WO2023040917A1 - Mutant hppd polypeptide and application thereof - Google Patents

Abstract

Provided are a herbicide-resistant gene, a polypeptide, and an application thereof in plant breeding. Specifically, provided is a mutant HPPD polypeptide, and compared with a parent HPPD polypeptide, the mutant HPPD polypeptide has mutation occurred at any one or more of amino acids corresponding to positions 54, 133, and 401 of SEQ ID NO.1. The mutant HPPD polypeptide is highly tolerant of herbicides, and has a wide application prospect in the field of improving and cultivating plants tolerant of anti-HPPD inhibitory herbicides.

Description

Mutant HPPD polypeptides and applications thereof technical field

The invention belongs to the field of agricultural genetic engineering, and specifically relates to a novel mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) for imparting HPPD-inhibiting herbicide resistance or tolerance to plants, its encoding nucleic acid and application.

Background technique

4-Hydroxyphenylpyruvate Dioxygenase (4-Hydroxyphenylpyruvate Dioxygenase, HPPD, EC 1.13.11.27) is an important enzyme in the process of tyrosine metabolism in organisms, and it exists in almost all aerobic organisms. Tyrosine generates p-hydroxyphenylpyruvic acid (HPPA) under the action of Tyrosine aminotransferase (TAT), and HPPD can catalyze the conversion of HPPA into homogentisic acid with the participation of oxygen (homogentisate, HGA). In animals, the main function of HPPD is to promote the catabolism of tyrosine, aryl and phenylalanine. However, the role in plants is significantly different from that in animals. Homogentisic acid further forms plastoquinones and tocopherols (vitamin E) (Ahrens et al., 2013). Tocopherol acts as a membrane-associated antioxidant, which is an essential antioxidant for plant growth and can effectively enhance the stress resistance of plants. Plastidoquinone is a key cofactor in the process of photosynthesis in plants, which promotes the synthesis of carotenoids in plants. More than 60% of the chlorophyll in plants is bound to the light-harvesting antenna complex, which absorbs sunlight and transmits the excitation energy to the photosynthetic reaction center, and carotenoids are the chlorophyll-binding protein and antenna system of the reaction center It plays an important role in the light-absorbing auxiliary pigment in plant photosynthesis, has the ability to absorb and transfer electrons, and plays an important role in scavenging free radicals.

Inhibition of HPPD leads to uncoupling of photosynthesis in plant cells, lack of auxiliary light-harvesting pigments, and at the same time, due to the lack of photoprotection normally provided by carotenoids, reactive oxygen intermediates and photooxidation lead to the destruction of chlorophyll, resulting in plant photosynthesis Tissues develop albinism and growth arrest until death (Beaudegnies et al., 2009).

Identified as a herbicide target since the 1990s, HPPD is followed by acetolactate synthase (ALS), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), and acetyl-CoA carboxylase (ACCase) The latter is another important herbicide target, and its unique mechanism of action can effectively control a variety of resistant weeds. HPPD herbicides are a hot-selling product emerging in recent years, with a series of advantages such as high efficiency, low toxicity, good environmental compatibility and high safety to subsequent crops. Studies have found that there are significant differences in the homology of HPPD amino acid sequences between plants and mammals, while the homology between plants and animals is relatively high (Yang et al., 2004). This provides a theoretical basis for the subsequent development of HPPD herbicides with higher selectivity and safety. Currently, five herbicides targeting HPPD have been developed according to their structure, mainly including triketones, pyrazolones, isoxazoles, diketonitriles and benzophenones.

However, these HPPD-inhibiting herbicides will also cause certain damage to crops while killing weeds. Different crops have different tolerances to different HPPD herbicides, which also limits the scope of use of HPPD herbicides. Crops that are tolerant to herbicides are especially important. Current strategies, in addition to attempting to bypass HPPD-mediated homogentisate production, include overexpressing this enzyme to produce large quantities of herbicide-targeted enzymes in plants, alleviating herbicide inhibition. Although overexpression of HPPD gave plants better pre-emergent tolerance to herbicides such as diketonitrile derivatives of isoxafluorine, this tolerance was not sufficient to resist post-emergence herbicide treatments.

CRISPR/Cas gene editing technology is an emerging genetic engineering technology in recent years. It is a DNA cutting technology mediated by guideRNA. Various editing systems have been developed for different Cas, including Cas9, Cpf1, Cms1, C2c1, C2c2, etc. . CRISPR/Cas editing technology can realize three kinds of site-specific editing: the first is site-specific gene knockout, Cas protein recognizes and cuts the target under the guidance of targeting RNA (gRNA), resulting in double-strand DNA breaks; the broken DNA usually Repair is performed by non-homologous end joining (NHEJ); frameshift mutations are prone to occur during repair to disrupt the gene. The efficiency of targeted knockout is higher. The second is to perform homologous replacement of the target to replace the target sequence or site-specific insertion. When a double-strand DNA break occurs, homologous replacement or site-directed insertion may occur if there is a homologous repair template nearby. Homologous substitutions are less efficient and become less efficient with the length of the sequence being substituted. The third is single base editing. Single base editing is a gene editing method that uses the CRISPR/Cas system to target deaminases to specific sites in the genome to modify specific bases. This method has been successfully used in rice.

The period of large-scale use of HPPD herbicides is relatively short, and there are very few reports on the resistance caused by mutations in the HPPD gene itself. But combined with CRISPR technology, we can speed up the screening of resistant HPPD peptides and improve crop tolerance to HPPD inhibitors. It is of great significance to expand the application range and prolong the service life of herbicides.

Contents of the invention

The purpose of the present invention is to provide a mutant HPPD polypeptide that can improve plant resistance or tolerance to HPPD-inhibiting herbicides; the present invention also relates to a biologically active fragment of mutant HPPD, a multinuclear polypeptide encoding the protein or fragment Glycolic acid and its application.

On the one hand, the present invention provides a mutant polypeptide of p-hydroxyphenylpyruvate dioxygenase (HPPD), compared with the amino acid sequence of the parent p-hydroxyphenylpyruvate dioxygenase (HPPD), the mutant polypeptide has There are mutations at any one or several of the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No.1: position 54, position 133, and position 401.

In another preferred example, the mutation is amino acid insertion, deletion or substitution.

In another preferred embodiment, the mutant polypeptide is a herbicide resistance/tolerance polypeptide, especially the resistance/tolerance to HPPD inhibitor herbicides.

In one embodiment, said position 54 is mutated.

In one embodiment, said position 133 is mutated.

In one embodiment, said position 401 is mutated.

In one embodiment, the 54th and 401st positions are mutated at the same time.

In one embodiment, the 54th and 133rd positions are mutated at the same time.

In one embodiment, the 54th, 401st and 133rd positions are mutated at the same time.

In one embodiment, the 54th, 401st and 133rd amino acid positions are L, K and A, respectively.

In one embodiment, the amino acid at position 54 is mutated to an amino acid other than L, for example, A, V, G, Q, F, W, Y, D, N, E, K, M, S, T, C , P, H, R, I; preferably, I, F.

In one embodiment, the amino acid at position 133 is mutated to an amino acid other than A, for example, V, G, L, Q, F, W, Y, D, N, E, K, M, S, T, C , P, H, R, I; preferably, H, E, C, F, G, T.

In one embodiment, the amino acid at position 401 is mutated to an amino acid other than K, for example, A, V, G, Q, F, W, Y, D, N, E, L, M, S, T, C , P, H, R, I; preferably, E.

In one embodiment, the 54th position L is mutated to I; the 133rd position A is mutated to H; the 401st position K is mutated to E.

In another aspect, the present invention provides a mutant HPPD polypeptide, which is selected from any one or several groups of I-VI below:

I. The 54th amino acid mutation corresponding to the sequence shown in SEQ ID No.1 is I or F;

II. The 133rd amino acid mutation corresponding to the sequence shown in SEQ ID No.1 is H, E, C, F, G or T;

III. The 401st amino acid mutation corresponding to the sequence shown in SEQ ID No.1 is E;

IV. Simultaneous mutation at position 54 and position 401 corresponding to the sequence shown in SEQ ID No.1, wherein the amino acid at position 54 is mutated to I or F, and the amino acid at position 401 is mutated to E;

V. Simultaneous mutations occur at the 54th and 133rd positions corresponding to the sequence shown in SEQ ID No.1, wherein the 54th amino acid mutation is I or F, and the 133rd amino acid mutation is H, E, C, F , G or T;

VI. Simultaneous mutations at positions 54, 133 and 401 corresponding to the sequence shown in SEQ ID No.1, wherein the amino acid at position 54 is mutated to I or F, and the amino acid at position 133 is mutated to H and E , C, F, G or T, the 401st amino acid is mutated to E.

In another aspect, the present invention provides a mutant HPPD polypeptide selected from any group of the following I-III:

1. A mutant HPPD polypeptide obtained by mutation of the amino acid sequence shown in SEQ ID No.1 at any one or several of the following amino acid positions: position 54, position 401, position 133;

II. Compared with the mutant HPPD polypeptide described in I, it has the mutation site described in I; and, compared with the mutant HPPD polypeptide described in I, it has at least 80%, at least 85%, at least A mutant HPPD polypeptide with 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, And retain the activity of herbicide resistance;

III. Compared with the mutant HPPD polypeptide described in I, it has the mutation site described in I; and, compared with the mutant HPPD polypeptide described in I, it has one or more amino acid substitutions and deletions or an added sequence, and retains the activity of herbicide resistance; said one or more amino acids include 1, 2, 3, 4, 5, 6, 7, 8, 9 or Substitution, deletion or addition of 10 amino acids.

In another preferred example, the mutant HPPD polypeptide further includes other mutation sites, and the other mutation sites are corresponding to the 20th, 93rd, 103rd, 141st, 141st, 152, 165, 170, 191, 211, 220, 226, 276, 277, 336, 337, 338, 339, 340, 342, 346, 347, 353, 370, 377, 386, 390, 392, 403, 410, One or more of the 418, 419, 420, 430 and 431 positions, the other mutation positions can maintain or enhance the tolerance or resistance of the mutant polypeptide to HPPD-inhibiting herbicides or increase the mutant HPPD The scope of application of peptides to herbicides.

In another preferred example, the mutation methods of other mutation sites corresponding to the amino acid sequence shown in SEQ ID No.1 include: A20E, D152N, D170N, E353K, P211L, P336L, Y339H, Y340H, R93S, A103S , H141R/K/T, A165V, V191I, R220K, G226H, L276W, P277N, P336D/L, P337A, N338D/SY, G342D, R346C/D/H/S/Y, A347V, D370N, I377C, P386T, L390I One or more of , M392L, E403G, K410I, K418P, G419F/L/V, N420S, N420T, E430G and Y431L.

In another preferred embodiment, the parent HPPD polypeptide is derived from a monocot and/or a dicot.

In another preferred example, the parent HPPD polypeptide is derived from one or more plants selected from the group consisting of Poaceae, Fabaceae, Chenopodiaceae, and Brassicaceae.

In another preferred embodiment, the parent HPPD polypeptide is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, Quinoa, lettuce, canola, cabbage, strawberries.

In another preferred example, the parent HPPD polypeptide is derived from rice; its amino acid sequence is shown in SEQ ID No.1;

In another preferred example, the amino acid sequence of the parent HPPD polypeptide has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% of the amino acid sequence shown in SEQ ID No.1 , at least 98%, at least 99% sequence identity.

In another preferred example, the mutant polypeptide (herbicide resistance polypeptide) is formed by mutation of the polypeptide shown in SEQ ID No.1.

In another preferred example, the amino acid sequence of the mutant polypeptide is identical or substantially identical to the sequence shown in SEQ ID No.1 except for the above-mentioned mutation.

In another preferred embodiment, the substantially identical is at most 50 (preferably 1-20, more preferably 1-10, more preferably 1-5) amino acid differences, wherein, The difference includes amino acid substitution, deletion or addition, and the mutant protein has herbicide tolerance activity (HPPD inhibitor herbicide).

