WO2023030162A1

WO2023030162A1 - Extended probe-type qpcr detection method for snv

Info

Publication number: WO2023030162A1
Application number: PCT/CN2022/114842
Authority: WO
Inventors: 杨永臣; 张泓
Original assignee: 上海市儿童医院; 道之精准医学科技上海有限公司
Priority date: 2021-09-01
Filing date: 2022-08-25
Publication date: 2023-03-09
Also published as: CN113846147A

Abstract

Disclosed in the present invention is an extended probe-type qPCR detection method for single nucleotide variation (SNV). Four primers are designed according to known single nucleotide variation sites, with two of the primers being external primers and the other two being specific primers, wherein bases at the 3' ends of the specific primers are respectively complementary with bases of a mutation template and a normal template; mismatches can be introduced or not introduced into bases near the 3' ends; and a segment of artificial sequence is extended at the 5' end of each specific primer, with an accessory primer in the same direction designed on the 5' segment of the artificial sequence and an accessory probe designed on the 3' segment thereof. In the amplification of the specific primers and downstream primers, the accessory probes on the specific primers are degraded and emit light in the extension of the accessory primers so as to indicate the amplification efficiency of the specific primers. If only one genotype of the single nucleotide variation sites is detected, two external primers, one specific primer, and the accessory primer and probe of the specific primer can be used. The method still has many implementation modes, and has a higher sensitivity and a lower cost than a probe-type AS-PCR.

Description

A kind of epitaxial probe type qPCR detection method of SNV

technical field

The invention relates to the field of gene detection, in particular to an extension probe type qPCR detection method for single base variation (SNV).

Background technique

Single nucleotide variation (Single nucleotide variants, SNV) is a single nucleotide variation in the DNA sequence. Single nucleotide variation widely exists in the human genome or other biological genomes, and it plays a regulatory role in biological processes such as RNA transcription and protein expression, and is closely related to human diseases. In this paper, SNVs include SNPs, which are not distinguished or given different names according to the population frequency of single base variation, whether the variation is from germ cells or somatic cells.

There are many methods for SNV detection, such as PCR-Sanger sequencing, next-generation sequencing, pyrosequencing, TaqMan probe qPCR method, PCR-RFLP enzyme digestion method, Multiplex SNaPshot method, Sequenom MassArray method, AS-PCR method , chip method and so on. For the detection of a large number of samples for a small number of sites, you can choose to use the AS-PCR (allele specific PCR) method with probes and the TaqMan probe qPCR method.

A typical AS-PCR consists of four primers: an outer upstream primer, an outer downstream primer, an inner upstream specific primer, and an inner downstream specific primer. Among them, the internal upstream specific primer and the internal downstream specific primer are respectively combined with the positive strand and the reverse strand of DNA, and their 3' ends are respectively matched with different allele types of the same SNV on the DNA. The specificity of the specific primer is increased (this is not required) by introducing an intentional mismatch at the second or third position at the 3' end. Therefore, the four primers have three kinds of amplification products: the outer upstream primer and the outer downstream primer are amplified, and the products are used as internal references for amplification and provide more templates for the amplification of specific primers; the outer upstream primer and the inner downstream specific The primers are used to amplify the SNV allele type corresponding to the internal test downstream specific primer; the inner upstream specific primer and the outer downstream primer are used to amplify the SNV allele type corresponding to the internal test upstream specific primer. The amplification products of the outer upstream primer and the inner downstream specific primer, and the amplification products of the inner upstream specific primer and the outer downstream primer have different lengths. After amplification, electrophoresis is performed, and whether the SNV is wild-type, mutant or heterozygous is judged by the presence or absence of amplified bands with two specific primers.

For the typical mode and various variants of AS-PCR, if qPCR is used for detection without introducing probes, it can generally only be distinguished by the melting curve method. This method is unstable due to the difference in the Tm value of the amplified product, and it is difficult to be used in clinical detection. To introduce probes into the system, the fourth variant has traditionally been used. This is because, no matter the amplification product of the outer upstream primer and the inner downstream specific primer, or the amplification product of the inner upstream specific primer and the outer downstream primer, it is covered by the amplification product of the outer upstream primer and the outer downstream primer, and then The latter is the inevitable product of the typical mode of AS-PCR. In this way, the amplification product of the outer upstream primer and the inner downstream specific primer, or the amplification product of the inner upstream specific primer and the outer downstream primer, cannot design specific probes to indicate the amplification product in which the specific primer participates. . In the fourth variant, since only one outer primer and the corresponding inner specific primer are retained, the amplification curve can reflect the 3' end base binding situation of the specific primer without interference from other products. Therefore, this method has been widely used in various application scenarios such as clinical cancer SNV detection and virus mutation site detection. The disadvantage of this variant is that the decrease in binding efficiency due to the introduction of deliberate mismatches on the specific primers cannot be compensated for by the amplification of the template provided by the two outer primers, resulting in most cases Reduced detection sensitivity and specificity.

Contents of the invention

In view of the above problems, the technical problem to be solved by the present invention is to design a qPCR detection scheme to obtain a more accurate and low-cost method for detecting nucleic acid variation sites.

The detection scheme used in the present invention is a modification based on the non-quantitative AS-PCR mode of the classic four primers or three primers, and the detection probe is designed outside the amplification region to indicate the amplification region. A method for the rate of amplification of internal products. Specifically, the middle mismatched primer is extended outward from the 5' end, and the accessory probe and accessory primer are designed on the extended fragment, so that the probe is located outside the amplification target region and can reflect the amplification region. effect of internal amplification. Since the extension sequence can be designed almost arbitrarily, not only can it easily avoid the sequence identity with the outer amplification product, but more importantly, when we use the same pattern to detect another mutation site, we only need to replace the upstream primer, downstream The parts on the primers and specific primers that match the target region, while retaining the extended part of the 5' end of the accessory probes, accessory primers, and specific primers, thereby realizing the repeated use of accessory primers and accessory probes, saving expensive new Probe synthesis costs.

At a relatively high F1 primer concentration, the unidirectional epitaxial probe qPCR detection system has a good ability to distinguish SNVs using a probe-based qPCR reagent that does not have 3’-5’ exonuclease activity.

The ability of the unidirectional epitaxial probe qPCR detection system to detect SNV has been further confirmed through amplification curve, sensitivity test, specificity analysis and other tests. The unidirectional epitaxial probe qPCR detection system of the present invention has better performance in detecting SNVs, especially in detection scenarios with low proportion of mutations, such as the detection of gene mutation sites in cancer tissues, the detection of virus drug resistance sites, etc. application value.

