WO2023025899A2

WO2023025899A2 - Delivery system for targeting genes of the interferon pathway

Info

Publication number: WO2023025899A2
Application number: PCT/EP2022/073703
Authority: WO
Inventors: Eric Quemeneur; Philippe Erbs; Abdelkader MOURI; Jean-Claude Maurel; Hervé SEITZ
Original assignee: Transgene; Medesis Pharma; Centre National De La Recherche Scientifique
Priority date: 2021-08-26
Filing date: 2022-08-25
Publication date: 2023-03-02
Also published as: WO2023025899A3

Abstract

The present invention relates to specific reverse micelle system which allows the administration and intracellular delivery of unmodified oligonucleotide, such as siRNA, targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene. The reverse micelle system of the invention is thus particularly useful for the treatment of pathologies related to an overexpression of IFNAR1 gene. The reverse micelle system of the invention is also for use in combination with an oncolytic virus or composition thereof for the treatment of cancers. In particular embodiments, said cancers are resistant to oncolytic virus-based treatments and/or are characterized by an overexpression of IFNAR1 gene.

Description

Delivery system for targeting genes of the interferon pathway

FIELD OF THE INVENTION

The present invention relates to a specific reverse micelle system which allows the administration and intracellular delivery of unmodified oligonucleotide, such as siRNA, targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene. The reverse micelle system of the invention is thus particularly useful for the treatment of pathologies caused by overexpression of genes linked to the interferon pathway, with a preference for the IFNAR1 gene, as well as for the treatment of cancers in combination with oncolytic viruses.

BACKGROUND OF THE INVENTION

Interferons (IFNs) are a group of signaling proteins made and released by host cells in response to the presence of viruses. In a typical scenario, a virus-infected cell will release interferons causing nearby cells to heighten their anti-viral defenses.

IFNs belong to the large class of proteins known as cytokines, that act as molecular signals in cells to trigger the protective pathways of the immune system, and thus help combat pathogenic viruses. Interferons are named for their ability to "interfere" with viral replication by protecting cells from virus infections. IFNs also have various other functions: they activate immune cells, such as natural killer cells and macrophages; they increase host defenses by up- regulating antigen presentation by virtue of increasing the expression of major histocompatibility complex (MHC) antigens.

IFN signaling pathways are highly regulated. Host, pathogen, and environmental factors regulate the responses of cells and thus calibrate host defenses while limiting tissue damage and preventing autoimmunity. These regulatory mechanisms determine the biological outcomes of IFN responses and whether pathogens are cleared effectively or chronic infection or autoimmune disease ensues (Ivashkiv and Donlin, 2014, Nat Rev Immunol. 14, 36-49).

Based on the nature of their receptors, human interferons have been classified into three major types. • Interferon type I: All type I IFNs bind to a specific cell surface receptor complex known as the IFN-a/p receptor (IFNAR) that consists of IFNAR1 and IFNAR2 chains. IFN- a, IFN-P, IFN-s, IFN-K and IFN-co are members to type I-IFN family. In general, type I interferons are produced when the body recognizes a virus that has invaded it. They are produced by fibroblasts and monocytes. The production of type I IFN-a is counterbalanced by another cytokine known as Interleukin- 10. Once released, type I IFNs bind to specific receptors on target cells, which leads to expression of proteins that will prevent the virus from producing and replicating its RNA and DNA. Overall, IFN-a can be used to treat hepatitis B and C infections, while IFN-P can be used to treat multiple sclerosis.

• Interferon type II (IFN-y in humans): This is also known as immune interferon and is activated by Interleukin-12. Furthermore, type II interferons are released by Cytotoxic T cells and T helper cells, type 1 specifically. However, they block the proliferation of T helper cells type two. The previous results in an inhibition of Th2 immune response and a further induction of Thl immune response, which leads to the development of debilitating diseases such as multiple sclerosis. IFN type II binds to IFNGR, which consists of IFNGR1 and IFNGR2 chains.

• Interferon type III: Signal through a receptor complex consisting of IL 10R2 (also called CRF2-4) and IFNLR1 (also called CRF2-12). Although discovered more recently than type I and type II IFNs, recent information demonstrates the importance of Type III IFNs in some types of virus or fungal infections.

Another function of interferons is to up-regulate major histocompatibility complex molecules, MHC I and MHC II, and increase immunoproteasome activity. All interferons significantly enhance the presentation of MHC I dependent antigens.

Interferons can also suppress angiogenesis by down regulation of angiogenic stimuli deriving from tumor cells. They also suppress the proliferation of endothelial cells. Such suppression causes a decrease in tumor angiogenesis, a decrease in its vascularization and subsequent growth inhibition. Interferons, such as interferon gamma, directly activate other immune cells, such as macrophages and natural killer cells. The interferon-a/p receptor (IFNAR) is a virtually ubiquitous membrane receptor which binds endogenous type I interferon (IFN) cytokines. Endogenous human type I IFNs include many subtypes, such as interferons-a, -P, -a, -K, -CO, and -C,.

Interferon beta- la and interferon beta- lb are used to treat and control multiple sclerosis, an autoimmune disorder. This treatment may help in reducing attacks in relapsing-remitting multiple sclerosis and slowing disease progression and activity in secondary progressive multiple sclerosis.

Investigations of patients with systemic lupus erythematosus (SLE) have applied insights from studies of the innate immune response to define type I interferon (IFN-I), with IFN-a the dominant mediator, as central to the pathogenesis of this prototype systemic autoimmune disease. Genetic association data identify regulators of nucleic acid degradation and components of Toll-Like-Receptor-independent, endosomal Toll-Like-Receptor-dependent, and IFN-I signaling pathways as contributors to lupus disease susceptibility. Together with a gene expression signature characterized by IFN-I-induced gene transcripts in lupus blood and tissue, those data support the conclusion that many of the immunologic and pathologic features of this disease are a consequence of a persistent self-directed immune reaction driven by IFN-I and mimicking a sustained anti-virus response.

Interferon therapy is used in combination with chemotherapy and radiation as a treatment for some cancers. This treatment can be used in hematological malignancy, such as in leukemia and lymphomas including hairy cell leukemia, chronic myeloid leukemia, nodular lymphoma, and cutaneous T-cell lymphoma. Patients with recurrent melanomas receive recombinant IFN- a2b. Both hepatitis B and hepatitis C are treated with IFN-a, often in combination with other antiviral drugs.

The efficacy of several therapeutic strategies against cancer, including cytotoxic drugs, radiotherapy, targeted immunotherapies and oncolytic viruses, depends on intact type I interferon signaling for the promotion of both direct (tumor cell inhibition) and indirect (antitumor immune responses) effects. Malfunctions of this pathway in tumor cells or in immune cells may be responsible for the lack of response or resistance. Although type I IFN signaling is required to trigger anti-tumor immunity, emerging evidence indicates that chronic activation of type I IFN pathway may be involved in mediating resistance to different cancer treatments. The plastic and dynamic features of type I IFN responses should be carefully considered to fully exploit the therapeutic potential of strategies targeting IFN signaling. As an example, in melanoma and lung cancer patients, interferon signaling in tumor cells and immune cells oppose each other to establish a regulatory relationship that limits both adaptive and innate immune killing (Benci et al. 2019, Cell 178, 933-48).

In tumor cells, interferons elicit antiviral response upon binding to cell surface receptors. However, said antiviral response in the tumor microenvironment could restrict or compromise the efficacy of cancer therapies based on viruses, like oncolytic viruses.

Oncolytic viruses constitute a promising immunotherapeutic approach for treating cancers. They selectively infect and kill host dividing cells (e.g. cancer cells) as they replicate, while they leave non-dividing cells (e.g. normal cells) unharmed (de Matos et al., 2020, Mol. Ther: methods and clin dev. 17, 349-358). As the infected dividing cells are destroyed by lysis, they release new infectious particles to infect the surrounding dividing cells (Fisher et al., 2006, Curr. Opin. Mol. Ther., 8(4):301 -13). Oncolytic viruses derive from natural strains; used either as genetically unmodified isolates, or more often as genetically engineered vectors to weaken viral pathogenicity, to improve immunogenicity, and/or to insert therapeutic genes (de Matos et al., 2020, Mol. Ther: methods and clin dev. 17, 349-358).

Oncolytic virotherapy has largely progressed over the last decades, and several virus species including adenovirus, reovirus, measles, herpes simplex, Newcastle disease virus and vaccinia virus have been brought from preclinical to clinical development. Three products have received formal marketing authorization: T-Vec (Imlygic) in Europe and in the USA, Oncorine in China, Rigvir in Latvia.

Anti -tumor and antiviral immunities are inter-dependent (Gujar, et al. 2018, Trends in Immunol. 39, 209-221; de Matos et al. 2020, Mol. Ther: methods and clin dev. 17, 349-358): oncolytic viruses will act on the tumor by awaking the immune-suppressed system, while excessive stimulation of the host immune system might be detrimental for the efficacy of the cancer therapy. Thus, manipulating the host immune system to minimize the antiviral response, and viral clearance while still promoting immune-mediated anti-tumor response is the key challenge of oncolytic virotherapy (Filley and Dey, 2017, Frontiers in Oncol. 7, doi: 10.3389/fonc.2017.00106). Anti-viral response is thus a major obstacle to the efficacy of oncolytic therapy, and many authors have reported on the nature of these neutralizing mechanisms (Zheng et al., 2019, Molecular Therapy: Oncolytics Vol.15, 234-247, Harrington et al. 2019, Nature Rev. Drug Discov. 18, 686-706, Hwong et al. 2010, Viruses 2, 78-106).

A few strategies have been envisaged to suppress antiviral immunity and the emission of danger signals, including the use of immunomodulators, genetic manipulation, histone deacetylase inhibitors, antioxidant sulforaphane, cytokines, antibodies depletion and magnetic nanoparticles. These strategies hindered antiviral immunity, promoting viral replication and enhancing cytotoxicity. However, oncolytic virus-induced antiviral immune responses are also beneficial to antitumor immunity because they can overturn tumor-associated immunosuppression, home immune cells to tumors, and lead to virus-induced immunogenic cell death, thereby activating antitumor immunity. It is therefore important to develop strategies to manage antiviral immunity, to enhance antitumor immune activity, and to maintain the balance between them (Zheng et al., 2019, Molecular Therapy: Oncolytics Vol.15, 234-247).