It is clear to those skilled in the art that the structure of a protein can be changed without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced in the amino acid sequence of the protein without affecting the activity and/or Three-dimensional structures are adversely affected. Examples and implementations of conservative amino acid substitutions are clear to those skilled in the art. Specifically, the amino acid residue can be replaced with another amino acid residue belonging to the same group as the site to be substituted, that is, a non-polar amino acid residue is used to replace another non-polar amino acid residue, and a non-polar amino acid residue is replaced with a polar uncharged amino acid residue. Substituting an amino acid residue for another polar uncharged amino acid residue, substituting a basic amino acid residue for another basic amino acid residue, and substituting an acidic amino acid residue for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions in which one amino acid is replaced by another amino acid belonging to the same group fall within the scope of the present invention as long as the substitution does not result in the inactivation of the biological activity of the protein. Therefore, the protein of the present invention may contain one or more conservative substitutions in the amino acid sequence, and these conservative substitutions are preferably produced according to Table 1. In addition, the present invention also encompasses proteins that also contain one or more other non-conservative substitutions, as long as the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention. Conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues. A "nonessential" amino acid residue is one that can be altered (deleted, substituted or substituted) without altering biological activity, whereas an "essential" amino acid residue is required for biological activity. A "conservative amino acid substitution" is one in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Amino acid substitutions can be made in non-conserved regions of HPPD. Generally, such substitutions are not made to conserved amino acid residues, or to amino acid residues located within conserved motifs, where such residues are required for protein activity. However, those skilled in the art will appreciate that functional variants may have fewer conservative or non-conservative changes in conserved regions.

It is well known in the art that one or more amino acid residues can be altered (substituted, deleted, truncated or inserted) from the N- and/or C-termini of a protein while retaining its functional activity. Accordingly, proteins that have one or more amino acid residues altered from the N- and/or C-terminus of the HPPD protein while retaining its desired functional activity are also within the scope of the present invention. These changes may include those introduced by modern molecular methods such as PCR, which involves PCR amplification that alters or extends protein coding sequences by virtue of the inclusion of amino acid coding sequences in the oligonucleotides used in PCR amplification.

It will be appreciated that proteins may be altered in various ways, including amino acid substitutions, deletions, truncations and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the ACC protein can be prepared by mutating the DNA. It can also be accomplished by other forms of mutagenesis and/or by directed evolution, for example, using known mutagenesis, recombination and/or shuffling methods, in combination with relevant screening methods, for single or multiple amino acid substitutions, deletions and/or insertions.

Those skilled in the art will understand that these minor amino acid changes in the HPPD protein of the present invention can occur (eg, naturally occurring mutations) or be produced (eg, using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may change, but the polypeptide may retain its activity. Smaller effects can be expected if the mutations present are not close to the catalytic domain, active site, or other functional domains.

Those skilled in the art can identify the essential amino acids of the HPPD protein according to methods known in the art, such as site-directed mutagenesis or protein evolution or bioinformatics analysis. The catalytic domain, active site, or other functional domains of a protein can also be determined by physical analysis of structure, such as by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, binding to putative key sites. Point amino acid mutations are identified.

Table 1

initial residue	representative replacement	preferred substitution
Ala(A)	Val; Leu; Ile	Val
Arg(R)	Lys; Gln; Asn	Lys
Asn(N)	Gln; His; Lys; Arg	Gln
Asp(D)	Glu	Glu
Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
Glu(E)	Asp	Asp
Gly(G)	Pro;	Ala
His(H)	Asn; Gln; Lys; Arg	Arg
Ile (I)	Leu; Val; Met; Ala; Phe	Leu
Leu(L)	Ile; Val; Met; Ala; Phe	Ile
Lys(K)	Arg; Gln; Asn	Arg
Met(M)	Leu; Phe; Ile	Leu
Phe(F)	Leu; Val; Ile; Ala; Tyr	Leu
Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
Thr(T)	Ser	Ser
Trp(W)	Tyr; Phe	Tyr
Tyr(Y)	Trp; Phe; Thr; Ser	Phe
Val(V)	Ile; Leu; Met; Phe;	Leu

In one embodiment, the HPPD inhibitor herbicides (or referred to as HPPD inhibitor herbicides) include triketones, diketonitriles, isoxazoles, pyrazoles, benzophenones , quinazolinediones, pyrazolones, or combinations thereof. Triketone herbicides are preferably triazole sulcotrione, furan sulcotrione, bicyclic sulcotrione, mesotrione, mesotrione, sulcotrione, tembotrione, tefurtrione or fluroxytrione One or any several of them; the isoxazole herbicide is preferably one or any of several of isoxaflutole, clomazone, and clomazone; the pyrazole herbicide Preferably, one or more of benzacazole, pyrazon, pyrazolate, pyrasulfotole, tolpyralate, sulfoxazone or fenflumezone; Mesotrione, Mesotrione, Mesotrione.

The triketone herbicides also include compounds described in CN104557739A, CN110669016A, CN110669016B, or CN110963993B.

For example, the compound of the following formula described in CN110669016B:

Wherein, R is n-propyl or cyclopentyl.

As another example, CN110963993B records a compound of the following formula:

Wherein, Y is a methyl or ethyl group, R is a C-containing group, and the C atom in R is directly connected to the mother nucleus structure to form a CN bond, and R is selected from: naphthyl; heteroaryl, the group is not A saturated ring with 1 to 5 heteroatoms selected from O, S and N, and a ring-forming carbon number of 2 to 6, wherein the group is optionally substituted by 1 or more than 2 identical or different R5; Heterocyclophenyl, except for the bond shared with the phenyl group, the ring-forming bonds of the heterocyclic part of the group are all saturated bonds, and the group has 1 to 5 selected from O, S and N Heteroatom, the number of ring-forming carbons in the group is 7 to 11, and the group is optionally substituted by 1 or 2 or more identical or different R7; benzoaromatic heterocyclic group, except those shared with phenyl In addition to bonds, the ring-forming bond of the aromatic heterocyclic part of the group contains unsaturated bonds, and the group has 1 to 5 heteroatoms selected from O, S and N, and the ring-forming carbon of the group The number is 7 to 11, and the phenyl group in the group is optionally substituted by 1 or 2 or more identical or different R6; the aromatic heterocyclic phenyl group, except for the bond shared with the phenyl group, the group's The ring-forming bond of the aromatic heterocyclic part contains an unsaturated bond, and the group has 1 to 5 heteroatoms selected from O, S and N, and the ring-forming carbon number of the group is 7 to 11, and The phenyl in this group is optionally substituted by 1 or more identical or different R6; cycloalkanophenyl, except for the bond shared with phenyl, the ring-forming bond of the cycloalkyl part of the group Both are saturated bonds, the number of ring-forming carbons in this group is 7 to 10, and this group is optionally substituted by 1 or 2 or more identical or different R6; benzocycloalkyl, except sharing with phenyl Except for the bonds, the ring-forming bonds of the cycloalkyl part of the group are all saturated bonds, the number of ring-forming carbons in the group is 7 to 12, and the group optionally consists of 1 or more identical or similar different R6 substitution; wherein, the benzo aromatic heterocyclic group means that the aromatic heterocyclic ring is directly connected to the N atom on the mother core structure, and the aromatic heterocyclic ring and the benzene ring form a bicyclic ring together; the aromatic heterocyclic aphenyl Indicates that the benzene ring is directly connected to the N atom on the parent nucleus structure, and the benzene ring and the aromatic heterocycle together form a bicyclic ring; benzocycloalkyl indicates that the cycloalkyl ring is directly connected to the N atom on the parent nucleus structure. Atoms are connected, and the cycloalkyl ring and the benzene ring jointly form a bicyclic ring; cycloalkanophenyl means that the benzene ring is directly connected to the N atom on the parent core structure, and the benzene ring and the cycloalkyl ring jointly form a bicyclic ring; Form a bicyclic ring; wherein, R5 is selected from one or more of C1-6 alkyl, C1-6 alkoxy, halogen, C1-6 haloalkyl, phenoxy and phenylthio; R6 is selected from C1 One or more of -6 alkyl; R7 is selected from one or more of C1-6 alkyl, C2-6 alkenyl and halogen, or R7 forms a keto group with the carbon atom forming the ring

In another preferred example, the HPPD-inhibiting herbicides are quinazolinediones, and the quinazolidinone herbicides are preferably quinazolidone and methylquinazone.

In another preferred example, the HPPD-inhibiting herbicides are quinatrione, mequinazone, fenflumezone, and mesotrione.

In another preferred example, compared with the parental HPPD polypeptide, the mutant polypeptide has a tolerance concentration of the maximum HPPD-inhibiting herbicide that is increased by at least 1.5 times, preferably by at least 2 times, preferably by at least 3 times, preferably by at least 1.5 times. At least a 4-fold increase, preferably at least a 5-fold increase, preferably at least a 6-fold increase, preferably at least a 10-fold increase.

In another preferred example, the maximum tolerance concentration of the plant containing the mutant polypeptide to the HPPD-inhibiting herbicide is at least 2 times higher than that of the parental plant, preferably 3 times higher, preferably 4 times higher, preferably 5 times higher. times, preferably 6 times, preferably 7 times, preferably 8 times, preferably 10 times, preferably 12 times, preferably 14 times, preferably 16 times.

In another preferred example, the mutant HPPD polypeptide endows plants with at least 0.01 mg/L, preferably at least 0.02 mg/L, preferably at least 0.03 mg/L, preferably at least 0.05 mg/L, preferably at least 0.08 mg/L, preferably At least 0.1 mg/L, preferably at least 0.2 mg/L, preferably up to 0.5 mg/L, preferably at least 0.8 mg/L, preferably at least 1 mg/L, preferably at least 2 mg/L, preferably at least 5 mg/L, preferably at least 10 mg/L - Tolerance of HPPD-inhibiting herbicides at a concentration of 50 mg/L.

Another aspect of the present invention provides a fusion protein comprising the mutant polypeptide or a biologically active fragment thereof; further, the fusion protein also includes a protein fused with the mutant polypeptide, for example, a tag peptide, a plasmid Body leader peptide or regulatory element. Among them, tag peptides such as histidine tag, 6×His; plastid guide peptides, such as peptides guided into chloroplasts; regulatory elements, such as promoter sequences, terminator sequences, leader sequences, polyadenylation sequences, marker genes, etc.

Another aspect of the present invention provides a polynucleotide encoding the mutant polypeptide or an active fragment thereof, or encoding the fusion protein.

In another preferred embodiment, the polynucleotide is selected from the group consisting of genome sequence, cDNA sequence, RNA sequence, or a combination thereof.

In another preferred example, the polynucleotide is preferably single-stranded or double-stranded.

In another preferred example, the polynucleotide additionally contains auxiliary elements selected from the following group at the flanks of the ORF of the mutant polypeptide: signal peptide, secretory peptide, tag sequence (such as 6His), nuclear localization signal or its combination.

In another preferred example, the polynucleotide further comprises a promoter operably linked to the ORF sequence of the mutant polypeptide.

In another preferred example, the promoter is selected from the group consisting of constitutive promoters, tissue-specific promoters, inducible promoters, or strong promoters.

Another aspect of the present invention provides a nucleic acid construct comprising the polynucleotide and regulatory elements operably linked thereto.

In another preferred example, the regulatory element is selected from one or more of the following group: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

On the other hand, the present invention also provides a vector, which contains a nucleic acid sequence encoding the mutant HPPD polypeptide or fusion protein of the present invention, preferably, the vector also includes an expression Regulatory elements.

In another preferred example, the vector includes a cloning vector, an expression vector, a shuttle vector or an integration vector.

In one embodiment, the vector can be a vector for gene editing the endogenous HPPD gene of the host cell.

In one embodiment, the expression vector further contains at least one origin of replication to realize self-replication.