Compared with TaqMan probe qPCR method, AS-PCR technology with probe is a more accurate and efficient SNV detection technology. However, because only one specific primer and one corresponding outer primer are reserved, the detection sensitivity and specificity of the AS-PCR technique with probes are slightly lower. To solve this problem, based on the principle of AS-PCR, we designed an epitaxial probe-type qPCR detection scheme to obtain a more accurate and low-cost detection method.

The invention firstly discloses a design mode of primers and probes. Based on the classic PCR principle, this mode includes a set of extension components and a downstream primer; wherein the extension components include extension primers, accessory primers, and accessory probes. The feature of the extension primer is: except for the region where the 3' section of the primer binds to the template, an artificial sequence is extended outward at the 5' end of the primer, and the artificial sequence is divided into a 5' section and a 3' section according to the relative position. The aforementioned so-called accessory primer is a primer that can be reversely complementary to the reverse complementary sequence of the 5' segment of the artificial sequence; the aforementioned so-called accessory probe is a band that can be reversely complementary to the reverse complementary sequence of the 3' segment of the artificial sequence Probes with luminescent and extractive groups. There is no overlap or partial overlap between the accessory primer and the accessory probe on the region corresponding to the extension primer. The aforementioned so-called downstream primers refer to primers that form a pair of primers with the extension primers and can perform PCR amplification on the template in a normal PCR system. During the PCR amplification process, the downstream primer binds and extends the single strand following the extension product of the upstream primer, which can serve as the binding object of the accessory primer and accessory probe, and initiate qPCR amplification. This is a probe design mode where the probe is designed on the primer, especially when the probe is not suitable for designing in the product region between the two primers, it gives another option for probe design. We call this method the epitaxial probe qPCR method, and the schematic diagram is shown in Figure 1: epitaxial probe qPCR. Furthermore, combining the epitaxial probe qPCR method with the principle of AS-PCR, we designed an epitaxial probe qPCR detection system for the purpose of SNV detection. Based on a set of extension components and a downstream primer included in the extension probe type qPCR method, the system modifies the 3' end of the extension primer. Genotype matching, on the other hand, can replace the second or third base at the 3' end to improve binding specificity. In the PCR system (the Taq enzyme used does not have 3' to 5' exonuclease activity), when the base of the 3' end of the extension primer matches the base of the SNV, the primer is extended and qPCR can be started, and the primer cannot be used when it does not match. Extension, qPCR cannot be started or is extremely difficult to start. According to the amplification curve triggered by the fluorescent signal, the allelic type of SNV and the proportion of this type can be analyzed. This epitaxial component modified for the purpose of SNV detection is called a specific epitaxial component, and the epitaxial primer contained in it is called a specific epitaxial primer. We call this method a specific epitaxial probe-based qPCR method, and its schematic diagram is shown in Figure 2.

Furthermore, there are many specific implementation modes for the epitaxial probe type qPCR detection system for the purpose of SNV detection. One of the modes is: in the extension probe type qPCR detection system, an outer upstream primer is designed upstream of the specific extension primer, and on the amplification product of the outer upstream primer and the downstream primer, an outer upstream primer and the extension primer are set in the middle position. An internal reference probe bound to the template with a fluorescence different from that of the attached probe is used to indicate the amplification efficiency of the outer upstream primer and the downstream primer (expressed as a Ct value), by comparing the Ct value with that of the attached probe on the extension primer The Ct value can be used to calculate the relative proportion of the specific extension primer corresponding to the genotype. We call this scheme a unidirectional epitaxial probe qPCR detection system, and its schematic diagram is shown in Figure 3.

Furthermore, there are many specific implementation modes for the epitaxial probe type qPCR detection system for the purpose of SNV detection. The second mode is: for two allelic types of a certain SNV, two corresponding specific extension components are designed on the forward and reverse strands respectively, and outer amplification primers are designed on the outer side respectively. The accessory probes of the two specific epitaxy components have different fluorescence. According to the amplification curves of the two fluorescences, the relative proportions of the two genotypes of the SNV can be judged. We call this scheme a two-way epitaxial probe qPCR detection system, and its schematic diagram is shown in Figure 4.

Furthermore, there are many specific implementation modes for the epitaxial probe type qPCR detection system for the purpose of SNV detection. The third mode is: for the two allelic types of a certain SNV, two specific epitaxial components are designed in the same direction on the forward or reverse strands, and they combine with each other at the same position in a competitive relationship. Design amplification primers. The accessory probe sequences of the two specific extension components are different, so that each corresponds to an extension primer and has different fluorescence. According to the amplification curves of the two fluorescences, the relative proportions of the two genotypes of the SNV can be judged. We call this scheme a qPCR detection system of unidirectional paired epitaxial probes, and its schematic diagram is shown in Figure 5.

If not specified in the present invention, commercially available or conventional PCR reagents, such as Taq enzymes that do not have 3'-5' exonuclease activity, can be used.

Further, in a preferred embodiment of the present invention, the detection scheme designed for the mutation site N501Y on the new coronavirus (commonly known as COVID-19, named by the World Health Organization as 2019-nCoV) can determine the COVID-19 in the template. The presence or absence of -19, the presence and proportion of N501Y, and the proportion of the N501Y mutant plasmid in the wild-type plasmid can be judged in the simulation experiment, and the accuracy can reach less than 1%.

Primers and probes used include: N501Y-F1: 5'-ACTGAAATCTATCAGGCCGGT-3' (SEQ ID NO 1); N501Y-R1: 5'-ACAAACAGTTGCTGGTGCAT-3' (SEQ ID NO 2); N501Y-F2: 5' -ATCTCCGTTCCTAAGGTTGGACAAAGCTTCCGATTAGGGATTCTCCATGTCAATCATATGGTTTCCAACCCACCT-3' (SEQ ID NO 3); N501Y-F3:5'-ATCTCCGTTCCTAAGGTTGGA-3' (SEQ ID NO 4); N501Y-P1:5'-FAM-AGCTTCCGATTAGG3GATTCTCCATG-BHQ ); N501Y-P2: 5'-VIC-CTTGTAATGGTGTTGAAGGTT-MGB-3' (SEQ ID NO 6). N501Y-F1 and N501Y-R1 are outer primers, F2 is an extension-specific primer, F3 and P1 are accessory primers and accessory probes, respectively, and P2 is an internal reference probe. Test according to the PCR program recommended by the probe qPCR kit and the recommended qPCR instrument. By comparing the fluorescence curve of FAM with that of VIC, the ratio of N501Y mutant plasmid to wild-type plasmid can be accurately judged, and the accuracy can reach less than 1%.

