed by Airyscan processing (ZEN2.3 software, Carl Zeiss).
카베올린-1이 높게 발현된 난치성 위암 세포주인 HS746T에 클로로퀸 약물 처리 전 후를 비교한 결과 클로로퀸이 Cav1 매개 세포내 이입이 억제된 것을 확인하였다(도 6 참조).As a result of comparison before and after treatment with chloroquine in HS746T, a refractory gastric cancer cell line in which caveolin-1 was highly expressed, it was confirmed that chloroquine inhibited Cav1-mediated endocytosis (see FIG. 6 ).
실시예 5: 줄기 유사 아형 위암의 특이적 치료 효과 확인Example 5: Confirmation of specific therapeutic effect of stem-like subtype gastric cancer
5.1 세포주 실험5.1 Cell line experiments
12 웰 플레이트에 한 웰당 15,000 개의 HS746T, 15,000 개의 NCIN87을 분주한 뒤 다음날 10 % 소 태아 혈청 (FBS), 100 U/ml 페니실린 및 100 μg/ml 스트렙토 마이신이 함유된 배지(gibco)에 클로로퀸(Chloroquine, Sigma), 하이드록시클로로퀸(Hydroxychloroquine sulfate, Sigma), 메플로퀸(Mefloquine hydrochloride, R&D System)을 1, 2.5, 5, 10, 25, 50 또는 100 ug/ml의 농도로 각각 처리하였다. 처리 직후부터 48 시간 후, 세포 배양 배지를 제거한 뒤 인산완충생리식염수(PBS)로 세척하였고, 0.025 % 트립신 용액(Trypsin/EDTA Solution, Thermo Fisher)으로 세포를 재부양 시켰다, 이후 튜브로 옮겨 배지를 추가한 후 3,000 rpm에서 3 분 동안 원심 분리하여 세포만을 침전시켰다. 이후 자동 세포 계수기 키트(AccuChip Kit, ADAM™)와 ADAM-MC cell counter를 제조사의 권장 방법에 따라 이용해 살아있는 세포의 수를 측정하였다.After dispensing 15,000 HS746T and 15,000 NCIN87 per well in a 12-well plate, the next day, Chloroquine , Sigma), hydroxychloroquine sulfate (Sigma), and mefloquine hydrochloride (R&D System) were treated at concentrations of 1, 2.5, 5, 10, 25, 50 or 100 ug/ml, respectively. 48 hours after the treatment, the cell culture medium was removed, washed with phosphate buffered saline (PBS), and the cells were resuspended with 0.025% trypsin solution (Trypsin/EDTA Solution, Thermo Fisher), then transferred to a tube and the medium After addition, only cells were precipitated by centrifugation at 3,000 rpm for 3 minutes. Then, the number of viable cells was measured using an automatic cell counter kit (AccuChip Kit, ADAM™) and an ADAM-MC cell counter according to the manufacturer's recommended method.
장 분자 아형 위암 세포주인 NCIN87과 줄기 유사 아형 위암 세포주인 HS746T에서 클로로퀸의 농도 별 세포 증식 분석을 진행하였고, 클로로퀸 또는 클로로퀸과 같은 퀴놀론 계열의 약물인 하이드록시클로로퀸, 메플로퀸을 1, 2.5, 5, 10, 25, 50 또는 100 ug/ml의 농도로 각각 처리한 결과를 도 7a 내지 도 7C에 나타내었다. 이를 살펴보면 장 분자 아형인 NCIN87과 비교하여 줄기 유사 아형인 HS746T에서 상대적으로 적은 농도로도 세포 증식을 효과적으로 억제시킬 수 있음을 확인하였다. Intestinal molecular subtype gastric cancer cell line NCIN87 and stem-like subtype gastric cancer cell line HS746T were analyzed for cell proliferation by concentration of chloroquine. , 25, 50 or 100 ug/ml concentrations, respectively, are shown in FIGS. 7A to 7C. Looking at this, it was confirmed that cell proliferation can be effectively inhibited even at a relatively low concentration in the stem-like subtype HS746T compared to the intestinal molecular subtype NCIN87.
5.2 오가노이드 실험5.2 Organoid experiments