In one embodiment, the vector may be a vector that is integrated into the genome when introduced into a host cell and replicated together with the chromosome into which it has been integrated.

Vectors can be of the type of plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art.

Preferably, the vector in the present invention is a plasmid.

In another aspect, the present invention provides an editing vector system, which comprises one or more vectors, and the one or more vectors comprise at least a guide sequence targeting the parental HPPD. The guide sequence contains part of the nucleotide sequence of the parental HPPD, preferably at least 15 bp of the HPPD nucleotide sequence, more preferably at least 20 bp of the HPPD nucleotide sequence. In one embodiment, the editing vector system further includes a gene editing enzyme. The gene editing enzymes include CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Transcription Activator-like (TAL) effector nucleases), ZFN (zinc Refers to nucleic acid technology, the nuclease of Zinc finger nuclease) editing tool.

Preferably, the gene editing enzyme is Cas protein, also known as CRISPR enzyme or Cas effector protein, and its types include but not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein.

Preferably, the Cas protein is operably linked to the first regulatory element.

In one embodiment, the gene editing enzyme is Cas9 protein, and the carrier further includes a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably linked with the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably linked to a second regulatory element.

In other embodiments, the gene editing enzyme is a Cas12 protein, for example, Cas12a, Cas12b, Cas12i, and the vector also includes a unidirectional repeat sequence (Direct Repeat) specifically binding to the Cas12 protein. After the unidirectional repeat sequence and the guide sequence are operably linked, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably linked to a second regulatory element.

Such regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (such as transcription Termination signals, such as polyadenylation signals and polyU sequences).

Preferably, the editing vector system further includes a base editing element selected from adenine deaminase and/or cytosine deaminase.

In one embodiment, the editing vector also contains resistance genes for easy screening, the resistance genes include hyg, bar, kana, rif, spec, amp, and the resistance genes are well known to those skilled in the art .

Preferably, the Cas protein is selected from nCas9 or other Cas9 proteins with nick activity. Where "n" represents nick, that is, a Cas protein that only has single-strand cutting activity.

In another aspect, the present invention provides a gene editing reagent capable of producing the above-mentioned mutant polypeptide in plants; the gene editing reagent includes CRISPR/Cas protein and gRNA, and the gRNA can target endogenous plant Optionally, the gene editing reagent further includes a base editing element selected from adenine deaminase and/or cytosine deaminase.

In another embodiment, the gene editing reagent includes the editing vector system described above.

The present invention also provides the application of the above-mentioned gene editing reagent in preparing plants with resistance/tolerance to HPPD-inhibiting herbicides.

The present invention also provides a method for imparting resistance/tolerance to a plant to an HPPD-inhibiting herbicide or a method for preparing a plant having resistance/tolerance to an HPPD-inhibiting herbicide, the method comprising utilizing the above-mentioned gene Steps for gene editing of plants by editing reagents.

Another aspect of the present invention provides a host cell containing one or more of the mutant HPPD, the gene encoding the mutant HPPD, the fusion protein, the vector and the nucleic acid construct or, said polynucleotide is integrated in said host cell genome.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or an animal cell or a plant cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

In another preferred example, the plants include angiosperms and gymnosperms.

In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.

In another preferred example, the plants include herbaceous plants and woody plants.

In another preferred example, the plants include Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

In another aspect, the present invention provides a plant with herbicide resistance/tolerance, the plant comprising the mutant HPPD, the polynucleotide encoding the mutant HPPD, the fusion protein, the vector and One or more of the nucleic acid constructs; or the polynucleotide is integrated in the genome of the plant.

Another aspect of the present invention provides a method for preparing the mutant polypeptide or an active fragment thereof, the method comprising the steps of:

(a) cultivating a host cell comprising the mutant polypeptide under conditions suitable for expression, thereby expressing the mutant polypeptide; and, optionally,

(b) isolating said mutant polypeptide.

Another aspect of the present invention provides a plant cell, plant tissue, plant part, or plant that is tolerant to an HPPD-inhibiting herbicide or has resistance/tolerance to an HPPD-inhibiting herbicide, wherein the plant cell, plant Tissues, plant parts, and plants contain the mutant polypeptide or its polynucleotide sequence.

Another aspect of the present invention provides a method for conferring resistance or tolerance on plants to HPPD-inhibiting herbicides, said method comprising introducing said HPPD mutant polypeptide into plant cells, plant tissues, plant parts or plants step.

In another preferred example, in the method, introducing the HPPD mutant polypeptide includes expressing the HPPD mutant polypeptide in plant cells, plant tissues, plant parts or plants, for example, expressing the mutant polypeptide through an expression vector , or integrating the polynucleotide encoding the mutant polypeptide into the plant genome for expression.

In another preferred example, in the method, introducing the HPPD mutant polypeptide includes natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or gamma-ray mutagenesis), chemical mutagenesis (such as nitrous acid, hydroxylamine, EMS , nitrosoguanidine, etc.), biological mutagenesis (such as virus or bacteria-mediated mutagenesis), gene editing.

In another preferred example, the above method includes the following steps:

(1) providing an Agrobacterium carrying an expression vector, the expression vector containing the DNA coding sequence of the mutant polypeptide or an active fragment thereof;

(2) Plant cells, plant tissues, and plant parts are contacted with the Agrobacterium in step (1), so that the DNA coding sequence of the mutant polypeptide or its active fragment is transferred into the plant cell and integrated into the chromosome of the plant cell ;and

(3) Selecting plant cells that have been transformed with the DNA coding sequence of the mutant polypeptide or its active fragment.

In another preferred embodiment, in the method, introducing the mutant polypeptide of HPPD includes the step of mutating the endogenous HPPD of the plant so as to introduce the mutant polypeptide.

In another preferred example, in the method, introducing the mutant polypeptide of HPPD includes the step of mutating and expressing the endogenous HPPD nucleotide sequence of the plant so as to introduce the mutant polypeptide.

In another preferred example, in the method, the method of introducing mutations includes natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or gamma-ray mutagenesis), chemical mutagenesis (such as nitrous acid, hydroxylamine, EMS , nitrosoguanidine, etc.), biological mutagenesis (such as virus or bacteria-mediated mutagenesis), gene editing.

In another preferred example, the method includes the following steps:

(1) Introducing expression vectors containing gene editing tools into plant cells, plant tissues, and plant parts;

(2) Make the gene editing tool act on its endogenous HPPD coding sequence, and make it mutate at the above-mentioned mutation site corresponding to SEQ ID No.1;

(3) screening for mutated plant cells, plant tissues, and plant parts;

(4) separating the gene editing tool.

In another preferred example, the gene editing tools include CRISPR, TALEN and ZFN.

Another aspect of the present invention provides a reagent, which can be used to increase the herbicide resistance or tolerance of plant cells, plant tissues or plants, and the reagent contains the mutant polypeptide of the present invention or encodes a mutant polypeptide of nucleotides.

In another aspect of the present invention, it is provided that the mutant polypeptide, the polynucleotide, the fusion protein, the nucleic acid construct or the vector has resistance or tolerance to HPPD-inhibiting herbicides during cultivation (preparation) resistant plants, or in the preparation of reagents or kits for cultivating plants resistant or tolerant to HPPD-inhibiting herbicides.

In another aspect of the present invention, there is provided a method for identifying or selecting a transformed plant cell, plant tissue, plant or part thereof, comprising: (i) providing a transformed plant cell, plant tissue, plant or part thereof, wherein the transformed The plant cell, plant tissue, plant or part thereof comprising the indicated polynucleotide or a variant or derivative thereof, wherein the polynucleotide encodes a mutant polypeptide for use as a selectable marker, and wherein said transformed plant cell, plant tissue , the plant or part thereof may comprise another isolated polynucleotide comprising; (ii) contacting the transformed plant cell, plant tissue, plant or part thereof with at least one HPPD-inhibiting herbicide; (iii) ) determining whether a plant cell, plant tissue, plant or part thereof is affected by an inhibiting herbicide; and (iv) identifying or selecting transformed plant cells, plant tissue, plants or parts thereof.

Another aspect of the present invention provides a method of controlling an effective amount of unwanted plants at a plant cultivation site, the method comprising:

(1) providing a plant comprising the mutant polypeptide or the polynucleotide or the nucleic acid construct or the vector at the cultivation site;

(2) Plants are cultivated, and an effective amount of HPPD-inhibiting herbicide is applied at the cultivation site.

In one embodiment, the unwanted vegetation is a weed.

In another aspect, the present invention also provides a method for controlling the growth of weeds near plants, comprising:

a) providing the above-mentioned herbicide-resistant plants;

b) applying an effective amount of a herbicide to the plant and the weeds in the vicinity thereof, thereby controlling the weeds in the vicinity of the plant.

In another preferred example, the plants include angiosperms and gymnosperms.

In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.

In another preferred example, the plants include herbaceous plants and woody plants.

In another preferred example, the plants include Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

general definition

Unless defined in this application, the scientific terms or professional nouns used in the present invention have the meanings understood by those skilled in the art. When the meaning understood by those skilled in the art conflicts with the meaning defined in this application, the meaning defined in this application shall prevail meaning shall prevail. As used herein, the term "AxxB" means that amino acid A at position xx is changed to amino acid B, for example "L54F" means that amino acid L at position 54 is mutated to F, and so on. For multiple mutation types at the same site, each type is separated by "/", for example, P336D/L means that relative to the amino acid sequence of SEQ ID No.1, the proline at position 336 is replaced by aspartic acid acid or leucine substitution. For double or multiple mutations, each mutation is separated by "/" or "+", for example, L54F+K401E or L54F/K401E means that, relative to the amino acid sequence of SEQ ID No.1, the L at position 54 is replaced by F is substituted, and K at position 401 is substituted by E.

As used herein, the term "HPPD" refers to 4-Hydroxyphenylpyruvate Dioxygenase (HPPD, EC 1.13.11.27), which is present in various organisms and catalyzes the degradation product of tyrosine - The key enzyme in the reaction of generating homogentisate (HGA) from p-hydroxyphenylpyruvate (4-hydroxyphenylpyruvate, HPP) with oxygen. Inhibition of HPPD leads to uncoupling of photosynthesis in plant cells, lack of auxiliary light-harvesting pigments, and at the same time, due to the lack of photoprotection normally provided by carotenoids, reactive oxygen intermediates and photooxidation lead to the destruction of chlorophyll, resulting in plant photosynthesis. Tissues develop albinism, growth inhibition, and death. HPPD-inhibiting herbicides have been proven to be very effective selective herbicides, with broad-spectrum herbicidal activity, can be used both in pre-emergence and post-emergence, with high activity, low residue, safe for mammals and environmental friendliness, etc. features.

