WO2023040205A1 - Method for efficiently preparing nicotinamide mononucleotide and fusion protein - Google Patents

Abstract

Provided are a fusion protein and a protein combination thereof, the fusion protein comprising nicotinamide riboside kinase (NRK) and ATP cyclase linked to each other using a linker, and the protein combination comprising the NRK and the ATP cyclase in the fusion protein, a nucleic acid for correspondingly encoding the fusion protein or the protein combination, a recombinant expression vector containing the nucleic acid, a transformant containing the nucleic acid or the recombinant expression vector, and applications thereof. Also provided is a method for preparing nicotinamide mononucleotide using the fusion protein or the protein combination.

Description

A method for efficiently preparing nicotinamide mononucleotide and fusion protein

Priority and related applications

This application claims the priority of the Chinese patent application 202111076885.X entitled "A Method for Efficiently Preparing Nicotinamide Mononucleotide and Fusion Protein" filed on September 14, 2021, the entire content of which includes the appendix This application is incorporated by reference.

technical field

The invention belongs to the field of biosynthesis, and specifically relates to a method for efficiently preparing nicotinamide mononucleotide and a fusion protein or protein combination that can be used to prepare nicotinamide mononucleotide, and also relates to an isolated nucleic acid encoding a fusion protein, containing its vectors and transformants.

Background technique

β-nicotinamide mononucleotide (Nicotinamide mononucleotide, abbreviated as NMN) is a substance existing in living organisms, which is transformed into biological cells after being adenylated by nicotinamide nucleotide adenosyltransferase An important substance of nicotinamide adenine dinucleotide (NAD+, also known as coenzyme I). A study published in Science by David Scinclair's research team in March 2017 showed that the increase of NAD+ in mice reversed the signs of tissue and muscle aging in older mice, indicating that rejuvenation in humans is no longer a dream. Because the molecular weight of NAD+ is too large, it cannot be taken into the cells orally, and it mainly depends on the synthesis of cells in the body, and the synthesis amount is very low. However, with the research on NMN, a small molecule substance that is the precursor of NAD+, it has been found that consuming natural NMN can effectively increase the content of NAD+ in the body, and significantly inhibit the metabolism caused by aging, making natural NMN an "elixir of aging". So far, it has been found that nicotinamide mononucleotide has many health care applications such as delaying aging, treating senile diseases such as Parkinson's, regulating insulin secretion, and affecting mRNA expression.

At present, the main methods of synthesizing NMN include chemical synthesis and biocatalysis. Among them, the chemical method is costly and causes serious environmental pollution at the same time, and has been gradually replaced by the biocatalytic method. In comparison, the enzymatic catalytic production of NMN is more efficient, lower cost, energy-saving and environmentally friendly. At present, there are three biocatalytic methods to produce NMN. The first one uses nicotinamide ribose (NR) as raw material to generate NMN under the supply of ATP by nicotinamide ribokinase (Ribosylnicotinamide kinase, EC 2.7.1.22, NRK enzyme for short). The second is to use nicotinamide, ribose and ATP as substrates, through D-ribokinase (Ribokinase, EC 2.7.1.15), nucleic acid phosphate pyrophosphokinase (ribose phosphate pyrophosphokinase, EC 2.7.6.1), and nicotinamide ribose phosphate Transferase (Nicotinamide phosphoribosyltransferase, EC.2.4.2.12) catalyzes the reaction to generate NMN. The third is to use adenosine or AMP, ATP, nicotinamide as raw materials, through adenosine kinase (EC 2.7.1.20) (this enzyme is not required when AMP is used as raw material), adenine phosphoribosyltransferase (EC 2.4.2.7 ), nicotinamide phosphoribosyltransferase (nicotinamide phosphoribosyltransferase, EC.2.4.2.12) catalyzes the generation of NMN.

The above-mentioned second and third methods finally use 5-phosphoribosyl-1-pyrophosphate (Phosphoribosyl pyrophosphate, PRPP) and nicotinamide to prepare NMN through nicotinamide phosphoribosyltransferase (EC.2.4.2.12) . Because nicotinamide phosphoribosyltransferase catalyzes a reversible reaction, it can also hydrolyze NMN while synthesizing NMN, and the reaction conversion rate is low. At the same time, the synthesis of intermediate PRPP compounds is difficult to achieve, and PRPP is unstable, and the yield is very low, which is not conducive to the progress of the reaction, which has become the main limiting condition of the reaction.

The above-mentioned first method directly uses nicotinamide ribose as raw material, has high substrate conversion rate, high yield and high product purity, and will become the mainstream production method of NMN in the future. At present, there is a patent disclosing a new nicotinamide ribokinase and its mutant as an industrial enzyme in the catalytic synthesis of β-nicotinamide mononucleotide and its application (patent number: CN110373398A). However, under the condition of single NRK, the ATP usage is large, the cost is high, and the post-extraction is difficult.