연세대학교 의과대학 평가위원회 (Institutional Review Board; IRB)의 승인을 얻어 수득한 환자 유래 조직물로부터 임상적으로 검증된 분류 체계에 따라 장 분자 아형(intestinal, GA326)과 난치성 아형(stem like, GA077)으로 분류하여 실험에 이용하였다. 오가노이드는 40 % advanced DMEM/F12 (gibco), 50 % Wnt3A 세포배양액(conditioned media), 10 % R-spond1 세포배양액(conditioned media), 1 % HEPES(gibco), 1 % 글루타맥스(gibco). 0.2 % 프리모신(invivogen), 2 % B-27(Invitrogen), 10 mM 니코틴아마이드(sigma), 1 mM N-아세틸시스테인(sigma), 2 uM A8301, 50 ng/ml mEGF(invitrogen), 100 ng/ml m노긴(mNoggin, peprotech), 1 nM 가스트린(sigma), 200 ng/ml hFGF10(peprotech), 12.5 uM Y-27632(Enzo)로 배양하였으며 매트리젤(corning)을 이용하여 3D 구조를 형성하였다. 상기 실험은 24 웰 플레이트에서 진행되었으며 5 uM CB839(cayman)를 포함한 오가노이드 미디어를 처리하였다. 처리 직후부터 매 24 시간 광학 현미경(Olympus)로 촬영하였고, Image J를 통해 중앙을 지나는 가장 긴 지름과 가장 짧은 지름을 측정한 뒤 두 값을 평균 내어 각 오가노이드의 지름을 측정하였다. 측정된 지름은 현미경 사이즈 바를 통해 um 단위로 변환하였으며 0 일차의 지름으로 평균화를 진행한 뒤 퍼센티지(%)로 나타내었다. Intestinal subtypes (intestinal, GA326) and intractable subtypes (stem like, GA077) according to a clinically verified classification system from patient-derived tissue obtained with the approval of the Institutional Review Board (IRB) of Yonsei University College of Medicine were classified and used in the experiment. Organoids are 40% advanced DMEM/F12 (gibco), 50% Wnt3A cell culture medium (conditioned media), 10% R-spond1 cell culture medium (conditioned media), 1% HEPES (gibco), 1% Glutamax (gibco) . 0.2% Primosin (Invivogen), 2% B-27 (Invitrogen), 10 mM Nicotinamide (Sigma), 1 mM N-Acetylcysteine (Sigma), 2 uM A8301, 50 ng/ml mEGF (Invitrogen), 100 ng /ml mNoggin (mNoggin, peprotech), 1 nM gastrin (sigma), 200 ng/ml hFGF10 (peprotech), 12.5 uM Y-27632 (Enzo) were cultured and a 3D structure was formed using matrigel (corning) . The experiment was conducted in a 24-well plate and organoid media containing 5 uM CB839 (cayman) was treated. Immediately after treatment, images were taken with an optical microscope (Olympus) every 24 hours, and the longest and shortest diameters passing through the center were measured using Image J, and the two values were averaged to measure the diameter of each organoid. The measured diameter was converted into um units through a microscope size bar, averaged with the diameter of the 0th day, and expressed as a percentage (%).
난치성 위암 환자(줄기 유사 아형) 유래 오가노이드(patient derived organoid, PDO)인 GA077에 클로로퀸 50 ug/ml을 96 시간 동안 처리했을 때 장 분자 아형 환자 유래 오가노이드인 GA326에 비하여 증식이 현저히 효과적으로 감소한 것을 확인하였다(도 8b 참조). 이와 같은 결과는 같은 위암일지라도 아형의 유형에 따라 치료 효과가 달라지게 됨을 의미하는 것이며, 줄기 유사 아형 위암의 치료에 적합한 약물로 활용할 수 있음을 시사한다.When 50 ug/ml of chloroquine was treated for 96 hours with GA077, a patient derived organoid (PDO) derived from a patient with intractable gastric cancer (stem-like subtype), the proliferation was markedly and effectively reduced compared to GA326, a patient derived organoid derived from an intestinal subtype. It was confirmed (see Fig. 8b). These results mean that the treatment effect varies depending on the subtype even for the same gastric cancer, and suggests that it can be used as a drug suitable for the treatment of stem-like subtype gastric cancer.