As used herein, the terms "HPPD inhibitors", "HPPD herbicides", "HPPD-inhibiting herbicides", and "HPPD-inhibiting herbicides" are used interchangeably and refer to substances that have herbicidal activity in themselves or are associated with substances that can modify its effect. Substances combined with other herbicides and/or additives, which act by inhibiting HPPD, appear as agents that inhibit plant growth or even cause plant death. Substances capable of herbicidal action by inhibiting HPPD are well known in the art, including many types, 1) triketones, for example, sulcotrione (Sulcotrione, CAS No.: 99105-77-8); mesotrione Ketone (Mesotrione, CAS No.: 104206-82-8); Bicyclopyrone (CAS No.: 352010-68-5); Tembotrione (CAS No.: 335104-84-2); Furansulfone Ketones (tefuryltrione, CAS No.: 473278-76-1); Benzobicyclon (CAS No.: 156963-66-5); 2) diketonitriles, for example, 2-cyano-3-cyclopropyl -1-(2-Methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione (CAS No.: 143701-75-1); 2-cyano-3-cyclopropyl- 1-(2-Methylsulfonyl-3,4-dichlorophenyl)propane-1,3-dione (CAS No.: 212829-55-5); 2-cyano-1-[4-(methyl (CAS number: 143659-52-3); 3) Isoxazole Classes, for example, isoxaflutole (isoxaflutole, also known as isoxaflutole, CAS number: 141112-29-0); isoxachlortole (isoxachlortole, CAS number: 141112-06-3); clomazone Ketones (clomazone, CAS No.: 81777-89-1); 4) pyrazoles, for example, topramezone (CAS No.: 210631-68-8); pyrasulfotole (CAS No.: 365400-11-9); pyrazoxyfen (CAS number: 71561-11-0); pyrazolate (pyrazolate, CAS number: 58011-68-0); benzofenap (CAS number: 82692- 44-2); Bifentrazone (CAS No.: 1622908-18-2); Tolpyralate (CAS No.: 1101132-67-5); Oxaflutrazone (CAS No.: 1992017-55-6); Fluorotrione (CAS No.: 1855929-45-1); Triazole Sulfotrione (CAS No.: 1911613-97-2); 5) Benzophenones; 6) Quinazolinediones, which refer to those containing such as The HPPD inhibitor compounds with the quinazoline dione core structure shown in the figure, such as the compounds disclosed in patents such as Publication No. 39426-14-4), quinatrione-methyl (CAS No.), 6-(2-hydroxy-6-oxycyclohex-1-ene-1). 7) Others: lancotrione (CAS No.: 1486617-21-3); fenquinotrione (CAS No.: 1342891-70-6). Preferably, the herbicides are quinazolinediones; preferably, the herbicides are quinazadone and methyl quinazadone. The herbicides can control unwanted plants (such as weeds) before emergence, after emergence, before planting, and at the time of planting, taking into account the type of crop or weed to which it is applied.

The term "effective amount" or "effective concentration" means an amount or concentration sufficient to kill or inhibit the growth of a similar parental (or wild-type) plant, plant tissue, plant cell or host cell, respectively, However, said amounts do not kill or severely inhibit the growth of the herbicide-resistant plants, plant tissues, plant cells and host cells of the present invention. Generally, an effective amount of a herbicide is that amount routinely used in an agricultural production system to kill the weed of interest. Such amounts are known to those of ordinary skill in the art. The herbicides according to the present invention exhibit herbicidal activity at any stage of growth or when applied directly to the plant or to the locus of the plant before planting or emergence. The observed effect depends on the plant species to be controlled, the growth stage of the plants, the application parameters of the dilution and the spray droplet size, the particle size of the solid component, the environmental conditions at the time of use, the specific compound used, the specific adjuvant used and carrier, soil type, etc., and the amount of chemicals applied. These and other factors can be adjusted to promote non-selective or selective herbicidal action, as is known in the art.

The term "parent nucleotide or polypeptide" refers to a nucleic acid molecule or polypeptide (protein) that can be found in nature, including wild-type nucleic acid molecules or proteins (polypeptides) that have not been artificially modified, and can also include artificially modified nucleic acid molecules or proteins (polypeptides). Modified nucleic acid molecules or proteins (polypeptides) that do not contain the content of the present invention. Its nucleotides can be obtained through genetic engineering techniques, such as genome sequencing, polymerase chain reaction (PCR), etc., and its amino acid sequence can be deduced from the nucleotide sequence. The "parent plant" is the plant containing the parent nucleotide or polypeptide. The "parent nucleotide or polypeptide" can be extracted from the parent plant according to techniques well known to those skilled in the art, or can be obtained by chemical synthesis. The amino acid sequence of the parent HPPD polypeptide is shown in, for example, SEQ ID No.1.

"Tolerance" or "resistance" in the present invention refers to the ability of HPPD protein or protein-containing cells, tissues or plants to withstand herbicides while maintaining enzyme activity or viability or plant growth , generally can be characterized by parameters such as the amount or concentration of herbicide used. Further, the HPPD enzyme of "increased tolerance to HPPD-inhibiting herbicides" or "increased resistance to HPPD-inhibiting herbicides" in the present invention refers to such HPPD enzymes, which are maintained under the same conditions as the parent HPPD enzymes Its activity to catalyze the conversion of p-hydroxyphenylpyruvate to homogentisate exhibits a maximum tolerated concentration that is at least 1.5-10 times higher than that of the parental HPPD enzyme. Plants with "increased tolerance to HPPD-inhibiting herbicides" or "increased resistance to HPPD-inhibiting herbicides" mean plants that are tolerant or resistant to said HPPD-inhibiting herbicides Increased compared to plants containing the parental HPPD gene, the tolerated concentration is at least 2-16 times higher than the tolerated concentration of the parental plant. The optimal degree of improving "tolerance" or "resistance" of the present invention is that under the same herbicide usage or concentration, it can reduce or inhibit or kill unwanted plants without affecting the mutations contained in the present invention. The growth or viability of a plant with protein.

In the present invention, "giving plants resistance or tolerance to HPPD-inhibiting herbicides" includes no resistance or tolerance to HPPD-inhibiting herbicides in parent plants, or parental plants are resistant to HPPD-inhibiting herbicides Herbicides have a certain or lower tolerance (at the same concentration of herbicides), by introducing the mutated polypeptide of the present invention or the nucleotide encoding the mutated polypeptide into the plants, thereby giving plants without resistance to a certain degree Herbicide resistance or tolerance, increasing the tolerance of plants with a certain or low tolerance to herbicides.

The terms "protein", "polypeptide" and "peptide" are used interchangeably herein to refer to polymers of amino acid residues, including polymers in which one or more amino acid residues are chemical analogs of natural amino acid residues things. The proteins and polypeptides of the present invention can be produced recombinantly or by chemical synthesis. The term "mutant protein" or "mutant protein" refers to a protein having one or more substitutions, insertions, deletions and/or additions of amino acid residues compared to the amino acid sequence of a parent protein. As used herein, the terms "herbicide resistance polypeptide", "mutated HPPD polypeptide", "mutated HPPD polypeptide", "mutated HPPD protein", "mutated HPPD enzyme", "mutated protein", "mutated polypeptide", " The "polypeptide of the present invention" and the like are used interchangeably.

The term "encoding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA or mRNA, as in a sequence having a defined nucleotide sequence (i.e. rRNA, tRNA and mRNA) or a defined amino acid sequence and its Templates for the synthesis of other polymers and macromolecules in biological processes that generate biological properties. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to the gene produces the protein in a cell or other biological system.

The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in organisms are composed of 20 basic amino acids.

The term "mutant protein" or "mutant protein" refers to a protein having one or more substitutions, insertions, deletions and/or additions of amino acid residues compared to the amino acid sequence of a parent protein.

In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows expression of the nucleotide sequence (e.g. , in an in vitro transcription/translation system or when the vector is introduced into the host cell, in the host cell).

In the present invention, "host organism" should be understood as any unicellular or multicellular organism into which a mutant HPPD protein-encoding nucleic acid can be introduced, including, for example, bacteria such as Escherichia coli, fungi such as yeast (such as Saccharomyces cerevisiae), molds (such as Aspergillus ), plant cells and plants etc.

The term "regulatory element", also known as "regulatory element", as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, Internal ribosome entry sites (IRES), and other expression control elements (such as transcription termination signals, such as polyadenylation signals and polyU sequences), are described in detail in Goeddel, Gene Expression Technology : METHODS IN ENZYMOLOGY" (GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY) 185, Academic Press (Academic Press), San Diego (San Diego), CA (1990). In certain instances, regulatory elements include those that direct the constitutive expression of a nucleotide sequence in many types of host cells as well as those that direct the expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may primarily direct expression in a desired tissue of interest, such as muscle, neurons, bone, skin, blood, a specific organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocytes). In certain instances, regulatory elements may also direct expression in a timing-dependent manner (eg, in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; the R-U5' fragment in the LTR of HTLV-1 ((Mol. Cell. Biol., 8( 1), pp. 466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc.Natl.Acad.Sci.USA., Vol. 78(3), pp. 1527-31, 1981).

As used herein, the term "promoter" has the meaning known to those skilled in the art, which refers to a non-coding nucleotide sequence located upstream of a gene that can promote the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or defines a gene product, results in the expression of the gene product in the cell under most or all physiological conditions of the cell. generation. An inducible promoter is a nucleotide sequence which, when operably linked to a polynucleotide encoding or defining a gene product, results in a The gene product is produced intracellularly. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or defines a gene product, results in a The gene product is produced in the cell.

A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for import into the nucleus by nuclear transport, ie, a protein with a NLS is transported to the nucleus. Typically, NLSs contain positively charged Lys or Arg residues exposed on the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows expression of the nucleotide sequence (e.g. , in an in vitro transcription/translation system or when the vector is introduced into the host cell, in the host cell).

The term "vector" is intended to include elements that allow the vector to integrate into the genome of a host cell or replicate autonomously within the cell independent of the genome. The vector may contain any element that ensures self-replication. It usually carries genes that are not part of the central metabolism of the cell, and is usually in the form of double-stranded DNA. The choice of vector generally depends on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of the vector depends on methods well known to those skilled in the art for transforming host cells. For example, plasmid vectors can be used.

The term "plant" is to be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, kohlrabi, Arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine), bok choy, yellow taro, melons (e.g., melon, watermelon, crenshaw ), cantaloupe, cantaloupe), canola crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoons, carrots, napa, Okra, onions, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, gourds (e.g., zucchini, cucumbers, zucchini, squash, squash), radishes, dried bulbs, rutabaga, Purple eggplant (also known as eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, chard, Wasabi, tomatoes, turnips, and spices; fruit and/or vine crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quinces, almonds, chestnuts, hazelnuts, pecans, Pistachios, pecans, citrus, blueberries, boysenberry, cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples , tropical fruit, pome fruit, melon, mango, papaya, and lychee; field crops such as clover, alfalfa, evening primrose, mangosteen, corn/maize (feed corn, sweet corn, popcorn), hops, lotus Barley, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans), oily plants (rape, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, groundnut), Arabidopsis, fiber plant (cotton, flax, hemp, jute), lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or bedding plants such as flowering plants, cacti, succulents, and/or ornamental plants, and trees such as forests (both broadleaved and evergreens such as conifers), fruit trees, ornamental Trees, and nut-bearing trees, and shrubs and other seedlings.

The term "undesirable plants" is understood as plants of no practical or application value which interfere with the normal growth of desired plants, such as crops, and may include weeds, such as dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds include, but are not limited to, those of the following genera: Sinapis, Lepidium, Galium, Stellaria, Matricaria, Spring Anthemis, Galinsoga, Chenopodium, Urtica, Senecio, Amaranthus, Portulaca, Cocklebur Xanthium, Convolvulus, Ipomoea, Polygonum, Sesbania, Ambrosia, Cirsium, Carduus , Sonchus, Solanum, Rorippa, Rotala, Lindernia, Lamium, Veronica , Abutilon, Emex, Datura, Viola, Galeopsis, Papaver, Cornflower ( Centaurea), Trifolium, Ranunculus and Taraxacum. Monocotyledonous weeds include, but are not limited to, those of the following genera: Echinochloa, Setaria, Panicum, Digitaria, Phleum, Bluegrass (Poa), Festuca, Eleusine, Brachiaria, Lolium, Bromus, Avena, Cyperus ), Sorghum, Agropyron, Cynodon, Monochoria, Fimbristyslis, Sagittaria, Eleocharis, Currant Scirpus, Paspalum, Ischaemum, Sphenoclea, Dactyloctenium, Agrostis, Apricot ( Alopecurus) and Apera. The unwanted plants may also include other plants that are different from the plants to be cultivated, such as the part of rice growing naturally or a small amount of soybeans and other crops.

In the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, Branches, seedlings, fruits, cores, spikes, roots, root tips, anthers, etc.

In the present invention, "plant cell" is understood as any cell from or found in a plant, which is capable of forming, for example: undifferentiated tissue such as callus, differentiated tissue such as embryo, plant component, plant or seed.