Studies have shown that there are enzymes that use polyphosphoric acid or its salts to regenerate ATP in some bacteria. The enzyme system includes polyphosphate kinase (EC 2.7.4.1, Ppk), adenylate kinase (EC 2.7.4.3, Adk) and polyphosphate adenylate phosphotransferase (EC 2.7.4.-, Pap), Among them, Ppk catalyzes the reaction of ADP and polyphosphoric acid or its salt to generate ATP, Adk catalyzes the reaction of 2 molecules of ADP to generate 1 molecule of ATP and 1 molecule of AMP, and Pap catalyzes the reaction of AMP and polyphosphoric acid or its salt to generate ADP. All of them can help the ATP cycle regeneration consumed in the enzymatic reaction, and greatly reduce the consumption of ATP in the production process. The present invention collectively refers to these three enzymes as "ATP cycle enzymes". At present, there have been patents that have established recovery systems for these ATP cycle enzymes, and proved to be suitable for industrialized large-scale production (patent number: CN105861598A).

In addition, an enzyme-catalyzed synthesis method of β-nicotinamide mononucleotide has been disclosed (patent number: CN112795606A). Phosphate is used as a raw material, and β-nicotinamide mononucleotide is synthesized under the catalysis of purine-nucleoside phosphorylase (purine-nucleoside phosphorylase, abbreviated as PNP) and nicotinamide ribokinase NRK whose EC number is EC 2.4.2.1, and The ADP generated in the reaction process realizes the recycling of ATP under the action of polyphosphate kinase, thereby reducing the production cost.

But there is a lack of a method to further improve the production efficiency of NMN in this field.

Contents of the invention

The technical problem solved by the present invention is to overcome the defect of lacking an efficient production of β-nicotinamide mononucleotide (NMN) in this field, and provide a method and fusion protein for efficiently preparing nicotinamide mononucleotide.

In the present invention, nicotinamide ribokinase (NRK) and ATP cycle enzyme are connected into a fusion protein with a linker, and the fusion protein is produced by fermentation, and the fermented fusion protein is used as a catalyst, which can not only efficiently convert nicotinamide ribose (NR) or its chloride It catalyzes the generation of NMN, and can realize the recycling of ATP simultaneously, which greatly reduces the amount of ATP feeding, reduces the workload of separation and purification, and improves the production efficiency of NMN.

The technical principle of the present invention is that the nicotinamide ribokinase (NRK) gene and the ATP cycle enzyme (polyphosphate kinase, Ppk) gene are connected with a linker to form a fusion protein gene, and the gene is transformed into an expression bacterium , obtain the fusion protein (enzyme) with the function of NRK and Ppk at the same time and the bacterium containing this fusion protein (enzyme), use the enzyme obtained by fermenting the bacterium or the broken bacterium as a catalyst, under the condition of very little ATP, The phosphate group is provided by cheaper sodium hexametaphosphate to complete the efficient conversion of NR to NMN.

One of the technical solutions of the present invention is to provide a fusion protein comprising nicotinamide ribokinase NRK and ATP cycle enzyme.

In some preferred embodiments, the ATP cycle enzyme is Ppk.

Preferably, the Ppk is derived from Escherichia coli, and the NRK is derived from Haemophilus influenzae.

More preferably, the amino acid sequence of NRK is shown in SEQ ID NO: 1, and the amino acid sequence of Ppk is shown in SEQ ID NO: 2.

In some more preferred embodiments, the NRK and Ppk are connected with or without a linker L.

Preferably, the structure of the fusion protein is NRK-L-Ppk or Ppk-L-NRK.

And/or, the amino acid sequence of said L is shown in SEQ ID NO:3.

The second technical solution of the present invention is to provide a protein combination, which includes nicotinamide ribokinase NRK and ATP cycle enzyme in any one of the above fusion proteins.

The third technical solution of the present invention is to provide an isolated nucleic acid encoding any one of the above-mentioned fusion proteins, or any one of the above-mentioned protein combinations.

The fourth technical solution of the present invention is: a recombinant expression vector is provided, the recombinant expression vector includes the above-mentioned isolated nucleic acid; preferably, the nucleotide sequence encoding the NRK is shown in SEQ ID NO: 4; The nucleotide sequence encoding the Ppk is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the L is shown in SEQ ID NO: 6.

Preferably, the NRK and Ppk are on the same recombinant expression vector.

More preferably, the backbone plasmid of the recombinant expression vector is pET28a(+).

After the expression vector is transformed into a suitable host strain, it can express any one of the fusion proteins or any one of the above protein combinations.

The fifth technical solution of the present invention is to provide a transformant comprising the above-mentioned isolated nucleic acid, or the above-mentioned recombinant expression vector.

Wherein the transformant is preferably Escherichia coli as the starting bacterium.

The Escherichia coli is preferably E.coli BL21(DE3).

The transformant can be fermented to produce a sludge containing any one of the above-mentioned fusion proteins or any one of the above-mentioned protein combinations for efficient production of nicotinamide mononucleotide.

