WO2023020212A1 - Use of drd2 inhibitor in preparation of drug for treating diseases associated with liver fibrosis - Google Patents

Abstract

Use of a DRD2 inhibitor in the preparation of a drug for treating diseases associated with liver fibrosis. In one embodiment, the DRD2 inhibitor is Fluphenazine (Flu) and a pharmaceutically acceptable salt thereof.

Description

Application of DRD2 inhibitor in preparation of medicine for treating diseases related to liver fibrosis

priority application

This application claims the priority of the Chinese invention patent application [CN2021109490082] filed on August 18, 2021, entitled "Application of DRD2 Inhibitors in the Treatment of Liver Fibrosis", which is incorporated by reference in its entirety .

technical field

The invention belongs to the field of biomedicine, and mainly relates to the application of DRD2 inhibitors in the preparation of medicines for treating diseases related to liver fibrosis.

Background technique

Fibrosis can occur in multiple organs and is the final pathological outcome of many common chronic inflammatory, immune-mediated metabolic diseases and the main cause of morbidity and mortality in these diseases. A variety of noxious stimuli, including toxins, infectious pathogens, autoimmune responses, and mechanical stress, can induce fibrotic cellular responses. Fibrosis affects all tissues in the body and, if left unchecked, can lead to organ failure and death.

Fibrosis is a repair response to protect the relative integrity of tissues and organs after tissue damage. In response to tissue injury, myofibroblasts derived from multiple sources including resident fibroblasts, mesenchymal cells, circulating fibroblasts, and transdifferentiation of other cell types can initiate wounding by remodeling the extracellular environment Healing response to restore tissue integrity and promote parenchymal cell replacement. Normally, this pro-fibrotic program is switched off while the tissue is healing. However, sustained injury and damage can lead to dysregulation of this process, leading to pathologically excessive deposition of extracellular matrix (ECM) proteins, including collagen, laminin, and fibronectin, with concomitant myofibroblast activity Up-regulation of , resulting in a chronic inflammatory environment infiltrated by macrophages (and monocytes) and immune cells. And this "excessive deposition", although it repairs the damage, does not have the structure and function of the parenchymal cells of the organ, and will instead cause fibrosis and dysfunction of the organ.

The liver has the unique ability to regenerate damaged liver tissue. However, chronic or excessive liver injury often causes dysfunctional/dysregulated repair and a pronounced scarring response, leading to excessive scarring and fibrosis. Hepatic fibrosis often leads to cirrhosis and liver failure and is a pathological feature of liver diseases such as nonalcoholic steatohepatitis (NASH). Liver fibrosis involves dynamic interactions between parenchymal hepatocytes and nonparenchymal cells (NPCs), including immune cells, hepatic stellate cells (HSCs), and hepatic sinusoidal endothelial cells (ECs). The balance between liver regeneration and fibrosis may be modulated by "context-specific" mechanisms of the liver microenvironment.

Contents of the invention

The invention provides the application of the DRD2 inhibitor in the preparation of medicines for treating diseases related to liver fibrosis.

In one embodiment, the DRD2 inhibitor is fluphenazine (Flu) and pharmaceutically acceptable salts thereof.

In one embodiment, the disease associated with liver fibrosis is caused by chronic liver injury.

In one embodiment, the diseases associated with liver fibrosis include nonalcoholic steatohepatitis, autoimmune hepatitis, congenital liver fibrosis, nonalcoholic fatty liver disease, cholestatic liver disease, alcoholic hepatitis, viral One or more of hepatitis.

In one embodiment, the symptoms of the disease associated with liver fibrosis include increased levels of Yes-associated protein (YAP) in liver macrophages.

In one embodiment, the symptoms of a disease associated with liver fibrosis include increased levels of one or more of the following molecules: α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF), Vascular cell adhesion factor 1 (VCAM-1), collagen Ⅰ, Yes-associated protein (YAP), phosphorylated YAP, serum alanine aminotransferase (ALT), serum aspartate aminotransferase (AST) and liver Hydroxyproline.

In one embodiment, said medicament is used to selectively target said Yes-associated protein (YAP) pathway in said liver macrophages.

In one embodiment, the medicament is for upregulating the type I interferon response.

In one embodiment, the medicament is used to alleviate one or more of the following symptoms: liver fibrosis, liver damage, and intrahepatic lipid deposition.

In one embodiment, the medicament is for promoting hepatocyte proliferation and/or promoting liver regeneration.

In one embodiment, said medicament is used to reverse said liver fibrosis.

As used herein, "DRD2 inhibitor" refers to a substance that reduces or eliminates the activity of dopamine D2 receptors. DRD2 inhibitors may be compounds such as phenothiazines, clozapines. The DRD2 inhibitor can be fluphenazine (Fluphenazine, a phenothiazine piperazine derivative) and pharmaceutically acceptable salts thereof, such as fluphenazine hydrochloride, fluphenazine heptanoate, Fluphenazine decanoate, etc. The DRD2 inhibitor can be a polypeptide or protein, such as an antibody targeting dopamine D2 receptor. The DRD2 inhibitor can also be a gene editing tool capable of reducing or eliminating the expression of dopamine D2 receptor. In the present invention, "DRD2 inhibitor" and "DRD2 antagonist", "DRD2 inhibition" and "DRD2 antagonism" have the same meaning.

As used herein, "chronic liver injury" refers to damage to the liver caused by infection, exposure to drugs or toxic compounds, alcohol, impurities in food, abnormal accumulation of normal substances in the blood, autoimmune processes, genetic defects, or other factors chronic damage. Chronic liver damage may lead to liver fibrosis and cirrhosis.

As used herein, "diseases associated with liver fibrosis" refers to a class of diseases characterized by chronic liver damage and fibrosis. Exemplary "diseases associated with liver fibrosis" include autoimmune hepatitis, congenital liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), cholestatic liver disease, alcoholic Hepatitis, viral hepatitis.

As used herein, "reduce", "reduce", "alleviate", "block" and "inhibit" generally mean to reduce by a statistically significant amount, for example, by between about 10% and Any amount between approximately 100%.

As used herein, "increase", "enhance", "enhance", "activate", "upregulate" and "induce" generally mean increasing by a statistically significant amount, e.g., increasing relative to a reference level by about Any amount between 10% and about 100% or an increase of about 2-fold or more relative to a reference level.

As used herein, "liver regeneration" is a repair process in which the remaining hepatocytes in the liver grow out of a morphologically and/or functionally the same structure as before the damage or resection by proliferating after the liver is damaged or partially resected.

As used herein, "enhancing" refers to the further improvement of the described object at the existing level, and the existing level includes one or more of quantitative level, expression level, functional level, ability level.

As used herein, "reverse fibrosis" refers to transforming an organ in a fibrotic state to a regenerative direction, including reducing the level of fibrosis, reducing the severity of symptoms caused by fibrosis, enhancing regenerative ability, and the like.

Description of drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the description of the embodiments or the prior art. Apparently, the drawings in the following description are some embodiments of the present invention, and those skilled in the art can obtain other drawings according to these drawings without any creative effort.

Figure 1 shows that YAP levels are increased in macrophages from human cirrhotic livers and mouse fibrotic livers;

Figure 2 shows that deletion of myeloid-specific YAP attenuates liver fibrosis by stimulating type I interferon signaling;

Figure 3 shows scRNA-Seq analysis to determine the altered cell populations caused by myeloid-specific deletion of YAP after _CCl4 -induced chronic injury;

Figure 4 shows the determination of crosstalk between YAP-deficient macrophages and endothelial cells;

Figure 5 shows G protein-coupled receptor (GPCR) ligand library screening to identify dopamine receptor DRD2 antagonists targeting macrophage pro-fibrogenesis YAP;

Figure 6 shows that DRD2 antagonists and myeloid-specific deletion of Drd2 attenuate liver fibrosis;

Figure 7 shows selective targeting of the pro-fibrotic DRD2-YAP axis in macrophages attenuates liver fibrosis by stimulating type I interferon signaling;

Figure 8 shows that DRD2 antagonists reduce liver fibrosis in a minipig NASH model;

Figure 9 shows the percentage of F4/80 ⁺ cells relative to visual hepatocytes (related to Figure 1);

Figure 10 shows immunofluorescence or α-SMA and Sirius red staining for YAP (green), F4/80 (red) and DAPI (blue) for the number of injections shown in Figure 1B;

Figure 11 shows the knockout efficiency of myeloid-specific deletion of Yap (related to Figure 2);

Figure 12 shows immunofluorescent staining of F4/80 (A) or Desmin (green) (B) at the indicated number of injections (with IFN-β (red) and DAPI (blue), related to Figure 2I);

Figure 13 shows that IFN-β treatment protects liver function after _CCl4- induced injury (related to Figure 2);

Figure 14 shows immunofluorescence of F4/80 (green) or CD31 (red) and DAPI (blue) showing Yap1 ^fl/fl _Lyz2 -Cre ⁺ small Decreased number of macrophages or endothelial cells in mouse liver slices (associated with Figure 3);

Figure 15 shows a comparison of the frequencies of different cell populations in WT or Yap1 ^fl/fl Lyz2-Cre ⁺ mice (related to Figure 3);

Figure 16 shows a violin plot showing the expression of endothelial cell markers Cdh5 and Pecam1 in endothelial cell subsets (related to Figure 3);

Figure 17 shows a heatmap showing differentially expressed transcripts in endothelial cell subpopulations (related to Figure 3);