In the present invention, the term "gene editing" technology includes CRISPR technology, TALEN technology, and ZFN technology. The gene editing tools referred to in CRISPR technology include guideRNA and Cas protein (such as Cas9, Cpf1, Cas12b, etc.). The gene editing tool referred to in TALEN technology is a restriction enzyme that can cut a specific DNA sequence, which includes a TAL effector DNA binding domain and a DNA cutting domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut specific DNA sequences, which includes a zinc finger DNA binding domain and a DNA cutting domain. Those skilled in the art are well aware that by constructing nucleotides encoding gene editing tools and other regulatory elements in appropriate vectors, and then transforming cells, the editing of the genome in the cells can be realized. The types of editing include gene knockout, insertion , base editing.

In the present invention, the term "maximum tolerated concentration" refers to the application of herbicides, when p-hydroxyphenylpyruvate dioxygenase (HPPD) can still substantially maintain its catalytic activity and/or not affect the normal growth of plants The herbicide concentration that can be tolerated, the catalytic activity is the activity of HPPD converting p-hydroxyphenylpyruvate into homogentisic acid.

The terms "homology" or "identity" are used to refer to the match of sequences between two polypeptides or between two nucleic acids. Accordingly, the compositions and methods of the invention also encompass homologues of the nucleotide sequences and polypeptide sequences of the invention. "Homology" can be calculated by known methods including but not limited to: Computational Molecular Biology [Computational Molecular Biology] (Lesk, A.M. ed.) Oxford University Press [Oxford University Press], New York (1988); Biocomputing: Informatics and Genome Projects [Biological Computing: Informatics and Genome Project] (Smith, D.W. Edited) Academic Press [Academic Press], New York (1993); Computer Analysis of Sequence Data, Part I [Computer Analysis of Sequence Data, Part I Section] (Griffin, A.M. and Griffin, H.G. eds.) Humana Press [Humana Press], NJ (1994); Sequence Analysis in Molecular Biology (ed. von Heinje, G.) Academic Press (1987); and Sequence Analysis Primer (eds. Gribskov, M. and Devereux, J.) Stockton Press, New York (1991).

The specific amino acid position (number) in the protein of the present invention is determined by comparing the amino acid sequence of the target protein with SEQ ID NO.1 using a standard sequence alignment tool, such as using the Smith-Waterman algorithm or using CLUSTALW2 The algorithm aligns two sequences, where the sequences are considered aligned when the alignment score is highest. The alignment score can be calculated according to the method described in Wilbur, W.J. and Lipman, D.J. (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80:726-730. The default parameters are preferably used in the ClustalW2(1.82) algorithm: protein gap opening penalty=10.0; protein gap extension penalty=0.2; protein matrix=Gonnet; protein/DNA end gap=-1; protein/DNAGAPDIST=4. Determined by comparing the amino acid sequence of the protein with SEQ ID No. 1, preferably using the AlignX program (part of the vectorNTI group) with default parameters suitable for multiple alignments (gap opening penalty: 10og gap extension penalty 0.05) The position of a specific amino acid within a protein of the invention. For example, through sequence alignment, it is determined that in soybean crops (sequence accession number NP_001235148.2), the 176th position corresponding to the sequence of SEQ ID No.1 is the 214th position.

It should be understood that the amino acid numbering in the mutant protein of the present invention is based on SEQ ID No.1. When the homology of a specific mutant protein to the sequence shown in SEQ ID No.1 reaches 80% or more, the amino acid numbering of the mutant protein There may be a dislocation relative to the amino acid numbering of SEQ ID No.1, such as 1-5 positions to the N-terminal or C-terminal dislocation of the amino acid, and using conventional sequence alignment techniques in the art, those skilled in the art can generally understand that such The dislocation is within a reasonable range, and it should not be considered that the homology reaches 80% (such as 90%, 95%, 98%), and has the same or similar herbicide tolerance activity due to the dislocation of amino acid numbering. Muteins are not within the scope of the muteins of the present invention.

In the present invention, the parent p-hydroxyphenylpyruvate dioxygenase protein may be derived from any plant, especially the aforementioned monocotyledonous or dicotyledonous plant. Several sources of parental (eg, wild-type) p-hydroxyphenylpyruvate dioxygenase protein sequences and coding sequences have been disclosed in the prior art literature, which is incorporated herein by reference.

Preferably, the parent p-hydroxyphenylpyruvate dioxygenase protein of the invention is derived from Oryza genus, especially rice. More preferably, the parent p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence shown in SEQ ID NO.1, or at least 80%, at least 85%, at least Amino acid sequences having 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.

The present invention also includes the mutant polypeptide (protein) and its active fragments, variants, derivatives and analogs including substances produced by any substitution, mutation or modification of the protein described below.

For example, it is also clear to those skilled in the art that the structure of a protein can be changed without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced in the protein amino acid sequence without affecting the activity of the protein molecule. and/or three-dimensional configuration adversely affected. Examples and implementations of conservative amino acid substitutions are clear to those skilled in the art. Specifically, the amino acid residue can be replaced with another amino acid residue belonging to the same group as the site to be substituted, that is, a non-polar amino acid residue is used to replace another non-polar amino acid residue, and a non-polar amino acid residue is replaced with a polar uncharged amino acid residue. Substituting an amino acid residue for another polar uncharged amino acid residue, substituting a basic amino acid residue for another basic amino acid residue, and substituting an acidic amino acid residue for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions in which one amino acid is replaced by another amino acid belonging to the same group fall within the scope of the present invention as long as the substitution does not impair the biological activity of the protein. Therefore, in addition to the above-mentioned mutations, the mutant HPPD protein of the present invention may also contain one or more other mutations such as conservative substitutions in the amino acid sequence. In addition, the present invention also encompasses mutant HPPD proteins that also contain one or more other non-conservative substitutions, as long as the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.

As is well known in the art, one or more amino acid residues may be deleted from the N- and/or C-termini of a protein and still retain its functional activity. Therefore, in another aspect, the present invention also relates to the deletion of one or more amino acid residues from the N- and/or C-terminus of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein while retaining its required Functionally active fragments (such as amino acid fragments containing mutation sites of the present invention), which are also within the scope of the present invention, are called biologically active fragments. In the present invention, "biologically active fragment" refers to a part of the mutant HPPD protein of the present invention, which retains the biological activity of the mutant HPPD protein of the present invention, and at the same time has a similar tolerance or resistance to HPPD inhibitors. Increased compared to HPPD fragments without the mutation. For example, the biologically active fragment of the mutant HPPD protein can be one or more (such as 1-50, 1-25, 1-10 or 1-5) deleted at the N and/or C terminus of the protein , such as 1, 2, 3, 4 or 5) amino acid residues, but which still retain the biological activity of the full-length protein.

In addition, the muteins of the present invention can also be modified. Modified (usually without altering primary structure) forms include: chemically derivatized forms of muteins such as acetylation or carboxylation in vivo or in vitro. Modifications also include glycosylation, such as those produced by glycosylation modifications during the synthesis and processing of the mutein or during further processing steps. This modification can be accomplished by exposing the mutein to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylation enzyme. Modified forms also include sequences with phosphorylated amino acid residues (eg, phosphotyrosine, phosphoserine, phosphothreonine). Also included are muteins that have been modified to increase their resistance to proteolysis or to optimize solubility.

The present invention also provides a polynucleotide encoding the mutant HPPD polypeptide, which may also include additional coding and/or non-coding sequences. Those skilled in the art are well aware that due to the degeneracy of the genetic code, there are many different nucleic acid sequences that can encode the amino acid sequences disclosed herein. It is within the ability of a person of ordinary skill in the art to generate other nucleic acid sequences encoding the same protein, thus the present invention encompasses nucleic acid sequences encoding the same amino acid sequence due to the degeneracy of the genetic code. For example, in order to achieve high expression of a heterologous gene in a target host organism such as a plant, the gene can be optimized using codons preferred by the host organism for better expression.

The present invention also includes polynucleotides that hybridize to the above polynucleotide sequences under stringent conditions and have at least 50%, preferably at least 70%, and more preferably at least 80% matching between the two sequences. Preferably, the stringent conditions may refer to conditions of 6M urea, 0.4% SDS, 0.5×SSC or hybridization conditions equivalent thereto, or conditions with higher stringency, such as 6M urea, 0.4% SDS, 0.1×SSC or The hybridization conditions are the same as those, or a denaturant is added during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42°C, etc. Under various conditions, the temperature may be above 40°C, and if more stringent conditions are required, the temperature may be, for example, about 50°C, and further may be about 65°C.

The muteins and polynucleotides of the present invention are preferably provided in an isolated form, more preferably, purified to homogeneity.

The full-length polynucleotide sequence of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed according to the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequence, and the cDNA prepared by a commercially available cDNA library or a conventional method known to those skilled in the art can be used. The library is used as a template to amplify related sequences. When the sequence is long, it is often necessary to carry out two or more PCR amplifications, and then splice together the amplified fragments in the correct order. The obtained nucleotide sequence can be cloned into a vector, then transformed into cells, and then a large number of related sequences can be obtained from the proliferated host cells by conventional methods. The mutation site of the present invention can also be introduced by artificial synthesis.

The present invention also provides a nucleic acid construct, which comprises a nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase protein of the present invention or its biologically active fragment or fusion protein and one or more a regulatory element.

The term "regulatory element" in the present invention refers to a nucleic acid sequence capable of regulating the transcription and/or translation of a nucleic acid to which it is operably linked. The regulatory elements include promoter sequence, terminator sequence, leader sequence, polyadenylation sequence, signal peptide coding region, marker gene and so on.

The promoter of the present invention can be any nucleotide sequence showing transcriptional activity in the selected host cell, including mutant, truncated and hybrid promoters, and may be obtained from homologous or heterologous to the host cell Genes encoding extracellular or intracellular polypeptides of origin. As a promoter for expression in plant cells or plants, a promoter native to p-hydroxyphenylpyruvate dioxygenase, or a heterologous promoter active in plants can be used. The promoter may be constitutively expressed, or may be inducibly expressed. Examples of promoters include, for example, histone promoters, rice actin promoters, plant virus promoters such as cauliflower mosaic virus promoters, and the like.

The present invention also provides an expression vector, which contains the nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase protein of the present invention or its biologically active fragment or fusion protein and the expression control elements operably linked thereto . The expression vector also contains at least one origin of replication to realize self-replication. The choice of vector generally depends on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, ie one that exists as an extrachromosomal entity whose replication is not dependent on the replication of a chromosome, such as a plasmid, extrachromosomal element, minichromosome or artificial chromosome. The vector may contain any element that ensures self-replication. Alternatively, the vector may be one that, when introduced into a host cell, is integrated into the genome and replicates with the chromosome into which it has been integrated. In addition, a single vector or plasmid or two or more vectors or plasmids together comprising the total DNA to be introduced into the host cell genome, or a transposon may be used. Alternatively, the vector may also be a vector for gene editing the endogenous HPPD gene of the host cell.

Vectors can be of the type such as plasmids, viruses, cosmids, bacteriophages, etc., which are well known to those skilled in the art and numerously described in the art. Preferably, the expression vector in the present invention is a plasmid. Expression vectors may contain promoters, ribosome binding sites for translation initiation, polyadenylation sites, transcription terminators, enhancers, and the like. Expression vectors may also contain one or more selectable marker genes for selection of host cells containing the vector. Such selectable markers include genes encoding dihydrofolate reductase, or genes conferring resistance to neomycin, genes conferring resistance to tetracycline or ampicillin, and the like.