The experimental method and results are shown in the specific implementation method. The results show that the AceQ Universal U+Probe Master Mix V2 reagent has a better ability to distinguish wild-type and mutant plasmids than the Premix Ex Taq ^TM reagent.

According to the National Comprehensive Cancer Network (NCCN), American Society of Clinical Oncology (ASCO), European Society for Medical Oncology (ESMO) and Chinese Anti-Cancer Association Clinical Oncology The colorectal cancer-related guidelines of the Collaborating Center (Chinese Society of Clinical Oncology, CSCO) and others recommend that patients with primary or metastatic colorectal cancer should be tested for KRAS/NRAS/BRAF gene mutations and their status should be clarified. Among these genes, common pathogenic mutations leading to rectal cancer include: KRAS gene Exon 2: p.G12S (34G>A), p.G12D (35G>A), p.G12C (34G>T), p. G12V (35G>T), p.G12A (35G>C 522), p.G13D (38G>A); KRAS gene Exon 3: p.Q61H (183A>C), KRAS gene Exon 4: p.K117N (351A >C), p.K117N(351A>T), p.Al46T(436G>A), p.A146V(437C>T), p.A146P(436G>C); NRAS gene Exon 2: p.G12D(35G >A), NRAS gene Exon 3: p.Q61R (182A>G), p.Q61K (181C>A 580); BRAF gene Exon 15: p.V600E (1799T>A); PIK3CA gene Exon20: p.H1047R ( CAT>CGT), p.H1047L (CAT>CTT), p.E542K (GAA>AAA), p.E545K (GAG>AAG), p.E545D (GAG>GA1). During the treatment of cancer, monitoring the proportion of small residues of the discovered pathogenic mutations is an important means of judging the prognosis. In this process, it is very important to use molecular detection methods to accurately, periodically and continuously detect the mutation ratio. This is an indispensable key indicator for changing the treatment plan and judging the follow-up direction.

Further, in a preferred embodiment of the present invention, for the BRAF gene Exon 15:p.V600E (1799T>A) related to the pathogenic mutation leading to rectal cancer, the designed detection scheme can determine whether the BRAF gene Exon 15 :p.V600E (1799T>A) with or without and the ratio, the results of simulation experiments show that it has better detection accuracy.

The above method is based on the general knowledge of PCR. If there is no special point, you can refer to the conventional method in this field or the materials and methods used in the "Molecular Cloning Experiment Guide" (Cold Spring Harbor). For example, the above-mentioned combination of primers and templates is based on the annealing rules of PCR, the 5' and 3' ends are cut according to the target of the probe, the composition of the PCR system, the base replacement rules in the primers, and the labeling position of the luminescent group in the probe , the type of luminescent group, etc., are common knowledge of PCR.

Furthermore, based on the bidirectional epitaxial probe qPCR detection system, we designed a detection scheme for two SNP sites. The detected loci are c.-3279T>G and c.1091C>T on the human gene UGT1A1. UGT1A1：c.-3279T>G位点检测所用的特异引物和外侧引物为：Ug3279-Fn:5'-ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtCCTTTGATGTTCTCAAATTGCTTTGTTTAA-3'(特异引物)(SEQ ID NO 7)；Ug3279-Rn:5'-ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactGTAAGCTGGCCAAGGGTAGAGTTCAATG -3' (specific primer) (SEQ ID NO 8); Ug3279-Fo: 5'-CTCTGCCTCTTACCCTCTAGCCATTCT-3' (outer primer) (SEQ ID NO 9); Ug3279-Ro: 5'-CCTCTAGTTACATAACCTGAAACCCGGA-3' (outer primer ) (SEQ ID NO 10) (outer primer); UGT1A1: c.1091C> T site detection specific primers and outer primers used are: Ug1091-Fn: 5'-ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtTCCTCCCTATTTTGCATCTCAGGTCAACC-3' (specific primer) (SEQ ID NO 11); Ug1091-Rn:5'-ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactATGGGTGATAAAGGCACGGGTCAGCA-3' (specific primer) (SEQ ID NO 12); Ug1091-Fo:5'-CTTCTGCAAATTTCTGCAAGGGCATGTG-3' (SEQ ID 1 NO0 primer 13) (outside : 5'-TCCAGAACATTCAGGGTCACTCCAGCTC-3' (SEQ ID NO 14) (outer primer). The two accessory probes shared by the two sites are: General-Fam: 5'-FAM-agcttccgattagggattctccatg-MGB-3' (SEQ ID NO 15); General-Vic: 5'-VIC-gcacaccgttgactgcttatgac-MGB-3 '(SEQ ID NO 16); the accessory primer shared by the two sites is: General-F: 5'-ATCTCCGTTCCTAAGGTTGGA-3'(SEQ ID NO 17). Test according to the PCR program recommended by the probe qPCR kit and the recommended qPCR instrument. By comparing the fluorescence curve of FAM with that of VIC, the determined SNP genotype was consistent with the results of first-generation sequencing.

In the present invention, the primer and probe combination of the SNV extension probe type qPCR detection method includes a set of extension components and a downstream primer;

Wherein the extension components include extension primers, accessory primers, and accessory probes;

In addition to the region where the 3' segment binds to the template, the extension primer extends an artificial sequence outward at the 5' end, and the artificial sequence is divided into a 5' segment and a 3' segment according to the relative position;

The so-called accessory primer is a primer that can be reverse complementary to the reverse complementary sequence of the 5' segment of the artificial sequence;

The so-called accessory probe is a probe with a luminescent group and an extraction group that can be reverse complementary to the reverse complementary sequence of the 3' segment of the artificial sequence;

The so-called downstream primers refer to primers that form a pair of upstream and downstream primers with the extension primers, and can perform PCR amplification on the template in a normal PCR system.

The epitaxial probe type qPCR detection method of SNV described in the present invention, its application includes but not limited to:

Identify the presence or absence of target SNVs;

determine the alleles of the SNV of interest; or

Determine the content or ratio of each allele of the target SNV in the sample.

In the method described in the present invention, the primer and probe sequences designed based on the epitaxial probe qPCR design mode and derivation mode disclosed in the present invention are different from those disclosed in this patent, and are still covered by the claims.

The species source of the gene variation detection applied by the method of the present invention includes but not limited to human beings, various animals, various plants, microorganisms, viruses and artificially designed or modified genes, such as originating from humans, and the sample types include but not limited to : Blood, urine, throat swab, feces, alveolar lavage fluid, pus, drainage fluid, tissue blocks, etc.