RNAi (RNA interference) and antisense (AS) strategies consist in silencing the expression of a target gene by the use of nucleic acids which allow the degradation or the translational arrest of mRNA target. New antisense applications (exon skipping, alternative splicing correction), by masking the mutation responsible for an alternative splicing default, have permitted the synthesis of a functional protein. Aptamers are nucleic acids capable of interacting with a target protein and down regulating its synthesis. The discovery of all these nucleic acids, and more recently siRNA and miRNA, has opened wide perspectives in therapeutics for the treatment of diseases like genetic diseases, cancers, neurodegenerative diseases, infectious and inflammatory diseases or to block cell proliferation and diseases caused thereby.

However, these molecules are unstable in biological fluids, in vitro and in vivo, they display a poor intracellular penetration and low bioavailability. These critical drawbacks have limited their use in therapeutics. As a result, clinical applications of said nucleic acids have required chemical modifications with the aim of retaining their capacity to knockdown protein expression while increasing stability and cellular penetration. Research groups have also applied the nanotechnology approach to improve their delivery, to overcome most barriers that hampered the development of nucleic acids delivery -based therapies. To improve bioavailability, many researchers have also attempted to use alternative administration routes: ocular, skin, oral, intramuscular. Those attempts have not been totally satisfactory so far. For instance, some of these attempts, more specifically assays with nucleic acids in liposome carriers have stimulated immune response.

SUMMARY OF THE INVENTION

The invention provides a therapeutic strategy for the treatment of pathologies related to an overexpression of genes linked to the interferon pathway, with a preference for the IFNAR1 gene, as well as for the treatment of cancers in combination with oncolytic viruses (e.g. cancers resistant to oncolytic virus-based therapy, and/or cancers overexpressing genes linked to the interferon pathway, with a preference for the IFNAR1 gene). More particularly, it is an object of the invention to provide a drug delivery system comprising an unmodified oligonucleotide (e.g. siRNA) targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene, which can be for instance administered via buccal mucosa, giving rise to a satisfactory drug bioavailability in an active form. More particularly, it is an object of the invention to provide a combination of a drug delivery system comprising an unmodified oligonucleotide (e.g.: siRNA) targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene with an oncolytic virus (e.g.: poxvirus or Vaccinia Virus).

According to a first aspect, the present invention relates to a reverse micelle system comprising at least one sterol, acylglycerol, phospholipid, an alcohol, and at least one unmodified oligonucleotide targeting genes linked to the interferon pathway, with a preference for IFNAR1 gene.

According to advantageous and non-limiting features:

Said micelles of the reverse micelle system present aqueous cores of around 4 nm, preferably from 3 to 5 nm, more preferably from 3.5 to 5 nm, in particular from 3.7 to 4.5 nm.

Said acylglycerol of the reverse micelle system presents the following formula (I):

in which: - R1 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, a hydrogen atom, or a mono-, di- or tri-galactose or glucose;

- R2 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 2 and 18 carbon atoms;

- R3 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, or a hydrogen atom.

Said at least one sterol is sitosterol, and/or phospholipid is lecithin, and/or alcohol is ethanol, and/or acylglycerol is glycerol monooleate.

Said unmodified oligonucleotides of the reverse micelle system are selected in the group consisting of antisense oligonucleotides, short interfering nucleic acid (siNA), short interfering RNA (siRNA), short interfering nucleic acid molecule, short interfering oligonucleotide molecule, miRNA, micro-RNA, guide RNA (gRNA), short guide RNA (sgRNA) of a CRISPR system, short hairpin RNA (shRNA) and a mixture thereof.

Said unmodified oligonucleotides of the reverse micelle system are at least 10, 15, 20 or 25 nucleotides (nt) long, more preferably in the range of 19 to 25 nucleotides long, or typically 19, 20, 21, 22, 23, 24 or 25 nt long.

Said unmodified oligonucleotides of the reverse micelle system are synthetic RNA duplexes comprising or consisting of two unmodified 21-mer oligonucleotides annealed together to form siRNAs.

Said siRNA of the reverse micelle system comprises, or consists of, one of the following duplexes: siRNA- 1

Guide strand: 5’ P-UUAUCUUCAGCUUCUAAAUGUA 3’ (SEQ ID NO : 1)

Passenger strand: 3’ UUCAUAGAAGUCGAAGAUUUAC 5’ , which, read in the 5’ to 3’ sense, is listed as SEQ ID NO: 2 (5’ CAUUUAGAAGCUGAAGAUACUU 3’) siRNA-2

Guide strand: 5’ P-UUUAUCUUCAGCUUCUAAAUG 3’ (SEQ ID NO: 3) Passenger strand: 3’ UUCAAUAGAAGUCGAAGAUUU 5’, which, read in the 5’ to 3’ sense, is listed as SEQ ID NO: 4 (5’UUUAGAAGCUGAAGAUAACUU 3’) siRNA-3

Guide strand: 5’ P-ACAGUAAGUAGUCUCUGGUGA 3’ (SEQ ID NO: 5)

Passenger strand 3 ’ UUGGUCAUUCAUCAGAGACC A 5 ’ , which, read in the 5 ’ to 3 ’ sense, is listed as SEQ ID NO: 6 (5’ACCAGAGACUACUUACUGGUU 3’)

The appended sequence listing in the ST.26 format shows all RNA sequences with a T nucleotide in lieu of the U nucleotides.

Said siRNA of the reverse micelle system comprises, or consists of siRNA-1.

Said siRNA of the reverse micelle system comprises, or consists of siRNA-2.

Said siRNA of the reverse micelle system comprises, or consists of siRNA-3.

According to a further aspect, the present invention relates to a method for the preparation of a reverse micelle system as defined in any one of the preceding claims, wherein it comprises the following steps:

(a) Contacting (i) sterol, (ii) acylglycerol, preferably diacylglycerol of fatty acids, (iii) phospholipid, preferably phosphatidylcholine, (iv) alcohol, (v) water, preferably purified water, and (vi) at least one unmodified oligonucleotide capable of targeting the IFNAR1 gene,

(b) Stirring mixture obtained in step (a), at 40 °C or less, and for a time sufficient to obtain formation of reverse micelles, said stirring being carried out mechanically.

According to another aspect, the present invention relates to a pharmaceutical composition comprising a reverse micelle system and at least a pharmaceutically acceptable carrier, excipient or support. In a preferred embodiment, said pharmaceutical composition is administered by buccal route. .

According to another aspect, the present invention relates to a reverse micelle system or a pharmaceutical composition for use for the treatment of pathologies related to the overexpression of one or more genes linked to the interferon pathway, with a preference for IFNAR1 gene. The present reverse micelle system or pharmaceutical composition is also useful for treating an infection, a cancer and an autoimmune and/or inflammatory disease. In a preferred embodiment, said pathologies are systemic lupus erythematosus or cancers overexpressing IFNAR1 gene.

According to still another aspect, the present invention relates to a reverse micelle system or a pharmaceutical composition for use in combination with an oncolytic virus or a composition thereof for the treatment of cancers.

According to advantageous and non-limiting features:

Said oncolytic virus may be a poxvirus, preferably a Vaccinia virus, more preferably defective for thymidine kinase (TK) activity and/or ribonucleotide reductase (RR) activity.

Said cancer may be resistant to oncolytic virus-based treatment, more particularly to poxvirusbased treatment, even more particularly to vaccinia virus-based treatment.

Said cancer is preferably characterized by an overexpression of one or more genes linked to the interferon pathway, with a preference for IFNAR1 gene.

Said oncolytic virus or composition thereof may be administered e.g. by intratumoral, intravenous or intramuscular route.

It is further provided method for treating cancer in a subject in need thereof comprising the administration to the subject of a therapeutically effective amount of reverse micelle system or comprised in a pharmaceutical composition, and the administration of an oncolytic virus or composition thereof.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1: Western blot detection of IFNAR1 protein expression in CT26 cells 24 and 48 hours after transfection with siRNA- 1, siRNA-2, siRNA-3, a mix of the 3 siRNAs (siRNAmix) and non-targeting control siRNA (siRNAc). Molecular weight standards are shown in kDa (M). The presence of IFNAR1 (~70 kDa) is indicated (arrow).

Figure 2: In vivo antitumor activity of oncolytic vaccinia virus combined with formulated siRNAs directed against IFNAR1. From day 4 to day 12 post-tumor inoculation, mice bearing CT26 subcutaneous tumors were treated through the buccal mucosa by formulated siRNA- 1, siRNA-2, siRNA-3, a mix of the 3 siRNAs (siRNA mix) and non-targeting control siRNA (siRNAc). On days 7, 9 and 11 post-tumor inoculation, mice were injected intratumorally with VVTG18058, an oncolytic vaccinia virus defective in thymidine kinase (TK) and ribonucleotide reductase (RR) activity. Results are represented as the mean tumor size (A) or as survival percentage (B). The data represent the mean of 10 animals per group. *p < 0.05, ns: non-significant.

Figure 3 is a schematic of siRNA structures used in the invention.

DETAILED DESCRIPTION OF THE INVENTION

Reverse micelles

The reverse micelle system according to the invention is characterized as a micro-emulsion comprising a dispersion of water-nanodroplets in oil. The dispersion is stabilised by two surfactants (acylglycerol, more preferably a diacylglycerol of fatty acids and a phospholipid, more preferably phosphatidylcholine) and a co-surfactant (alcohol) that are most likely at the water/oil interface. The reverse micelle phase can be defined as a system wherein water forms the internal phase and the hydrophobic tails of the lipids form the continuous phase. Reverse micelles containing oil(s), surfactant(s), co-surfactant(s), and an aqueous phase are also characterized as water-in-oil micro-emulsions.

Generally, the size of micelles according to the invention is very small, more particularly, it is less than 10 nm; more specifically it is less than 8 nm and more preferably less than 5 nm. The size may vary with the quantity of added water and phospholipid. The present invention relates more particularly to reverse micelles with an aqueous core of 3 to 5 nm, preferably from 3.5 to 5 nm, in particular from 3.7 to 4.5 nm.

The reverse micelles and the size of their aqueous core can be characterized by various methods, including:

Small Angle X-Ray Scattering (SAXS)

- Neutrons Scattering

Transmission Electron Microscopy (TEM)

- Dynamic Light Scattering (DLS)

The ratios of the lipidic constituents (including sterol, acylglycerol and phospholipid) in the reverse-micelle system according to the invention can vary. For instance, the weight ratio sterol/acylglycerol can range from 0.015 to 0.05, more particularly from 0.03 to 0.04. The weight ratio phospholipid/acylglycerol is from 0.06 to 0.25. For the calculation of these ratios, the weight of phospholipid corresponds to the total weight of the mixture of phospholipids, for instance the weight of lecithin, used in the formulation.