Figure 18 shows immunofluorescence and quantification of CTGF or VCAM1 (green), CD31 (red) and DAPI (blue) in liver sections from control or Yap1 ^fl/fl Lyz2-Cre ⁺ mice after ₃ injections of CCl (related to Figure 4);

Figure 19 shows immunofluorescence showing that macrophages labeled by F4/80 were mainly aggregated with sinusoidal endothelial cells (LYVE-1) after one injection of _CCl4 (scale bar, 50 μm; related to Figure 4);

Figure 20 shows immunofluorescence of DRD2, F4/80 (macrophages) and HNF- _4α (hepatocytes) demonstrating that DRD2 is selectively induced in macrophages but not in In hepatocytes (scale bar, 100 μm; related to Fig. 5);

Figure 21 shows immunofluorescence of DRD2 and YAP showing that, at the indicated _CCl injection times, these proteins were co-expressed in large quantities and that changes in their respective expression levels were correlated (scale bar, 100 μm; related to Figure 5);

Figure 22 shows body weight measured after Flu treatment in a _CCl4- induced chronic liver fibrosis model (related to Figure 6);

Figure 23 shows the knockout efficiency of Drd2 myeloid-specific deletion (related to Figure 6);

Figure 24 shows qRT-PCR analysis of mRNA expression of IFIT1, OAS2, MX1, ISG15 and IFIT3 in anti-IFNAR1 treated or control mice (related to Figure 7);

Figure 25 shows that immunofluorescence of YAP and F4/80 demonstrates that anti-IFNAR1 treatment does not affect YAP levels (related to Figure 7);

Figure 26 shows that antibody blockade of IFNAR1 signaling reverses enhanced liver regeneration in myeloid-specific DRD2 or YAP deficient mice (related to Figure 7);

Figure 27 shows immunofluorescence of VCAM1 (green) and CD31 (red) demonstrating that antibody blockade of IFNAR1 signaling reversed the repressed VCAM1 in myeloid-specific DRD2 or YAP-deficient mice (scale bar, 100 μm; 7 related);

Figure 28 shows the body weight measured from the 0th to the 58th injection of CCl ₄ after Flu treatment in the minipig NASH model induced by Western diet (WD) and chemical injury (n=2-4 minipig/group; related to Figure 8);

Figure 29 shows pathological examination of human control and cirrhotic sections (related to Figure 1);

Figure 30 shows the apparent effect of IFN-β treatment during or after liver fibrosis (repair) (related to Figure 2);

Figure 31 shows a summary schematic diagram of an embodiment of the invention.

Detailed ways

In order to make the purpose, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Apparently, the described embodiments are some, but not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without creative efforts fall within the protection scope of the present invention.

It should be noted that, in this document, the term "comprising", "comprising" or any other variation thereof is intended to cover a non-exclusive inclusion such that a process, method, article or apparatus comprising a set of elements includes not only those elements, It also includes other elements not expressly listed, or elements inherent in the process, method, article, or device. Without further limitations, an element defined by the phrase "comprising a ..." does not preclude the presence of additional identical elements in the process, method, article, or apparatus comprising that element.

As used in this specification, the term "about" typically means +/- 5% of the stated value, more typically +/- 4% of the stated value, more typically +/- 4% of the stated value /-3%, more typically +/-2% of the stated value, even more typically +/-1% of the stated value, even more typically +/-0.5% of the stated value.

In this specification, certain embodiments may be disclosed in a range of formats. It should be understood that this description "within a certain range" is merely for convenience and brevity, and should not be construed as an inflexible limitation on the disclosed scope. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, a description of a range 1 to 6 should be read as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc. , and individual numbers within this range, such as 1, 2, 3, 4, 5, and 6. The above rules apply regardless of the breadth of the scope.

Detailed description of the drawings

Figure 1: (A) Immunofluorescence staining for YAP (green), F4/80 (red) and DAPI (blue: nuclei) in 'human' control and cirrhotic liver sections. Scale bar, 100 μm. Data were quantified (n=5 samples/group). (B,C) Immunofluorescence for YAP (green) and F4/80 (red) on mouse liver sections after the indicated _CCl injections, as well as immunohistochemistry for α-SMA and Sirius red staining are shown and Quantification (n=4 mice/group). Scale bar, 100 μm. (D) Immunofluorescence and quantification of YAP (green) and F4/80 (red) in liver sections from control or nonalcoholic steatohepatitis (NASH) model mice (n = 4 mice/group). All results are expressed as mean ± SD. *p<0.05;**p<0.01.

^Figure 2: (AC) Sirius _red ^and Masson staining, _alpha - Immunofluorescent staining of SMA and collagen I and determination of hydroxyproline and collagen I (n=3 mice/group). Scale bar, 100 μm. (D,E,F) Sirius red and H&E staining, immunofluorescence staining for α-SMA and collagen I ^{, and} hydroxy Proline assay (n=3 or 4 mice/group). Scale bar, 100 μm. (G,H) GO enrichment analysis of RNA-Seq data from CD45 ⁺ CD11b ⁺ F4/80 ⁺ macrophages from livers of WT or Yap1 ^fl/fl Lyz2-Cre ⁺ mice after ₄ repeated CCl injections and heat map. FPKM (Fragments Per Kilobase of exon model per Million mapped fragments), fragments per kilobase of transcription per million mapped reads. (I) ELISA detection of IFN-β protein in livers of WT or Yap1 ^fl/fl Lyz2-Cre ⁺ mice after _repeated CCl injections (n=3 or 4 mice/group). (J) Quantification of IFNβ ⁺ F4/80 ⁺ or IFNβ ⁺ Desmin (desmin) ⁺ double positive cells relative to IFNβ ⁺ cells at the indicated number of CCl ₄ injections (n=4 mice/group). (K) Immunofluorescent staining of IFNβ and F4/80 in livers of WT or Yap1 ^fl/fl Lyz2-Cre ⁺ mice at the indicated number of CCl injections (n = 4 _mice /group). Scale bar, 100 μm. (L,M) Sirius red staining or Western blot analysis of α-SMA and collagen I in mouse livers of a chronic _CCl4- induced injury model with or without IFN-β treatment (n=3 or 4 mice /Group). Scale bar, 100 μm. (N) Myeloid-specific deletion of Yap attenuates liver fibrosis through upregulation of anti-fibrotic type I interferon in macrophages. All results are expressed as mean ± SD. *p<0.05;**p<0.01.

Figure 3: (A) Hepatic nonparenchymal cells (NPCs) isolated from mouse livers and subjected to scRNA-Seq after ₄ CCl injections. Cell lines were inferred from the expression of marker genes and annotated: B cell, B cells; T cell, T cells; Mono, monocytes; Neu, neutrophils; EC, endothelial cells; DC, dendritic cells; MP , macrophages; Hepa, hepatocytes; HSC, hepatic stellate cells. (B) Comparison of frequencies of different cell populations in control or Yap1 ^fl/fl Lyz2-Cre ⁺ mice. (C) Prediction and scoring of cell-cell interactions based on the ligand/receptor principle. (D,E) Violin plots showing the expression of the lineage-specific markers Adgre1, Clec4f, Macro and Trem2 in Pecam1 and Cdh5 in intrahepatic macrophages or EC subsets. (F,G) Heatmap showing genes preferentially enriched in the EC1 subpopulation, including Ctgf and Vcam1. (H) Deletion of Yap in myeloid cells blocks the generation of the Ctgf ⁺ Vcam1 ⁺ EC subset. (I,J) Expression profiles of the indicated marker genes Vimentin and Tgfb1 in HSCs.

Figure 4: (A) Quantification of the frequency of Ctgf ⁺ Vcam1 ⁺ ECs in healthy and cirrhotic human livers from a public database (http://www.livercellatlas.mvm.ed.ac.uk.). (BD) In control and cirrhotic human liver sections (n = 5 samples/group) and from WT or Yap1 ^fl/fl Lyz2-Cre ⁺ mouse liver sections (n = 4 mice) after ₁ injection of CCl4 /group), immunofluorescent staining and quantification of CTGF or VCAM1 (green), CD31 (red). Scale bar, 100 μm. (E) Immunofluorescence shows that VCAM1 or CTGF mainly co-localized with sinus endothelial marker (LYVE-1). Scale bar, 100 μm. (FH) IFN-β treatment suppressed CTGF and VCAM1 mRNA expression in mouse liver sections after ₁ injection of HUVECs and CCl4 (n=4 mice/group). Scale bar, 100 μm. (I) EMOA cells were co-cultured with control or YAP knockdown Raw264.7 cells for 2 days (left), or with giant cells isolated from WT or Yap1 ^fl/fl Lyz2-Cre+ mice after 1 injection of _CCl4 Phage cells were co-cultured for 2 days (right). The above cells were also treated with IgG or anti-IFNAR1 antibody at the same time. Analysis of mRNA expression of CTGF and VCAM1 in EMOA cells. Data shown are representative of 3 independent experiments. (J) Immunofluorescence staining, Sirius red and Masson staining of α-SMA and collagen I on liver sections from control or K-7174-treated mice after chronic _CCl4 injury (n=4 mice/group ). Scale bar, 100 μm. (K) Disruption of YAP in myeloid cells induces expression of anti-fibrotic type I IFN (which blocks expression of pro-fibrotic CTGF and VCAM1 in endothelial cells). All results are expressed as mean ± SD. *p<0.05;**p<0.01.