The sixth technical solution of the present invention is to provide a method for preparing a fusion protein by culturing the above-mentioned transformant to express the fusion protein.

The seventh technical solution of the present invention is to provide a method for preparing NMN, using nicotinamide ribose or its salt, ATP or its salt as raw materials, and using any of the above-mentioned fusion proteins or any of the above-mentioned protein combinations to catalyze the reaction , to generate NMN.

Preferably, the reaction also includes magnesium ions and polyphosphate.

More preferably, the nicotinamide ribose is nicotinamide ribose chloride, the ATP or its salt is ATP disodium salt, the magnesium ion comes from MgCl ₂ , and the polyphosphate is sodium hexametaphosphate; The reaction time is 0.5-2 hours; the pH of the reaction is 4.0-7.0, and the reaction temperature is 28-40°C.

Further more preferably, in the reaction, ATP or its salt 8mM, magnesium salt 50mM, pure nicotinamide ribose or nicotinamide ribose chloride 80mM, sodium hexametaphosphate 8mM, add 10% to 20% of the reaction volume containing For the sludge of any one of the above fusion proteins or any one of the above protein combinations, the reaction time is 1.5-2 hours.

And/or, the pH is 5.5, and the reaction temperature is 40°C.

The eighth technical solution of the present invention is to provide an application of any one of the above-mentioned fusion proteins or any one of the above-mentioned protein combinations in the preparation of a catalyst for the production of nicotinamide mononucleotide.

On the basis of conforming to common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain preferred examples of the present invention.

The reagents and raw materials used in the present invention are all commercially available.

Before the present invention is described in detail, it is to be understood that this invention is not limited to the particular methodology and experimental conditions in this specification, since such methodology and conditions may vary. Additionally, the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

In addition, in order to better illustrate the present invention, numerous specific details are given in the specific embodiments below. It will be understood by those skilled in the art that the present invention may be practiced without certain of the specific details. In other instances, methods, means, devices and steps well known to those skilled in the art are not described in detail in order to highlight the gist of the present invention.

Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values and numerical ranges appearing in the present invention should be understood as including inevitable systematic errors in industrial production.

The positive progress effect of the present invention is:

1. The fusion protein constructed by the present invention or the protein combination used has high activity, and the conversion of more than 89% can be completed by directly using crude NR or its chloride (purity 40-50%).

2. According to the report in the open literature, the concentration of most substrates in the prior art does not exceed 50 mM, but the concentration of the substrate in the present invention can reach 80 mM, and the production efficiency is increased by at least 60%.

3. The fusion protein constructed by the present invention not only realizes the simultaneous expression of NRK enzyme and Ppk enzyme at a ratio of 1:1, but also the functional subunits of the two enzymes are not far apart, that is, when the ATP cycle enzyme regenerates ATP , which can be used immediately by invertase to catalyze NR into NMN, making the reaction more efficient.

4. The nucleotide sequences of NRK enzyme and Ppk enzyme are optimized according to the optimal codon of Escherichia coli, and the expression effect of the optimized enzyme is better.

Description of drawings

Fig. 1 is to utilize NRK enzyme to catalyze NR reaction in the present invention to obtain NMN, and utilize Ppk enzyme to realize the reaction pathway schematic diagram of ATP cycle regeneration in this process.

Fig. 2 is the expression plasmid map of the enzyme constructed in the present invention. Wherein, A of Fig. 2 is the NRK enzyme expression plasmid map, Fig. 2 B is the Ppk enzyme expression plasmid map, and Fig. 2 C is the NRK and Ppk fusion protein expression plasmid map.

Fig. 3 is a protein gel map verifying that the target gene carried by each constructed expression plasmid can be normally expressed in bacteria. Among them, the fusion protein is expressed by the BL21(DE3) strain containing the plasmid pET28a-fusion protein; Ppk is expressed by the BL21(DE3) strain containing the plasmid pET28a-Ppk; NRK is expressed by the BL21(DE3) strain containing the plasmid pET28a-NRK income.

Detailed ways

The present invention is further illustrated below by means of examples, but the present invention is not limited to the scope of the examples. For the experimental methods that do not specify specific conditions in the following examples, select according to conventional methods and conditions, or according to the product instructions.

Embodiment 1 Construction of fusion protein gene expression strain

1. First obtain the amino acid sequences of NRK, Ppk and linker proteins from NCBI by means of functional gene search: NRK amino acid sequence (SEQ ID NO: 1), Ppk amino acid sequence (SEQ ID NO: 2) and flexible linker Amino acid sequence (SEQ ID NO: 3).

NRK amino acid sequence (SEQ ID NO: 1):

Ppk amino acid sequence (SEQ ID NO: 2):

The amino acid sequence of the flexible linker (SEQ ID NO: 3):

KESGSVSSEQLAQFRSLD

Then the amino acid sequence was translated into DNA sequence and optimized according to the optimal codon of Escherichia coli: the DNA sequence encoding NRK (SEQ ID NO: 4), the DNA sequence encoding Ppk (SEQ ID NO: 5), and the encoding flexible linker were obtained DNA sequence (SEQ ID NO: 6).