The compounds of the reverse-micelle system can be analysed by appropriate means. More specifically, sterols can be identified by gas chromatographic analysis and acylglycerol by high- performance liquid chromatography (HPLC), in particular with a light scattering detector, on a silica column (kromasil Cl 8), in the presence of an eluent, e.g. isocratic acetonitrile. Gas chromatography can also be used to analyse diacylglycerols. Phospholipids can be analysed by high-performance liquid chromatography (HPLC), with a diol column with a light scattering detector.

Reverse micelles are dynamic systems. Brownian motion causes perpetual collisions of micelles, which lead to coalescence of micelles and exchange of the aqueous cores. Separation and regeneration of micelles occur and allow chemical reactions between different solutions. The exchange rate between micelles increases in particular with temperature, the length of hydrocarbon chains of the surfactant, and the water/surfactant ratio. Within the context of the invention and contrary to what is expected in nanotechnology, aqueous cores of micelles must have a specific size allowing one or more molecules of unmodified oligonucleotide, in particular nucleic acid capable of mediating RNA interference, to be stabilised in the prepared micelles. As mentioned above, the size of the aqueous core is around 4 nm, preferably from 3 to 5 nm, more preferably from 3.5 to 5 nm, in particular from 3.7 to 4.5 nm.

Without being bound to any theory, it seems that inclusion of a phospholipid in the reverse micelle system allows formation of micelles with greater diameter and volume, thus allowing vectorization of greater quantities of oligonucleotide.

In addition, it seems that, when applied to mucosa tissue, the reverse micelle system triggers formation of lipoproteins that cross the cellular membrane and allow delivery of the oligonucleotide, in particular the nucleic acid capable of modulating gene expression of IFNAR gene into the cells.

After the deposition of the micro emulsion on the buccal mucosa (or rectal mucosa) in the subject, the Brownian dynamics of the reverse micelles promotes intramucosal penetration into the intercellular spaces, and in contact with the apoproteins present physiologically in the mucosa, there takes place a structure in lipoproteins vHDL and HDL.

Oligonucleotides must be perfectly soluble in water, so as not to interfere with the water/oil interface of the reverse micelles according to the invention.

An amphiphilic molecule modifies the water solubility in the nano micelles, interferes with the interface and removes the fluidity of the permanent Brownian-like motions of the micelles which is necessary for their passage in the mucosa and their absorption through the structuration in lipoproteins.

The oligonucleotides described in the present invention are necessarily unmodified in order to be perfectly water-soluble.

Accordingly, the invention ensures absorption of the compounds to be delivered across mucosa, preferably across mouth, nasal and/or rectal mucosa, more preferably across mouth mucosa. Also, reverse micelles of the present invention provide an important bioavailability with low variability of absorption.

Method for preparing reverse micelles

In a particular embodiment, the invention relates to a method for preparing reverse micelles as defined above (involving more specifically at least one unmodified oligonucleotide targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene, a sterol, an acylglycerol, a phospholipid, an alcohol, and water), wherein said method comprises the following steps:

(a) Contacting (i) sterol, (ii) acylglycerol, preferably diacylglycerol of fatty acids, (iii) phospholipid, preferably phosphatidylcholine, (iv) alcohol, (v) water, preferably purified water, and (vi) at least one unmodified oligonucleotide capable of targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene,

The obtained and recovered reverse micelles are then particularly useful as a delivery system for unmodified oligonucleotides. Step (b) of the process is of particular importance since it allows reverse micelles to be obtained, said reverse micelles being then useful as a transport system to deliver unmodified oligonucleotides directly into the cytoplasm of all cells in all tissues and organs, through the cell membrane lipoprotein receptors.

In a particular embodiment, the unmodified oligonucleotide is first solubilised in water, preferably purified water, to form an aqueous phase. Said aqueous phase is then introduced into the oily phase (according to step(a)). The oily phase preferably comprises at least a sterol, an acylglycerol, a phospholipid and an alcohol.

The compounds involved in step (a) will be described in more details below.

Stirring of the mixture obtained by step (a) is carried out at a temperature less than or equal to 40°C, preferably ranging from 15 °C to 40°C, more preferably from 25 °C to 37 °C, for a time sufficient to form of reverse micelles. The time sufficient can vary in particular upon the used stirring techniques, i.e., mechanical stirring. The time of mechanical stirring is more specifically the time needed to convert the initial mixture into a visually transparent reverse micelle solution.

One skilled in the art knows how to select excipients or components that may be used along with the composition according to the present invention in order to keep their beneficial properties. In particular, the presence of glycerol can, when introduced in large amount, prevent the formation of reverse micelles or break the reverse micelle system. More specifically, no more than 2.5%, and preferably no glycerol (percent expressed by weight of glycerol / weight of acylglycerol) is used for the preparation of the reverse micelles of the present invention.

Other compounds can be introduced in step (a). One can cite for instance colouring agents and/or flavouring substances.

In an advantageous manner, the compounds cited above or the commercially available mixtures containing them are the only ingredients introduced to prepare the micelle system and consequently the only ones present in the micelle system of the invention.

Physical parameters, in particular time- for instance comprised between 3 and 5 minutes, in one or several times-, are dependent on the used material, volumes of the mixture and viscosity thereof. One skilled in the art can readily define such parameters. Temperature of the mixture is less than 40°C. Such a temperature avoids degradation of the reactants. Temperature is preferably ranging from 30 °C to 38 °C, more preferably from 30 °C to 35 °C. The usual materials use propellers whose fast movements generate turbulences and swirls allowing interpenetration of particles and formation of reverse micelles within the mixture.

Stirring speed is preferably ranging from 100 to 2 000 r/minute, more preferably from 300 to 700 r/minute. The implemented volumes, device, and stirring speed depend on and should be adapted with the reactants and amounts thereof.

As described above, temperature of the mixture must not exceed 40°C. Temperature is preferably ranging from 15 °C to 40 °C, more preferably from 25°C to 37 °C.

REVERSE MICELLES COMPOUNDS

ACYLGLYCEROL

Acylglycerols, more particularly acylglycerols of fatty acids, useful for the preparation of the reverse-micelle system according to the invention can be isolated from the majority of animals and more preferably plants.

Acylglycerols can include mono- and diacylglycerols. In a particular embodiment, mono- or diacylglycerols preferentially used in the present invention present the following formula (I):

in which:

- Ri is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, a hydrogen atom, or a mono-, di- or tri-galactose or glucose;

- R3 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, or a hydrogen atom. According to a particular embodiment, Ri or R3, preferably only one of Ri and R3, in particular only Ri, represents an acyl residue of oleic acid (Cl 8: l[cis]-9), including in particular glycerol monooleate.

According to a particular aspect, R2 has one unsaturated bond (e.g., ethylenic bond) and has advantageously 18 carbon atoms, preferably R2 is an oleic acid residue (oleoyl group), one of its positional isomers with respect to the double bond (cis-6,7,9,11 and 13) or one of its isobranched isomers.

According to another particular aspect, Ri represents an oleoyl group.

According to another particular aspect, R2 represents an acetyl group.

According to another particular aspect, R3 is a hydrogen atom.

As a general rule, oil containing a high concentration of oleic acid will be chosen as a useful source of acylglycerols according to the invention. Such oil usually contains a high proportion of acylglycerols useful according to the invention.

According to a particular aspect of the invention, the preferred diglycerols of fatty acids are selected in the group consisting of 1,2-di olein and l-oleoyl-2-acetyl glycerol.

A certain number of them, and more particularly those which are found to be the most active in the applications sought after, are also available commercially. This is the case particularly for l-oleoyl-2-acetylglycerol and 1,2-di oleoylglycerol, which exist as commercial products with a high purity content. In particular, glycerol monooleate containing about 44 % of dioleic glycerol, from which about 14 % is 1,2-diolein. Such a compound is pharmaceutically accepted (European Pharmacopeia (4^th Edition), USP 25/NF20, and Japanese Standard of food Additives). Such product is for instance commercially available by Gattefosse Company under the name PECEOL®.

The acylglycerols are preferably incorporated or comprised in the composition or reversemicelle system in an amount by weight ranging from 50 g to 90 g with respect to 100 g of the total weight of the composition or reverse-micelle system according to the invention. The amounts specified herein will be adapted with respect to the other compounds as to correspond more specifically to the weight ratios identified below. STEROLS

The sterols useful for the preparation of the reverse-micelle system according to the invention are preferably natural sterols, such as cholesterol or phytosterols (vegetable sterols). Sitosterol or cholesterol are the preferred sterols useful for the reverse-micelle system according to the invention.

Sitosterol and cholesterol are commercially available. More particularly, commercial sitosterol which is extracted from soya can be used. In such a product, the sitosterol generally represents from 50 to 80% by weight of the product and is generally found in a mixture with campesterol and sitostanol in respective proportions in the order of 15% each. Commercial sitosterol which is extracted from a variety of pine called tall oil can also be used. In general, it will be possible to use sitosterol in mixture with sitostanol. Preferably, said mixture comprises at least 50% sitosterol by weight of the mixture.

As mentioned above, the ratios of the lipidic constituents (sterols, acylglycerol and phospholipids) in the reverse-micelle system according to the invention can vary in a wide range, for instance the weight ratio sterol s/acylglycerol can range from 0.015 to 0.05, more particularly from 0.03 to 0.04.

The sterols are preferably incorporated or comprised in the composition or reverse micelle system in an amount by weight ranging from 0.825 g to 4.5 g with respect to 100 g of the total weight of the composition or reverse micelle system according to the invention. The amounts specified herein will be adapted with respect to the other compounds as to correspond more specifically to the weight ratios identified above and/or below.

PHOSPHOLIPIDS

Phospholipids are formed of a glycerol linked to 2 fatty acids and to a phosphate group. The variability of phospholipids relies on the fatty acids that are attached to the glycerol and on the chemical groups that are susceptible to link to the phosphate group. Phospholipids are the major lipidic constituents of biological membranes.

Phospholipids useful in the present invention include phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol, and phosphatidylcholine. In a particular embodiment, the phospholipid is phosphatidylcholine. Phosphatidylcholine is also known as l,2-diacyl-glycero-3 -phosphocholine or PtdCho.

Phosphatidylcholine is formed from a choline, a phosphate group, a glycerol and two fatty acids. It is actually a group of molecules, wherein the fatty acid compositions vary from one molecule to another. Phosphatidylcholine may be obtained from commercial lecithin that contains phosphatidylcholine in concentrations of 20 to 98%. The lecithin preferably used for the preparation of the reverse micelles according to the invention is LipoidS 100 and contains phosphatidylcholine at a concentration of more than 90%.