5.3 이종이식 마우스 모델 실험 - 종양 생성(tumorigenesis) 억제 효과 비교5.3 Xenograft mouse model experiment - comparison of tumorigenesis inhibitory effect
생체 내 치료 이종 이식 모델에서 클로로퀸이 종양 생성에 미치는 영향을 평가하기 위해서 생후 6 주된 암컷 BALB/c 누드 마우스 (Central Lab Animal Inc)에 50,000 개의 HS746T를 희석한 배지(DMEM)와 BD 매트리젤을 1:1 희석하여 총 100 ul로 피하 주사하였다. 3 일 후 식염수, 시스플라틴(cisplatin; CDDP) 또는 클로로퀸(SIGMA, C6628-25G)을 3 주 동안 매일 복강 내 주사하였고, 종양이 형성된 5 일 후부터는 캘리퍼로 종양의 크기를 측정하여 그 결과를 도 9b에 나타내었다. 그 후, 수술로 제거한 종양의 무게를 재서 추가 분석에 사용하였다(도 9c 및 도 9d 참조). To evaluate the effect of chloroquine on tumorigenesis in an in vivo therapeutic xenograft model, 6-week-old female BALB/c nude mice (Central Lab Animal Inc) were treated with medium (DMEM) diluted with 50,000 HS746T and BD Matrigel. :1 diluted and injected subcutaneously in a total of 100 ul. After 3 days, saline, cisplatin (CDDP) or chloroquine (SIGMA, C6628-25G) was intraperitoneally injected every day for 3 weeks, and the size of the tumor was measured with a caliper from 5 days after the tumor was formed, and the results are shown in FIG. 9B. showed up Then, the surgically removed tumor was weighed and used for further analysis (see FIGS. 9C and 9D ).
실험 결과를 살펴보면 줄기 유사 아형의 위암의 경우 위암 치료제로 통용되는 시스플라틴 처리 시에 비하여 클로로퀸 처리 시 종양의 크기가 감소된 상태를 유지하였으며, 제거된 종양의 크기를 보면 시각적으로도 현저한 차이를 확인할 수 있었으며, 제거된 종양의 무게를 측정한 결과 역시 마찬가지로 확인되었다. 상기 결과를 종합하면 난치성 위암 세포주의 이종이식 마우스 모델에 클로로퀸 처리 시 종양의 생성을 보다 효과적으로 감소시키는 것을 확인하였다.Examining the experimental results, in the case of gastric cancer of the stem-like subtype, the size of the tumor remained reduced when treated with chloroquine compared to when treated with cisplatin, which is commonly used as a gastric cancer treatment. The results of measuring the weight of the removed tumor were also confirmed. Summarizing the above results, it was confirmed that the formation of tumors was more effectively reduced when chloroquine was treated in a xenograft mouse model of a refractory gastric cancer cell line.
5.4 이종이식 마우스 모델 실험 - 종양 성장(tumor growth) 억제 효과 비교5.4 Xenograft mouse model experiment - Comparison of tumor growth inhibition effect
클로로퀸이 종양의 성장에 미치는 영향을 평가하기 위해서는 암컷 BALB/c 누드 마우스를 6 주차에 50,000 개의 HS746T를 희석한 배지와 BD 매트리젤과 1:1 희석하여 총 100 ul로 복강 내 주입한 뒤 일정 크기로 종양이 형성된 2 주부터 3 주 동안 매일 식염수, 시스플라틴(cisplatin; CDDP) 또는 클로로퀸(60 mg/kg)을 복강내 주사로 투여하였다. 종양의 크기를 캘리퍼로 매일 측정하여 도 10b에 나타내었다. 그 후, 수술로 제거한 종양의 무게를 재서 추가 분석에 사용하였다(도 10c 및 도 10d 참조).To evaluate the effect of chloroquine on tumor growth, female BALB/c nude mice were intraperitoneally injected at week 6 with 50,000 HS746T diluted medium and 1:1 diluted with BD Matrigel at a total volume of 100 ul. Saline, cisplatin (CDDP), or chloroquine (60 mg/kg) was administered by intraperitoneal injection every day for 2 to 3 weeks after tumor formation. The size of the tumor was measured daily with a caliper and is shown in FIG. 10B. Thereafter, the surgically removed tumor was weighed and used for further analysis (see FIGS. 10C and 10D ).