DNA sequence (SEQ ID NO: 4) encoding NRK:

DNA sequence encoding Ppk (SEQ ID NO: 5):

DNA sequence encoding flexible linker (SEQ ID NO: 6):

The NRK gene (SEQ ID NO: 4) was connected to the restriction sites BamHI and EcoRI at the first position by PCR, and then connected to the plasmid pET28a by restriction restriction. The primers were designed as follows:

NRK-BamHI-F: cgcGGATCCATGGGTTTTACCACAGGACG (SEQ ID NO: 7)

NRK-EcoRI-R: ggccttaagAATTTGGGAGGTGCCTTTTATTGGAA (SEQ ID NO: 8)

The obtained plasmid is shown in A of Fig. 2 .

The Ppk gene (SEQ ID NO: 5) was connected to the enzyme cutting sites EcoRI and HindIII at the first position by PCR, and then connected to the plasmid pET28a by enzyme cutting and ligation. The primers were designed as follows:

Ppk-EcoRI-F: CCGGAATTCATGGGACAGGAGAAATTG (SEQ ID NO: 9)

Ppk-HindIII-R: CCCAAGCTTCTCTGGCTGTTCCAACG (SEQ ID NO: 10)

The obtained plasmid is shown in B of Fig. 2 .

2. Connect a specific flexible linker (SEQ ID NO: 6) between the NRK and Ppk gene sequences. The connection method between the NRK gene and the Ppk gene and the linker is to connect by overlapping PCR (OEPCR), wherein NRK+linker and linker The primers for +Ppk were designed as follows:

NRK-BamHI-F: cgcGGATCCATGGGTTTTACCACAGGACG (SEQ ID NO: 11)

NRK-linker-R: CTCCCGCTTTTCCTTTTGGGAGGTGCC (SEQ ID NO: 12)

Linker-Ppk-F: GTTTAGAAGTTTGGATGGACAGGAGAAATTG (SEQ ID NO: 13)

Ppk-HindIII-R: CCCAAGCTTCTCTGGCTGTTCCAACG (SEQ ID NO: 14)

After OEPCR, a fusion protein gene with restriction sites of BamHI and HindIII at the beginning and end respectively was obtained.

3. The recombined gene was connected to the expression plasmid pET28a(+) by enzyme-cut ligation, and the resulting plasmid map for expressing the fusion protein was constructed as shown in C of FIG. 2 .

4. The expression plasmid is transformed into the bacterial Escherichia coli BL21 (DE3) with functional expression of the foreign gene;

5. It was verified by protein electrophoresis that the target gene carried by each constructed expression plasmid can be expressed normally in bacteria, and the protein gel map is shown in Figure 3.

Example 2 Production of fusion protein by fermentation

1. Fermentation process:

1) Inoculate a single colony in a medium containing yeast powder, peptone and sodium chloride, and culture in a shake flask at 37° C. for 8 hours.

2) The primary shake flask is expanded to the secondary shake flask, and cultured at 37° C. for 3 to 7 hours.

3) The secondary shake flask was inoculated in the culture medium containing peptone, yeast powder, glycerin, disodium hydrogen phosphate dodecahydrate, potassium dihydrogen phosphate, ammonium chloride, anhydrous sodium sulfate, magnesium sulfate, and antifoaming agent, 37 ℃ fermentation and culture for 6-10 hours, supplemented with ammonia water and glycerol during the process.

4) Add IPTG (final concentration of IPTG is 1mM) when the OD ₆₀₀ of the fermentation broth is 20-30, culture at 25°C, keep the dissolved oxygen at 25-40% and the glycerin concentration at about 2g/L until the end of the fermentation.

2. After the fermentation is over, centrifuge the fermentation liquid for 10 minutes under the centrifugal force of 7000×g, collect the precipitate, and refrigerate the precipitate in a -20°C refrigerator for more than 24 hours. After thawing at room temperature, the bacteria sludge is obtained. In the case of bacteria, it is necessary to break the wall of the bacteria by ultrasonication or homogenization to obtain the broken bacteria sludge.

Embodiment 3 NR pure product prepares NMN

The following six reaction systems (reaction systems a, b, c, d, e and f) were used to prepare NMN from pure NR.

Reaction system a (reaction system using NRK enzyme alone, SEQ ID NO: 4):

ATP or its salt 8mM, magnesium salt 50mM, pure NR 80mM, hexametaphosphoric acid or its salt 8mM, after configuring it into a solution, adjust the pH of the solution to 5.5, and add 10% of the reaction volume derived from Haemophilus influenzae For the sludge of NRK enzyme, keep the reaction temperature at 40°C, carry out the reaction, monitor the output of NMN by HPLC, and calculate the conversion rate of NR to NMN. After conversion for 2 hours, the reaction solution was centrifuged to remove the enzyme, and the remaining ATP and its series (ADP, AMP) in the reaction solution were removed through anion resin and cationic resin in turn. During the removal process, the liquid in the liquid after passing through the resin was monitored by HPLC. For the residual situation of ATP and its series, if the residual amount of ATP and its series in HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of resin used is calculated.