Sphingolipids are a class of lipids derived from the aliphatic amino alcohol sphingosine. Among sphingolipids that may be used in the present invention may be cited acyl sphingosine, sphingomyelins, glycosphingolipids, and gangliosides.

The reverse micelles system of the invention may comprise phospholipids, sphingolipids, or a mixture of both types of compounds, preferably phospholipids.

According to a specific embodiment, the reverse micelles system of the invention comprises phospholipids.

The weight ratio phospholipid/acylglycerol in compositions or reverse-micelle systems according to the invention is from 0.05 to 0.4 and preferably from 0.06 to 0.25.

The phospholipids or sphingolipids are preferably incorporated or comprised in the composition or reverse micelle system in an amount by weight ranging from 1 g to 30 g, preferably from 5 to 20 g, with respect to 100 g of the total weight of the composition or reverse micelle system according to the invention. The amounts specified herein will be adapted with respect to the other compounds as to correspond more specifically to the weight ratios identified above.

ALCOHOLS

The alcohols useful for the preparation of the reverse-micelle system according to the invention are preferably linear or branched mono-alcohols from C2 to C6. Examples of alcohols are ethanol, 1 -butanol, 2-butanol, 3 -methyl- 1 -butanol, 2-methyl-l -propanol, 1 -pentanol, 1- propanol, 2-propanol and any mixture thereof. In a particular embodiment of the invention, alcohol is ethanol. The alcohol is preferably incorporated or comprised in the composition or reverse-micelle system in an amount by weight ranging from 5 g to 12 g with respect to 100 g of the total weight of the composition or reverse-micelle system according to the invention.

WATER

The water useful for the preparation of the reverse-micelle system according to the invention is preferably purified water, more preferably RNAse or DNAse-free water.

Water is preferably incorporated or comprised in the composition or reverse micelle systems in an amount by weight ranging from 1 g to 15 g, preferably from 5 g to 15 g, with respect to 100 ml of the total volume of the composition or reverse micelle system according to the invention.

One of ordinary skill in the art will adapt the amount of phospholipid or sphingolipid in the systems to the desired amount of water. For instance, increasing amount of water should imply increasing amount of phospholipid or sphingolipid in the systems.

OLIGONUCLEOTIDES

The unmodified oligonucleotides targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene, can be any nucleic acid molecule capable of modulating gene expression by down regulating or knocking down the expression of a target nucleic acid of an interferon pathway gene and more specifically the IFNAR1 gene.

Down regulating or knocking down the expression of a target nucleic acid sequence is commonly accomplished via RNA interference (RNAi). RNAi generally designates a phenomenon by which dsRNA specifically reduces expression of a target gene at post- translational level. In normal conditions, RNA interference is initiated by double-stranded RNA molecules (dsRNA) of various length, for example ranging from 15 to 30 base pair length. In vivo, dsRNA introduced into a cell is cleaved into a mixture of short dsRNA molecules.

Nucleic acid molecules capable of modulating gene expression by down regulating or knocking down the expression of a target nucleic acid sequence as IFNAR1 gene can thus include “antisense oligonucleotides”, "short interfering nucleic acid" (siNA), "short interfering RNA" (siRNA), "short interfering nucleic acid molecule", "short interfering oligonucleotide molecule", “miRNA”, “micro RNA”, “guide RNA” (gRNA), “short guide RNA” (sgRNA) of a CRISPR system, “short hairpin RNA” (shRNA) or a mixture thereof.

Unmodified oligonucleotides as defined above, such as siRNAs, are prone to rapid degradation by ubiquitous endo- and exonucleases and they are undetectable in the blood already 10 min after administration.

The oligonucleotides used in the present invention are necessarily chemically unmodified in order to be perfectly water-soluble. More specifically, unmodified oligonucleotides refer to oligonucleotides without any structural modifications at the ribose level (e.g.: 2’ -fluoro, 2’- methyl, and/or 2’-methoxy), at the base level and at the backbone level (e.g.: phosphodiester, phosphorithi oate) .

According to a preferred embodiment, oligonucleotides of the present invention are at least 10, 15, 20 or 25 nucleotides (nt) long, more preferably in the range of 19 to 25 nucleotides long, or typically 19, 20, 21, 22, 23, 24 or 25 nt long.

According to a preferred embodiment, oligonucleotides of the present invention are designed to have complementarity to the target sequence. In the context of the present invention, they are more specifically designed to have complementarity to a target nucleic acid sequence of a gene linked to the interferon pathway, with a preference for the IFNAR1 gene.

The term RNA interference (RNAi) is used to describe gene silencing or knocking down at the mRNA level guided by small complementary non-coding RNA species. There are several classes of RNAi mediators, one of which, namely small interfering RNAs (siRNAs). The source of siRNAs during infection is viral double-stranded RNA (dsRNA), which is cleaved by cytoplasmic RNAse III family enzyme Dicer into 19-27 base pair (bp) long molecules with a perfectly complementary middle region and 2-nt overhangs on both 3' ends. These siRNAs are incorporated into a multiprotein RNA-induced silencing complex (RISC). Following the strand separation, the antisense strand guides the RISC to recognize and cut target RNA transcripts (the other strand is called passenger strand).

Unmodified oligonucleotides as defined above, such as siRNAs, can be used to protect host from viral infection, inhibit the expression of viral antigen and accessory genes, control the transcription and replication of viral genome, hinder the assembly of viral particles, or display influences in virus-host interactions. After internalization of siRNA duplexes in treated cells, the duplexes are loaded on proteins of the “Ago” family, forming a molecular complex named “RISC” (RNA-induced silencing complex). There are 4 Ago proteins in mouse and in human, but only one (called “Ago2”) is able to degrade target RNAs by endonucleolytic cleavage. That reaction generally occurs when the guide strand and the target are highly complementary (a perfect match to the “seed” [preferably nucleotides 2-7 of the guide strand] is important for target binding; and a perfect match to the central part [preferably nucleotides 8-14] of the guide strand is important for target cleavage).

According to a preferred embodiment, oligonucleotides of the present invention are designed to have complementarity to a target nucleic acid sequence of IFNAR genome. This complementarity involves at least 13 bases, typically between 13 and 25 bases, preferably at least 14 bases, even more preferably at least 18 bases of the oligonucleotides of the present invention.

In a particular aspect, the oligonucleotides of the present invention is a RNA, typically a doublestranded RNA (or RNA duplexes), in particular a small interfering RNA (siRNA).

According to a more particular embodiment, the oligonucleotides of the present invention are synthetic RNA duplexes comprising or consisting of two unmodified 21-mer oligonucleotides annealed together to form short/small interfering RNAs (siRNAs). mRNA accessibility to RISC can be hindered by RNA-binding proteins, whose binding pattern is not known. But the 5' UTR and coding sequence of mRNAs are cleaned by ribosome scanning making them more sensitive to RISC than the 3 ' UTR: while scoring predicted off- targets, it is advisable to focus on those with a seed match in their 3' UTR. mRNA accessibility to RISC can also be inhibited by mRNA secondary structures, especially short-term interactions, which are likely to re-form rapidly after ribosome scanning.

Natural human miRNAs frequently have a 5' uridine, which may be due to an intrinsically higher affinity of the Ago protein or its loading machinery (at least Ago2 binds preferentially 5' uridines and 5' adenosines.

In addition to the intended target, introduced siRNAs might bind additional mRNAs (“off- targets”). The main determinant of target recognition is a perfect match between nucleotides 2- 7 of the guide strand (the “seed” of the guide strand) and the off-target RNA. If there are many off-targets, the siRNA is likely to be partially titrated, hence less efficient. And because off- targets might be (moderately) repressed by the siRNA, they could trigger unwanted secondary effects. It is thus preferable to choose siRNAs that minimize the number of off-targets, and to minimize the number of off-targets whose modest down-regulation is most susceptible to trigger phenotypic consequences in humans.

According to a preferred embodiment, the siRNA of the invention comprises, or consists of, one of sequences shown on Figure 3.

The unmodified oligonucleotides, such as siRNAs, targeting the IFNAR1 gene are present in the aqueous core of the reverse micelles.

The amount of unmodified oligonucleotides, such as siRNAs, targeting the IFNAR1 gene incorporated into the reverse micelle system is determined by their solubility in the hydrophilic phase (aqueous core). Preferably, the amount of unmodified oligonucleotides, such as siRNAs, targeting the IFNAR1 gene included in the reverse micelle system depends on their size.

The reverse micelles of the invention allow the oligonucleotides included therein to be administered and transported to cells with a high degree of protection in lipoprotein HDL and vHDL, in particular without affecting their stability.

It is known today that a reverse-micelle system can be used for the preparation of nanomaterials, which act as micro reactors. The activity and stability of bio molecules can be controlled, mainly by the concentration of water in this medium.

Composition

The reverse micelle system as defined herein can be comprised at a therapeutically effective amount in a pharmaceutical composition with a pharmaceutically acceptable vehicle.

As used herein, the term “therapeutically effective amount” corresponds to the amount of each of the active agents (e.g.: unmodified oligonucleotides as defined above) comprised in the composition of the invention that is sufficient for producing one or more beneficial results (e.g. : treatment of pathologies related to an overexpression of IFNAR-1 gene). In a particular embodiment, the therapeutically effective amount to be administered is an amount sufficient to down regulate or knock down the expression of IFNAR-1 gene. The therapeutically effective amount of unmodified oligonucleotides to be administered can be determined by standard procedure well known by those of ordinary skill in the art. Such a therapeutically effective amount may vary as a function of various parameters, e.g.: the mode and routes of administration; the disease nature and state; the age, size and weight of the subject; the ability of the subject to respond to the treatment; the kind of concurrent treatment; the frequency of treatment; and/or the need for prevention or therapy. In particular, a therapeutically effective amount could be that amount necessary to cause an observable improvement of the clinical status over the baseline status or over the expected status if not treated, as described herein.

The term “pharmaceutically acceptable vehicle” is intended to include any and all carriers, solvents, diluents, excipients, adjuvants, dispersion media, coatings, antibacterial and antifungal agents, absorption agents and the like, well-known by the person skilled in the art, and compatible with administration in mammals and in particular human subjects. Other additives well-known to the person skilled in the art such as stabilisers, drying agents, binders or pH buffers may also be used. Preferred excipients in accordance with the invention promote adherence of the finished product to the mucosa.

According to a particular embodiment, the pharmaceutical composition is in the form of airless bottle, a capsule, a caplet, an aerosol, a spray, a solution or a soft elastic gelatin capsule.