실험 결과를 살펴보면 시간 경과에 따라 종양 크기 격차가 70 % 이상 나게 되며, 수술로 제거한 종양 무게를 측정한 결과 또한 50 % 이상 감소한 것을 통해 난치성 위암 세포주의 이종이식 마우스 모델에 클로로퀸 처리 시 종양 성장이 효과적으로 감소되는 것을 확인하였다. Examining the experimental results, the tumor size gap increased by more than 70% over time, and the result of measuring the weight of the surgically removed tumor also decreased by more than 50%. confirmed to decrease.
상기 결과를 종합하면, 본 발명에 따른 클로로퀸 계열의 화합물은 줄기 유사 아형 위암에 특이적으로 작용하여 Cav1 매개 세포내 이입 기전을 억제함으로써 종양의 형성 및 성장을 억제할 수 있을 뿐만 아니라, 난치성 위암, 특히는 카베올린-1 과발현 줄기 유사 아형 위암을 효과적으로 치료할 수 있을 것으로 기대된다. Taken together, the chloroquine-based compound according to the present invention specifically acts on stem-like subtype gastric cancer and suppresses the Cav1-mediated endocytosis mechanism, thereby inhibiting tumor formation and growth, as well as inhibiting refractory gastric cancer, In particular, it is expected to be able to effectively treat caveolin-1 overexpressing stem-like subtype gastric cancer.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.Having described specific parts of the present invention in detail above, it is clear that these specific techniques are only preferred embodiments for those skilled in the art, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
본 발명의 조성물을 사용하는 경우, 카베올린-1 매개 세포내 이입 작용을 억제할 수 있는 약물에 적합한 유전적 특성을 지닌 대상체를 선별하고, 선별된 대상체에게 상기 약물을 투여함으로써 위암, 특히는 난치성 위암을 매우 효과적으로 예방, 개선 또는 치료할 수 있다.In the case of using the composition of the present invention, gastric cancer, particularly intractable, is treated by selecting a subject having genetic characteristics suitable for a drug capable of inhibiting caveolin-1-mediated endocytosis, and administering the drug to the selected subject. Gastric cancer can be prevented, ameliorated or treated very effectively.
서열번호 1: caveolin-1, Homo sapiensSEQ ID NO: 1: caveolin-1, Homo sapiens
msggkyvdse ghlytvpire qgniykpnnk amadelsekq vydahtkeid lvnrdpkhlnmsggkyvdse ghlytvpire qgniykpnnk amadelsekq vydahtkeid lvnrdpkhln
ddvvkidfed viaepegths fdgiwkasft tftvtkywfy rllsalfgip maliwgiyfaddvvkidfed viaepegths fdgiwkasft tftvtkywfy rllsalfgip maliwgiyfa
ilsflhiwav vpciksflie iqcisrvysi yvhtvcdplf eavgkifsnv rinlqkeiilsflhiwav vpciksflie iqcisrvysi yvhtvcdplf eavgkifsnv rinlqkei
서열번호 2: caveolin-1, Homo sapiensSEQ ID NO: 2: caveolin-1, Homo sapiens
atactggttt taccgcttgc tgtctgccct ctttggcatc ccgatggcac tcatctggggatactggttt taccgcttgc tgtctgccct ctttggcatc ccgatggcac tcatctgggg
catttacttc gccattctct ctttcctgca catctgggca gttgtaccat gcattaagagcatttacttc gccattctct ctttcctgca catctgggca gttgtaccat gcattaagag
cttcctgatt gagattcagt gcatcagccg tgtctattcc atctacgtcc acaccgtctgcttcctgatt gagattcagt gcatcagccg tgtctattcc atctacgtcc acaccgtctg
tgacccactc tttgaagctg ttgggaaaat attcagcaat gtccgcatca acttgcagaatgacccactc tttgaagctg ttgggaaaat attcagcaat gtccgcatca acttgcagaa
agaaatataaagaaatataa