Reaction system b (reaction system using one bacterium and two enzymes, SEQ ID NO: 4+SEQ ID NO: 5):

The enzyme added to this reaction system is 10% of the reaction volume of the sludge containing NRK enzyme and Ppk enzyme, and other reaction conditions are completely the same as the reaction system a.

Reaction system c (reaction system using fusion protease, SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5):

The enzyme added in this reaction system is 10% of the reaction volume of the fusion protein sludge, and other reaction conditions are completely the same as the reaction system a.

Reaction system d (reaction system using NRK enzyme derived from Kluyveromyces marx and Ppk enzyme derived from Escherichia coli combined, SEQ ID NO: 16 and SEQ ID NO: 5):

The enzymes added to this reaction system are 10% of the reaction volume derived from Kluyveromyces marxii containing NRK enzyme sludge, and 10% of the reaction volume derived from Escherichia coli containing Ppk enzyme sludge, other reaction conditions It is exactly the same as the reaction system a.

Reaction system e (reaction system using NRK enzyme derived from Kluyveromyces marx and Ppk enzyme derived from Pseudomonas aeruginosa combined, SEQ ID NO: 16 and SEQ ID NO: 17):

The enzyme added in this reaction system is 10% of the reaction volume derived from the NRK enzyme sludge of Kluyveromyces marx, and 10% of the reaction volume derived from the Pseudomonas aeruginosa Ppk enzyme sludge, other reaction conditions and The reaction system a is exactly the same.

Reaction system f (reaction system using NRK enzyme derived from Haemophilus influenzae and Ppk enzyme derived from Escherichia coli combined, SEQ ID NO: 4 and SEQ ID NO: 5):

The enzyme added in this reaction system is 10% of the reaction volume derived from the NRK enzyme sludge of Haemophilus influenzae, and 10% of the reaction volume derived from the bacteria sludge of Escherichia coli Ppk enzyme, other reaction conditions and reaction system a exactly the same.

Under the single variable, measure and calculate the conversion rate of NR of six kinds of reaction systems, the usage amount of anion resin and cationic resin needed per 100g of the product after removing ATP, the results are shown in the following table:

As can be seen from Example 3, when the pure product NR is used as a substrate and the NRK enzyme is used alone, the catalytic conversion rate of NR is too low (system a, 11.2%). The catalytic conversion rate of the protein combination can reach 92.3%, which is better than other protein combinations (72.4% of the d system and 82.5% of the e system), and when the combination is constructed into a non-fusion protein one bacterium double enzyme system (b system) the catalytic conversion rate is better (95.5%), and the catalytic conversion rate is the best (99.8%) when the combination is constructed into a bacterium dual-enzyme system (c system) of the fusion protein. In addition, compared with other reaction systems in this example, the amount of anion and cation resin used in the fusion protein (system c) is the lowest, which reduces the cost of the production process. It can also be seen that when the substrate concentration is 80 mM, only the combination of NRK enzyme derived from Haemophilus influenzae and Ppk enzyme derived from Escherichia coli can achieve a conversion efficiency of more than 90%, and the catalytic efficiency of enzymes from other sources And the activity is all inferior to the combination of NRK enzyme derived from Haemophilus influenzae and Ppk enzyme derived from Escherichia coli. In addition, by comparing the conversion rate and the amount of anion and cation resins, we can find that the higher the conversion rate, the lower the amount of resin required for purification.

Embodiment 4 content is 40% NR chloride crude product prepares NMN

The following six reaction systems (reaction systems a1, b1, c1, d1, e1 and f1) were used respectively, and the catalytic content was 40% NR chloride to prepare NMN. The amount of the substance added in the reaction system is calculated according to the amount of the pure NR actually contained in the crude NR.

Reaction system a1 (reaction system using NRK enzyme alone, SEQ ID NO: 4):

ATP or its salt 80mM, magnesium salt 50mM, content is 40% NR chloride 80mM, after it is configured into a solution, adjust the pH of the solution to 5.5, add 20% of the reaction volume derived from the NRK enzyme bacteria of Haemophilus influenzae mud, keep the reaction temperature at 40°C, carry out the reaction, monitor the yield of NMN by HPLC, and calculate the conversion rate from NR to NMN. After conversion for 2 hours, the reaction solution was removed by ultrafiltration to remove enzymes, and the remaining ATP and its series (ADP, AMP) in the reaction solution were removed through anion resin and cationic resin in turn. During the removal process, the liquid after passing through the resin was monitored by HPLC. For the residual situation of ATP and its series in the HPLC, if the residual amount of ATP and its series in HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of the resin used is calculated.