Figure 5: (A) Schematic diagram of the screening strategy based on the activity of the 8×GTIIC-luc reporter gene. (B) Luciferase assay for Flu treatment was performed in Raw264.7 or HepG2 cells. (C) Western blot analysis of DRD2 expression in hepatocytes and macrophages isolated from WT mice. (D) Immunofluorescence demonstrates that DRD2 is selectively highly expressed in macrophages (F4/80) but not in hepatocytes (HNF-4α) and correlates with altered levels of YAP. Scale bar, 100 μm. (E,F,G,H) Flu induced YAP phosphorylation and upregulated interferon β1 (Ifnb1) in Raw264.7 cells (E,G) or peritoneal macrophages (F,H). (I,J) Knockdown of endogenous DRD2 in Raw264.7 cells, resulting in phosphorylation of YAP and its upstream effectors (LATS1/2), and in 200ng/ml LPS (left) or vesicular stomatitis Upregulation of Ifnbl mRNA levels after 6 hours of virus (VSV, MOI=1) (right) stimulation. (K) Combined with the GPCR compound library screening platform and YAP-based cell reporter, the DRD2 antagonist Flu that selectively blocks the Hippo/YAP signaling of "macrophages" but not "hepatocytes" was identified. Data presented are representative of 3 independent experiments. All results are expressed as mean ± S.D. *p<0.05; **p<0.01. n.s., not significant; MOI, multiplicity of infection; shRNA, short hairpin RNA.

Figure 6: (A) Immunofluorescence of DRD2 (green) and F4/80 (red) in control and cirrhotic human liver sections (n=5 samples/group). Scale bar, 100 μm. (BE) Sirius red, Masson, and α-SMA and collagen I after _CCl4 chronic injury with or without Flu treatment (B,C) or in WT or Drd2 ^fl/fl Lyz2-Cre+ mice (D,E) Immunofluorescent staining of , and ALT or AST activity (n=3 or 5 mice/group). Scale bar, 200 μm. **p<0.01. (FJ) Myeloid deletion of Drd2 attenuates liver fibrosis in bile duct ligation (BDL) (F,J) and NASH (HJ) models by immunofluorescent staining of Sirius red and H&E, α-SMA and collagen I, ALT and AST activities and measurements of hydroxyproline were assessed (n=3-4 mice/group). Scale bar, 100 μm. (K) Pharmacological inhibition of DRD2 or myeloid-specific Drd2 deletion attenuates liver fibrosis. All results are expressed as mean ± SD. *p<0.05;**p<0.01.

Figure 7: (A,B) KEGG enrichment of RNA-sequencing data from CD45 ⁺ CD11b ⁺ F4/80 ⁺ liver macrophages from WT or Drd2 ^fl/fl Lyz2-Cre ⁺ mice after 4 _CCl injections Pathway analysis and scatterplots. FC, fold change. (C,D) Deficiency of myeloid-specific DRD2 upregulated IFN-β expression and suppressed CTGF and VCAM1 expression after 1 or 3 injections of _CCl4 (n = 4 mice/group). Scale bar, 100 μm. (E) Ki67 staining assessed hepatocyte proliferation in WT, Yap1 ^fl/fl Lyz2-Cre ⁺ and Drd2 ^fl/fl Lyz2-Cre ⁺ mice after 7 _CCl injections (n = 3 mice/group). Scale bar, 50 μm. (FJ) Antibody blockade of IFNAR1 signaling reversed attenuation of liver fibrosis in myeloid-specific DRD2 or YAP deficient mice (n=3 or 4 mice/group). Sirius red and Masson _staining (F,G), liver hydroxyproline (H ) and VCAM1 and Ki67 expression (I, J). Scale bar, 100 μm. (K) Selective targeting of pro-fibrotic DRD2-YAP in macrophages attenuates liver fibrosis by promoting anti-fibrotic type I IFN production, which can be reversed by antibody blockade of type I IFN signaling . All results are expressed as mean ± SD. *p<0.05;**p<0.01.

Figure 8: (A) Schematic summarizing the experimental setup for assessing the efficacy of the DRD2 antagonist Flu in the minipig NASH model induced by Western diet and chemical insult. (B-D) Liver fibrosis in Flu-blocked minipig NASH model (n=3 minipigs/group). Sirius Red, Oil Red O, H&E staining (B) and immunofluorescent staining (C) and hydroxyproline assay (D) for αSMA and collagen I on minipig liver sections. Scale bar, 200 μm. (E) Ki67 staining was performed on minipig liver sections to assess the proliferation of hepatocytes in the NASH model. Scale bar, 50 μm. All results are expressed as mean ± S.D. *p<0.05; **p<0.01.

Figure 9: Data quantified as percentage of F4/80 ⁺ cells relative to visual hepatocytes in control and cirrhotic human liver sections as shown in Figure 1A. All results are shown as mean ± SD. *p<0.05;**p<0.01.

Figure 11: (A) qRT-PCR analysis of YAP mRNA in wild type (WT) and Yap1 ^fl/fl Lyz2-Cre ⁺ BMDMs. (B) Western blot analysis of YAP expression in wild-type and Yap1 ^fl/fl Lyz2-Cre ⁺ BMDMs.

Figure 13: ALT activity was measured in the sera of the indicated groups of mice (n=3 or 4 mice/group). All results are shown as mean ± S.D. *p<0.05; **p<0.01.

Figure 14: n=4 mice/group. All results are shown as mean ± S.D. *p<0.05; **p<0.01.

Figure 18: n=4 mice/group. Scale bar, 100 μm. All results are shown as mean ± S.D. *p<0.05; **p<0.01.

Figure 22: n=4 mice/group. All results are shown as mean ± S.D.

Figure 23: (A) qRT-PCR analysis of DRD2 mRNA in WT and Drd2 ^fl/fl Lyz2-Cre ⁺ BMDMs. (B) Immunoblot analysis of DRD2 expression in WT and Drd2 ^fl/fl Lyz2-Cre ⁺ BMDMs.

Figure 24: Results showing that anti-IFNARl treatment successfully inhibited IFN-β signaling (n=3 or 4 mice/group). All results are shown as mean ± S.D. *p<0.05; **p<0.01.

Figure 25: n=3 or 4 mice/group. Scale bar, 100 μm. All results are shown as mean ± S.D. *p<0.05; **p<0.01.

Figure 26: Ki67 staining to assess hepatocyte proliferation in WT, Yap1 ^fl/fl Lyz2-Cre ⁺ or Drd2 ^fl/fl Lyz2-Cre ⁺ mice after chronic injury of _CCl4 with or without antibody blockade of IFNAR1 signaling . Scale bar, 50 μm.

Figure 29: (A) H&E staining showing the formation of pseudolobules in cirrhotic liver sections. (B,C) Immunofluorescence staining showed that the expressions of α-SMA and type I collagen were significantly increased in cirrhotic liver sections (n=5 samples/group). Scale bar, 100 μm. All results are shown as mean ± S.D. *p<0.05; **p<0.01.

Figure 30: Sirius red staining, α-SMA or type I collagen expression in IFNβ- _CCl4 (1-4) (A) or IFNβ- _CCl4 (4-7) models (B) were quantified. The IFNβ-CCl ₄ (1-4) model evaluates the effect of IFN-β on liver fibrosis at the early stage (four injections) of CCl ₄ chronic injury. The IFNβ-CCl ₄ (4-7) model evaluates the effect of IFN-β on hepatic repair in late stages (four to seven injections) of CCl ₄ chronic injury (n=4 mice/group). Scale bar: 100 μm. All results are shown as mean ± SD. *p<0.05;**p<0.01; ns, not significant.

Embodiment one: material and method

Human subjects: Liver biopsy samples from 5 clinically high fibrosis grades (F3-F4) cirrhotic patients and 5 non-cirrhotic patients were obtained from the Department of Hepatobiliary, West China Hospital, Sichuan University. Clinical information for this cohort is summarized in Table 1. Hepatic explants from cirrhotic or control patients were partially fixed with 4% paraformaldehyde (for histochemical analysis) and partially embedded with OCT (for immunofluorescence analysis).

Table 1 Basic information of patients

Remarks: TBIL, total bilirubin; DBIL, direct bilirubin; IBIL, indirect bilirubin; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALP, alkaline phosphatase; GGT , glutamyl transpeptidase. F0 or F4, different pathological grades of human liver fibrosis.

Mouse Model: Mice were maintained in a specific pathogen free (SPF) environment. Yap1 ^fl/fl mice (Stock No. 032192, Jackson Laboratory, Bar Harbor, ME) and Drd2 ^fl/fl mice (Stock No. 020631, Jackson Laboratory) were crossed with the Lyz2-Cre transgene to obtain Yap1 ^fl/fl -Lyz2, respectively -Cre ⁺ and Drd2 ^fl/fl -Lyz2-Cre ⁺ mice. Mice were genotyped using polymerase chain reaction (PCR) with tail DNA as template. To induce liver injury and fibrosis, CCl ₄ (Sigma-Aldrich) was dissolved in corn oil (Sigma-Aldrich) to give a concentration of 40% (0.64 g/ml) as previously described [Ref. S1], and Liver fibrosis was induced by intraperitoneal injection of 1.6 g/kg of CCl ₄ to mice every 3 days for 7 times; or corn oil was used as a control to less induce liver damage. Two days after the last injection, mice were sacrificed for analysis. In some experiments, liver fibrosis was also induced by extrahepatic cholestasis by bile duct ligation (BDL) [ref. S1] or in NASH models induced by Western diet (WD) and chemical insult [ref. S2]. For BDL, mice were anesthetized with isoflurane via an inhaler. The control group received a sham operation consisting of exposure but no ligation. Twenty days after surgery, mice were analyzed. To generate the NASH model [Ref. S2], mice were fed a Western diet containing 21.1% fat, 41% sucrose and 1.25% cholesterol (w/w) and a diet containing 23.1 g/L d-fructose and 18.9 g/L d- Glucose high glucose solution, continued for 20 weeks, and treated with 0.32g/kg of CCl ₄ , intraperitoneal injection, once a week. For the treatment method, during the chronic injury of _CCl4 , mice were injected peritoneally with Flu (MCE, catalog HY-A0081, 1 mg/kg), IFN-β protein (Sino Biological, catalog 50708-MCCH, 20 ug/kg), K- 7174 (25 mg/kg) or anti-mouse IFNAR-1 antibody (BioLegend, MAR1-5A3, 5 mg/kg). At the indicated time points, mice were sacrificed and whole liver tissues were collected for analysis of fibrogenesis.