Claims (29)

  1. 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제를 포함하는, 암 치료제의 적합성 판별용 조성물.A composition for determining the suitability of a cancer therapeutic agent, comprising an agent for measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same.
  2. 제 1항에 있어서,According to claim 1,
    상기 카베올린-1 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 것인, 조성물.The composition, wherein the caveolin-1 protein consists of the amino acid sequence represented by SEQ ID NO: 1.
  3. 제 1항에 있어서,According to claim 1,
    상기 카베올린-1 유전자는 서열번호 2로 표시되는 핵산 서열로 이루어진 것인, 조성물.The caveolin-1 gene is composed of the nucleic acid sequence represented by SEQ ID NO: 2, the composition.
  4. 제 1항에 있어서,According to claim 1,
    상기 단백질의 발현 수준을 측정하는 제제는 상기 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA (peptide nucleic acid) 및 앱타머 (aptamer)로 이루어진 군에서 선택된 1 종 이상을 포함하는, 조성물.The agent for measuring the expression level of the protein comprises at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNAs (peptide nucleic acids) and aptamers that bind specifically to the protein, composition .
  5. 제 1항에 있어서,According to claim 1,
    상기 유전자의 발현 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1 종 이상을 포함하는, 조성물.An agent for measuring the expression level of the gene comprises at least one selected from the group consisting of primers, probes and antisense nucleotides that specifically bind to the gene, composition.
  6. 제 1항에 있어서, According to claim 1,
    상기 암은 위암, 유방암, 대장암, 폐암, 간암, 식도암, 췌장암, 담낭암, 신장암, 방광암, 전립선암, 고환암, 결장암, 자궁경부암, 자궁내막암, 융모암, 피부암, 난소암, 갑상선암, 뇌암, 혈액암, 두경부암, 악성흑색종 및 림프종으로 이루어진 군으로부터 선택되는 적어도 하나인, 조성물.The cancers include gastric cancer, breast cancer, colon cancer, lung cancer, liver cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, colon cancer, cervical cancer, endometrial cancer, choriocarcinoma, skin cancer, ovarian cancer, thyroid cancer, and brain cancer. , At least one composition selected from the group consisting of blood cancer, head and neck cancer, malignant melanoma, and lymphoma.
  7. 제 6항에 있어서, According to claim 6,
    상기 위암은 위(gastric), 염증성(inflammatory), 장 분자(intestinal), 혼합(mixed) 및 줄기 유사(stem-like)로 이루어진 군에서 선택된 적어도 하나의 아형에 해당하는 것인, 조성물.The composition of claim 1, wherein the gastric cancer corresponds to at least one subtype selected from the group consisting of gastric, inflammatory, intestinal, mixed, and stem-like.
  8. 제 1항에 있어서, According to claim 1,
    상기 치료제는 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나인, 조성물.The therapeutic agent is chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; at least one selected from the group consisting of, a composition.
  9. 제 1항 내지 제 8항 중 어느 한 항의 조성물을 포함하는, 암 치료제의 적합성 판별용 키트.A kit for determining the suitability of a cancer therapeutic agent comprising the composition of any one of claims 1 to 8.
  10. 제 9항에 있어서,According to claim 9,
    상기 키트는 RT-PCR 키트, DNA 칩 키트, ELISA 키트, 단백질 칩 키트, 래피드 (rapid) 키트 또는 MRM (Multiple reaction monitoring) 키트인, 키트.The kit is an RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit.
  11. 목적하는 개체로부터 분리된 생물학적 시료에서, 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함하는 암 치료제 적합성에 관한 정보를 제공하는 방법.A method for providing information on suitability for cancer treatment comprising measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest.
  12. 제 11항에 있어서,According to claim 11,
    상기 생물학적 시료에서 측정된 카베올린-1 단백질 또는 이를 암호화하는 유전자의 발현 수준이 정상 대조군에 비하여 높을 경우, 상기 목적하는 개체에게 발생한 암을 치료하기 위한 치료제로서의 효과가 높을 것으로 예측하는 것인, 방법.When the expression level of the caveolin-1 protein or the gene encoding it measured in the biological sample is higher than that of the normal control, the effect as a therapeutic agent for treating cancer in the target subject is predicted to be high, method .
  13. 제 11항에 있어서,According to claim 11,