The vectors of the invention may contain elements that allow the vector to integrate into the host cell genome or replicate autonomously within the cell independent of the genome. For integration into the host cell genome, the vector may rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector suitable for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at the exact chromosomal location. In order to increase the probability of integration at the exact position, the integration element should preferably comprise a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, more preferably 800 to 10,000 base pairs, which Have a high degree of identity with the corresponding target sequence to increase the probability of homologous recombination. An integrating element may be any sequence that is homologous to a target sequence within the genome of the host cell. Furthermore, integrating elements may be non-coding or coding nucleotide sequences. On the other hand, the vector may integrate into the genome of the host cell by non-homologous recombination. For autonomous replication, the vector may further comprise an origin of replication that enables the vector to replicate autonomously within said host cell. The origin of replication may be any plasmid replicator that functions within the cell to mediate autonomous replication. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.

More than one copy of the polynucleotide of the present invention can be inserted into the host cell to increase the production of the gene product. An increase in the copy number of a polynucleotide may be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, in the latter case Cells containing an amplified copy of a selectable marker gene, and thus an additional copy of a polynucleotide, can be selected by artificially culturing said cells in the presence of an appropriate selectable agent.

Methods well known to those skilled in the art can be used to construct a vector comprising a DNA sequence encoding a herbicide resistance polypeptide and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology and the like. Said DNA sequence can be operably linked to an appropriate promoter in the vector to direct mRNA synthesis. The vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Suitable vectors in the present invention include commercially available plasmids, such as but not limited to: pBR322 (ATCC37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70 , pQE60, pQE-9 (Qiagen), pD10, psiX174pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia) and the like.

The present invention also provides host cells comprising the nucleic acid sequence, nucleic acid construct or expression vector of the present invention. Introducing a vector comprising an encoding of the present invention into a host cell allows the vector to exist as part of a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier, or the vector can gene edit the endogenous HPPD gene of the host cell. The host cell can be any host cell familiar to those skilled in the art, including prokaryotic cells and eukaryotic cells.

The nucleic acid sequence, nucleic acid construct or expression vector of the present invention can be introduced into host cells by various techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene transfer, and calcium phosphate transduction transfection, DEAE-dextran-mediated transfection, lipofection or electroporation, etc.

The present invention also relates to methods for producing mutant HPPD proteins or biologically active fragments thereof. Including: (a) cultivating the above-mentioned host cells under conditions conducive to the production of the mutant HPPD protein or its biologically active fragment or fusion protein; and (b) isolating the mutant HPPD protein or its biologically active fragment or fusion protein protein.

In the production method of the present invention, the cells are cultured on a nutrient medium suitable for the production of the polypeptide by methods well known in the art. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the culture medium, it can be recovered from cell lysates.

The polypeptide can be detected using methods known in the art that are specific for the polypeptide. These detection methods may include the use of specific antibodies, the formation of enzyme products, or the disappearance of enzyme substrates.

The resulting polypeptide can be recovered by methods known in the art. For example, cells can be harvested by centrifugation, disrupted physically or chemically, and the resulting crude extract retained for further purification. Transformed host cells expressing a mutant HPPD protein of the present invention or a biologically active fragment or fusion protein thereof may be lysed by any convenient method, including freeze-thaw cycles, sonication, mechanical disruption, or use of cell lysing agents. These methods are well known to those skilled in the art. The mutated HPPD protein of the present invention or its biologically active fragments can be recovered and purified from the culture of transformed host cells, and the methods adopted include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography , Hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and phytohemagglutinin chromatography, etc.

The present invention also relates to a method for preparing a host organism, in particular a plant cell, plant tissue, plant part or plant, which is tolerant or resistant to an HPPD-inhibiting herbicide, comprising using a The nucleic acid sequence encoding the ylpyruvate dioxygenase protein or its biologically active fragment, the nucleic acid construct or expression vector comprising the nucleic acid sequence is used to transform the host organism, and suitable vectors and selectable markers are well known to those skilled in the art of. Methods for transformation of host cells, such as plant cells, are known in the art and include, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation, Perforation or bombardment etc. A series of such transformation methods are described in the prior art, for example, EP1186666 describes the technology for soybean transformation, WO 92/09696 describes a suitable technology for the transformation of monocotyledonous plants, especially rice, etc. Plant explants may also advantageously be grown with A. tumefaciens or A. rhizogenes to transfer DNA into plant cells. Whole plants can then be regenerated from infected plant material parts (such as leaf fragments, stem segments, roots, and protoplasts or cells in suspension culture) in a suitable medium, which may contain antibiotics or killing agents for selection. Insecticide. Transformed cells are grown in the plant in the usual manner, they can form germ cells and transmit the transformed trait to progeny plants. Such plants can be grown in the normal manner and crossed with plants having the same transforming or other genetic factors. The resulting heterozygous individuals have corresponding phenotypic properties.

The present invention also provides a method for increasing the tolerance or resistance of a plant cell, plant tissue, plant part or plant to an HPPD-inhibiting herbicide, comprising using the mutant p-hydroxyphenylpyruvate dioxygenated compound comprising the present invention The nucleic acid molecule encoding the nucleic acid sequence of the enzyme protein or its biologically active fragment or the fusion protein is transformed and expressed in the plant or its part. The nucleic acid molecule can be expressed as an extrachromosomal entity, or can be integrated into the genome of a plant cell for expression, in particular integrated into an endogenous gene location of a plant cell by homologous recombination.

The invention also provides a method for increasing the tolerance or resistance of a plant or its part to a HPPD-inhibiting herbicide, comprising expressing the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the present invention or its Plants of the biologically active fragment or fusion protein are crossed to another plant, and plants or parts thereof are selected for increased resistance or tolerance to HPPD-inhibiting herbicides.

The present invention also provides a method of increasing tolerance or resistance to an HPPD-inhibiting herbicide in a plant cell, plant tissue, plant part or plant, comprising treating said plant cell, plant tissue, plant part or plant The endogenous HPPD protein is gene-edited to express the mutant p-hydroxyphenylpyruvate dioxygenase protein of the present invention or its biologically active fragment or fusion protein therein.

The present invention further relates to plant cells, plant tissues, plant parts and plants obtained by the methods described above, and progeny thereof. Preferably, a plant cell, plant tissue or plant part transformed with a polynucleotide of the invention can be regenerated into a whole plant. The invention includes cell cultures, including tissue cell cultures, liquid cultures and solid plate cultures. Seeds produced by the plants of the invention and/or used to regenerate the plants of the invention are also included within the scope of the invention. Other plant tissues and parts are also included in the present invention. The invention also includes methods of producing plants or cells comprising a nucleic acid molecule of the invention. A preferred method of producing such plants is by planting the seeds of the invention. Plants transformed in this manner can acquire resistance to a variety of herbicides with different modes of action.

The present invention also provides a method for controlling unwanted plants at a plant cultivation site, or a method for controlling the growth of weeds near plants, comprising: applying an effective amount for controlling unwanted plants to a cultivation site comprising the plants or seeds of the present invention. amount of one or more HPPD-inhibiting herbicides.

In the present invention, the term "cultivation site" includes a site such as soil where the plant of the present invention is cultivated, and also includes, for example, plant seeds, plant seedlings, and grown plants. The term "effective amount for controlling unwanted plants" refers to an amount of a herbicide sufficient to affect the growth or development of unwanted plants, such as weeds, for example to prevent or inhibit the growth or development of unwanted plants, or to kill the unwanted plants. plant. Advantageously, the unwanted plant-controlling effective amount does not significantly affect the growth and/or development of the plant seeds, plant shoots or plants of the invention. Such an effective amount for controlling unwanted plants can be determined by one skilled in the art by routine experimentation.

Main advantage of the present invention:

The present invention screens out a HPPD mutant polypeptide with high resistance to HPPD inhibitor herbicides, which can be used to prepare plants with resistance or tolerance to HPPD inhibitor herbicides.

Description of drawings

Figure 1. Color changes of HF581 and HF1113 clones under different concentrations of herbicides; where, WT is the wild type.

Figure 2. Color changes and absorbance values of HF581 and HF1113 clones under different concentrations of herbicides, where WT is the wild type.

Figure 3. Color response and absorbance value changes of HF581, HF581-54, and HF581-401 clones after adding herbicides, wherein WT is wild type.

Figure 4. Herbicide resistance of different mutation types at position 54 of the OsHPPD protein sequence, and the color response of different mutant clones after adding herbicides, wherein WT is wild type.

Figure 5. Herbicide resistance of different mutation types at position 54 of the OsHPPD protein sequence, and the change in absorbance value of different mutant clones after adding herbicides, wherein WT is wild type.

Figure 6. The resistance of L54F mutants to different concentrations of Y13287 herbicide, and the color response of L54F mutant clones after adding herbicides, wherein WT is wild type.

Figure 7. The resistance of L54F mutants to different concentrations of fenmetrazone herbicide. Figure 7A and Figure 7B are the color response and absorbance value changes of L54F mutant clones after adding herbicide, respectively, where WT is wild type.

Figure 8. Resistance of L54F mutants to different concentrations of mesotrione herbicide, Figure 8A and Figure 8B are the color response and absorbance value changes of L54F mutant clones after adding herbicide, respectively, where WT is wild type.

Figure 9. Herbicide resistance of different mutation types at position 133 of the OsHPPD protein sequence, and the color response of different mutant clones after adding herbicides, wherein WT is wild type.

Figure 10. The herbicide resistance of different mutation types at position 133 of the OsHPPD protein sequence, and the change in absorbance value of different mutant clones after adding herbicides, wherein WT is wild type.

Figure 11. Herbicide resistance of L54F+K401E+A133T combined mutant clones, Figure 9A and Figure 9B are the color response and absorbance value changes of L54F+K401E+A133T combined mutant clones after adding herbicides, where WT is wild type.

Figure 12. Herbicide resistance of L54F mutant rice plants of HPPD protein.

Detailed ways

The present invention will be further described below in conjunction with the embodiments. The following descriptions are only preferred embodiments of the present invention, and are not intended to limit the present invention to other forms. Changes to equivalent embodiments with equivalent changes. Any simple modifications or equivalent changes made to the following embodiments according to the technical essence of the present invention without departing from the solution content of the present invention fall within the protection scope of the present invention.

The following experimental content is combined with embodiment example to further explain the present invention. All methods and procedures described in these examples are provided by way of example and should not be construed as limiting. For methods of DNA manipulation, refer to Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel F.M.Greene Publishing Associates and Wiley Interscience, 1989, Molecular Cloning, T.Maniatis et al., 1982, or Sambrook J.and Russell D ., 2001, Molecular Cloning: a laboratory manual, version 3.

Example 1. Screening of OsHPPD inhibitor compound resistance sites

In plants, tyrosine can generate p-hydroxypyruvate (HPP) through cell endogenous tyrosine amino 4-hydroxyphenylpyruvate transferase, and HPP is converted into homogentisic acid (HGA) under the action of HPPD, and then Converted to plastoquinone and tocopherol required for electron transfer in photosynthesis. In addition, homogentisic acid will be further oxidized and turn dark brown. HPPD can also be used as the target gene of HPPD inhibitor herbicides, and the inhibited HPPD will not be able to catalyze the generation of homogentisic acid (HGA) in the organism, and there will be no color reaction. If HPPD is mutated and expressed in Escherichia coli, after adding HPPD inhibitor compounds, HPPD can also catalyze p-hydroxypyruvate to generate homogentisic acid, and the E. coli liquid will appear dark brown, which will reflect the mutation of the HPPD gene. As a result, this inhibitor herbicide cannot inhibit the function of the HPPD gene.

In this embodiment, we cultured Escherichia coli on a solid medium containing tyrosine and herbicides (HPPD inhibitor compounds), and then screened the mutant sites of the HPPD gene that are resistant to inhibitor compounds according to the color change.