Table 2 Information of the antibodies used in the present invention

Antibody	catalog number	supplier	application	dilution
YAP	ab205270	abcam	WB	1:1000
YAP	14074	CST	IF	1:200
YAP (phosphoS127)	ab76252	abcam	WB	1:1000
LATS1/2(phosphoT1079+T1041)	ab111344	abcam	WB	1:1000
LATS1	3477	CST	WB	1:1000
Collagen I	84336s	CST	WB	1:1000
Collagen I	ab34710	abcam	IF	1:200

Miniature pig model: Bama miniature pigs were purchased from Chengdu Dashuo Biotechnology Co., Ltd. and raised in Chengdu Dashuo Experimental Animal Center. Each piglet was individually housed in a single cage. Male minipigs were used in NASH studies [Refs S2-S4]. Minipigs were fed a high-fat diet (containing 2% cholesterol and 30% fat [w/w]) and high-sugar water (2.31% fructose and 1.89% glucose) and injected every 3 days with 20% _CCl4 dissolved in corn oil ( 0.25ml/kg). The treatment group was injected with Flu (0.11 mg/kg, 5% dimethyl sulfoxide (DMSO)) every 3 days, while the control group was injected with the same volume of normal saline (containing 5% DMSO). The experiment lasted 6 months, and liver biopsies were taken to test the effect of Flu treatment.

Cells: RAW264.7 cells, HEK293T cells and HepG2 cells were cultured in supplemented with 10% (v/v) fetal bovine serum (FBS) (catalogue number 10099-141) (GIBCO, USA), 100 U/ml penicillin and 100 μg/ml Streptomycin in Dulbecco's modified Eagle's medium (DMEM) (GIBCO, USA), 37°C, 5% CO2 in a humidified incubator. EMOA (mouse hemangioendothelioma cells) were cultured in the primary endothelial cell culture system (PriMed-iCell-002). Isolation of mouse peritoneal macrophages and bone marrow-derived macrophages (BMDMs) [Ref. S5]: Four days after injection of thioglycolate, peritoneal macrophages were harvested from mice and cultured in media supplemented with DMEM with 10% FBS. BMDMs were isolated from tibia and femur, and cells were cultured in DMEM with 10% FBS, glutamine and 30% L929 supernatant at 37°C for 7 days.

GPCR protein compound library screening: For screening experiments in HEK293T cells, a GPCR/G protein compound library (489 compounds dissolved in DMSO, 10 mM) was obtained from MCE (MedChemExpress Inc.). The sequence of the YAP/TAZ reactive promoter was previously described and cloned into the pGL3-basic vector to construct the 8×GTIIC-Luc reporter [ref. S6]. HEK293T cells were transfected with plasmids with 8 x GTIIC-Luc reporter or PGL3-promoter (as a reference for normalization of transfection efficiency). After 24 hours, cells were plated on blank clear-bottom 96-well plates and grown overnight. Subsequently, drugs were transferred from library stock plates (10 mM in DMSO) to plates containing 10 [mu]M cells. After another 24 hour incubation, the cells in the 96-well plate were lysed and tested for luciferase activity. Luminescence was detected according to the protocol of the Bright-Glo luciferase detection system (Promega). Experiments in HepG2 cells were performed with a similar procedure. For experiments in Raw264.7 cells, the 8×GTIIC-Luc sequence was cloned into the pEZX-LvGA01 lentiviral vector (GeneCopoeia) to construct the Lv-8×GTIIC-Luc reporter (contains 2 reporter genes: for testing Gaussia luciferase (Gluc) of the YAP-responsive promoter and secreted alkaline phosphatase (SEAP) normalized according to transfection efficiency as a reference). Screening of lentiviral particles and stable cell lines were prepared as before. Luminescence was detected according to the protocol of the Secrete-Pair ^™ Dual Luminescence Detection Kit (GeneCopoeia).

Silencing of endogenous DRD2 or YAP: Based on the pGLVU6/Puro vector (Shanghai GenePharma), a shRNA recombinant lentivirus targeting mouse DRD2 was constructed. The shRNA sequence information used in the present invention is as follows: NC, 5'-TTCTCCGAACGTGTGTCACGTTTC-3' (SEQ ID NO: 1); shDRD2-1, 5'-CCACTACAACTATGCCAT-3' (SEQ ID NO: 2), shDRD2-2, 5 '-GACCAGAATGAGTGTATCATT-3' (SEQ ID NO:3), shDRD2-3, 5'-CAGGATTCACTGTGACATCTT-3' (SEQ ID NO:4); shYAP-1, 5'-CCACCAAGCTAGATAAAGAAA-3' (SEQ ID NO:5 ), shYAP-2, 5'-GCGGTTGAAACAACAGGAATT-3' (SEQ ID NO: 6), shYAP-3, 5'-CTGGTCAAAGATACTTCTTAA-3' (SEQ ID NO: 7). The LV2 plasmid containing the shRNA sequence and the helper plasmids (pMD2.G and pSPAX2) encoding the backbone structure were co-transfected into HEK293T cells by using lipofectamine 6000 transfection reagent (Biyotime, China). The above "shRNA sequence" actually refers to the DNA sequence corresponding to the shRNA (that is, the base U involved in the RNA sequence is replaced by the base T), and this naming method is established by those skilled in the art. Those skilled in the art first design the desired shRNA sequence and its corresponding DNA sequence; then synthesize the DNA sequence corresponding to the shRNA and connect it to a vector (such as a plasmid) and transfect it into a host cell; finally, the desired shRNA will be expressed in the host cell expression and exert its gene silencing function. After 48 hours, the supernatant was collected and filtered through a 0.22 μM membrane. The supernatant was diluted 1:4 and then incubated with Raw 264.7 cells for 48 hours at 37°C, 5 μg/ml polybrene. For stable gene knockdown in cell lines, infected cells were cultured in selection medium containing 5 μg/ml puromycin (Invitrogen) during the first 48 hours after transduction, and after about 1 week in culture, Obtain stable gene knockdown. All knockdown cell lines were confirmed by Western blot analysis. DRD2-knockdown and Raw264.7 cells were stimulated with 200 ng/ml LPS or vesicular stomatitis virus (MOI=1) for 6 hours, and IFNb1 transcripts were detected by qRT-PCR.

In vitro Transwell co-culture: Experiments were performed as previously described [Ref. S7]. EMOA cells were seeded in the upper chamber of Transwell-24 chambers (Corning, pore size 0.4 μm and diameter 6.5 mm) in 100 μL of primary endothelial cell culture system and allowed to attach for 1 hour at 37° C. and 5% CO 2 . The medium was removed and replaced with 100 μL of co-culture medium (1:1 ratio of DMEM (Raw264.7) or PRIM1640 (isolated liver macrophages) to primary endothelial cell culture system supplemented with 10% FBS), to support cell survival. Transwell chambers containing EMOA cells were transferred to wells seeded with macrophages (n=3 per phenotype). Add additional co-cultivation medium to the lower and upper chambers, respectively. After 2 days, transfer the Transwell chambers to a clean 24-well plate. EMOA cells were directly lysed in the chamber with 500 μL TRIzol and subjected to qRT-PCR analysis.

Isolation and analysis of mouse liver macrophages and hepatocytes: Liver tissue was finely minced with scissors and treated with 2 mg/ml collagenase A and DNase as previously described (with some modifications) [ref. S8]. Cell-to-cell contacts were broken using an 18G syringe, and the cell suspension was filtered and centrifuged. Then, the cell pellet was washed once with DPBS and treated with erythrocyte lysis reagent, and the cells were washed, centrifuged and resuspended in DPBS. For flow cytometric analysis and sorting, cells were blocked in 10% normal goat serum for 10 min at 4°C prior to antibody staining for CD45 ⁺ , CD11b ⁺ and F4/80 ⁺ . Flow cytometry was performed on a FACS Aria II cell sorter (BD Biosciences), and data were analyzed with FlowJo software. Single cells from specific populations are collected for subsequent RNA-sequencing analysis. For the isolation of mouse hepatocytes or liver macrophages, centrifuge the cell suspension of mouse liver at 50 g for 2 min. The pellet mainly contained hepatocytes, and the supernatant suspension mainly contained nonparenchymal cells (NPCs). NPCs were centrifuged and washed by 1-2 mL of MACS buffer (Miltenyi, 130-091-221), and centrifuged and resuspended in 90 μL of MACS buffer. Then, NPCs were incubated with anti-F4/80 magnetic beads (Miltenyi, 130-110-443) and incubated at 4°C for 15 minutes with shaking. F4/80 ⁺ cells were labeled with anti-F4/80 magnetic beads and collected using LS MACS columns (Miltenyi, 130-042-401 ) and separators. Wash the column three times with 3 mL of MACS buffer to remove excess beads and unlabeled cells. After removing the column from the magnetic field, magnetically retained F4/80 ⁺ cells were eluted as selected cells.