    상기 암은 위암, 유방암, 대장암, 폐암, 간암, 식도암, 췌장암, 담낭암, 신장암, 방광암, 전립선암, 고환암, 결장암, 자궁경부암, 자궁내막암, 융모암, 피부암, 난소암, 갑상선암, 뇌암, 혈액암, 두경부암, 악성흑색종 및 림프종으로 이루어진 군으로부터 선택되는 적어도 하나인, 방법.The cancers include gastric cancer, breast cancer, colon cancer, lung cancer, liver cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, colon cancer, cervical cancer, endometrial cancer, choriocarcinoma, skin cancer, ovarian cancer, thyroid cancer, and brain cancer. , At least one selected from the group consisting of hematological cancer, head and neck cancer, malignant melanoma, and lymphoma.
  14. 제 13항에 있어서,According to claim 13,
    상기 위암은 위(gastric), 염증(inflammatory), 장(intestinal), 혼합(mixed) 및 줄기 유사(stem-like)로 이루어진 군에서 선택된 적어도 하나의 아형에 해당하는 것인, 방법.Wherein the gastric cancer corresponds to at least one subtype selected from the group consisting of gastric, inflammatory, intestinal, mixed, and stem-like.
  15. 제 11항에 있어서,According to claim 11,
    상기 치료제는 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나인, 방법.The therapeutic agent is chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; at least one selected from the group consisting of, method.
  16. 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 제제를 포함하는, 위암 진단용 조성물.A composition for diagnosing gastric cancer, comprising an agent for measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same.
  17. 제 16항에 있어서,According to claim 16,
    상기 위암은 줄기 유사(stem-like) 아형인, 조성물.The composition of claim 1, wherein the gastric cancer is a stem-like subtype.
  18. 제 16항의 조성물을 포함하는, 위암 진단용 키트.A kit for diagnosing gastric cancer comprising the composition of claim 16.
  19. 목적하는 개체로부터 분리된 생물학적 시료에서, 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계를 포함하는 위암의 진단에 관한 정보를 제공하는 방법.A method for providing information on the diagnosis of gastric cancer comprising measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest.
  20. (a) 목적하는 개체로부터 얻어진 생물학적 시료에 대하여 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 측정부; 및 (a) a measurement unit for measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same with respect to a biological sample obtained from a subject of interest; and
    (b) 상기 측정부에서 측정된 단백질 또는 이를 암호화하는 유전자의 발현 수준으로부터 상기 목적하는 개체의 위암의 아형을 출력하는 검출부;를 포함하는 위암의 진단 기기.(b) a detection unit outputting the subtype of gastric cancer of the subject from the expression level of the protein measured by the measurement unit or the gene encoding the same;
  21. 제 20항에 있어서,21. The method of claim 20,
    상기 위암의 아형은 위(gastric), 염증(inflammatory), 장(intestinal), 혼합(mixed) 및 줄기 유사(stem-like)로 이루어진 군에서 선택된 적어도 하나인, 진단 기기.The diagnostic device, wherein the subtype of gastric cancer is at least one selected from the group consisting of gastric, inflammatory, intestinal, mixed, and stem-like.
  22. 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는, 암의 예방 또는 치료용 약학 조성물.Chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; containing at least one selected from the group consisting of as an active ingredient, a pharmaceutical composition for preventing or treating cancer.
  23. 제 22항에 있어서,23. The method of claim 22,
    상기 암은 위암, 유방암, 대장암, 폐암, 간암, 식도암, 췌장암, 담낭암, 신장암, 방광암, 전립선암, 고환암, 결장암, 자궁경부암, 자궁내막암, 융모암, 피부암, 난소암, 갑상선암, 뇌암, 혈액암, 두경부암, 악성흑색종 및 림프종으로 이루어진 군으로부터 선택되는 적어도 하나인 것인, 조성물.The cancers include gastric cancer, breast cancer, colon cancer, lung cancer, liver cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, colon cancer, cervical cancer, endometrial cancer, choriocarcinoma, skin cancer, ovarian cancer, thyroid cancer, and brain cancer. .
  24. 제 23항에 있어서,24. The method of claim 23,
    상기 위암은 위(gastric), 염증(inflammatory), 장(intestinal), 혼합(mixed) 및 줄기 유사(stem-like)로 이루어진 군에서 선택된 적어도 하나의 아형에 해당하는 것인, 조성물.Wherein the gastric cancer corresponds to at least one subtype selected from the group consisting of gastric, inflammatory, intestinal, mixed and stem-like, composition.