Dosage

In a preferred embodiment, the composition as described herein is formulated in individual doses, each dose containing from approximately 50 pg/ml to approximately 5000 pg/ml of siRNA targeting the IFNAR1 gene. As a general guidance, individual doses which are suitable for the siRNA targeting the IFNAR1 gene comprises from approximately 50 pg/ml to approximately 5000 pg/ml, preferably from approximately 100 pg/ml to approximately 3000 pg/ml, more preferably from approximately 500 pg/ml to approximately 1500 pg/ml, more preferably from approximately 750 pg/ml to approximately 1250 pg/ml, and even more preferably between 900 pg/ml to approximately 1100 pg/ml of siRNA targeting the IFNAR1 gene.

Administration of reverse micelle system or pharmaceutical composition

The reverse micelle system or pharmaceutical composition of the invention can be administered in different ways, in particular via the oral, nasal, vaginal or rectal route, preferably with a buccal, nasal, vaginal or digestive absorption, or more generally via mucosal tissue absorption. In a preferred embodiment, the reverse micelle system or pharmaceutical composition of the invention is administered by buccal route. In a specific embodiment, the reverse micelle system or pharmaceutical composition of the invention is administered via mucosa. As used herein, the terms "mucosa" and "mucosal" refer to a mucous tissue such as of the respiratory, digestive, or genital tissue. "Mucosal delivery", "mucosal administration" and analogous terms as used herein refer to the administration of a composition through a mucosal tissue. “Mucosal delivery", "mucosal administration" and analogous terms include, but are not limited to, the delivery of a composition through preferably buccal administration, bronchi, gingival, lingual, nasal, oral, vaginal, rectal, and gastro-intestinal mucosal tissue. Administration according to the invention is more preferably carried out via buccal mucosa or rectal mucosa.

USE OF REVERSE MICELLE SYSTEM TO DELIVER UNMODIFIED NUCLEOTIDES TARGETING IFNAR1 GENE FOR THE TREATMENT OF PATHOLOGIES RELATED TO AN OVEREXPRESSION OF ONE OR MORE GENES LINKED TO THE INTERFERON PATHWAY, WITH A PREFERENCE FOR IFNAR1 GENE, AND METHODS OF TREATMENT.

A further object of the invention concerns the use of reverse micelles as defined above for preparing a pharmaceutical composition intended for the treatment of pathologies related to an overexpression of one or more genes linked to the interferon pathway, with a preference for IFNAR1 gene.

Genes linked to the interferon pathways are selected in a group comprising genes encoding interferons of type I (e.g.: IFNa, IFNP, IFNs, IFNK, IFNCO, and IFNQ, interferons of type II (e.g.: IFNy), interferons of type III (e.g.: IFN- ), and interferon receptors (e.g.: IFNAR1, IFNAR2, IL10R2, and IFNLR1).

Examples of pathologies related to an overexpression of one or more genes linked to the interferon pathway, with a preference for IFNAR1 gene, are infections, such as bacterial, viral, or parasitic infections and autoimmune and/or inflammatory diseases, including systemic lupus erythematosus (SLE), multiple sclerosis (MS), myositis like dermatomyositis, Sjogren’s disease, scleroderma, rheumatoid arthritis or sarcoidosis, and neuropsychiatric pathology and some cancers, especially cancers overexpressing IFNAR-1 gene. In this context “overexpression” means a higher level of IFNAR1 expression compared to IFNAR1 level in all organs and tissues in a low or medium mode on the scale of expression of genes and proteins (human protein atlas). The organs or tissues used for such a comparison (reference tissue) may be collected from the patient himself or from one or several individuals. In the case of a cancer overexpressing IFNAR1, said cancer has a higher level of IFNAR1 expression compared to IFNAR1 level in normal tissues, or in tumors with low or medium expression of IFNAR1. The normal tissues or tumors used for such a comparison (reference tissue) may be collected from one or several individuals. The level of expression can be measured by standard methods such as immunochemistry, fluorescent (e.g., fluorescence- activated cell sorting FACS), histological methods or mRNA expression measurements.

The present invention further concerns a method for the treatment of pathologies related to an overexpression of IFNAR1 gene, wherein the method comprises the step of administering into a subject in need of such treatment a therapeutically efficient amount of one or more unmodified oligonucleotides as defined above.

Within the context of the invention, the term treatment denotes curative, symptomatic, and preventive treatment. As used herein, the term “treatment” refers to pathologies related to an overexpression of IFNAR1 gene. The treatment can be designed to eradicate the disease, to stop the progression of the disease, and/or to promote the regression of the disease.

The term “subject” generally refers to a vertebrate organism for whom any of the product or methods disclosed herein is needed or may be beneficial. Typically, the organism is a mammal, particularly a mammal selected from the group consisting of domestic animals, farm animals, sport animals, and primates (human and non-human). The terms “subject” and “patient” may be used interchangeably when referring to a human organism and covers male and female as well as a foetus, new-born, infant, young adult, adult and elderly.

USE OF REVERSE MICELLE SYSTEM TO DELIVER UNMODIFIED NUCLEOTIDES TARGETING ONE OR MORE GENES LINKED TO THE INTERFERON PATHWAY, WITH A PREFERENCE FOR IFNAR1 GENE, IN COMBINATION WITH ONCOLYTIC VIRUSES FOR THE TREATMENT OF CANCER, AND METHOD OF TREATMENT In one embodiment of the invention, the reverse micelle system or composition thereof as defined herein is for use in combination with an oncolytic virus or composition thereof for the treatment of cancer.

Oncolytic viruses

As used herein, the term “oncolytic” refers to the capacity of a virus of selectively replicating in dividing cells (e.g.: a proliferative cell such as a cancer cell) with the aim of slowing the growth and/or lysing said dividing cell, either in vitro or in vivo, while showing no or minimal replication in non-dividing (e.g.: normal or healthy) cells. “Replication” (or any form of replication such as “replicate” and “replicating”, etc.) means duplication of a virus that can occur at the level of nucleic acid or, preferably, at the level of infectious viral particle. Such an oncolytic virus can be obtained from any member of virus identified at present time. It may be a native virus that is naturally oncolytic or may be engineered by modifying one or more viral genes so-as to increase tumour selectivity and/or preferential replication in dividing cells, such as those involved in DNA replication, nucleic acid metabolism, host tropism, surface attachment, virulence, lysis and spread (see for example Wong et al., 2010, Viruses 2: 78-106). One may also envisage placing one or more viral gene(s) under the control of event or tissuespecific regulatory elements (e.g.: promoter). Exemplary oncolytic viruses include without limitation reovirus, Seneca Valley virus (SVV), vesicular stomatitis virus (VSV), Newcastle disease virus (NDV), herpes simplex virus (HSV), morbillivirus, adenovirus, poxvirus, retrovirus, measles virus, foamy virus, alpha virus, lentivirus, influenza virus, Sinbis virus, myxoma virus, rhabdovirus, picornavirus, coxsackievirus, parvovirus or the like. Such viruses are known to those skilled in the arts of medicine and virology.

In some embodiments, the oncolytic virus for use in combination herein is a poxvirus. As used herein, the term “poxvirus” or “poxviral” refers to any Poxviridae virus identified at present time or being identified afterwards that is infectious for one or more mammalian cells (e.g.: human cells) and characterized by a double-stranded DNA genome that encodes numerous viral enzymes and factors that enable the virus to replicate independently from the host cell machinery. The term “virus” as used in the context of poxvirus or any other virus mentioned herein encompasses the viral genome as well as the viral particle (encapsidated and/or enveloped genome). In some embodiments, the poxvirus for use in combination herein is a Chordopoxvirinae, preferably selected from the group of genus consisting of Avipoxvirus, Capripoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus, Cervidpoxvirus and Yatapoxvirus. The genomic sequence of a number of poxviruses and the encoded open reading frames (ORFs) are well known in the art and available in database such as GenBank.

In a preferred embodiment, the poxvirus for use in combination herein is an Orthopoxvirus, with a specific preference for a Vaccinia virus. Vaccinia viruses are members of the poxvirus family. The nucleotide sequence of the vaccinia virus complete genome of approximately 200 kb is available in the art and specialized databases such as Genbank (see e.g. accession number NC 006998). The majority of vaccinia virus particles is intracellular (IMV for “intracellular mature virion”) with a single lipid envelop and remains in the cytosol of infected cells until lysis. The other infectious form is a double enveloped particle (EEV for “extracellular enveloped virion”) that buds out from the infected cell without lysing it. Although it can originate from any Vaccinia virus strain, Elstree, Wyeth, Copenhagen, Lister, Tian-Tan and Western Reserve strains are particularly preferred. The gene nomenclature used herein is that of Copenhagen vaccinia strain. It is also used herein for the homologous genes of other Vaccinia virus unless otherwise indicated since gene nomenclature may be different according to the strain but correspondence between Copenhagen and other vaccinia strains are generally available in the literature.

In some embodiments, the oncolytic poxvirus (e.g. Vaccinia virus) for use in combination herein comprises a genome which has been modified by the man’s hands to be at least defective for two or more viral gene product(s). The term “defective” as used herein, refers to the lack of synthesis or the synthesis of a protein unable to ensure the activity of the protein produced under normal conditions by the unmodified viral gene. Such a defective character typically results from inactivating mutation(s) within the viral gene sequence or its regulatory elements. Inactivating mutation(s) encompass deletion, mutation and/or substitution of one or more nucleotide(s) (contiguous or not). Such mutation(s) can be made in a number of ways known to those skilled in the art using conventional recombinant techniques. In the context of the invention, the oncolytic poxvirus is preferably defective for one or more viral genes involved in DNA metabolism, host virulence, IFN pathway and the like (see e.g.: Guse et al., 2011, Expert Opinion Biol. Ther.11(5): 595-608). In some embodiments, the oncolytic poxvirus (e.g.: Vaccinia virus) used in combination herein is defective for thymidine kinase (TK) activity resulting from inactivating mutations in the TK- encoding gene (locus J2R). The TK enzyme is involved in the synthesis of deoxyribonucleotides. TK is needed for viral replication in normal cells as these cells have generally low concentration of nucleotides whereas it is dispensable in dividing cells which contain high nucleotide concentration.

In some embodiments, the oncolytic poxvirus (e.g.: Vaccinia virus) for use in combination herein is defective for ribonucleotide reductase (RR) activity resulting from inactivating mutations in at least one gene or both genes encoding RR enzyme. In the natural context, this enzyme catalyses the reduction of ribonucleotides to deoxyribonucleotides that represents a crucial step in DNA biosynthesis. The viral enzyme is similar in subunit structure to the mammalian enzyme, being composed of two heterologous subunits, designed R1 large subunit and R2 small subunit, encoded respectively by the I4L and F4L locus. Sequences for the I4L and F4L genes and their location in the Vaccinia virus genome are available in public databases. In the context of the invention, either the I4L gene or the F4L gene or both may be inactivated.