Reaction system b1 (reaction system using one bacterium and two enzymes, SEQ ID NO: 4+SEQ ID NO: 5):

The amount of ATP or its salt added to the reaction system was 8mM, and the added enzyme was 20% of the reaction volume containing the bacteria sludge of NRK enzyme and Ppk enzyme. Other reaction conditions were completely the same as those of the reaction system a1.

Reaction system c1 (reaction system using fusion protease, SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5):

The amount of ATP or its salt added to the reaction system is 8mM, the enzyme added is 20% of the reaction volume of the fusion protein bacteria sludge, and other reaction conditions are completely the same as those of the reaction system a1.

Reaction system d1 (reaction system using a combination of NRK enzyme derived from Kluyveromyces marx and Ppk enzyme derived from Escherichia coli, SEQ ID NO: 16 and SEQ ID NO: 5):

The ATP or its salt added to this reaction system is 8mM, and the enzyme added is 20% of the reaction volume derived from Kluyveromyces marxii containing NRK enzyme sludge, and 20% of the reaction volume derived from Escherichia coli containing For the sludge of Ppk enzyme, other reaction conditions are exactly the same as those of the reaction system a1.

Reaction system e1 (reaction system using NRK enzyme derived from Kluyveromyces marx and Ppk enzyme derived from Pseudomonas aeruginosa combined, SEQ ID NO: 16 and SEQ ID NO: 17):

The ATP or its salt added to this reaction system is 8mM, and the enzyme added is 20% of the reaction volume derived from the NRK enzyme sludge of Kluyveromyces marx, and 20% of the reaction volume is derived from Pseudomonas aeruginosa Ppk For the sludge of the enzyme, other reaction conditions are exactly the same as those of the reaction system a1.

Reaction system f1 (reaction system using NRK enzyme derived from Haemophilus influenzae and Ppk enzyme derived from Escherichia coli combined, SEQ ID NO: 4 and SEQ ID NO: 5):

The ATP or its salt that this reaction system adds is 8mM, and the added enzyme is the bacterium slime that derives from the NRK enzyme of Haemophilus influenzae of 20% of the reaction volume, and the bacterium that derives from the Escherichia coli Ppk enzyme of 20% of the reaction volume Mud, other reaction conditions are exactly the same as the reaction system a1.

Measure and calculate the conversion rate of NR of six kinds of reaction systems, the usage amount of anion resin and cationic resin needed per 100g of the product after removing ATP, the results are shown in the following table:

As can be seen from Example 4, when the content is 40% NR chloride as the substrate, under the same conditions, only adding NRK enzyme system, even if 1 equivalent of ATP is added, the conversion rate can only reach 10.1%, With the enzyme combination (d1 system) in the prior art, the productive rate is only 67.2%, while with the enzyme combination (f1 system) of the present invention, the productive rate can reach 89.3%. The combination of enzymes is connected by a linker to form a fusion protein (c1 system), and the yield can reach 96.7%. In addition, compared with other reaction systems in this example, the amount of anion and cation resin used in the fusion protein (c1 system) is the lowest, which reduces the cost of the production process.

Example 5 The fusion protease (SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5) or fusion protease (SEQ ID NO: 16+SEQ ID NO: 6+SEQ ID NO: 17) catalytic content is Preparation of NMN from 70% NR chloride, screening for optimal reaction time

The following five reaction systems (reaction systems a2, b2, c2 and d2, e2) were used respectively, and the catalytic content was 70% NR chloride to prepare NMN. The amount of substances added in the reaction system is calculated according to the amount of pure NR actually contained in the crude NR chloride.

Reaction system a2:

Prepare NMN with fusion protease (SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5) catalytic content of 70% NR chloride, ATP or its salt 8mM, magnesium salt 50mM, content of 70% NR chloride 80mM, hexametaphosphoric acid or its salt 8mM, after configuring it into a solution, adjust the pH of the solution to 5.5, add 10% of the reaction volume of the fusion protein sludge, keep the reaction temperature at 40°C, and carry out the reaction, and monitor NMN by HPLC The yield of , thus calculate the conversion rate of NR to NMN. After conversion for 30 minutes, the reaction solution was removed by ultrafiltration to remove enzymes, and the remaining ATP and its series (ADP, AMP) in the reaction solution were removed through anion resin and cationic resin in turn. During the removal process, the liquid after passing through the resin was monitored by HPLC. For the residual situation of ATP and its series in the HPLC, if the residual amount of ATP and its series in HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of the resin used is calculated.

Reaction system b2:

Set the conversion time in reaction system a2 as 1 h, and the other conditions are exactly the same.

Reaction system c2:

The conversion time in the reaction system a2 is set to 90min, and other conditions are exactly the same.

Reaction system d2:

Set the conversion time in the reaction system a2 as 2h, and the other conditions are exactly the same.