  25. 제 22항에 있어서,23. The method of claim 22,
    상기 조성물은 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 소라페닙, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 카페시타빈, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈블라스틴, 이다루비신, 미토마이신, 블레로마이신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 올라파립, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴, 5FU, 보리노스텟, 엔티노스텟 및 카르무스틴으로 이루어진 군으로부터 선택되는 적어도 하나를 추가로 포함하는, 조성물.The composition includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, lesta urtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, viscum album, asparaginase, tretinoin, hydroxycarbamide, Dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomabtucetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, chitosan holmium nitrate, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacytidine, methotrexate, uracil, cytarabine, fluorouracil, fludabine, enocitabine, flutamide, capecitabine, decitabine, mercaptopurine, thioguanine, cladribine, carmophor, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vinbla Steen, idarubicin, mitomycin, bleromycin, dactinomycin, pirarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, Melpharan, altretmin, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exmestane, aminoglutecimide, anagrelide, olaparib, navelbine at least selected from the group consisting of fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, 5FU, vorinostat, entinostat and carmustine A composition further comprising one.
  26. a) 목적하는 개체로부터 분리된 생물학적 시료에서 카베올린-1(Caveolin-1; Cav1)의 단백질 또는 이를 암호화하는 유전자의 발현 수준을 측정하는 단계; 및 a) measuring the expression level of a protein of Caveolin-1 (Cav1) or a gene encoding the same in a biological sample isolated from a subject of interest; and
    b) 상기에서 측정된 발현 수준이 정상 대조군에 비하여 높은 개체를 선별하는 단계;를 포함하는 암 치료제 적용을 위한 대상체를 동반 진단하는 방법.b) selecting a subject whose expression level measured above is higher than that of a normal control group;
  27. 제 26항에 있어서,27. The method of claim 26,
    상기 암 치료제는 제 16항 내지 제 19항 중 어느 하나의 조성물인, 방법.The cancer treatment is a composition according to any one of claims 16 to 19.
  28. 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는 암의 예방, 개선 또는 치료 방법에 이용하기 위한 약학적 조성물.Chloroquine or a pharmaceutically acceptable salt thereof; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; And mefloquine (Mefloquine) or a pharmaceutically acceptable salt thereof; a pharmaceutical composition for use in a method for preventing, improving or treating cancer comprising at least one selected from the group consisting of as an active ingredient.
  29. 투여가 필요한 대상체에게 클로로퀸(Chloroquine) 또는 이의 약학적으로 허용 가능한 염; 하이드록시클로로퀸(Hydroxychloroquine) 또는 이의 약학적으로 허용 가능한 염; 및 메플로퀸(Mefloquine) 또는 이의 약학적으로 허용 가능한 염;으로 이루어진 군에서 선택된 적어도 하나를 유효 성분으로 포함하는 조성물을 약학적으로 유효한 양으로 투여하는 단계를 포함하는 암의 예방 또는 치료 방법.Chloroquine or a pharmaceutically acceptable salt thereof to a subject in need of administration; Hydroxychloroquine or a pharmaceutically acceptable salt thereof; and mefloquine or a pharmaceutically acceptable salt thereof; a method for preventing or treating cancer comprising administering a pharmaceutically effective amount of a composition comprising at least one selected from the group consisting of as an active ingredient.
PCT/KR2021/012879 2021-09-17 2021-09-17 Composition for preventing, ameliorating, or treating gastric cancer WO2023042944A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/012879 WO2023042944A1 (en) 2021-09-17 2021-09-17 Composition for preventing, ameliorating, or treating gastric cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/012879 WO2023042944A1 (en) 2021-09-17 2021-09-17 Composition for preventing, ameliorating, or treating gastric cancer