Mouse immunostaining (IF), histological and biochemical assays: experiments were performed as described previously with some modifications [ref. S9]. Serum was collected and stored at -70°C for determination of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) by Huaxi Haiqi Pharmaceutical Technology (WCFP). The liver was cut into four parts for each of the following analyses: (1) stored in 10% formalin for histology; (2) frozen at –80°C for hydroxyproline; (3) OCT embedding and cryosection; and (4) Immediately used for protein and RNA isolation. For immunohistochemistry (IHC), liver tissues were fixed in 10% neutral buffered formalin, embedded in paraffin and cut into 4 μm thick sections. Slides were deparaffinized and hydrated. Antigen retrieval was performed by heating in 10 mM sodium citrate buffer (pH 6.0) for 10 minutes and cooling for 2 hours, followed by rinsing with PBS. Samples were then incubated in 3% hydrogen peroxide to block endogenous peroxidases, blocked in 10% sheep serum for 30 minutes at room temperature and incubated with primary antibodies overnight at 4°C. A two-step universal anti-rabbit/mouse immunohistochemistry kit (ZSGB-BIO) was used to visualize proteins. For immunofluorescence staining, liver tissues were frozen in OCT compound and cut into 6 μm thick sections and fixed with 10% neutral buffered formalin. After fixation, slides were blocked in 10% sheep serum for 30 min at room temperature, followed by incubation overnight at 4°C with primary antibody and 1 h with secondary antibody. Samples were stained with DAPI and sealed. The concentration of IFN-β in mouse liver was measured by ELISA kit (R&D Systems). Liver tissue was minced with scissors and washed with PBS (1 ml PBS/0.5 g liver) at 4° C. for 10 minutes with constant gentle inclination. The mixture was centrifuged at 1500 rpm for 10 minutes, and the supernatant was evaluated with an ELISA kit.

RNA quantification and sequencing: Total cellular RNA was isolated using TRIzol reagent following standard protocols. One-step qRT-PCR was performed with QuantiTect SYBR Green RT-PCR kit (Qiagen, Germany) using Applied Biosystems 7500 real-time thermal cycler (Applied Biosystems, USA). The sequences of RT-PCR primers used in the present invention are shown in Table 3. Target gene and GAPDH transcript levels were determined by the ΔΔCT method. According to the standard procedure, the total cellular RNA of mouse liver macrophages sorted by flow cytometry was isolated with TRIzol reagent, and sent to Beijing Genomics Institute (BGI) for RNA sequencing analysis. Transcriptome libraries were constructed using BGISEQ-500RS RNA-Seq (quantitative). Align the sequenced reads (Sequenced reads) with the mouse (Mus musculus) reference genome (GRCm38.p5) with HISAT2 (version 2.1.0) [Reference S10], and use HTSeq-count (version 0.9.1) Aligned reads were quantified for mRNA expression [ref. S11]. DESeq2 (R/Bioconductor package) was used to determine differentially expressed genes between samples [ref. S12]. Pathway enrichment analysis and Gene Ontology (Gene Ontology) analysis were performed using KOBAS 3.0 (available online: http://kobas.cbi.pku.edu.cn/).

Table 3 All RT-PCR primers used for mouse cells

mIfit1RT-S	CTGAGATGTCACTTCACATGGAA (SEQ ID NO:8)
mIfit1RT-A	GTGCATCCCAATGGGTTCT (SEQ ID NO: 9)
mOas2RT-S	GGACCGTGCTGCGACTTAT (SEQ ID NO: 10)
mOas2RT-A	ACCCATCATCTTTGCCCAC (SEQ ID NO: 11)
mMx1RT-S	GACCATAGGGGTCTTGACCAA (SEQ ID NO: 12)
mMx1RT-A	AGACTTGCTCTTTCTGAAAAGCC (SEQ ID NO: 13)
mIsg15RT-S	GGTGTCCGTGACTAACTCCAT (SEQ ID NO: 14)
mIsg15RT-A	TGGAAAGGGTAAGACCGTCCT (SEQ ID NO: 15)
mIFIT3RT-S	CCTACATAAAGCACCTAGATGGC (SEQ ID NO: 16)
mIFIT3RT-A	ATGTGATAGTAGATCCAGGCGT (SEQ ID NO: 17)
mGAPDH-S	GTGCCGCCTGGAGAAACCT (SEQ ID NO: 18)
mGAPDH-A	TGAAGTCGCAGGAGACAACC (SEQ ID NO: 19)
mIFNb1-S	GCGTTCCTGCTGTGCTTCT (SEQ ID NO: 20)
mIFNb1-A	TCTTCTGCATCTTCTCCGTCA (SEQ ID NO: 21)
mVcam1-S	CTTGTGGAAATGTGCCCGAAAC (SEQ ID NO: 22)
mVcam1-A	TGTGCCTGGCGGATGGTGTA (SEQ ID NO: 23)
mctgf-S	TCTCCACCCGAGTTACCAATG (SEQ ID NO: 24)
mctgf-A	AATGTTTTTCCTCCAGGTCAGC (SEQ ID NO: 25)

Single-cell RNA sequencing and analysis: According to the procedure of Guangzhou Gideo Biotechnology Co., Ltd., NPCs were loaded into the GemCode instrument (10×Genomics) to generate single-cell gel beads in emulsion (Gel Bead in emulsion, GEMs). Briefly, PCR tubes containing GEMs are placed on the PCR machine to generate cDNA. According to the 10×Genomics single-cell 3' library construction V3 process, 35 μL cDNA obtained by reverse transcription was added to 65 μL cDNA amplification mixture to amplify the cDNA. Library quality detection was performed using a high-sensitivity DNA detection kit (Agilent Technologies). Finally, ABI Step One Plus real-time PCR system (Life Technologies) was used for quantification and pooling, and sequencing was performed according to the PE150 mode of illuminaNovaseq. Overall, 5269 cells from wild-type NPCs passed the quality control threshold of >1000 transcripts and 4731 cells from Yap1 ^fl/fl -Lyz2-Cre+ NPCs passed. All datasets were analyzed and processed by the R 3.6.1 Seurat package [S8].

Western blotting (WB): For Western blot analysis, cells were incubated with 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 2 mM EDTA and protease inhibitor cocktail (Roche, Switzerland) lysed in IB buffer. The protein concentration of the lysate was determined by a spectrophotometer. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes (Millipore, USA). The membrane was blocked overnight at 4°C with a solution of 5% skim milk powder in Tris-buffered saline. Then, the membrane was blotted with the specific primary antibody for 1 hour and washed 3 times for 5 minutes with Tris buffered saline solution containing 0.1% Tween-20 (v/v). It was then incubated with horseradish peroxidase-conjugated secondary antibody for 45 minutes and washed 5 times for 5 minutes with Tris-buffered saline containing 0.1% Tween 20 (v/v). Proteins were visualized and quantified by ImageJ software using chemiluminescence with Clarity Western ECL substrate (Bio-rad, USA).

Statistical Analysis: Data analysis was performed by GraphPad Prism 6 software. Data are presented as mean ± SD. Statistical analysis of differences between two groups was performed using a two-tailed Student's t-test, and comparisons between multiple groups were performed using a one-way ANOVA followed by Dunnett's test. p-values less than 0.05 and 0.01 were considered significant and very significant, respectively, and were expressed as p<0.05=*;p<0.01=**.

Example 2: YAP levels increase in macrophages of human cirrhotic liver and mouse fibrotic liver

To analyze YAP expression in macrophages in cirrhotic patients, human liver samples from non-cirrhotic or cirrhotic patients were immunofluorescently stained for YAP and F4/80. observed that YAP expression was significantly increased in human cirrhotic liver samples. In particular, YAP expression induced during cirrhosis was found to be partially colocalized with F4/80 ⁺ macrophages ( FIG. 1A , FIGS. 29A-29C , FIG. 9 ). To elucidate the role of YAP in modulating liver repair, a model of chronic liver fibrosis was used in which liver fibrosis was induced by repeated intraperitoneal injections of carbon tetrachloride ( _CCl4 ) injury [Ref. 2]. Liver fibrosis was assessed by immunohistochemistry of α-smooth muscle actin (α-SMA) and morphometric analysis of Sirius red. In the early stages of 1 to ₄ CCl injections, α-SMA and Sirius red were gradually enhanced, and liver fibrosis was evident after ₄ CCl injections (Fig. 1B), which is consistent with what was reported in [Ref. 2] . Immunofluorescence staining showed that, as in acute injury, the expression of YAP protein in the liver significantly increased after 1 injection of _CCl4 , and thereafter decreased in chronic injury. YAP levels in macrophages gradually increased from 1 to 4 injections of _CCl4 and remained stable thereafter (Fig. 1B-1C, Fig. 10). Furthermore, macrophage YAP levels were also increased in diet- and chemical-induced mouse NASH models [ref. S2] compared with controls (Fig. 1D). Collectively, these data demonstrate that macrophage YAP is increased in the livers of humans and mice with fibrosis, leading the inventors to explore the possibility that YAP expression in macrophages may be a contributing factor to liver fibrosis.