Reaction system e2:

Prepare NMN with fusion protease (SEQ ID NO: 16+SEQ ID NO: 6+SEQ ID NO: 17) catalytic content of 70% NR chloride, ATP or its salt 8mM, magnesium salt 50mM, content of 70% NR chloride 80mM, hexametaphosphoric acid or its salt 8mM, after configuring it into a solution, adjust the pH of the solution to 5.5, add 10% of the reaction volume of the fusion protein sludge, keep the reaction temperature at 40°C, and carry out the reaction, and monitor NMN by HPLC The yield of , thus calculate the conversion rate of NR to NMN. After 1.5 hours of conversion, the reaction liquid was removed by ultrafiltration to remove enzymes, and the remaining ATP and its series (ADP, AMP) in the reaction liquid were removed through anion resin and cationic resin in turn. Residues of ATP and its series in the liquid, if the residual amount of ATP and its series in HPLC is ≤0.05%, the removal is considered complete, and the volume of resin used is calculated.

Determination and calculation of the conversion rate of NR of the five reaction systems, the amount of anion resin and cationic resin required for the product after removing ATP per 100g, the results are shown in the following table:

As can be seen from Example 5, the catalytic efficiency of the fusion protein is very high. Even if the content is 70% NR chloride as the reaction raw material, only 10% of the fusion protein bacterium slime of the reaction volume needs to be added, and the raw material will be converted in 1.5 hours. The conversion can be basically completed (c2 system). And other sources of protein, the content of which is 70% NR chloride as the reaction raw material, its conversion efficiency is very low, only 36.7%, indicating that the impurities in the raw material have a great impact on the enzyme activity.

Example 6 Preparation of NMN from fusion protein obtained by connecting different linkers

The following four fusion proteins (the fusion proteins are respectively a3, b3, c3 and d3) were used to catalyze the preparation of NMN from pure NR chloride.

Fusion protein a3 (the enzyme connection sequence is: NRK enzyme derived from Haemophilus influenzae+flexible linker+Ppk enzyme derived from Escherichia coli, namely SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5):

The reaction system is: ATP or its salt 8mM, magnesium salt 50mM, NR chloride 80mM, after configuring it into a solution, adjust the pH of the solution to 5.5, add 20% of the reaction volume of the fusion protein a3 sludge, and keep the reaction temperature The reaction was carried out at 40°C, and the yield of NMN was monitored by HPLC, from which the conversion rate of NR to NMN was calculated. After conversion for 2 hours, the reaction solution was removed by ultrafiltration to remove enzymes, and the remaining ATP and its series (ADP, AMP) in the reaction solution were removed through anion resin and cationic resin in turn. During the removal process, the liquid after passing through the resin was monitored by HPLC. For the residual situation of ATP and its series in the HPLC, if the residual amount of ATP and its series in HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of the resin used is calculated.

Fusion protein b3 (the enzyme connection sequence is: Ppk enzyme derived from Escherichia coli + flexible linker + NRK enzyme derived from Haemophilus influenzae, namely SEQ ID NO: 5 + SEQ ID NO: 6 + SEQ ID NO: 4):

The enzyme added to the reaction system was 20% of the reaction volume of the fusion protein b3 sludge, and other reaction conditions were exactly the same as the reaction system in which the fusion protein a3 was added in this example.

Fusion protein c3 (enzyme connection sequence is: NRK enzyme derived from Haemophilus influenzae + rigid linker + Ppk enzyme derived from Escherichia coli, namely SEQ ID NO: 4+SEQ ID NO: 15+SEQ ID NO: 5):

Among them, the DNA sequence (SEQ ID NO: 15) encoding rigid linker:

The enzyme added to the reaction system was 20% of the reaction volume of the fusion protein c3 sludge, and the other reaction conditions were exactly the same as the reaction system in which the fusion protein a3 was added in this example.

Fusion protein d3 (the enzyme connection sequence is: Ppk enzyme derived from Escherichia coli + rigid linker + NRK enzyme derived from Haemophilus influenzae, namely SEQ ID NO: 5 + SEQ ID NO: 15 + SEQ ID NO: 4):

The enzyme added to the reaction system was 20% of the reaction volume of the fusion protein d3 sludge, and the other reaction conditions were exactly the same as the reaction system in which the fusion protein a3 was added in this example.

Measure and calculate the conversion rate of NR of four kinds of reaction systems, the usage amount of anion resin and cationic resin needed per 100g of the product after removing ATP, the results are shown in the following table:

It can be seen from Example 6 that under the same conditions, the conversion rate of fusion proteins with different linkers and different enzyme linking sequences also has a large difference. The enzymes are linked with a flexible linker, and the functions of the two enzymes are not affected. And its conversion efficiency is the highest, connecting the enzyme with a rigid linker will affect the function of the active subunit of the enzyme, resulting in a decrease in enzyme activity.