Owing to adopting above-mentioned technical scheme, the beneficial effect that the present invention obtains comprises:

The epitaxial probe type qPCR detection disclosed in the present invention, and the unidirectional epitaxial probe qPCR detection system developed accordingly, have higher sensitivity and specificity than the traditional probe type AS-PCR; The probe qPCR detection system has higher sensitivity and specificity than the TaqMan probe qPCR method in SNV detection, and the two probes can be reused between different detection sites, which greatly reduces the cost. The new coronavirus N501Y site detection kit developed based on the unidirectional epitaxial probe qPCR detection system can detect less than 1% of the mutant plasmids in the wild-type plasmid.

Description of drawings

Figure 1 Schematic diagram of epitaxial probe qPCR.

Fig. 2 Schematic diagram of specific epitaxial probe-type qPCR method.

Fig. 3 Schematic diagram of the qPCR detection system of the unidirectional epitaxial probe.

Fig. 4 Schematic diagram of the qPCR detection system of the bidirectional epitaxy probe.

Fig. 5 Schematic diagram of qPCR detection system of unidirectional paired epitaxial probes.

Figure 6 N501Y, the sequencing map of the mutant plasmid and the wild-type plasmid.

Figure 7 N501Y, the test of different amplification systems.

Figure 8 N501Y, amplification curves of mutant plasmids at different concentrations.

Figure 9 N501Y, the standard curve of the amplification curves of different concentrations of mutant plasmids.

Figure 10 N501Y, amplification curves of wild-type plasmids at different concentrations.

Figure 11 N501Y, the standard curve of the amplification curves of wild-type plasmids at different concentrations. Wherein, the closer the data points are to the fitting curve, the more reliable the method of the present invention is.

Figure 12 N501Y, amplification curves of mutant plasmids with different ratios under 10 to the 8th power copy plasmid. Use 10 to the 8th power positive plasmid for dilution, and the amplification curves from top to bottom are 100%, 10%, 4&, 2%, 1%, 0.5%, 0.25%, and 0 dilution ratios. It can be seen from the figure that at a concentration of 10 to the 8th power, a mutation ratio of 0.25% can be distinguished.

Figure 13 N501Y, the standard curve of the amplification curves of mutant plasmids with different ratios under 10 to the 8th power copy plasmid.

Figure 14 N501Y, under 10 to the 6th power copy plasmid, the amplification curves of mutant plasmids with different ratios. Use 10 to the 6th power positive plasmid for dilution, and the amplification curves from top to bottom are 100%, 10%, 4&, 2%, 1%, 0.5%, 0.25%, and 0 dilution ratios. It can be seen from the figure that at a concentration of 10 to the 6th power, a mutation ratio of 2% can be distinguished.

Figure 15 N501Y, specificity analysis of the amplification system.

Figure 16 UGT1A1: c.-3279T>G Sanger sequencing typing.

Figure 17 UGT1A1: c.1091C>T Sanger sequencing typing.

Figure 18 UGT1A1: c.-3279T>G epitaxial qPCR amplification curve.

Figure 19 UGT1A1: c.-3279T>G epitaxial qPCR amplification curve, sample aggregation.

Figure 20 UGT1A1: c.1091C>T epitaxial qPCR amplification curve.

Figure 21 UGT1A1: c.1091C>T epitaxial qPCR amplification curve, sample aggregation.

Detailed ways

The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

Example 1 Detection of New Coronavirus N501Y

We intend to develop a new coronavirus N501Y site detection kit based on the unidirectional epitaxial probe qPCR detection system to prove the effectiveness of the unidirectional epitaxial probe qPCR detection system.

1 Materials and methods

1.1 Preparation of N501Y mutant and wild-type plasmids

According to the gene sequence of "SARS-CoV-2VOC 202012/01" or "B.1.1.7." entered by GenBank, select the 1398th to 1588th sites in the spike protein gene sequence (the position in the full-length sequence is 22935 to 23125 sites), the wild-type sequence and the N501Y mutant sequence were synthesized by General Biosystems (Anhui) Co., Ltd. by splicing primers, and inserted into the EcoRV blunt-end restriction site of the puc57 plasmid. After the plasmid was transformed and extracted , Dilute the wild-type plasmid and the mutant plasmid with double distilled water to 1×10 10th power copies/uL, 1×10 9th power copies/uL, 1×10 8th power copies/uL, 1 ×10 to the 7th power copies/uL, 1×10 to the 6th power copies/uL, 1×10 to the 5th power copies/uL, 1×10 to the 4th power copies/uL, 1×10 to the 3rd power Copies/uL, 1×10 to the 2nd power copies/uL, 1×10 to the 1st power copies/uL.

The wild-type sequence inserted in the plasmid is:

The mutant sequence inserted in the plasmid is:

The sequence diagram is shown in Figure 6, the upper sequence in the figure is the mutant type, and the lower sequence is the wild type.

1.2 Primer design

Primers and probes used include:

N501Y-F1:5'-ACTGAAATCTATCAGGCCGGT-3';

N501Y-R1: 5'-ACAAACAGTTGCTGGTGCAT-3';

N501Y-F2:

5'-ATCTCCGTTCCTAAGGTTGGACAAAGCTTCCGATTAGGGATTCTCCATGTCAATCATATGGTTTCCAACCCACCT-3';

N501Y-F3:5'-ATCTCCGTTCCTAAGGTTGGA-3';

N501Y-P1:5'-FAM-AGCTTCCGATTAGGGATTCTCCATG-BHQ1-3';

N501Y-P2: 5'-VIC-CTTGTAATGGTGTTGAAGGTT-MGB-3'.

Primers and probes have been prepared at a concentration of 2pMol with double distilled water before use.