Example 3: Myeloid-specific YAP deficiency alleviates liver fibrosis in mice and liver fibrosis in NASH model

In order to study the function of macrophage YAP protein in liver repair, the experimenters used myeloid-specific Yap gene knockout mice (Yap1 ^fl/fl Lyz2-Cre ⁺ mice), and the efficiency of Yap deletion was determined by quantitative PCR and Western Confirmed by blot (FIGS. 11A-11B). Masson's and Sirius red staining showed that Yap1 ^fl/fl Lyz2-Cre ⁺ mice exhibited significantly reduced liver fibrosis after chronic _CCl4 injury (Fig. 2A). The amounts of α-SMA), collagen I, and hydroxyproline were also decreased in the livers of Yap1 ^fl/fl Lyz2-Cre ⁺ mice compared with control mice (Fig. 2B-2C). Similarly, in a mouse NASH model [ref. S2], Yap1 ^fl/fl Lyz2-Cre ⁺ mice showed reduced liver fibrosis (Fig. 2D-2F). These results suggest that myeloid-specific deletion of Yap hinders liver fibrosis after chronic liver injury or NASH.

Example 4: Genetic deletion of YAP in macrophages activates type I interferon signaling after chronic liver injury

To further characterize the pro-fibrotic function of macrophage YAP, CD45 ⁺ CD11b ⁺ F4/80 ⁺ macrophages were isolated from myeloid Yap-deficient mice or control mice after ₄ injections of CCl4 and analyzed. RNA sequencing analysis. 416 differentially expressed genes were identified (P<0.05, fold change cut-off >1.5). Gene Ontology (GO) enrichment analysis revealed six major enriched pathways, including 'wound healing' and 'response to interferon beta (IFN-β)' (Fig. 2G). Genes related to class I interferon signaling were upregulated in Yap-deficient macrophages, including Ifnb1, Ifi27I2a, Ifi44, Isg15, etc. (Fig. 2H). IFN-β protein is mainly produced by macrophages and is increased in the liver of myeloid Yap-deleted mice during the early stages of _CCl4 -induced chronic injury, but at later stages (during which, HSCs marked by desmin, an important source of IFN-β protein) did not increase (Fig. 2I-2K, Fig. 12A-12B). Immunofluorescence staining revealed that hepatic IFN-β protein expression was significantly increased in bone marrow Yap-deleted macrophages after 1 or 3 injections of _CCl4 (Fig. 2K). Treatment with IFN-β attenuated liver fibrosis after chronic _CCl4 injury, confirming its anti-fibrotic function (Fig. 2L-2M, Fig. 13). Interestingly, IFN-β mainly exerts this activity during the early stages of _CCl4- induced chronic injury, rather than after fibrosis has already occurred (Fig. 30A-30B). These data imply that myeloid-specific deletion of Yap activates type I interferon signaling and prevents liver fibrosis, especially at initiation (Fig. 2N).

Example 5: Single-cell analysis identifies altered cell populations caused by YAP deficiency in macrophages

The profibrotic effect of YAP in macrophages was subsequently deciphered at the single-cell level. Single-cell RNA sequencing (scRNA-Seq) analysis of liver NPCs from Yap1 ^fl/fl Lyz2-Cre ⁺ mice or control mice after _four CCl injections identified 21 groups (Figure 3A). Unified Manifold Approximation and Projection (UMAP) analysis of NPCs revealed that the frequency of macrophage and EC populations was most dramatically reduced in Yap1 ^fl/fl Lyz2-Cre ⁺ mice (which was confirmed by immunofluorescence staining) (Fig. 3A- 3B, Figure 14, Figure 15). Furthermore, the prediction of cellular crosstalk based on the ligand/receptor principle also indicated the possibility of high-level interactions between macrophages and ECs (Fig. 3C). Specific markers for macrophages (Adgre1, Clec4f, Macro and Trem2) and ECs (Pecam1 and Cdh5) were determined (Fig. 3D-3E). Single-cell t-distributed stochastic neighborhood embedding (tSNE) analysis of ECs revealed five cell subpopulations, among which EC subpopulation 1 (EC1) showed higher expression of the pro-fibrotic genes Ctgf and Vcam1 (Fig. 3F–H, Fig. 16, Figure 17). Therefore, the inventors decided to focus on determining the crosstalk between macrophages and EC populations. In addition, other cell types, including HSCs, were also affected after myeloid-specific Yap deletion (Fig. 3I-3J).

Example 6: Crosstalk between YAP-deficient macrophages and endothelial cells affects liver fibrosis

analyzed a published scRNA-Seq dataset of liver-resident cells [ref. S8], and found that the CTGF ⁺ VCAM1 ⁺ endothelial cell subset was increased in human cirrhotic livers (Fig. 4A). Human liver samples from non-cirrhotic or cirrhotic patients were co-stained for CTGF or VCAM1 with the endothelial marker CD31. In cirrhotic liver samples, the expression of CTGF and VCAM1 was significantly increased in CD31 ⁺ ECs (Fig. 4B-4C). In a mouse model of _CCl4 injury, CTGF and _VCAM1 in endothelial cells were highly upregulated after 1 or 3 CCl4 injections, which was reversed by myeloid-specific Yap deletion (Fig. 4D, Fig. 18). Immunofluorescence staining showed that macrophages mainly aggregated with CTGF ⁺ VCAM1 ⁺ sinus endothelial cells marked by LYVE-1 (lymphatic endothelial cell receptor 1) after 1 injection of _CCl4 (Fig. 4E, Fig. 19).

We next investigated whether the interferon response suppresses the emergence of CTGF ⁺ VCAM1 ⁺ endothelial cell subsets. Primary human endothelial HUVECs were treated with IFN-β, and the expression of CTGF and VCAM1 was examined. In vitro experiments showed that IFN-β protein attenuated the expression of CTGF and VCAM1 on human umbilical vein endothelial cells (HUVECs) (Fig. 4F). In vivo, IFN-β treatment downregulated the expression of CTGF and VCAM1 on ECs after 1 injection of CCl ₄ ( FIGS. 4G-4H ). To demonstrate macrophage-endothelial cell crosstalk, Raw264.7 or isolated liver macrophages were co-cultured with mouse hemangioendothelioma endothelial (EMOA) cells. After co-culture of EMOA cells with YAP-knockdown Raw264.7 cells or isolated YAP-deficient liver macrophages, expression of CTGF and VCAM1 was suppressed in EMOA cells; antibody blockade of IFNAR1 signaling reversed this suppression ( Figure 4I). Multiple publications have shown that gene knockdown or deletion of connective tissue growth factor (CTGF) has been shown to attenuate the development of liver fibrosis [Refs 33-35]. And K-7174, a VCAM1 blocker (blocker), was found to attenuate liver fibrosis after chronic CCl ₄ injury (Fig. 4J). Therefore, the present data imply that crosstalk between YAP-deficient macrophages and endothelial cells affects liver fibrosis (Fig. 4K).

Example 7: High-throughput GPCR ligand library screening to determine compounds that selectively antagonize YAP that promotes fibrosis in macrophages

The inventors conducted a screening experiment with a GPCR protein compound library and found that Fluphenazine dihydrochloride (Flu), a classic dopamine receptor D2 (DRD2) antagonist, can effectively target and block dopamine receptor body D2 for therapeutic use), was one of the most potent compounds at reducing YAP activity (Fig. 5A). Furthermore, Flu decreased the signal of YAP response in macrophage Raw264.7 but not in hepatocyte HepG2 (Fig. 5B). Western blotting of proteins isolated from mouse liver macrophages or hepatocytes confirmed that DRD2 was selectively highly expressed in macrophages (Fig. 5C). Immunofluorescence staining revealed that DRD2 was selectively induced in macrophages after _CCl4 injury and correlated with altered levels of YAP (Fig. 5D, Fig. 20, Fig. 21). In Raw264.7 cells and peritoneal macrophages (Fig. 5E and Fig. 5F), Flu treatment increased YAP phosphorylation (Ser127), inhibited YAP activity, and promoted Ifnb1 expression (Fig. 5G-5H). In Raw264.7, knockdown of DRD2 enhanced phosphorylation of YAP and LATS1/2 kinases (Fig. Expression of IFNbl (Fig. 5J). These data suggest that antagonizing DRD2 modulates YAP activity in macrophages and upregulates type I interferon signaling (Fig. 5K).

Example 8: DRD2 antagonism or myeloid-specific Drd2 deletion alleviates liver fibrosis

By analyzing human liver samples from non-cirrhotic or cirrhotic patients, a significant increase in the expression of DRD2 co-localized with F4/80 ⁺ macrophages was observed in cirrhotic samples (Fig. 6A). In vivo, the effect of the DRD2 antagonist Flu was assessed in a model of _CCl4- induced chronic injury. Flu treatment had some side effects and resulted in a loss of body weight in mice (Figure 22). Compared with the control group, the Flu-treated group showed a reversal of established (established) liver fibrosis (α-SMA and collagen I domains were eliminated in the liver of Flu-treated mice), and attenuated liver damage (ALT and AST levels were reduced) (Figure 6B and 6C). The pro-fibrotic effect of macrophage DRD2 was further investigated with myeloid-specific Drd2 knockout mice (Drd2 ^fl/fl Lyz2-Cre ⁺ ) ( FIGS. 23A-23B ). Drd2 ^fl/fl Lyz2-Cre ⁺ mice exhibited mild liver fibrosis and attenuated liver injury after repeated injections of CCl ₄ (Fig. 6D, Fig. 6E). In both cholestatic injury [ref. 2] and mouse models of NASH (bile duct ligation (BDL) was used to induce cholestatic injury, while the mouse NASH phenotype was produced by Western diet feeding and subsequent chemical insult ), deletion of DRD2 in mouse macrophages abrogated liver fibrosis and attenuated liver injury (Fig. 6F–J). Attenuated liver fibrosis in all 3 models examined suggests that targeting DRD2 has the potential to block liver fibrosis in various pathological conditions (Fig. 6K).