Publications (1)

Publication Number Publication Date
WO2023042944A1 true WO2023042944A1 (en) 2023-03-23

Family

ID=85603028

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/012879 WO2023042944A1 (en) 2021-09-17 2021-09-17 Composition for preventing, ameliorating, or treating gastric cancer

Country Status (1)

Country Link
WO (1) WO2023042944A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002030973A2 (en) * 2000-10-13 2002-04-18 University Of Lausanne The caveolin-1 gene and polypeptide encoded thereby and methods of use thereof
WO2003063690A2 (en) * 2002-01-31 2003-08-07 Baylor College Of Medicine Secreted caveolin as a marker for prostate cancer
KR20130081952A (en) * 2012-01-10 2013-07-18 삼성전자주식회사 Biomarkers for diagnosing cancer and method for isolating cancer cell using the same
WO2013149058A1 (en) * 2012-03-30 2013-10-03 Board Of Regents, The University Of Texas System Monoclonal antibodies specific to human cav-1 and uses thereof
KR101968046B1 (en) * 2018-07-19 2019-04-11 (주) 바이오인프라생명과학 Complex biomarkers for early diagnosis of cancer

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002030973A2 (en) * 2000-10-13 2002-04-18 University Of Lausanne The caveolin-1 gene and polypeptide encoded thereby and methods of use thereof
WO2003063690A2 (en) * 2002-01-31 2003-08-07 Baylor College Of Medicine Secreted caveolin as a marker for prostate cancer
KR20130081952A (en) * 2012-01-10 2013-07-18 삼성전자주식회사 Biomarkers for diagnosing cancer and method for isolating cancer cell using the same
WO2013149058A1 (en) * 2012-03-30 2013-10-03 Board Of Regents, The University Of Texas System Monoclonal antibodies specific to human cav-1 and uses thereof
KR101968046B1 (en) * 2018-07-19 2019-04-11 (주) 바이오인프라생명과학 Complex biomarkers for early diagnosis of cancer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN ANONYMOUS : "Homo sapiens caveolin 1, caveolae protein, 22kDa, partial [synthetic construct]", XP093048172, retrieved from NCBI *
HWANG, N. ET AL.: "Caveolin-1 supplies energy necessary for migration and metastasis of gastric cancer cells", KSBMB INTERNATIONAL CONFERENCE 2020; THESIS ABSTRACT., 23 September 2020 (2020-09-23) *

Similar Documents

Publication Publication Date Title
WO2009113814A2 (en) Protein marker for early diagnosis of liver cancer
US10175244B2 (en) Dominant negative HSP110 mutant and its use in prognosing and treating cancers
WO2016036172A1 (en) Biomarker for predicting sensitivity to protein kinase inhibitor and use thereof
WO2016129890A1 (en) A biomarker for diagnosing vascular diseases and the uses thereof
WO2021182843A1 (en) Composition for diagnosing or treating anticancer drug resistance
WO2017026843A1 (en) Method for providing information on chronic myeloid leukemia
WO2021177691A1 (en) Composition for diagnosis or treatment of anticancer drug resistance
WO2017082655A1 (en) Methods for determining resistance to anticancer therapy and composition used therefor
WO2011081421A9 (en) Complement c9 as markers for the diagnosis of cancer
WO2011052906A2 (en) Use of eif3m for the diagnosis and treatment of cancer
WO2023042944A1 (en) Composition for preventing, ameliorating, or treating gastric cancer
WO2017164568A1 (en) Method for predicting survival rate and prognosis of esophageal cancer patient by measuring protein expression level of v-atpase subunit v1e1
WO2019013392A1 (en) Monoclonal antibody obtained from specific antigen specifically recognizing en2 protein or composition for diagnosing prostate cancer containing same
WO2014014157A1 (en) Use of adcy3 for diagnosis and treatment of gastric cancer
WO2023101457A1 (en) Composition for preventing or treating biliary tract cancer
WO2009131366A2 (en) Cdca5 as a diagnosis marker and therapeutic agent for gastric cancer or colorectal cancer
WO2021025412A1 (en) Method for diagnosing alzheimer's disease by using complement component c8 gamma
WO2022177341A1 (en) Composition for diagnosing resistance to anticancer agent
KR20230041267A (en) A composition for preventing, alleviating or treating gastric cancer
WO2016200246A1 (en) Novel biomarker for diagnosing resistance to anticancer agent for biliary tract cancer and use thereof
WO2021206406A1 (en) Composition for diagnosis or treatment of anticancer drug resistance
WO2021246780A1 (en) Composition for diagnosis of cancer metastasis and recurrence
WO2023038375A1 (en) Use of drg2 as biomarker
WO2016003231A1 (en) Composition for diagnosing or treating pancreatic cancer using kiaa1199
WO2021060688A1 (en) Pharmaceutical composition for preventing or treating cancer, comprising inhibitor of myo1d expression as effective component

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21957612

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21957612

Country of ref document: EP

Kind code of ref document: A1