The research of embodiment 7 reaction temperature and pH

Reaction system a4:

ATP or its salt 8mM, magnesium salt 50mM, NR chloride 80mM, after it is configured into a solution, adjust the pH of the solution to be 5.5, add 20% of the fusion protein a3 of the reaction volume (NRK enzyme+flexible protein derived from Haemophilus influenzae linker + Ppk enzyme derived from Escherichia coli, that is, the bacteria slime of SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5), keep the reaction temperature at 40°C for the reaction, and monitor the output of NMN by HPLC. This calculates the conversion of NR to NMN. After conversion for 2 hours, the reaction solution was removed by ultrafiltration to remove enzymes, and the remaining ATP and its series (ADP, AMP) in the reaction solution were removed through anion resin and cationic resin in turn. During the removal process, the liquid after passing through the resin was monitored by HPLC. For the residual situation of ATP and its series in the HPLC, if the residual amount of ATP and its series in HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of the resin used is calculated.

Reaction system b4:

In this reaction system, the pH of the solution is adjusted to 7.0, the reaction temperature is 35°C, and other reaction conditions are completely the same as those of the reaction system a4.

Reaction system c4:

In this reaction system, the pH of the solution is adjusted to 6.5, the reaction temperature is 30° C., and other reaction conditions are completely the same as those of the reaction system a4.

Reaction system d4:

In this reaction system, the pH of the solution is adjusted to 4.0, the reaction temperature is 28° C., and other reaction conditions are completely the same as those of the reaction system a4.

Measure and calculate the conversion rate of NR of four kinds of reaction systems, the usage amount of anion resin and cationic resin needed per 100g of the product after removing ATP, the results are shown in the following table:

The enzyme-catalyzed reactions in Examples 3-6 were all carried out at a pH of 5.5 and a reaction temperature of 40°C. In Example 7, we also tried other reaction conditions. From the results of the reaction system a4-d4, the pH Between 4.0-7.0, the temperature is between 28-40°C, and the corresponding enzyme-catalyzed reactions can also be carried out.

Claims (10)

1. A fusion protein, characterized in that the fusion protein includes nicotinamide ribokinase NRK and ATP cycle enzyme.
2. The fusion protein according to claim 1, wherein the ATP cycle enzyme is polyphosphate kinase Ppk;

   Preferably, the Ppk is derived from Escherichia coli, and the NRK is derived from Haemophilus influenzae;

   More preferably, the amino acid sequence of NRK is shown in SEQ ID NO: 1, and the amino acid sequence of Ppk is shown in SEQ ID NO: 2.
3. The fusion protein according to claim 1 or 2, wherein the NRK and Ppk are connected with or without a linker L;

   Preferably, the structure of the fusion protein is NRK-L-Ppk or Ppk-L-NRK;

   And/or, the amino acid sequence of said L is shown in SEQ ID NO:3.
4. A protein combination, characterized in that it comprises nicotinamide ribokinase NRK and ATP cycle enzyme in the fusion protein according to claim 2.
5. An isolated nucleic acid, characterized in that, the nucleic acid encodes the fusion protein as claimed in any one of claims 1 to 3, or the protein combination as claimed in claim 4; preferably, the nucleoside encoding the NRK The acid sequence is shown in SEQ ID NO: 4; the nucleotide sequence encoding the Ppk is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the L is shown in SEQ ID NO: 6.
6. A recombinant expression vector, characterized in that, the recombinant expression vector comprises the isolated nucleic acid as claimed in claim 5;

   Preferably, the NRK and Ppk are on the same recombinant expression vector; more preferably, the backbone plasmid of the recombinant expression vector is pET28a(+).
7. A transformant, characterized in that, the transformant comprises the isolated nucleic acid as claimed in claim 5, or the recombinant expression vector as claimed in claim 6; wherein the transformant is preferably Escherichia coli as the starting bacterium; the Escherichia coli is preferably E.coli BL21 (DE3).
8. A method for preparing a fusion protein, characterized in that the transformant according to claim 7 is cultivated to express the fusion protein.
9. A method for preparing NMN, characterized in that, using nicotinamide ribose or a salt thereof, ATP or a salt thereof as a raw material, using the fusion protein according to any one of claims 1 to 3, or using the fusion protein according to claim 4 protein combination to catalyze the reaction to produce NMN;

   Preferably, the reaction also includes magnesium ions and polyphosphate;

   Optionally, the nicotinamide ribose can also be nicotinamide ribose chloride, the ATP or its salt is ATP disodium salt, the magnesium ion comes from MgCl ₂ , and the polyphosphate is sodium hexametaphosphate; The time of the reaction is 0.5-2 hours; the pH of the reaction is 4.0-7.0, and the temperature of the reaction is 28-40°C;

   Further more preferably, in the reaction, ATP or its salt 8mM, magnesium salt 50mM, nicotinamide ribose or nicotinamide ribose chloride 80mM, sodium hexametaphosphate 8mM, add 10% to 20% of the reaction volume containing The fusion protein according to any one of claims 1 to 3 or the protein combination sludge according to claim 4, the reaction time is 1.5-2 hours;

   And/or, the pH is 5.5, and the reaction temperature is 40°C.
10. Application of the fusion protein according to any one of claims 1 to 3, or the protein combination according to claim 4 in the preparation of a catalyst for the production of nicotinamide mononucleotide.

Images