1.3 Test of amplification system

To test the applicability of AS-qPCR, we explored two qPCR reagents, one is AceQ Universal U+Probe Master Mix V2 (Vazyme, Cat#Q513-02) and the other is Premix Ex Taq ^TM (Probe q- PCR) (TAKARA, Cat#RR390A), the two were named as V group and T group respectively. Each group is further divided into two subgroups, and the plasmid DNA of 1×107 power copies added to N501Y mutant (m) and wild type (w) is used as the amplification template, which are named Vm, Vw, Tm in turn. , Tw group. Each group is divided into three PCR reactions, and each qPCR system (25 μL) contains: 2×Premix 12.5uL, F2 primer 0.5uL, F3 primer 2uL, R1 primer 2uL, P1 probe 1uL, P2 probe 1uL, In addition to 1uL of plasmid DNA, 2uL, 1uL, and 0uL of F1 were added to the three PCR reactions, respectively, and made up to 25uL with water. According to the different amplification reagents, templates, and the amount of F1 added, each tube is named Vm2, Vm1, Vm0, Vw2, Vw1, Vw0, Tm2, Tm1, Tm0, Tw2, Tw1, Tw0. In addition, there are two reaction systems except that no plasmid DNA is added, and the other components are the same as Vm2 and Tm2, named V-2 and T-2, as blank controls. Since AceQ Universal U+Probe Master Mix has been premixed with unknown concentration of RoxII, and Premix Ex Taq ^TM (Probe q-PCR) needs to add RoxII by itself, in order to make the amplification curve ΔRn value of group V and group T similar, we conducted a pre-experiment , 0.15uL of 50×Rox II included in the kit added in group T. The qPCR is run on the ABI 7500Fast Dx qPCR instrument. The set fluorescent signal type is consistent with the fluorescent signal type on the probe. The operating program is: denaturation at 95°C for 3 minutes, and then 40 cycles include: 95°C for 15 seconds, 60°C for 45 seconds And collect fluorescence at this stage.

1.4 Amplification curve test

To test the standard curve of the AS-qPCR method, use AceQ Universal U+Probe Master Mix V2 (Vazyme, Cat#Q513-02) reagent, and use different concentrations of N501Y mutant (m) and wild-type (w) plasmids as detection objects , for qPCR detection. The plasmid concentration used was 10-fold dilution from 1×108 copies/uL to 1×101 copies/uL. Each experiment was repeated for three tubes. The operating apparatus and procedures are the same as the above experiments.

1.5 Sensitivity test for mutations

Add the mutant plasmids to 1×10 7copies/μL and 1×105 copies/μL wild-type plasmids, and configure the proportions of mutant plasmids to be 100%, 50%, 10%, and 5% respectively. , 1%, 0.5%, 0.1%, 0% of mixed plasmids. Using AceQ Universal U+Probe Master Mix V2 (Vazyme, Cat#Q513-02) reagent, at the above two concentrations, the N501Y mutant (m) plasmid with different content was used as the detection object for qPCR detection. Each experiment was repeated for three tubes. The operating apparatus and procedures are the same as the above experiments.

1.6 Mutation specificity analysis

In the amplification system described in 1.4, human genomic DNA (20ug/mL), human original saliva, and 1uL of 8copies/μL puc57 plasmid of 1×10 were used to amplify instead of wild-type or mutant plasmids. Each experiment was replicated with 2 tubes. The operating apparatus and procedures are the same as the above experiments.

2 test results

2.1 Test results of the amplification system

AceQ Universal U+Probe Master Mix V2 reagent has a good ability to distinguish between wild-type and mutant plasmids. From the amplification curve triggered by the internal reference probe, adding 1uL or 2uL F1 probe, no matter for the wild-type plasmid or the mutant plasmid, there are similar amplification curves. If F1 is not added, none of the internal reference amplification curves exceeds the fluorescence detection threshold. From the amplification curve (Fam fluorescence) triggered by the accessory probe on the extension component, when F1 is not added, the Ct value of the mutant plasmid is 24.7, and the Ct value of the wild-type plasmid is 34.1; when the added F1 is 1uL , the Ct value of the mutant plasmid was 24.8, and the Ct value of the wild-type plasmid was 37.1; when the added F1 was 2uL, the Ct value of the mutant plasmid was 25.5, and the Ct value of the wild-type plasmid was lower than the detection threshold of the fluorescence signal .

2.2 Amplification curve

The mutant plasmid was amplified, and the amplification curve was as shown in FIG. 8 . We diluted 1×10 8 copies of the plasmid by 10 times, and 1×10 4 copies could be detected under the above conditions. The amplification curve obtained after 10-fold dilution of the mutant plasmid was used as a standard curve. The slope of the internal reference standard curve was -4.3594, the linear correlation coefficient was 0.9968 for R2, and the longitudinal intercept was 53.959. The slope of the epitaxial component standard curve is -4.042, the linear correlation coefficient is R2 is 0.9964, and the longitudinal intercept is 53.745 (Fig. 9).

The wild-type plasmid was amplified, and its amplification curve is shown in FIG. 10 . We diluted 1×10 8 copies of the plasmid by 10 times, and under the above conditions, the amplification signal of the internal reference could be detected at 1×10 4 copies. It can be seen from the figure that when the number of wild-type plasmids added to the amplification system is 1×108 copies, the Ct value of the amplification curve of the specific component is greater than 37, and the curve is not smooth. The amplification curve obtained after 10-fold dilution of the wild-type plasmid was used as a standard curve. The slope of the internal reference standard curve was -3.6049, the linear correlation coefficient was R2=0.9956, and the vertical intercept was 50.154 (Fig. 11).

2.3 Mutation Sensitivity Test Results

As shown in Figure 12, the mutation rate can be detected in the wild-type plasmid background of 1×108 copies of less than 0.25%. The logarithm of the number of mutant plasmids contained in the wild-type plasmid was used to make a standard curve. The slope of the internal reference was -4.302, the linear correlation coefficient was R2=0.9905, and the longitudinal intercept was 50.69 (Fig. 13). As shown in Figure 14, the mutation rate can be detected in the wild-type plasmid background of 1×106 copies of less than 2%.

2.4 Mutation specificity analysis

Using human genomic DNA, human saliva, and puc57 plasmid as templates, the Ct value of the amplification curve was greater than 37 (Figure 15).

In experiments that attempt to incorporate the mismatch principle into qPCR, typical AS-PCR protocols that introduce probes. The method is to design upstream and downstream primers, in which the end of one primer matches the mutation site and introduces an intentional mismatch, and a probe is placed in the middle of the amplification product. The fluorescence of the probe degradation reflects the amount of product amplification, while the product amplification Increment reflects the degree of matching between primers and templates and the ratio of mutations. From a theoretical point of view, the problem with this method is that, on the one hand, due to the mismatching of the primers, the amplification efficiency is reduced, and even the amplification fails; The template still has a weak amplification ability, and the mismatched primers lose the ability to specifically recognize the amplified product, resulting in the rapid accumulation of non-specific amplified products and the rapid rise of the amplification curve, resulting in a decrease in the specificity of detection.