In some embodiment, the oncolytic poxvirus for use in combination herein is defective for both TK and RR activities resulting from inactivating mutations in both the J2R and the I4L and/or F4L loci carried by the viral genome (e.g.: as described in W02009/065546 and Foloppe et al., 2008, Gene Then, 15: 1361-71) with a specific preference for an oncolytic Vaccinia virus defective for both TK and RR activities. In a preferred embodiment of the invention, the reverse micelle system or composition thereof delivers unmodified nucleotides (e.g. siRNAs) targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene, and is for use in combination with oncolytic poxviruses (e.g. Vaccinia viruses) defective for TK activity (resulting from alteration of the J2R locus) or defective for both TK and RR activities (resulting from alteration of both the J2R locus and at least one of the RR-encoding I4L and/or F4L locus) for the treatment of cancer.

Process for producing the oncolytic poxviruses

The oncolytic poxviruses (e.g. : Vaccinia viruses) for use in combination herein for the treatment of cancer are produced into a suitable host cell line using conventional techniques including culturing the transfected or infected host cell under suitable conditions so as to allow the production and recovery of infectious poxviral particles. Preferably, the method for producing the oncolytic poxvirus (e.g.: Vaccinia virus) comprises the steps of i) infecting a producer cell with the oncolytic poxvirus (e.g.: Vaccinia virus), ii) culturing said producer cell under conditions which are appropriate for enabling said oncolytic poxvirus to be produced and iii) recovering the produced virus from the producer cell culture.

Suitable host cells for production of the oncolytic poxviruses include without limitation human cell lines such as HeLa (ATCC), 293 cells (Graham et al., 1997, J. Gen. Virol. 36: 59-72), HER96, PER-C6 (Fallaux et al., 1998, Human Gene Ther. 9: 1909-17), Monkey cells such as Vero (ATCC CCL-081), CV-1 (ATCC CCL-70) and B SCI (ATCC CCL-26) cell lines, avian cells such as those described in W02005/042728, W02006/108846, W02008/129058, W02010/130756, W02012/001075, etc.), hamster cell lines such as BHK-21 (ATCC CCL-10) as well as primary chicken embryo fibroblasts (CEF) prepared from chicken embryos obtained from fertilized eggs. Host cells are preferably cultivated in a medium free of animal- or human- derived products, using a chemically defined medium with no product of animal or human origin. Culturing is carried out at a temperature, pH and oxygen content appropriate for the producer cell. Such culturing conditions are within the expertise of one of ordinary skill in the art. If growth factors are present, they are preferably recombinantly produced and not purified from animal material. Suitable animal-free medium media are commercially available, for example VP-SFM medium (Invitrogen) for culturing CEF producer cells. Producer cells are preferably cultivated at a temperature comprised between +30°C and +38°C (more preferably at about +37°C) for between 1 and 8 days (preferably for 1 to 5 days for CEF and 2 to 7 days for immortalized cells) before infection. If needed, several passages of 1 to 8 days may be made in order to increase the total number of cells.

Producer cells are infected by the oncolytic poxvirus with an appropriate multiplicity of infection (MOI), which can be as low as 0.001 (more preferably between 0.05 and 5) to permit productive infection.

In step ii), infected producer cells are then cultured under appropriate conditions well known to those skilled in the art until progeny viral vector is produced. Culture of infected producer cells is also preferably performed in a chemically defined medium (which may be the same as or different from the medium used for culture of producer cells and/or for infection step) free of animal- or human-derived products at a temperature between +30°C and +37°C, for 1 to 5 days. In step iii), the viral particles may be collected from the culture supernatant and/or the producer cells. Recovery from producer cells (and optionally also from culture supernatant), may require a step allowing the disruption of the producer cell membrane to allow the liberation of the virus from producer cells. The disruption of the producer cell membrane can be induced by various techniques well known to those skilled in the art, including but not limited to, freeze/thaw, hypotonic lysis, sonication, micro-fluidization, or high-speed homogenization.

The recovered oncolytic poxvirus can be at least partially purified before being used according to the present invention. Various purification steps can be envisaged, including clarification, enzymatic treatment (e.g.: endonuclease such as benzonase, protease), ultracentrifugation (e.g.: sucrose gradient or cesium chloride gradient), chromatographic and filtration steps. Appropriate methods are described in the art (e.g.: WO2007/147528; WO2008/138533, W02009/100521, W02010/130753, WO2013/022764).

Composition

The oncolytic poxvirus (e.g.: Vaccinia virus) for use in combination herein can be comprised at a therapeutically effective amount in a composition with a pharmaceutically acceptable vehicle.

As used herein, the term “therapeutically effective amount” corresponds to the amount of each of the active agents (e.g. oncolytic poxviruses or Vaccinia viruses) comprised in the composition of the invention that is sufficient for producing one or more beneficial results (e.g. treatment of cancers). Such a therapeutically effective amount may vary as a function of various parameters, e.g.: the mode and routes of administration; the disease nature and state; the age and weight of the subject; the ability of the subject to respond to the treatment; the kind of concurrent treatment; the frequency of treatment; and/or the need for prevention or therapy. In particular, a therapeutically effective amount could be that amount necessary to cause an observable improvement of the clinical status over the baseline status or over the expected status if not treated, as described herein.

A therapeutically effective amount could also be the amount necessary to cause the development of an effective non-specific (innate) and/or specific (adaptative) immune response. Typically, development of an immune response, in particular T cell response, can be evaluated in vitro, in suitable animal models or using biological samples collected from the subject (ELISA, flow cytometry, histology, etc.). One may also use various available antibodies so as to identify different immune cell populations involved in anti-tumor response that are present in the treated subjects, such as cytotoxic T cells, activated cytotoxic T cells, natural killer cells and activated natural killer cells.

The term “pharmaceutically acceptable vehicle” is intended to include any and all carriers, solvents, diluents, excipients, adjuvants, dispersion media, coatings, antibacterial and antifungal agents, absorption agents and the like well-known by the person skilled in the art, and compatible with administration in mammals and in particular human subjects. The oncolytic viruses can independently be placed in a solvent or diluent appropriate for human or animal use. The solvent or diluent is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength. Representative examples include sterile water, physiological saline (e.g.: sodium chloride), Ringer’s solution, glucose, trehalose or saccharose solutions, Hank’s solution, and other aqueous physiologically balanced salt solutions (see for example the most current edition of Remington: The Science and Practice of Pharmacy, A. Gennaro, Lippincott, Williams&Wilkins). In other embodiments, oncolytic poxviruses are suitably buffered for human use. Suitable buffers include without limitation phosphate buffer (e.g.: PBS), bicarbonate buffer and/or Tris buffer capable of maintaining a physiological or slightly basic pH (e.g.: from approximately pH 7 to approximately pH 9). The composition may also contain other pharmaceutically acceptable excipients for providing desirable pharmaceutical or pharmacodynamic properties, including for example osmolarity, viscosity, clarity, colour, sterility, stability, rate of dissolution of the formulation, modifying or maintaining release or absorption into a human or animal subject, promoting transport across the blood barrier or penetration in a particular organ.

In one embodiment, the composition may be formulated with the goal of improving its stability, in particular under the conditions of manufacture and long-term storage (i.e.: for at least 6 months, with a preference for at least two years) at freezing (e.g.: -70°C, -20°C), refrigerated (e.g.: 4°C) or ambient temperature. Such formulations generally include a liquid carrier such as aqueous solutions. Various virus formulations are available in the art either in frozen, liquid form or lyophilized form (e.g.: WO98/02522, WOOl/66137, WO03/053463, W02007/056847 and W02008/114021, etc.). Solid (e.g.: dry powdered or lyophilized) compositions can be obtained by a process involving vacuum drying and freeze-drying. For illustrative purposes, buffered formulations including NaCl and/or sugar are particularly adapted to the preservation of viruses (e.g.: Tris 10 mM pH 8 with sucrose 5 % (W/V), Sodium glutamate 10 mM, and NaCl 50 mM or phosphate-buffered saline with glycerol (10%) and NaCl).

Dosage of oncolytic poxvirus

In a preferred embodiment, the composition as described herein is formulated in individual doses, each dose containing from about 10³ to 10¹² vp (viral particles), iu (infectious unit) or pfu (plaque-forming units) of the oncolytic poxvirus (e.g.: Vaccinia virus) depending on the quantitative technique used. The quantity of oncolytic poxvirus present in a sample can be determined by routine titration techniques, e.g., by counting the number of plaques following infection of permissive cells to obtain a plaque forming units (pfu) titer, by measuring the A260 absorbance (vp titers), or still by quantitative immunofluorescence, e.g., using anti-virus antibodies (iu titers). Further refinement of the calculations necessary to adapt the appropriate dosage for a subject or a group of subjects may be routinely made by a practitioner, in the light of the relevant circumstances. As a general guidance, individual doses which are suitable for the oncolytic poxvirus composition comprise from approximately 10³ to approximately 10¹² pfu, advantageously from approximately 10⁴ pfu to approximately 10¹¹ pfu, preferably from approximately 10⁵ pfu to approximately 10¹⁰ pfu; and more preferably from approximately 10⁶ pfu to approximately 10⁹ pfu and notably individual doses of approximately 10⁶, 5xl0⁶, 10⁷, 5xl0⁷, 10⁸ or 5xl0⁸ pfu are particularly preferred.

Administration of oncolytic poxvirus

Any of the conventional administration routes is applicable for oncolytic poxviruses or oncolytic poxvirus composition, including parenteral, topical or mucosal routes. Parenteral routes are intended for administration as an injection or infusion and encompass systemic as well as local routes. Suitable administration routes to administer the oncolytic poxvirus (e.g.: Vaccinia virus) or oncolytic poxvirus composition include intravenous (into a vein), intravascular (into a blood vessel), intra-arterial (into an artery such as hepatic artery), intradermal (into the dermis), subcutaneous (under the skin), intramuscular (into muscle), intraperitoneal (into the peritoneum) and intratumoral (locally into a tumor or its close vicinity) and also scarification. Administration can be in the form of a single bolus dose, or may be, for example, by a continuous perfusion pump. Mucosal administrations include without limitation oral/alimentary, intranasal, intratracheal, intrapulmonary, intravaginal or intra-rectal route. Topical administration can also be performed using transdermal means (e.g.: patch and the like). Preferably, the oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof is formulated for intravenous or intra-tumoral administration.