Example 9: Targeting the DRD2-YAP axis in macrophages to inhibit fibrosis by stimulating type I IFN responses

The molecular mechanism underlying the pro-fibrotic effect of macrophage DRD2 was further explored. RNA-sequencing of macrophages isolated from myeloid Drd2-deficient mice or control mice following _four CCl injections; KEGG-enriched pathway analysis revealed that Hippo/YAP signaling is associated with DRD2 function in macrophages Significant association (Fig. 7A). Furthermore, genes associated with type I interferon signaling were upregulated in both myeloid DRD2 or YAP-deficient mice, including Ifnb1, Ifi27I2a, Ifi44, and Isg15 (Fig. 7B). Immunofluorescence staining revealed that myeloid Drd2 deletion upregulated IFN-β expression after 1 or 3 injections of CCl ₄ , and suppressed CTGF or VCAM1 in ECs and enhanced liver function following CCl ₄ -induced chronic injury. Proliferation of cells (Fig. 7C-E). Type I interferons act through a coreceptor consisting of IFNAR1 and IFNAR2. To establish an epistatic relationship between DRD2-YAP and type I IFN signaling, IFNAR1 neutralizing antibodies (MAR1-5A3) or corresponding IgG isotype controls were tested in mice with bone marrow-specific deletion of Drd2 or Yap (Fig. 7F). Treatment with an IFNAR1 neutralizing antibody successfully inhibited genes downstream of type I interferon signaling, including Ifit1, Oas2, Mx1, Isg15, and Ifit3 (Figure 24), without affecting liver YAP levels (Figure 25). This treatment with IFNAR1-neutralizing antibodies reversed the attenuation of liver fibrosis, upregulation of endothelial VCAM1 expression, and enhanced hepatocyte proliferation observed during _CCl4 -induced chronic injury in myeloid Drd2- and Yap-deficient mice (Figure 7G -J, Figure 26, Figure 27). These results collectively suggest that myeloid-specific deletion of Drd2 or Yap, through the induction of type I IFN signaling, promotes liver regeneration rather than fibrosis (Fig. 7K).

Example 10: Therapeutic effect of Flu in large animal NASH model

The therapeutic effect of Flu was then tested in a large animal NASH model. Since minipigs develop hepatic steatosis and fibrosis following injury, they have been used in preclinical studies of liver fibrosis [Refs 39-40]. NASH in minipigs was induced with a high-fat, high-sugar diet and repeated intraperitoneal injections of _CCl4 for 6 months. The treatment group received intraperitoneal injection of Flu (0.11 mg/kg) ( FIG. 8A ). Flu treatment had no significant effect on body weight (Figure 28). Histologically, the Flu-treated group showed a lower degree of liver fibrosis compared with the control group, and Oil Red O staining of liver sections showed that the Flu-treated group had less lipid deposition ( FIG. 8B ). In the livers of the Flu-treated group, the deposition of α-SMA and collagen I, as well as the amount of hepatic hydroxyproline were all decreased ( FIGS. 8C-8D ). Furthermore, Flu treatment significantly promoted hepatocyte proliferation in NASH minipig livers (Fig. 8E). These data, from clinically relevant large animal models, support the therapeutic value of DRD2 antagonism for stimulating liver regeneration (rather than fibrosis) in prevalent diseases such as NASH.

Summarize:

The present invention found that YAP levels in macrophages were increased in both human and mouse livers with hepatic fibrosis, and demonstrated through a series of experiments that genetic and pharmacological targeting of DRD2 in hepatic macrophages can alleviate Liver fibrosis.

The present invention also found that the pro-fibrotic dopamine receptor D2 (DRD2)-YAP axis is specifically present in liver macrophages, and after the initiation of liver injury, macrophages modulate the DRD2/YAP/IFN signaling axis. Anti-fibrotic function. Specific deficiency of DRD2 or YAP genes in hepatic macrophages (also understood as genetic targeting of the YAP pathway in hepatic macrophages) enhanced type I interferon (IFN) responses and attenuated the progression of hepatic fibrosis. Pro-fibrotic CTGF (connective tissue growth factor) ⁺ VCAM1 (vascular cell adhesion factor 1) ⁺ endothelial cell subsets, ie improved liver fibrosis. YAP-IFN signaling in macrophages affects liver fibrosis at least in part by regulating the above-mentioned endothelial cell subsets that exhibit pro-fibrotic molecular phenotypes. Conceivably, this endothelial cell subset might further recruit pro-fibrotic immune cells or stimulate CTGF-dependent fibroblast activation via VCAM1. Based on this, the experiments of the present invention suggest that drugs targeting DRD2 in liver macrophages may be potential drugs for treating liver fibrosis.

The present invention found that the profibrotic function of YAP in macrophages may be triggered by dopamine receptor D2 (DRD2). It was found that selective dopamine receptor D2 (DRD2) antagonists (also understood as pharmacological targeting of the YAP pathway in hepatic macrophages) administered to a large animal (minipig) NASH model recapitulating human pathology Blocks YAP in macrophages (but not hepatocytes) and selectively inhibits YAP-dependent pro-fibrotic functions of macrophages. Such DRD2 antagonists (preferably Flu) have been shown to effectively block fibrosis, restore liver structure, and promote liver regeneration in large animal (minipig) NASH preclinical models. It has been reported that DRD2 antagonists are currently actually used to block bone, brain and lung metastasis of tumor cells and to treat diseases involving the central nervous system such as schizophrenia. Thus, DRD2 antagonists of the present invention block the effects of liver fibrosis, providing additional insight into their therapeutic effects and uses.

In summary, the DRD2 antagonism (pharmacological and genetic targeting of DRD2 in macrophages) involved in the present invention induces type I interferon signaling through the YAP pathway, selectively targets liver macrophages, and effectively promotes The liver regenerated and avoided fibrosis, and even reversed it (summarized in Figure 31). Moreover, the above-mentioned anti-fibrosis effect of DRD2 antagonism has been demonstrated in both rodent and large animal models.

Embodiments of the present invention have been described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementations, and the above-mentioned specific implementations are only illustrative, rather than restrictive, and those of ordinary skill in the art will Under the enlightenment of the present invention, many forms can also be made without departing from the gist of the present invention and the protection scope of the claims, and these all belong to the protection of the present invention.

references

1. Gurtner GC, et al. Wound repair and regeneration. Nature 2008; 453(7193): 314-21.

2. Ding BS, et al. Divergent angiocrine signals from vascular niche balance liver regeneration and fibrosis. Nature 2014; 505(7481):97-102.

3. Wynn TA, Ramalingam TR. Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nature medicine 2012; 18(7): 1028-40.

4. Kordes C, Haussinger D. Hepatic stem cell niches. The Journal of clinical investigation 2013; 123(5):1874-80.

5. Ramachandran P, Iredale JP. Macrophages: central regulators of hepatic fibrogenesis and fibrosis resolution. Journal of Hepatology 2012; 56(6): 1417-9.

6. Moroni F, et al. Safety profile of autologous macrophage therapy for liver cirrhosis. Nature medicine 2019; 25(10): 1560-5.

7. Duffield JS, et al. Selective depletion of macrophages reveals distinct, opposing roles during liver injury and repair. The Journal of clinical investigation 2005; 115(1):56-65.

8. Tacke F. Targeting hepatic macrophages to treat liver diseases. Journal of Hepatology 2017; 66(6):1300-12.

9. Schuppan D, et al. Determinants of fibrosis progression and regression in NASH. Journal of Hepatology 2018; 68(2):238-50.

10. Melgar-Lesmes P, Edelman ER. Monocyte-endothelial cell interactions in the regulation of vascular sprouting and liver regeneration in mouse. Journal of Hepatology 2015; 63(4):917-25.

11. Matsuda M, et al. Oncostatin M causes liver fibrosis by regulating cooperation between hepatic stellate cells and macrophages in mice. Hepatology 2018; 67(1):296-312.

12. Cai B, et al. Macrophage MerTK Promotes Liver Fibrosis in Nonalcoholic Steatohepatitis. Cell Metab 2020; 31(2):406-21 e7.

13. Pepe-Mooney BJ, et al. Single-Cell Analysis of the Liver Epithelium Reveals Dynamic Heterogeneity and an Essential Role for YAP in Homeostasis and Regeneration. Cell Stem Cell 2019; 25(1):23-38 e8.

14. Li W, Yang L, et al. A Homeostatic Arid1a-Dependent Permissive Chromatin State Licenses Hepatocyte Responsiveness to Liver-Injury-Associated YAP Signaling. Cell Stem Cell 2019; 25(1):54-68 e5.

15. Verboven E, et al. Regeneration Defects in Yap and Taz Mutant Mouse Livers Are Caused by Bile Duct Disruption and Cholestasis. Gastroenterology 2021; 160(3):847-62.

16. Hyun J, et al. Dysregulation of the ESRP2-NF2-YAP/TAZ axis promotes hepatobiliary carcinoma in non-alcoholic fatty liver disease. Journal of hepatology 2021; doi:10.1016/j.jhep.2021.04.033.