The detection scheme we use is a modification based on the non-quantitative AS-PCR mode of the classic four primers or three primers, and the detection probe is designed outside the amplified region to indicate within the amplified region The method of product growth rate. Specifically, the middle mismatched primer is extended outward from the 5' end, and the accessory probe and accessory primer are designed on the extended fragment, so that the probe is located outside the amplification target region and can reflect the amplification region. effect of internal amplification. Since the extension sequence can be designed almost arbitrarily, not only can it easily avoid the sequence identity with the outer amplification product, but more importantly, when we use the same pattern to detect another mutation site, we only need to replace the upstream primer, downstream The part of the primer and specific primer that matches the target region, while retaining the extended part of the 5' end of the accessory probe, accessory primer and specific primer, thereby realizing the repeated use of accessory primers and accessory probes, saving expensive new Probe synthesis costs.

Whether it is seen from the experimental results or theoretically, this unidirectional extension probe qPCR detection system containing F1 primers is better than the previous scheme that does not contain F1 primers but directly uses specific primers and downstream primers for amplification. , with better specificity. We conclude that the unidirectional epiprobe qPCR assay provides good discrimination of point mutations at relatively high concentrations of F1 primers using probe-based qPCR reagents without 3'-5' exonuclease activity ability.

The ability of the unidirectional epitaxial probe qPCR detection system to detect SNV has been further confirmed through experiments such as concentration amplification curve, mutation sensitivity test, and mutation specificity analysis. Therefore, we believe that the unidirectional epitaxial probe qPCR detection system has great potential in the detection of SNV, especially in detection scenarios with a low mutation ratio, such as the detection of gene mutation sites in cancer tissues and the detection of viral drug resistance sites. better application value.

Embodiment 2 Detection of Multiple SNPs

We plan to develop c.-3279T>G and c.1091C>T detection methods on UGT1A1 based on the bidirectional epitaxial probe qPCR detection system to prove the effectiveness of the bidirectional epitaxial probe qPCR detection system in SNP detection and the fluorescent probe Multiplexability in detecting different SNPs.

1 Materials and methods

1.1 Subjects under inspection

Peripheral blood samples from 22 neonates, aged 0-1 years, all came from the Neonatology Department of Shanghai Children's Hospital. The sample acquisition has obtained the informed consent of the legal representative or family members.

1.2 Sanger sequencing

By amplifying the UGT1A1 exon, c.-3279T>G attachment region, and then performing Sanger sequencing, the variation of the subject's UGT1A1 gene was detected.

1.3 Design of primers and probes for two-way epitaxial probe qPCR detection system for detection of two SNPs

The specific primers and outer primers used for c.-3279T>G site detection on UGT1A1 are:

Ug3279-Fn:

5'-ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtCCTTTGATGTTCCTCAAATTGCTTTGTTTAA-3'

Ug3279-Rn:

5'-ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactGTAAGCTGGCCAAGGGTAGAGTTCAATG-3'

Ug3279-Fo:5'-CTCTGCCTCTCTACCCTCTAGCCATTCT-3'

Ug3279-Ro:5'-CCTCTAGTTACATAACCTGAAACCCGGA-3'

UGT1A1: The specific primers and outer primers used for c.1091C>T site detection are:

Ug1091-Fn:

5'-ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtTCCTCCCTATTTTGCATCTCAGGTCAACC-3'

Ug1091-Rn:

5'-ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactATGGGTGATAAAGGCACGGGTCAGCA-3'

Ug1091-Fo:5'-CTTCTGCAAATTTCTGCAAGGGCATGTG-3'

Ug1091-Ro:5'-TCCAGAACATTCAGGGTCACTCCAGCTC-3'

The two accessory probes shared by the two sites are:

General-Fam: 5'-FAM-agcttccgattagggattctccatg-MGB-3'

General-Vic: 5'-VIC-gcacaccgttgactgcttatgac-MGB-3'

The accessory primers shared by both loci are:

General-F: 5'-ATCTCCGTTCCTAAGGTTGGA-3'

1.4 qPCR

In order to detect c.-3279T>G on UGT1A1 in 15 DNA samples, a 20uL amplification system was used, including: AceQ Universal U+Probe Master Mix V2 (Vazyme, Cat#Q513-02) 10 microliters, Ug3279-Fn 0.5uL, Ug3279-Rn 0.08uL, Ug3279-Fo 2uL, Ug3279-Ro 2uL, General-Fam 1uL, General-Vic 1uL, General-F 2uL, Human Genomic DNA 1uL, add water to make up 20uL. qPCR is run on the ABI 7500Fast Dx qPCR instrument, and the set fluorescent signal type is consistent with the fluorescent signal type on the probe. The operating program is: denaturation at 95°C for 3 minutes, and then 40 cycles include: 95°C for 15 seconds, 60°C for 45 seconds And collect fluorescence at this stage.

To detect c.1091C>T on UGT1A1 in 7 DNA samples, a 20uL amplification system was used, including: AceQ Universal U+Probe Master Mix V2 (Vazyme, Cat#Q513-02) 10 microliters, Ug3279-Fn 0.5 uL, Ug3279-Rn 0.5uL, Ug3279-Fo 2uL, Ug3279-Ro 2uL, General-Fam 1uL, General-Vic 1uL, General-F 2uL, Human Genomic DNA 1uL. The qPCR is run on the ABI 7500 Fast Dx qPCR instrument. The set fluorescent signal type is consistent with the fluorescent signal type on the probe. The operating program is: denaturation at 95°C for 3 minutes, and then 40 cycles including: 95°C for 15 seconds, 60°C for 45 sec and collect fluorescence at this stage.

2 results

2.1 Sanger sequencing results

The sequence map of c.-3279T>G on UGT1A1, the three selected samples were TT, TG, GG types from top to bottom. Because the sequencing results are displayed in a reverse complementary manner, AA, AC, and CC are presented (Figure 16).

On the c.1091C>T sequence map of UGT1A1, the three selected samples were CC, CT, and TT types from top to bottom (Figure 17).

2.2 qPCR results

The c.-3279T>G epitaxial qPCR amplification curve on UGT1A1, the three selected samples are TT, TG, GG types from left to right. The qPCR results were consistent with the sequencing results (Figure 18). The 15 samples were divided into three groups according to the c.-3279T>G genotype, and the amplification curves of each group were superimposed on each other. The results are shown in FIG. 19 . c.1091C>T qPCR amplification curve on UGT1A1, the three selected samples are TT, CT, CC types from left to right. The qPCR results were consistent with the sequencing results (Figure 20). The 7 samples were divided into three groups according to the c.1091C>T genotype, and the amplification curves of each group were superimposed on each other, and the results are shown in Figure 21.