Administrations may use conventional syringes and needles (e.g.: Quadrafuse injection needles) or any compound or device available in the art capable of facilitating or improving delivery of the oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof in the subject. An alternative is the use of a needleless injection device (e.g.: Biojector TM device). Transdermal patches may also be envisaged.

The oncolytic poxvirus or composition thereof described herein is suitable for a single administration or a series of administrations. It is also possible to proceed via sequential cycles of administrations that are repeated after a rest period. Intervals between each administration can be from three days to about six months (e.g.: 72h, weekly, every two weeks, monthly or quarterly, etc.). Intervals can also be irregular. The doses can vary for each administration within the range described above. A preferred therapeutic scheme involves 2 to 10 weekly administrations possibly followed by 2 to 15 administrations at longer intervals (e.g.: 3 weeks) of the oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof.

Method and Use

In some embodiments, the reverse micelle system comprising siRNA targeting a gene linked to the interferon pathway with a preference for the IFNAR1 gene, or composition thereof, is for use in combination with an oncolytic poxvirus (e.g. : Vaccinia virus) or composition thereof for the treatment of cancer. In some embodiment, said cancer is resistant to oncolytic virus-based treatment, more particularly to poxvirus-based treatment, even more particularly to vaccinia virus-based treatment. In another embodiment, said cancer is characterized by an overexpression of one or more genes linked to the interferon pathway, with a preference for IFNAR1 gene.

In some embodiments, the invention also provides a method of treatment of cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of reverse micelle system comprising siRNA targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene or composition thereof, and a therapeutically effective amount of oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof. In some embodiments, the invention also provides a method for inhibiting tumor cell growth in a subject in need thereof comprising administering to the subject a therapeutically effective amount of reverse micelle system comprising siRNA targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene or composition thereof, and a therapeutically effective amount of oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof.

Typically, a therapeutically effective amount of reverse micelle system described herein comprises from approximately 50 pg/ml to approximately 5000 pg/ml, preferably from approximately 100 pg/ml to approximately 3000 pg/ml, more preferably from approximately 500 pg/ml to approximately 1500 pg/ml, more preferably from approximately 750 pg/ml to approximately 1250 pg/ml, and even more preferably between 900 pg/ml to approximately 1100 pg/ml of siRNA targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene.

Typically, a therapeutically effective amount of oncolytic poxvirus (e.g.: Vaccinia virus) described herein comprises from approximately 10³ to approximately 10¹² pfu, advantageously from approximately 10⁴ pfu to approximately 10¹¹ pfu, preferably from approximately 10⁵ pfu to approximately 10¹⁰ pfu, and more preferably from approximately 10⁶ pfu to approximately 10⁹ pfu.

In the context of the invention, the methods and uses described herein aim at providing the treated subject an observable improvement of the clinical status over the baseline status or over the expected status if not treated, such as slowing down, curing, ameliorating or controlling the occurrence or the progression of the cancer. For instance, such improvement in a subject having a cancer can be evidenced, e.g., by a reduction in the tumor number, a reduction of the tumor size, a reduction in the number or extent of metastases, an increase in the length of remission, a stabilization (i.e. not worsening) of the state of disease, a decrease of the rate of disease progression or its severity, a pro-longed survival, a better response to the standard treatment, an amelioration of the disease’s surrogate markers, an improvement of quality of life, a reduced mortality, and/or prevention of the disease’s recurrence, etc.

An improvement of the clinical status can be easily assessed by any relevant clinical measurement typically used by physicians or other skilled healthcare staff. For example, techniques routinely used in laboratories such as blood tests, analysis of biological fluids and biopsies (e.g.: by flow cytometry, histology, immunoassays, quantitative PCR assays) as well as medical imaging techniques to perform tumor surveillance. Such measurements are routine in the art in medical laboratories and hospitals and a large number of kits is available commercially. They can be performed before the administration (baseline) and at various time points during treatment and after cessation of the treatment.

In the context of the invention, the therapeutic benefit can be transient (for one or a couple of months after cessation of administration) or sustained (for several months or years). As the natural course of clinical status which may vary considerably from a subject to another, it is not required that the therapeutic benefit be observed in each subject treated but in a significant number of subjects (e.g.: statistically significant differences between two groups can be determined by any statistical test known in the art, such as a Tukey parametric test, the Kruskal- Wallis test, the U test according to Mann and Whitney, the Student’s t-test, the Wilcoxon test, etc.).

In some embodiments, the subject is a patient having a cancer, i.e., exhibiting symptoms of cancer. Preferably, the patient displays a cancer symptom and/or a cancer diagnostic marker. Such a cancer symptom and/or a cancer diagnostic marker can be measured and/or assessed and/or quantified by a person skilled in the art of medicine.

In some embodiments, the subject is a patient having a cancer displaying a poor response to immunotherapy, including poor responses to oncolytic viruses, more particularly to poxvirusbased treatment, even more particularly to vaccinia virus-based treatments.

In some embodiments, the subject is a patient having a cancer characterized by an overexpression of genes linked to the interferon pathway, with a preference for the IFNAR1 gene.

In some embodiments, the cancer to be treated in accordance with the present invention is a solid tumor. Representative examples of such cancers include, without limitation, bone cancer, gastrointestinal cancer, liver cancer (e.g.: hepatocarcinoma), pancreatic cancer, gastric cancer, colorectal cancer, oesophageal cancer, bile duct carcinoma, oropharyngeal cancer, laryngeal cancer, salivary gland carcinoma, thyroid cancer, lung cancer (e.g. : non-small cell lung cancer), skin cancer, squamous cell cancer, melanoma, uterine cancer, cervical cancer, endometrial carcinoma, vulvar cancer, ovarian cancer, breast cancer (e.g.: metastatic breast cancer), prostate cancer (e.g.: hormone refractory prostate adenocarcinoma), cancer of the endocrine system, sarcoma of soft tissue, bladder cancer, kidney cancer (e.g.: clear cell carcinoma), cancer of the head or neck, glioblastoma and various types of the central nervous system (CNS), etc.

The reverse micelle system comprising siRNA targeting the IFNAR1 gene or composition thereof and the oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof are administered to the subject in accordance with standard practice. They can be administered one or multiple times (e.g.: between 2 and 50 times) during a period of administration.

Any order of administration is contemplated by the present invention. In one embodiment, the period of administration of the reverse micelle system or composition thereof precedes the period of administration of oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof, with or without overlapping of these two periods. In another embodiment, the period of administration of oncolytic poxvirus or composition thereof precedes the period of administration of reverse micelle system or composition thereof, with or without overlapping of these two periods. In another embodiment the period of administration of reverse micelle system or composition thereof corresponds to the period of administration of oncolytic poxvirus or composition thereof. In another embodiment, the period of administration of reverse micelle system or composition thereof is included in the period of administration of oncolytic poxvirus or composition thereof, which means that the period of oncolytic poxvirus administration begins before the first administration of reverse micelle system, and ends after the last administration of reverse micelle system. In a preferred embodiment, the period of administration of oncolytic poxvirus or composition thereof is included in the period of administration of the reverse micelle system or composition thereof, which means that the period of reverse micelle system administration begins before the first administration of oncolytic poxvirus, and ends after the last administration of oncolytic poxvirus (e.g.: reverse micelle system or composition thereof administered between day 1 and day 9, and oncolytic poxvirus or composition thereof administered between day 4 and day 8). In overlapping periods of administration, the reverse micelle system or composition thereof and the oncolytic virus or composition thereof can be administered concurrently or separately. Concurrent administration includes administering the reverse micelle system or composition thereof at approximately the same time (e.g.: 0.5, 1, 2, 4 hours) as the oncolytic poxvirus or composition thereof. Concurrent administration does not require that the agents be mixed together for being administered. Separate administration includes administering the reverse micelle system or composition thereof and the oncolytic virus or composition thereof at different times (e.g.: 6, 12, 18 hours).

The reverse micelle system comprising siRNA targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene or composition thereof and the oncolytic virus or composition thereof can be independently administered by the same route or by different routes. Any of the conventional administration routes are applicable in the context of the invention. In a preferred embodiment, the reverse micelle system or composition thereof is administered via mucosal route, and the oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof is administered via intravenous or intratumoral routes.

In specific embodiments, the combination of the reverse micelle system comprising siRNA targeting genes linked to the interferon pathway, with a preference for the IFNAR1 gene or composition thereof and the oncolytic poxvirus (e.g.: Vaccinia virus) or composition thereof may be used in conjunction with one or more additional therapies, in particular standard of care therapy(ies) that are appropriate for the type of cancer afflicting the treated subject. Standard- of-care therapies for different types of cancer are well known by the person skilled in the art and usually disclosed in Cancer Network and clinical practice guidelines. Such one or more additional therapy(ies) is/are selected from the group consisting of surgery, radiotherapy, chemotherapy, cryotherapy, hormonal therapy, toxin therapy, immunotherapy, cytokine therapy, targeted cancer therapy, gene therapy, photodynamic therapy, transplantation, etc.

Other features, objects, and advantages of the invention will be apparent from the description and drawings and from the claims. The following examples are incorporated to illustrate preferred embodiments of the invention. However, in light of the present disclosure, those skilled in the art should appreciate that changes can be made in the specific embodiments that are disclosed without departing from the spirit and scope of the invention.

EXAMPLES The following examples are intended to exemplify the operation of the present invention but not to limit its scope.

Example 1: Manufacture and stability study of a product non GMP for a pharmacological study The aim of this study was to evaluate the impact of siRNA content on the formation and stability of the reverse microemulsion.

4 formulations with different concentrations of siRNA targeting IFNAR1 mRNA were prepared according to the procedure below.

4,32 g of commercially available lecithin, containing more than 97% of phosphatidylcholine, was dissolved in 3,38 g of absolute ethanol under magnetic stirring at 300 rpm for 10 minutes at room temperature. 0,70 g of beta-sitosterol was added to the mixture and stirred in the same conditions. 16,28 g of Peceol® were added thereto and magnetic stirring was carried out at 500 rpm for 45 minutes at 37 °C to form an oily homogeneous solution. A siRNA solution was added to the oil solution prepared and the mixture was vortexed for 10 minutes to achieve an isotropic and homogeneous reverse microemulsion.

The different formulations are summarized in the table below:

# siRNA- 1

# siRNA-3

Reverse microemulsions were prepared by increasing concentrations of siRNA from 600 to 1000 pg/ml. The percentage of beta-sitosterol was 2,5% (weight of beta-sitosterol/total weight of the composition), that of absolute ethanol was 12% (weight of ethanol/total weight of the composition), that of water was 12 % (weight of water/total volume of the composition, density of 0,94) and that of lecithin was 15% (weight of ethanol/total weight of the composition) of all these samples. The formation of thermodynamically stable microemulsions was evaluated by the visual determination of their limpidity.