1.1 Cloning of rice OsHPPD gene

The gene of p-hydroxypyruvate dioxidase (HPPD) in rice (Oryza sativa) is located at the Os02g0168100 site of chromosome 2, and the amino acid sequence of the wild-type HPPD is shown in SEQ ID No.1. According to its cDNA sequence (NCBI number XP_015626163.1) and the sequence of the cloning vector pMD19, the amplification primers NcoI-OsHPPD-F: AAGAAGGAGATATACC ATGCCTCCCACTCCCCACCCCCAC and HindIII-OsHPPD-R: AGTGCGGCCGCAAGCTT CTAGGATCCTTGAACTGT were designed. Total RNA was extracted from rice leaves, and cDNA was obtained by reverse transcription kit. The coding sequence of OsHPPD gene was obtained by PCR amplification with high-fidelity enzymes. The amplified fragment is ligated with a linearized gene expression vector.

(1) Acquisition of cDNA: Fresh leaves of rice were taken, RNA was extracted, and reverse transcription was performed using a TakaLa kit to obtain rice cDNA.

(2) Restriction vector: select the high-efficiency prokaryotic expression vector pET-28a, screen two single restriction sites, and contain the ampicillin resistance gene for screening. 100μL enzyme digestion system: mix with ddH2O (make up to 100μL), Vector (4μg), CutSmart (10μL), Nco-I, Hind III (2ul each), then centrifuge quickly, and react at 37°C for 1h.

(3) Gene cloning: use the OsHPPD coding sequence as an amplification template, design primers, and use high-fidelity enzymes to perform PCR amplification to obtain the OsHPPD gene coding sequence. The nucleic acid sequence of the obtained rice HPPD (OsHPPD) is shown in SEQ ID No.2 , the amino acid sequence encoded by it is shown in SEQ ID No.1.

(4) Use the gel recovery method: cut the gel, weigh and mark the gel, add Binding Buffer according to the ratio of 0.1g glue weight: 100μL. During the period, the column volume is 700μL each time, centrifuged at 12000rpm for 30s, discarding the waste solution, and so on. The last centrifugation of the sol solution is 12000rpm, 1min, discarding the waste solution, adding 300μL Binding Buffer, centrifuging at 12000rpm for 1min, and discarding the waste solution. Wash 3 times with SPW Wash Buffer added with absolute ethanol. Dry the column, add 40 μL of ddH2O preheated at 55°C, centrifuge at 12000 rpm for 1 min, and then add 40 μL of ddH2O again, centrifuge at 12000 rpm for 1 min. Mix the eluent and measure the concentration.

(5) Homologous recombination ligation vector: use homologous recombination ligase to ligate the linearized restriction plasmid and the amplified fragment to obtain pET28a-OsHPPD vector, 10ul ligation system, the molar ratio of vector to insert fragment is 1:3. The reaction conditions are 50°C, 30min.

1.2 OsHPPD random mutation and screening

(1) According to the sequences of vector pET-28a and OsHPPD, primers Y122: ACTTTAAGAAGGAGATATACC ATGCCTCCCACTCCCACCCCCAC and Y123: GGTGCTCGAGTGCGGCCGCAAGCTT CTAGGATCCTTGAACTGTAG were designed and synthesized. Using the pET28a-OsHPPD vector as the amplification template, using primers Y122/Y123 and Agilent Random Mutagenesis Kit (GeneMorph II Random Mutagenesis Kit) for Error-prone PCR amplification, agarose gel electrophoresis showed that the correct band size was 1.4kb, Cut glue recycling.

(2) Using the recovered product as a template, use Novizan Taq Master Mix (Dye Plus) Fidelity Kit for secondary amplification. The amplification conditions are: 95°C for 3 minutes; 95°C for 15s, 62°C for 15s, and 72°C 1 minute and 30 seconds, repeated 30 times; 5 minutes at 72°C. Agarose gel electrophoresis showed that the correct size of the band was 1.4 KB. After recovery, the concentration of OsHPPD-mut DNA fragments was determined by a spectrophotometer Nanodrop.

(3) Take an appropriate amount of OsHPPD-mut DNA fragment and mix it with MfeI-HF (NEB, New England Biolabs, Boston, USA) linearized PET-28a vector (the molar ratio of vector to insert fragment is 1:3), add 2x Basic Assembly Mix (Full Gold Homologous Recombination Kit

Seamless Cloning and Assembly Kit), mix well, and incubate at 50°C for 30min.

(4) Take an appropriate amount of the ligation product, add the ligation product to BL21(DE3), mix gently by touching the bottom of the EP tube by hand (avoid pipetting with a gun), and let stand on ice for 25 minutes. Heat shock in a water bath at 42°C for 45s, quickly put it back on ice and let it stand for two minutes, shaking will reduce the transformation efficiency. Add 700ul LB sterile medium without antibiotics to the centrifuge tube, mix well and recover at 37°C and 200rpm for 60min. Collect bacteria by centrifugation at 5000rpm for 1min, take about 100ul of the supernatant and gently pipette the resuspended bacteria block and spread it on the LB medium containing Kan antibiotics, and place the plate upside down in a 37°C incubator for overnight culture.

(5) Dip the grown single colony with a toothpick, and transfer it to an inducer containing HPPD inhibitor herbicide (for example, quinocazone), substrate tyrosine (1%) and IPTG (0.5mmol/L) 96-well plate LB solid medium, and Escherichia coli BL21 was used as a blank control, and the degree of color development was observed after inverting at room temperature for 24-48 hours.

Configure LB+Tyr (0.1%) solid medium (add 20ml/L 5% Tyr, 0.5mmol IPTG and Kan antibiotic 100mg/L), add 170ul of the above-mentioned medium in the 96-well plate, from the Escherichia coli transformed above On the plate, single clones of OsHPPD wild type and mutant (OsHPPD-Mut) were picked for solid culture in a 96-well plate. Add the HPPD inhibitor according to the concentration of the screened drug.

(6) Color observation: Place the 96-well plate at room temperature and culture it for 24-48 hours. The color of the different mutant sites was further checked against the wild type by visual inspection or by detecting the light absorbance of the culture at 405 nm.

The liquid screening system has the advantages of high efficiency, stability and easy observation. In order to further verify the herbicide resistance of the site, the liquid screening system was used in this experiment to further verify the resistance. Take 50 μL of glycerol-preserved bacteria solution and add it to LB liquid medium containing kanamycin for overnight recovery. Use 100 mL Erlenmeyer flasks as petri dishes, add 20 mL LB+Tyr (1%) liquid medium to each bottle, and add 200 μL The overnight cultured bacterial solution was repeated three times independently, sealed with a parafilm at 37°C, and cultured at 220rpm for about 1-2 hours. Cultivate the OD600 to 0.4-0.6, and measure the OD600 with a UV spectrophotometer. Use an ultraviolet spectrophotometer to measure the OD600 of the bacterial solution. When the OD value reaches the range of 0.4-0.6, add 0.3M IPTG inducer and different concentration gradients of the quinzamidone Y13287 herbicide working solution at the same time, seal it and put it in the shaker. 22°C, 220rpm, overnight induction culture. Put the induced bacterial solution into a 50mL centrifuge tube, centrifuge at 12000rpm for 10min, take 250μL of the supernatant and put it on a microplate reader, measure OD405, and further count the resistance results.

1.3 Experimental results

Using the solid medium screening method above, we screened tens of thousands of mutants and obtained two effective mutant clones, namely HF581 clone and HF1113 clone.

The inhibitory effect of OsHPPD protease inhibitors (Quinazadone) on HF581 and HF1113 clones was significantly weakened, and it was still able to metabolize tyrosine substrates in the presence of its Quizadone (Y13287 in Figure 1), and the color change occurred ,As shown in Figure 1. Repeated experiments showed that the color changes of HF581 clone and HF1113 clone were more significant compared with the wild-type control, indicating that their resistance to HPPD inhibitor herbicides was significantly better than that of the wild-type. The herbicide resistance of the mutants was evaluated according to the depth of the color. The more asterisks "*", the darker the color compared to the wild type, the higher the resistance/tolerance, as shown in Table 1.

Further analysis of the genotypes of the HF581 clone and the HF1113 clone: It was found that there were two nucleotide mutations in the rice OsHPPD in the HF581 clone, the C at the 160th position was changed to T and the A at the 1201st position was changed to G, resulting in Two amino acid types changed in OsHPPD protein sequence, namely L54F and K401E. In the HF1113 clone, there is a nucleotide mutation in the rice OsHPPD, which is G at the 160th position is changed to an A, which causes the amino acid at the 133rd position of the OsHPPD protein sequence to change from A to T.

Table 1. Rice HPPD mutants and their relative resistance to HPPD inhibitor herbicides

Put the chromogenic liquid into a 96-well plate, and measure the absorbance under OD ₄₀₅ light rays. The higher the absorbance value, the more the expressed OsHPPD enzyme reacts to the tyrosine in the solution, indicating that the herbicide has less inhibitory effect on the OsHPPD enzyme. significantly. According to the absorbance value (as shown in Figure 2), the absorbance value of HF581 clone and HF1113 clone did not decrease compared with the value of the wild-type clone in the absence of the inhibitor Y13287 (quinocetone); indicating that HPPD in HF581 and HF1113 Protein mutation will not affect the gene function of OsHPPD.

For the HF581 clone, its anti-Y13287 function was significantly improved compared with the wild type under four Y13287 inhibitor concentration conditions. For example, the activity of the wild type decreased by 50%, 63%, 70% and 81% under the conditions of Y13287 concentrations of 1 mg/L, 1.5 mg/L, 2 mg/L and 2.5 mg/L, respectively.

The functions of the HF581 clone decreased by 21%, 28%, 44% and 63% respectively under the four concentration conditions. In addition, the HF581 clone had the same effect as the wild type under the condition of 1mg/L inhibitor concentration. under the same enzymatic activity.

For the HF1113 clone, its resistance to inhibitors was not as good as that of HF581, and its function decreased by 34%, 47%, 63% and 71% under the four concentration gradients, respectively. Compared with the wild type, the resistance level has increased to a certain extent, indicating that the HF1113 clone has a certain tolerance to HPPD inhibitor compounds.

Compared with the wild-type HPPD, the HF581 clone has mutations at two amino acid sites. In order to further verify the tolerance of the above two sites to herbicides, site-directed mutations were performed for L54F or K401E, and L54F and K401E single sites were obtained, respectively. The mutated HPPD mutant clones were defined as HF581-54 and HF581-401 respectively; using the same method as above, the tolerance of the single-point mutation clones to Y13287 was verified. The results are shown in Figure 3. According to the OD ₄₀₅ absorbance reflection, in At a higher herbicide concentration (Y13287 concentration was 2 mg/L), the absorbance value of the HF581 clone was consistent with that of the HF581-54 clone, while the absorbance value of the HF581-401 clone dropped to a level similar to that of the wild type; the above results indicated that the HF581 The resistance of clones to HPPD inhibitor Y13287 mainly comes from the mutation of amino acid 54 from L to F.

Example 2, Herbicide resistance of different mutation types at the 54th position of the OsHPPD protein sequence

By means of site-directed mutagenesis, the 54th amino acid of OsHPPD was mutated to other types of amino acids (A, V, G, Q, W, Y, D, N, E, K, M, S, T, C, P, H , R or I), to obtain the following several different 54-amino acid mutated HPPD proteins: L54I, L54M, L54S, L54V, L54P, L54T, L54A, L54G, L54Y, L54H, L54Q, L54K, L54N, L54D, L54E, L54C, L54W, L54R.