Based on the bidirectional epitaxial probe qPCR detection system, the c.-3279T>G and c.1091C>T detection methods on UGT1A1 were developed, and the detection results were consistent with the sequencing results, proving that the bidirectional epitaxial probe qPCR detection system is effective in SNP detection of. The detection of two sites uses different amplification products and the same fluorescent probe, which proves that the bidirectional epitaxial probe qPCR detection system can realize the reusability of fluorescent probes when detecting different SNP sites.

The amplification curves of different samples are very similar, indicating that using different concentrations of DNA (when performing quantitative PCR, the consistency adjustment of sample DNA concentration was not performed), similar amplification curves can be obtained when the genotype is the same, and are not affected by other factors. The effect of is small, so this method is suitable for detecting SNPs.

At the same time, we should also see that compared with the detection of the new coronavirus N501Y, when c.-3279T>G is TT homozygous, the signal of G also has an amplification curve, and vice versa. This may be due to the fact that we did not adjust the annealing temperature, primer concentration, etc. However, for SNP typing, it is not necessary to make the corresponding probe completely have no amplification signal when the allele does not exist.

For two allele types of a SNP, the Tm values of the two probes may be different. When the Tm value difference is too large, the amplification curve will deviate from the preset result: when a certain allele is completely missing, there is still an overly strong amplification curve signal. At this time, adjust the concentration of the primers of the two alleles to obtain the desired effect.

All in all, in terms of SNP detection, the bidirectional epitaxial probe qPCR detection system is a cheaper and more accurate detection method than the TaqMan probe qPCR method.

Example 3 Detection of colorectal cancer-related BRAF gene

We intend to develop a colorectal cancer-related BRAF gene Exon 15 site detection kit based on the extension probe qPCR detection system to prove the effectiveness of the extension probe qPCR detection system.

1. Materials and methods

For the nearby sequence of BRAF gene Exon 15:p.V600E (1799T>A):

TTGACTCTAAGAGGAAAGATGAAGTACTATGTTTTAAAGAATATTATATTACAGAATTATAGAAATTAGATCTCTTACCTAAACTCTTCATAATGCTTGCTCTGATAGGAAAATGAGATCTACTGTTTTCCTTTACTTACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAG[T/A]GAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGTAAGAATTGAGGCTATTTTTCCACTGATTAAATTTTTGGCCCTGAGATGCTGCTGAGTTACTAGAAAGTCATTGAAGGTCTCAACTATAGTATTTTCATAGTTCCCAGTATTCACAAAAATCAGTGTTCTTATTTTTTATGTAAATAGATTTTTTAACTTTTTTCT(SEQ ID NO 20)，设计引物和探针，其包括：

Upstream inner primer (T allele):

ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtAATAGGTGATTTTGGTCTAGCTACGGT (SEQ ID NO 21);

Downstream inner primer (A allele):

ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactACCCACTCCATCGAGATTCCT (SEQ ID NO 22);

Upstream outer primer: 5'-92AATGCTTGCTCTGATAGGAAAATGA-3' (SEQ ID NO 23);

Downstream outer primer: 5'-332AGTAACTCAGCAGCATCTCAGGG-3' (SEQ ID NO 24);

Upstream medial probe: General-Vic: 5'-VIC-gcacaccgttgactgcttatgac-MGB-3';

Downstream medial probe: General-Fam: 5'-FAM-agcttccgattagggattctccatg-MGB-3';

The sequence of the accessory primer is: General-F: 5'-ATCTCCGTTCCTAAGGTTGGA-3'.

Using the qPCR reagents and methods described in Example 1, the amplification curve test and mutation sensitivity test were carried out, and the BRAF gene V600E standard product (1799T>A) (article number-specification: CW2767S-1μg Hangzhou Nuoyang Biotechnology Co., Ltd.) was used as the template.

2 test results

The test results show that the detection effect of the reagent on the BRAF gene Exon 15:p.V600E (1799T>A) site is consistent with the detection effect on the new crown mutation site in Example 1.

The above related descriptions and descriptions of the embodiments are intended to facilitate the understanding and application of the present invention by those of ordinary skill in the technical field. It is obvious that those skilled in the art can easily make various modifications to these contents, and apply the general principles described here to other embodiments without creative efforts. Therefore, the present invention is not limited to the above relevant descriptions and descriptions of the embodiments. According to the disclosure of the present invention, improvements and modifications made by those skilled in the art without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

A SNV epitaxial probe type qPCR detection method, characterized in that it includes a primer and probe design pattern, the pattern includes a set of epitaxial components and a downstream primer;

Wherein the extension components include extension primers, accessory primers, and accessory probes;

In addition to the region where the 3' segment binds to the template, the extension primer extends an artificial sequence outward at the 5' end, and the artificial sequence is divided into a 5' segment and a 3' segment according to the relative position;

The so-called accessory primer is a primer that can be reverse complementary to the reverse complementary sequence of the 5' segment of the artificial sequence;

The so-called accessory probe is a probe with a luminescent group and an extraction group that can be reverse complementary to the reverse complementary sequence of the 3' segment of the artificial sequence;

The so-called downstream primers refer to primers that form a pair of upstream and downstream primers with the extension primers, and can perform PCR amplification on the template in a normal PCR system;

During the PCR amplification process, the downstream primer binds and extends the single strand following the extension product of the extension primer, which can be used as the binding object of the accessory primer and accessory probe, and initiates qPCR amplification;

This kind of primer and probe design mode in which the probe is designed in the extended region of the 5' end of the primer to start the probe-type qPCR is called extension probe-type qPCR.
The epitaxial probe formula qPCR detection method of SNV according to claim 1 is characterized in that, on the basis of a group of epitaxial components and a downstream primer included in the epitaxial probe formula qPCR method, the 3' of the epitaxial primer At the same time, by replacing the second or third base at the 3' end, the specificity of binding is improved. This primer is called specific The epitaxy primer, the epitaxy component is called the specific epitaxy component, and the method is called the specific epitaxy probe type qPCR method.
The epitaxial probe formula qPCR detection method of SNV according to claim 2, is characterized in that, in the epitaxial probe formula qPCR detection system, an outer upstream primer is designed on the upstream of the specific epitaxial primer, and the outer upstream primer and the downstream primer are On the amplified product, an internal reference probe with different fluorescence bound to the template is set in the middle of the outer upstream primer and the extension primer to indicate the amplification efficiency of the outer upstream primer and downstream primer, and the amplification efficiency is measured by the Ct value express;