17. Mooring M, et al. Hepatocyte Stress Increases Expression of Yes-Associated Protein and Transcriptional Coactivator With PDZ-Binding Motif in Hepatocytes to Promote Parenchymal Inflammation and Fibrosis. Hepatology 2019; 71(5-1803): 1803

18. Zhang C, et al. Oroxylin A prevents angiogenesis of LSECs in liver fibrosis via inhibition of YAP/HIF-1alpha signaling. Journal of cellular biochemistry 2018; 119(2):2258-68.

19. HaakAJ, et al. Selective YAP/TAZ inhibition in fibroblasts via dopamine receptor D1 agonism reverses fibrosis. Science translational medicine 2019; 11(516).

20. Fan F, et al. Pharmacological targeting of kinases MST1 and MST2 augments tissue repair and regeneration. Science translational medicine 2016; 8(352):352ra108.

21. Wang X, et al. Hepatocyte TAZ/WWTR1 Promotes Inflammation and Fibrosis in Nonalcoholic Steatohepatitis. Cell Metab 2016; 24(6):848-62.

22. Van Soldt BJ, et al. Yap and its subcellular localization have distinct compartment-specific roles in the developing lung. Development 2019; 146(9).

23. Yu FX, et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 2012; 150(4):780-91.

24. Insel PA, et al. GPCR expression in tissues and cells: are the optimal receptors being used as drug targets? British journal of pharmacology 2012;165(6):1613-6.

25. Tsuchida T, et al. A simple diet-and chemical-induced murine NASH model with rapid progression of steatohepatitis, fibrosis and liver cancer. Journal of Hepatology 2018; 69(2):385-95.

26. Malecova B, et al. Dynamics of cellular states of fibro-adipogenic progenitors during myogenesis and muscular dystrophy. Nature communications 2018; 9(1): 3670.

27. Agassandian M, et al. VCAM-1 is a TGF-beta1 inducible gene upregulated in idiopathic pulmonary fibrosis. Cellular signaling 2015; 27(12):2467-73.

28. Rachfal AW, Brigstock DR. Connective tissue growth factor (CTGF/CCN2) in hepatic fibrosis. Hepatology research: the official journal of the Japan Society of Hepatology 2003; 26(1): 1-9.

29.Minutti CM, et al.Local amplifiers of IL-4Ralpha-mediated macrophage activation promote repair in lung and liver.Science 2017;356(6342):1076-80.

30. Puengel T, Tacke F. Repair macrophages in acute liver failure. Gut 2018; 67(2):202-3.

31. Cao Z, et al. Targeting the vascular and perivascular niches as a regenerative therapy for lung and liver fibrosis. Science translational medicine 2017; 9(405).

32. Ramachandran P, et al. Resolving the fibrotic niche of human liver cirrhosis at single-cell level. Nature 2019; 575(7783):512-8.

33. George J, Tsutsumi M. siRNA-mediated knockdown of connective tissue growth factor prevents N-nitrosodimethylamine-induced hepatic fibrosis in rats. Gene Ther 2007; 14(10):790-803.

34. Li G, et al. Inhibition of connective tissue growth factor by siRNA prevents liver fibrosis in rats. J Gene Med 2006; 8(7):889-900.

35. Pi L, et al. Connective tissue growth factor and integrin alphavbeta6: a new pair of regulators critical for ductular reaction and biliary fibrosis in mice. Hepatology 2015; 61(2):678-91.

36. Umetani M, et al. A novel cell adhesion inhibitor, K-7174, reduces the endothelial VCAM-1 induction by inflammatory cytokines, acting through the regulation of GATA. Biochemical and biophysical research communications 2000; 272(2): 37 4.

37. Zhao B, et al. The Hippo-YAP pathway in organ size control and tumorigenesis: an updated version. Genes & development 2010; 24(9): 862-74.

38. Pestka S, et al. Interferons, interferon-like cytokines, and their receptors. Immunol Rev 2004; 202:8-32.

39. Lee L, et al. Nutritional model of steatohepatitis and metabolic syndrome in the Ossabaw miniature swine. Hepatology 2009; 50(1):56-67.

40. Liang T, et al. Liver injury and fibrosis induced by dietary challenge in the Ossabaw miniature Swine. PloS one 2015; 10(5):e0124173.

41. Jiao S, et al. Targeting IRF3 as a YAP agonist therapy against gastric cancer. The Journal of experimental medicine 2018; 215(2):699-718.

42. Wang S, et al. YAP antagonistizes innate antiviral immunity and is targeted for lysosomal degradation through IKKvarepsilon-mediated phosphorylation. Nature immunology 2017; 18(7):733-43.

43.Petrasek J, et al. Interferon regulatory factor 3 and type I interferons are protective in alcoholic liver injury in mice by way of crosstalk of parenchymal and myeloid cells. Hepatology 2011;53(2):649-60.

44. Roh YS, et al. Toll-like receptor 7-mediated type I interferon signaling prevents cholestasis-and hepatotoxin-induced liver fibrosis. Hepatology 2014;60(1):237-49.

45. Inagaki Y, et al. Interferon alfa down-regulates collagen gene transcription and suppresses experimental hepatic fibrosis in mice. Hepatology 2003; 38(4):890-9.

46. Torres-Rosas R, et al. Dopamine mediates vagal modulation of the immune system by electroacupuncture. Nature medicine 2014; 20(3):291-5.

47. Yan Y, et al. Dopamine controls systemic inflammation through inhibition of NLRP3 inflammation. Cell 2015; 160(1-2):62-73.

48. Xu F, et al. Repositioning antipsychotic fluphenazine hydrochloride for treating triple negative breast cancer with brain metastases and lung metastases. Am J Cancer Res 2019; 9(3):459-78.

49. Liu S, et al. Osteocyte-Driven Downregulation of Snail Restrains Effects of Drd2 Inhibitors on Mammary Tumor Cells. Cancer research 2018; 78(14):3865-76.

S1. Ding BS, et al. Divergent angiocrine signals from vascular niche balance liver regeneration and fibrosis. Nature 2014; 505:97-102.

S2. Tsuchida T, et al. A simple diet-and chemical-induced murine NASH model with rapid progression of steatohepatitis, fibrosis and liver cancer. J Hepatol 2018;69:385-395.

S3. Lee L, et al. Nutritional model of steatohepatitis and metabolic syndrome in the Ossabaw miniature swine. Hepatology 2009; 50:56-67.

S4. Liang T, et al. Liver injury and fibrosis induced by dietary challenge in the Ossabaw miniature Swine. PLoS One 2015; 10:e0124173.

S5. Wang S, et al. YAP antagonists innate antiviral immunity and is targeted for lysosomal degradation through IKKvarepsilon-mediated phosphorylation. Nat Immunol 2017; 18:733-743.

S6. Dupont S, et al. Role of YAP/TAZ in mechanotransduction. Nature 2011; 474:179-183.

S7. Graney PL, et al. Macrophages of diverse phenotypes drive vascularization of engineered tissues. Sci Adv 2020; 6:eaay6391.

S8. Ramachandran P, et al. Resolving the fibrotic niche of human liver cirrhosis at single-cell level. Nature 2019; 575:512-518.

S9. Hyun J, et al. Dysregulation of the ESRP2-NF2-YAP/TAZ axis promotes hepatobiliary carcinoma in non-alcoholic fatty liver disease. J Hepatol 2021.

S10. Kim D, et al. HISAT: a fast spliced aligner with low memory requirements. Nat Methods 2015; 12:357-360.

S11. Anders S, et al.HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 2015; 31:166-169.

S12. Love MI, et al. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 2014; 15:550.

Claims (10)

1. Application of DRD2 inhibitor in preparation of medicine for treating diseases related to liver fibrosis.
2. The use according to claim 1, characterized in that the DRD2 inhibitor is fluphenazine (Flu) and pharmaceutically acceptable salts thereof.
3. The application according to claim 1, wherein the diseases related to liver fibrosis are caused by chronic liver damage, including nonalcoholic steatohepatitis, autoimmune hepatitis, congenital hepatic fibrosis, nonalcoholic fatty One or more of liver disease, cholestatic liver disease, alcoholic hepatitis, and viral hepatitis.
4. The use according to claim 1, characterized in that the symptoms of diseases related to liver fibrosis include an increase in the level of Yes-associated protein (YAP) in liver macrophages.
5. The application according to claim 1, wherein the symptoms of diseases related to liver fibrosis include an increase in the level of one or more of the following molecules: α-smooth muscle actin (α-SMA), connective Tissue growth factor (CTGF), vascular cell adhesion factor 1 (VCAM-1), collagen Ⅰ, Yes-associated protein (YAP), phosphorylated YAP, serum alanine aminotransferase (ALT), serum aspartate amino transferase (AST) and hepatic hydroxyproline.
6. The use according to claim 4, wherein the drug is used to selectively target the Yes-associated protein (YAP) pathway in the liver macrophages.
7. The use according to claim 6, characterized in that the drug is used for up-regulating type I interferon response.
8. The use according to any one of claims 1-7, characterized in that the medicament is used to alleviate one or more of the following symptoms: liver fibrosis, liver damage and intrahepatic lipid deposition.
9. The use according to any one of claims 1-7, characterized in that the drug is used to promote liver cell proliferation and/or promote liver regeneration.
10. The use according to any one of claims 1-7, characterized in that the drug is used to reverse the liver fibrosis.

Images