The above method of site-directed mutagenesis can be performed using conventional techniques in the art. For example, the 5' end of the primer is used to perform base mutation at a specific site. If the vector is small, the primer can be used to amplify the entire vector by PCR. If the vector fragment is large, the site to be mutated can be amplified by site-directed mutagenesis using the principle of vector construction, and then the fragment can be constructed on the vector after mutation. The upstream and downstream amplification primers contain a 20bp overlap, and the overlap contains a mutated base sequence, which is amplified using the high-fidelity amplification enzyme KOD. Then, take an appropriate amount of DNA fragment containing the target mutation site and mix it with AgeI and BsaI (NEB, New England Biolabs, Boston, USA) double-enzyme-digested linearized pET-28a vector (the molar ratio of vector to insert fragment is 1:3), Add 2X Basic Assembly Mix (whole gold homologous recombination kit

Seamless Cloning and Assembly Kit), mix well, and incubate at 50°C for 30min. Next, take an appropriate amount of the ligation product, add the ligation product to BL21(DE3), beat the bottom of the EP tube by hand to mix gently (avoid pipetting with a gun), and let stand on ice for 25 minutes. Heat shock in a water bath at 42°C for 45s, quickly put it back on ice and let it stand for two minutes (shaking during this period will reduce the efficiency). Add 700uL LB sterile medium without antibiotics to the centrifuge tube, mix well and recover at 37°C and 200rpm for 60min. Collect bacteria by centrifugation at 5000rpm for 1min, take about 100uL supernatant and gently pipette the resuspended bacteria block and spread it on LB medium containing Kan antibiotics, and place the plate upside down in a 37°C incubator for overnight culture. Finally, the grown single colony was dipped with a toothpick, transferred to a 1.5ml EP tube containing LB (Kan) liquid medium, and tested positive.

Using the same method as in Example 1, the tolerance of the above-mentioned mutated clones to Y13287 herbicide was verified, and the results are shown in Figure 4 and Figure 5: Compared with the wild type, L54S, L54P, L54T, L54A, L54G, L54H , L54Q, L54N, L54K, L54D, L54E, L54C, L54R, L54Y mutant clones had significantly reduced enzyme activity; L54M, L54V, L54W mutant clones had similar resistance to Y13287 herbicide as wild type; L54F and L54I mutant clones had The resistance to Y13287 herbicide, when the concentration of Y13287 was 2mg/L and 2.5mg/L, compared with WT, L54F resistance increased by 53.4% and 49.2%, and L54I resistance increased by 11.7% and 10.4%, respectively.

The resistance of L54F and L54I mutants of embodiment 3, OsHPPD protein to different herbicides

Using the same method as in Example 1, the resistance of the L54F mutant of the above OsHPPD protein to different herbicides was verified. The resistance of L54F mutant clones to Y13287 herbicide is shown in Figure 6. L54F mutant clones have strong resistance to Y13287 herbicide: when the concentration of Y13287 herbicide is 8mg/L, L54F mutant clones still show obvious resistance The resistance of the L54F mutant clone to the oxenzazone herbicide is shown in Figure 7, and the L54F mutant clone has a stronger resistance to the oxenzazone herbicide: when the oxenzazone herbicide concentration is 0.8mg/L, The L54F mutant clone still showed obvious resistance; the resistance of the L54F mutant clone to mesotrione herbicide is shown in Figure 8, and the L54F mutant clone had strong resistance to mesotrione herbicide: when the mesotrione herbicide When the ketone concentration was 3.5mg/L, the L54F mutant clone still showed obvious resistance.

Similar to the L54F mutation, the L54I mutant also exhibited similar herbicide resistance to Y13287, fenflumezone, and mesotrione herbicides.

Example 4, Herbicide resistance of different mutation types at the 133rd position of the OsHPPD protein sequence

In the same manner as in Example 2, the 133rd amino acid of OsHPPD was mutated into other types of amino acids (V, G, L, Q, F, W, Y, D, N, E, K, M, S, C, P , H, R, I), to obtain the following several different HPPD proteins with 133 amino acid mutations: A133E, A133S, A133V, A133F, A133W, A133Y, A133C, A133G, A133Q, A133R, A133D, A133H, A133N, A133P , A133I, A133K, A133L, A133M.

Using the same method as in Example 1, verify the tolerance of the above-mentioned mutated clones to Y13287, the results are shown in Figure 9 and Figure 10: A133D, A133I, A133N, A133L, A133S, A133W, A133V mutant clones are resistant to Y13287 herbicide The resistance of A133M, A133P, A133Q, A133R, A133Y, A133K mutant clones was reduced; When the herbicide resistance concentration was 2mg/L, 2.5mg/L and 3mg/L, the resistance of the mutant clones increased by 22.8%/20.9%/23.6%, 25.3%/13.7%/21.7%, 22.4%/31.8% %/32.3%, 13.3%/18.5%/19.8%, 38.8%/30.3%/35.9%, 10.5%/19.3%/16.7%.

The herbicide resistance of the combination mutant of embodiment 5, OsHPPD protein

The following combined mutations were carried out on HPPD: L54F+K401E+A133T. The same method as in Example 1 was used to verify the tolerance of the clones with the above combined mutations to Y13287. The results are shown in Figure 11: L54F/A133T/K401E mutation The resistance of the clone (the combined mutation of L54F+K401E+A133T) increased by 41.6%/40.8% when the concentration of Y13287 was 2.5mg/L and 3mg/L, respectively.

The following combined mutations were performed on HPPD: L54F+A133T. The same method as in Example 1 was used to verify the tolerance of the above-mentioned combined mutation clones to Y13287. The results showed that the L54F+A133T combined mutation clones were herbicide resistant.

Embodiment 6, verify the resistance of HPPD mutation site to herbicide in rice

Using base editing technology, the HPPD in rice plants is edited according to the HPPD mutation site that is resistant to herbicides verified above. The specific single base editing method can use base editing technology known in the art, such as , The base editing technology adopted in CN113249346A and CN110616203A will not be repeated here. Through base editing technology, edited rice seedlings in which L at position 54 of HPPD was mutated to F or I were obtained, which were respectively counted as L54F mutant rice plants and L54I mutant rice plants.

The resistance of L54F mutant rice plants and L54I mutant rice plants to herbicides was verified by spraying herbicides, and the obtained edited seedlings and wild-type rice plants were simultaneously sprayed with herbicide Y13287 (quinazone herbicide, concentration 0.56ml/L) to spray the leaves of the plants so that they are evenly distributed on the surface of the leaves, continue to cultivate in a 28°C culture room, and observe the growth of the plants after eight days of spraying. The experimental results are as shown in Figure 12: wild type The leaves of the plant showed obvious bleaching phenomenon, and the new leaves growing turned white; the rice plants with the L54F mutant of HPPD protein could grow new leaves without leaf albinism, and the new leaves remained green and in good growth condition. That is, the HPPD protein is edited in rice plants so that L at position 54 is mutated to F, and the L54F mutant rice plants of the obtained HPPD protein are more resistant to HPPD inhibitor herbicides than wild-type rice plants stronger.

Similar to the L54F mutant rice plants, the L54I mutant rice edited plants also exhibited similar herbicide resistance to Y13287 herbicide. All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (18)

1. A mutant polypeptide of p-hydroxyphenylpyruvate dioxygenase (HPPD), compared with the amino acid sequence of parental p-hydroxyphenylpyruvate dioxygenase (HPPD), the mutant polypeptide corresponds to SEQ ID No.1 There are mutations at any one or several of the following amino acid positions in the amino acid sequence shown: 54th, 133rd, and 401st.
2. The mutant polypeptide according to claim 1, wherein the mutant polypeptide is selected from any group or groups of the following I-VI:

   1. Compared with the amino acid sequence of the parental HPPD, the mutant polypeptide corresponds to the 54th amino acid mutation of the sequence shown in SEQ ID No.1 to I or F;

   II. Compared with the amino acid sequence of the parental HPPD, the mutant polypeptide corresponds to the 133rd amino acid mutation of the sequence shown in SEQ ID No.1 to H, E, C, F, G or T;

   III. Compared with the amino acid sequence of the parental HPPD, the mutant polypeptide corresponds to the 401st amino acid mutation of the sequence shown in SEQ ID No.1 to E;

   IV. Compared with the amino acid sequence of the parental HPPD, the mutant polypeptide corresponds to mutations at the 54th and 401st positions of the sequence shown in SEQ ID No.1, wherein the amino acid at the 54th position is mutated to I or F, and the amino acid at the 54th position is mutated to I or F, and The amino acid at position 401 is mutated to E;

   V. Compared with the amino acid sequence of the parental HPPD, the mutant polypeptide corresponds to mutations at the 54th and 133rd positions of the sequence shown in SEQ ID No.1, wherein the 54th amino acid is mutated to I or F, and the 54th amino acid is mutated to I or F, and Amino acid mutation at position 133 is H, E, C, F, G or T;

   VI. Compared with the amino acid sequence of the parental HPPD, the mutant polypeptide corresponds to mutations at the 54th, 133rd and 401st positions of the sequence shown in SEQ ID No.1, wherein the 54th amino acid mutation is I Or F, the amino acid at position 133 is mutated to H, E, C, F, G or T, and the amino acid at position 401 is mutated to E.
3. The mutant polypeptide according to any one of claims 1-2, characterized in that, the mutant polypeptide further includes other amino acid sites that confer resistance to herbicides.
4. The mutant polypeptide according to any one of claims 1-3, wherein the parent HPPD is derived from a monocotyledonous plant or a dicotyledonous plant.
5. The mutant polypeptide according to claim 4, wherein the parent HPPD is derived from rice.
6. A fusion protein comprising the mutant polypeptide according to any one of claims 1-5.
7. A polynucleotide encoding the mutant polypeptide of any one of claims 1-5 or the fusion protein of claim 6.
8. A nucleic acid construct, characterized in that, the nucleic acid construct contains the polynucleotide according to claim 7;

   Preferably, it also contains a regulatory element operably linked thereto;

   Preferably, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polynucleotide sequence, marker gene.
9. A host cell, characterized in that the host cell comprises the mutant polypeptide according to any one of claims 1-5, or the fusion protein according to claim 6, or the polynucleotide according to claim 7, or the The nucleic acid construct of Claim 8.
10. A gene editing reagent, characterized in that, the gene editing reagent can produce the mutant polypeptide described in any one of claims 1-5 in plants; the gene editing reagent includes CRISPR/Cas protein and gRNA, and the gRNA can Targets endogenous HPPD in plants.
11. The application of the gene editing reagent according to claim 10 in preparing plants with resistance/tolerance to HPPD-inhibiting herbicides.
12. A method of imparting resistance/tolerance to a plant to an HPPD-inhibiting herbicide or a method for preparing a plant having resistance/tolerance to an HPPD-inhibiting herbicide, said method comprising using the agent according to claim 10 Steps for gene editing a plant.
13. A method of giving plants resistance/tolerance to HPPD-inhibiting herbicides or a method for preparing plants with HPPD-inhibiting herbicide resistance/tolerance, the method comprising: plant cells, plant seeds, plant The step of introducing the mutant polypeptide according to any one of claims 1-5 into tissues, plant parts or plants.
14. The method according to claim 10, characterized in that the method comprises the step of expressing the mutant polypeptide according to any one of claims 1-5 in plant cells, plant seeds, plant tissues, plant parts or plants.
15. The method according to claim 10, characterized in that the method comprises the step of mutating the endogenous HPPD of the plant so as to introduce the mutant polypeptide.
16. The mutant polypeptide of any one of claims 1-5, or the fusion protein of claim 6, or the polynucleotide of claim 7, or the nucleic acid construct of claim 8, or the nucleic acid construct of claim 9 Use of the host cell described above in the preparation of plants with resistance/tolerance to HPPD-inhibiting herbicides.
17. A plant cell, plant seed, plant tissue, plant part or plant, which comprises the mutant polypeptide described in any one of claims 1-5, or the fusion protein described in claim 6, or the polynucleoside described in claim 7 acid, or the nucleic acid construct of claim 8, or the host cell of claim 9.
18. A method of controlling unwanted vegetation at a vegetative locus, the method comprising:

    (1) providing the mutant polypeptide comprising any one of claims 1-5, or the fusion protein described in claim 6, or the polynucleotide described in claim 7, or the nucleic acid construct described in claim 8, Or the plant of the host cell described in claim 9, or provide the plant obtained by any method of claims 12-15;

    (2) Cultivate the plant of step (1), and apply the HPPD-inhibiting herbicide to the cultivation site.

Images