By comparing the Ct value with the Ct value of the attached probe on the extension primer, the relative ratio of the corresponding genotype of the specific extension primer is calculated. This mode is called a unidirectional extension probe qPCR detection system.
The epitaxial probe type qPCR detection method of SNV according to claim 2, is characterized in that, for two allelic types of a certain SNV, two kinds of corresponding specific epitaxial groups are respectively designed on its positive strand and reverse strand points, and design outer amplification primers on the outer side respectively;

The accessory probes of the two specific epitaxial components have different fluorescence, and the relative ratio of the two genotypes of the SNV can be judged according to the amplification curves of the two kinds of fluorescence. This mode is called a two-way epitaxial probe qPCR detection system.
The epitaxial probe type qPCR detection method of SNV according to claim 2, characterized in that, for two allelic types of a certain SNV, two kinds of specific epitaxial components are designed in the same direction on its positive strand or reverse strand , compete with each other to bind to the same position, and the accessory probes of the two specific epitaxial components have different fluorescence. According to the amplification curves of the two fluorescences, the relative proportion of the two genotypes of the SNV can be judged. This scheme is called one-way Formed into an epitaxial probe qPCR detection system.
The epitaxial probe type qPCR detection method of SNV according to claim 3, characterized in that, for the detection scheme designed for the mutation site N501Y on the new coronavirus COVID-19, the presence or absence of COVID-19 and the presence of N501Y in the template are judged None and ratio; or judge the ratio of N501Y mutant plasmid to wild-type plasmid.
The epitaxial probe type qPCR detection method of SNV according to claim 4, characterized in that, for the two SNP sites c.-3279T>G and c.1091C>T on the human gene UGT1A1, different amplification methods are used. The primers and the same two universal probes can determine the genotype of the SNP by comparing the fluorescence curve of FAM with that of VIC.
The application of the epitaxial probe type qPCR detection method of SNV described in any one of claims 1-7, is characterized in that, described application includes but not limited to:

Identify the presence or absence of target SNVs;

determine the alleles of the SNV of interest; or

Determine the content or ratio of each allele of the target SNV in the sample.
The application according to claim 8, characterized in that,

When the target SNV is the new coronavirus N501Y,

The sequence of the upstream primer, N501Y-F1: 5'-ACTGAAATCTATCAGGCCGGT-3',

The sequence of the downstream primer N501Y-R1: 5'-ACAAACAGTTGCTGGTGCAT-3',

The sequence of the extension primer: N501Y-F2: 5'-ATCTCCGTTCCTAAGGTTGGACAAAGCTTCCGATTAGGGATTCTCCATGTCAATCATATGGTTTCCAACCCACCT-3',

The sequence of the accessory primer is N501Y-F3: 5'-ATCTCCGTTCCTAAGGTTGGA-3',

The sequence of the accessory probe is N501Y-P1: 5'-FAM-AGCTTCCGATTAGGGATTCTCCATG-BHQ1-3',

The sequence of the internal reference probe N501Y-P2: 5'-VIC-CTTGTAATGGTGTTGAAGGTT-MGB-3';

The N501Y refers to the mutation of amino acid residue N at position 501 of the spike protein in SARS-CoV-2 VOC 202012/01 to amino acid residue Y.
The application according to claim 8, characterized in that,

When the target SNV is c.-3279T>G of UGT1A1;

The sequence of the upstream extension specific primer is:

Ug3279-Fn:5'-ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtCCTTTGATGTTCCTCAAATTGCTTTGTTTAA-3';

The sequence of the downstream extension-specific primer is:

Ug3279-Rn:5'-ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactGTAAGCTGGCCAAGGGTAGAGTTCAATG-3',

The accessory probes are: General-Fam: 5'-FAM-agcttccgattagggattctccatg-MGB-3', and General-Vic: 5'-VIC-gcacaccgttgactgcttatgac-MGB-3',

The accessory primers are: General-F: 5'-ATCTCCGTTCCTAAGGTTGGA-3',

The upstream outer primer is: Ug3279-Fo:5'-CTCTGCCTCTTACCCTCTAGCCATTCT-3',

The downstream outer primer is Ug3279-Ro:5'-CCTCTAGTTACATAACCTGAAACCCGGA-3';

or,

The target SNV is c.1091C>T of UGT1A1,

The sequence of the upstream extension specific primer is:

Ug1091-Fn:5'-ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtTCCTCCCTATTTTGCATCTCAGGTCAACC-3',

The sequence of the downstream extension-specific primer is:

Ug1091-Rn:5'-ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactATGGGTGATAAAGGCACGGGTCAGCA-3',

The sequences of the extension-specific primers are as follows:

Ug1091-Fo:5'-CTTCTGCAAATTTCTGCAAGGGCATGTG-3';

Ug1091-Ro:5'-TCCAGAACATTCAGGGTCACTCCAGCTC-3';

The accessory probes are: General-Fam: 5'-FAM-agcttccgattagggattctccatg-MGB-3' and General-Vic: 5'-VIC-gcacaccgttgactgcttatgac-MGB-3',

The accessory primers are: General-F: 5'-ATCTCCGTTCCTAAGGTTGGA-3',

The upstream outer primer is: Ug1091-Fo:5'-CTTCTGCAAATTTCTGCAAGGGCATGTG-3';

The downstream outer primer is: Ug1091-Ro:5'-TCCAGAACATTCAGGGTCACTCCAGCTC-3'.
The application according to claim 8, characterized in that,

When the target SNV is BRAF gene Exon 15:p.V600E(1799T>A),

The sequence of the upstream inner primer (T allele):

ATCTCCGTTCCTAAGGTTGGAcaaagcttccgattagggattctccatgtAATAGGTGATTTTGGTCTAGCTACGG;

The sequence of the downstream inner primer (T allele):

ATCTCCGTTCCTAAGGTTGGAcaagcacaccgttgactgcttatgactACCCACTCCATCGAGATTCCT;

The sequence of the upstream outer primer: 5'-92 AATGCTTGCTCTGATAGGAAAATGA-3';

The sequence of the downstream outer primer: 5'-332 AGTAACTCAGCAGCATCTCAGGG-3';

The sequence of the upstream inner probe: General-Vic: 5'-VIC-gcacaccgttgactgcttatgac-MGB-3';

Sequence of downstream inner probe: General-Fam: 5'-FAM-agcttccgattagggattctccatg-MGB-3'.

The sequence of the accessory primer is: General-F: 5'-ATCTCCGTTCCTAAGGTTGGA-3'.