2 ml clear glass vial closed with rubber was used for this study.

The physical stability of the monophasic siRNA-loaded microemulsions was studied regarding the temperature stability and centrifugation. All tested microemulsions remained visually stable after 8 months at +25°C and 6 months at +40°C, no phase separation, turbidity, or drug precipitation was shown. The addition of siRNA targeting IFNAR1 mRNA doesn’t disturb the stability of tested formulations.

Example 2: In vitro siRNAs silencing experiment

The IFNAR1 knockdown by specific siRNAs (siRNA-1, siRNA-2 and siRNA-3) was confirmed by Western blot analysis (Fig. 1). Murine colorectal carcinoma CT26 cells (ATCC CRL-2638) were plated in 6-well plates (3 x 10⁵ cells/well) 24 h before transfection. On the day of transfection, CT26 cells were transfected by 20 nM of each siRNA, a mix of the 3 siRNAs (20 nM each) or by 20 nM of a non-targeting control siRNA (siRNAc) using DharmaFECT 1 transfection reagents according to the manufacturer’s instructions (Dharmacon, GE Healthcare). To normalize the levels of protein detected, the housekeeping protein beta actin was used as an internal loading control.

One and two days after siRNA transfection, cells were washed first and then suspended in 100 pL lysis buffer (Tris 50 mM, Triton-XlOO, DTT 1 mM, NaCl 150 mM, EDTA 5 mM). The amount of proteins was determined using the Bio-Rad protein assay. An equal amount of proteins (20 pg) was loaded in each lane. The proteins were separated by 4% to 15% SDS- polyacrylamide gel electrophoresis (SDS-PAGE) and electrically transferred to a polyvinylidene difluoride membrane (Bio-Rad). After blocking the membrane using 5% nonfat milk, target proteins were detected using IFNAR1 rabbit monoclonal antibody (SR45-08, Invitrogen). Thereafter, polyclonal goat horseradish peroxidase (HRP)-conjugated anti-rabbit Immunoglobulin (Agilent) was applied as the secondary antibody and the positive bands were detected using Amersham ECL Plus Western blotting detection reagents (GE Healthcare).

Western blot analysis showed that, two days post-transfection, expression of IFNAR1 protein was particularly reduced after transfection with siRNA- 1, siRNA-3 and the mix of the three siRNAs. No significant difference was identified between non-targeting control siRNA treated cells and control untreated ones.

In conclusion, these in vitro results have shown that siRNA- 1 and siRNA-3 can downregulate IFNAR1 protein.

Example 3: In vivo efficacy of siRNA targeting IFNAR1 gene

The main objective of this study was to evaluate the impact of RNA interference targeting IFNAR1 on the in vivo antitumor activity of oncolytic vaccinia virus, by evaluating the effects of the combination on tumor growth and on percentage of survival. The combination of oncolytic vaccinia virus and siRNAs directed against IFNAR1 sequence formulated in a water- in-oil microemulsion as described in exemple 1, was assessed in immunocompetent mice transplanted with murine colorectal carcinoma CT26 cells. For this anti-tumor evaluation, 2 x 10⁵ CT26 cells were injected subcutaneously into the flank of BALB/c mice at day 0. From day 4 to day 12 post-tumor inoculation, 20 pL of formulated siRNAs or a mix of the 3 formulated siRNAs (20 pL of each) were administered twice a day by buccal route, through the buccal mucosa, using a micropipette and adapted conical tips. On days 7, 9 and 11 post-tumor inoculation, mice were injected intratum orally with 1 x 10⁷ PFU of an unarmed double deleted TK'RR' Vaccinia virus (VVTG18058). Tumor size was measured twice a week with calipers. Tumor volumes were calculated in cubic millimeters using the formula n/6 x length x width². Mice were sacrificed when tumor volume reached 2000 mm³. Statistical analyses on tumor volumes were performed using the nonparametric Mann-Whitney U-test. For statistics on mice survival, a log-rank test was used. A/? < 0.05 was considered to be statistically significant.

As shown in Fig. 2A and 2B, three intratumoral injections of VVTG18058 did not induce an anti turn oral activity compared to the untreated control group. However, the intratumoral administration of VVTG18058 in combination with injections of formulated siRNA-1 or siRNA-3 inhibited the growth of the CT26 tumors (Fig. 2A) and improved the survival of the treated animals (Fig. 2B). This antitumoral effect (effect on the tumor volume and the survival) was also observed when combining the virus with the mix of the three siRNAs (Fig. 2A and 2B). On the other hand, administrations of formulated non-targeting control siRNA in combination with intratumoral injections of VVTG18058, did not improve the tumor-growth inhibition of the virus treatment.

These results demonstrated that formulated siRNAs targeting IFNAR1 can improve the antitumor activity of oncolytic vaccinia viruses. References

Benci et al. 2019, Cell 178, 933-48). de Matos et al., 2020, Mol. Ther: methods and clin dev. 17, 349-358

Fallaux et al., 1998, Human Gene Ther. 9: 1909-17

Filley and Dey, 2017, Frontiers in Oncol. 7, doi: 10.3389/fonc.2017.00106

Fisher et al., 2006, Curr. Opin. Mol. Ther., 8(4):301 - 13

Foloppe et al., 2008, Gene Ther., 15: 1361-71

Graham et al., 1997, J. Gen. Virol. 36: 59-72

Gujar, et al. 2018, Trends in Immunol. 39, 209-221

Guse et al., 2011, Expert Opinion Biol. Ther.11(5): 595-608

Harrington et al. 2019, Nature Rev. Drug Discov. 18, 686-706

Hwong et al. 2010, Viruses 2, 78-106

Ivashkiv and Donlin, 2014, Nat Rev Immunol. 14, 36-49

The Science and Practice of Pharmacy, A. Gennaro, Lippincott, Williams&Wilkins

Wong et al., 2010, Viruses 2: 78-106

Zheng et al., 2019, Molecular Therapy: Oncolytics Vol.15, 234-247

Claims

42

CLAIMS A reverse micelle system comprising at least one sterol, acylglycerol, phospholipid, an alcohol, and at least one unmodified oligonucleotide targeting a gene linked to the interferon pathway, wherein said gene is preferably IFNAR1 gene. The reverse micelle system according to claim 1, wherein the micelles present aqueous cores of around 4 nm, preferably from 3 to 5 nm, more preferably from 3.5 to 5 nm, in particular from 3.7 to 4.5 nm. The reverse micelle system according to claim 1, wherein acylglycerol presents the following formula (I):

in which:

- R.2 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 2 and 18 carbon atoms;

- R.3 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, or a hydrogen atom. The reverse micelle system according to any one of claims 1-3, wherein the at least one sterol is sitosterol, and/or phospholipid is lecithin, and/or alcohol is ethanol, and/or acylglycerol is glycerol monooleate. The reverse micelle system according to any one of claims 1-4, wherein the unmodified oligonucleotide is selected in the group consisting of antisense oligonucleotides, short interfering nucleic acid (siNA), short interfering RNA (siRNA), short interfering nucleic acid molecule, short interfering oligonucleotide molecule, miRNA, micro-RNA, guide 43

RNA (gRNA), short guide RNA (sgRNA) of a CRISPR system, short hairpin RNA (shRNA) and a mixture thereof. The reverse micelle system according to any one of claims 1-5, wherein the unmodified oligonucleotide is at least 10, 15, 20 or 25 nucleotides (nt) long, more preferably in the range of 19 to 25 nucleotides long, or typically 19, 20, 21, 22, 23, 24 or 25 nt long. The reverse micelle system according to any one of claims 1-6, wherein the unmodified oligonucleotide is double strand, preferably wherein the unmodified oligonucleotide is a synthetic RNA duplex comprising or consisting of two unmodified 21-mer oligonucleotides annealed together to form siRNAs. The reverse micelle system according to claim 7, wherein the siRNA comprises, or consists of, one of the following sequences: siRNA- 1

Guide strand: 5’ P-UUAUCUUCAGCUUCUAAAUGUA 3’ (SEQ ID NO: 1)

Passenger strand: 3 ’ UUCAUAGAAGUCGAAGAUUUAC 5 ’ (listed as SEQ ID NO: 2 in the 5’ to 3’ sense) siRNA-2

Guide strand: 5’ P-UUUAUCUUC AGCUUCUAAAUG 3 ’ (SEQ ID NO: 3)

Passenger strand: 3’ UUCAAUAGAAGUCGAAGAUUU 5’ (listed as SEQ ID NO: 4 in the 5’ to 3 ’sense) siRNA-3

Guide strand: 5’ P-ACAGUAAGUAGUCUCUGGUGA 3’ (SEQ ID NO: 5) Passenger strand 3’ UUGGUCAUUCAUCAGAGACCA 5’ (listed as SEQ ID NO: 6 in the 5’ to 3 ’sense) A method for the preparation of a reverse micelle system as defined in any one of claims 1-8, which method comprises the following steps

(b) Stirring mixture obtained in step (a), at 40 °C or less, and for a time sufficient to obtain formation of reverse micelles, said stirring being carried out mechanically. A pharmaceutical composition comprising a reverse micelle system as defined in any one of claims 1-8, and at least a pharmaceutically acceptable carrier, excipient or support, optionally wherein the composition is administered by buccal, oral or rectal route . 44

11. The reverse micelle system of any of claims 1 to 8, or prepared according to claim 9, or the pharmaceutical composition of claim 10, for use in treating a pathology selected from the group consisting of an infection, a cancer and an autoimmune and/or inflammatory disease, preferably systemic lupus erythematosus. 12. The reverse micelle system of any of claims 1 to 8, or prepared according to claim 9, or the pharmaceutical composition of claim 10, for use in combination with an oncolytic virus or a composition thereof for the treatment of cancers.

13. The reverse micelle system or pharmaceutical composition for use of claim 12, wherein said oncolytic virus is a poxvirus, preferably a Vaccinia virus, optionally wherein said poxvirus or Vaccinia virus is defective for TK activity and/or RR activity.

14. The reverse micelle system or pharmaceutical composition for use according to any one of claims 12 or 13, wherein said cancer is resistant to oncolytic virus-based treatment, more particularly to poxvirus-based treatment, even more particularly to vaccinia virusbased treatment. 15. The reverse micelle system or pharmaceutical composition for use according to any one of claims 11 to 14, wherein said cancer is characterized by an overexpression of one or more genes linked to the interferon pathway, preferably wherein said gene is IFNAR1 gene.