WO2023017512A1 - Antisense oligonucleotides for modulating exon skipping in cystic fibrosis transmembrane conductance regulator (cftr) - Google Patents

Antisense oligonucleotides for modulating exon skipping in cystic fibrosis transmembrane conductance regulator (cftr) Download PDF

Info

Publication number
WO2023017512A1
WO2023017512A1 PCT/IL2022/050864 IL2022050864W WO2023017512A1 WO 2023017512 A1 WO2023017512 A1 WO 2023017512A1 IL 2022050864 W IL2022050864 W IL 2022050864W WO 2023017512 A1 WO2023017512 A1 WO 2023017512A1
Authority
WO
WIPO (PCT)
Prior art keywords
cftr
subject
cystic fibrosis
oligonucleotide
composition
Prior art date
Application number
PCT/IL2022/050864
Other languages
French (fr)
Inventor
Yifat OREN
Ofra BARCHAD-AVITZUR
Renana ELGRABLI
Efrat OZERI-GALAI
Original Assignee
Splisense Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Splisense Ltd. filed Critical Splisense Ltd.
Publication of WO2023017512A1 publication Critical patent/WO2023017512A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the present invention provides specific synthetic oligonucleotides, as well as vectors, cells, and pharmaceutical compositions comprising the oligonucleotides, and their use in methods of treating, suppressing, or inhibiting cystic fibrosis.
  • Cystic fibrosis is a rare autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Approximately 100,000 children and adults worldwide are currently living with cystic fibrosis. The CFTR gene encodes a channel responsible for chloride transport in epithelial cells. Cystic fibrosis most severely affects the lungs, where there is insufficient CFTR function in the airway epithelium. More than 90% of cystic fibrosis mortality is related to the respiratory disease. Over 1,700 different mutations disrupting CFTR function have been identified worldwide in cystic fibrosis patients.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • the present invention provides a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
  • the present invention provides a vector comprising a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
  • the present invention provides a cell comprising a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
  • the present invention provides a pharmaceutical composition comprising a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
  • the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
  • the present invention provides a method for suppressing or inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
  • Figure 1 Model depicting Exon 16 skipping in patients with the 2789 +5 G-to-A (2789) mutation in CFTR (left) and how antisense oligonucleotides can modulate splicing and rescue normal full-length CFTR transcripts.
  • FIGS. 2A-2B 293-GT cells were transfected with EMG i 14-i 18 plasmid carrying a 2789 +5 G-to-A mutation and 24hrs later, transfected with lOOnM of one of the antisense oligonucleotides (ASOs). Following a 24-hour treatment with the indicated antisense oligonucleotide, RNA was extracted, treated with DNase, and cleaned on RNeasy mini spin column.
  • ASOs antisense oligonucleotides
  • FIG. 2A The effect of ASO treatment on splicing modulation was analyzed by RT- PCR.
  • FIG. 2B The effect of ASO treatment on splicing modulation was analyzed by quantitative RT-PCR (RT-qPCR). The values shown are the average fold change (mean+SEM) from 3-4 independent experiments relative to cells treated with a control antisense oligonucleotide. Values were normalized against transcripts of GUSb gene. Statistical analysis was performed using Student's t test (1 tail, paired).
  • Protein was extracted from organoid-derived monolayer cells from a patient carrying the 2789 +5 G-to-A mutation and a healthy volunteer (HV), and the levels of CFTR protein was analyzed by immunoblotting with anti CFTR (596), and anti-calnexin antibodies.
  • the present invention provides compositions and methods for treating cystic fibrosis in a subject by administering antisense oligonucleotides that alter the splicing in non-WT CFTR gene transcripts.
  • administration of the antisense oligonucleotides as described herein leads to cellular production of mRNA that codes for a CFTR protein with fully or partially restored CFTR function.
  • administration of the antisense oligonucleotides as described herein enhances expression levels of CFTR, cellular localization of CFTR, CFTR activity, function of CFTR, or a combination thereof.
  • the oligonucleotides, vectors, cells, compositions, methods, and kits as described herein comprise a splicing modulator or administration of a splicing modulator, which, in some embodiments, is an antisense oligonucleotide.
  • the antisense oligonucleotide is a chemically modified antisense oligonucleotide.
  • the disclosure provides an oligonucleotide having 8 to 30 linked nucleosides having a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 8 contiguous nucleobases complementary to an equal-length portion of a target region of a cystic fibrosis transmembrane conductance regulator (CFTR) transcript.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • antisense oligonucleotides modulate target nucleic acids and may comprise chemical modifications and motifs.
  • Antisense oligonucleotides may modulate protein expression by binding to a target messenger RNA (mRNA) encoding the protein.
  • mRNA target messenger RNA
  • the binding of an antisense oligonucleotide to its target mRNA results in the cleavage of the mRNA. In some embodiments, the binding of an antisense oligonucleotide to its target mRNA modulates the processing of pre-mRNA. In some embodiments, antisense oligonucleotides alter splicing, interfere with polyadenylation, or prevent formation of the 5'-cap of a pre-mRNA. In some embodiments, antisense oligonucleotides enhance inclusion or inhibit skipping of one or more CFTR exons.
  • antisense oligonucleotide describes an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
  • antisense activity describes any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • detecting or “measuring” means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
  • the present invention provides a synthetic oligonucleotide comprising any one or more of SEQ ID NOs: 1-44.
  • the present invention provides a synthetic oligonucleotide comprising any one or more of SEQ ID NOs: 25-31.
  • the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 31. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 32. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 29. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 30. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 28. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 27.
  • the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 35. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 34. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 33. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 26. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 41. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 37.
  • the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 25. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 39. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 40. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 36. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 38. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 24.
  • the antisense oligonucleotide comprises a chemical modification or is chemically modified.
  • the chemical modification comprises a modification of a backbone of the antisense oligonucleotide.
  • the antisense oligonucleotide comprises one or more phosphate-ribose.
  • the antisense oligonucleotide comprises one or more phosphate-deoxyriboses.
  • the antisense oligonucleotide comprises one or more phosphorothioates.
  • the antisense oligonucleotide comprises one or more phosphorothioate-deoxyriboses.
  • the antisense oligonucleotide comprises one or more 2'-O-methyl- phosphorothioates (2OMPs). In other embodiments, the antisense oligonucleotide comprises one or more phosphorodiamidates morpholino (PMOs). In other embodiments, the antisense oligonucleotide comprises one or more peptide nucleic acids (PNAs). In other embodiments, the antisense oligonucleotide comprises one or more 2-methoxyethyl phosphorothioates (MOEs). In other embodiments, the antisense oligonucleotide comprises a constrained ethyl (cET) backbone.
  • cET constrained ethyl
  • the antisense oligonucleotide comprises an alternating locked nucleic acid (LNA) backbone. In other embodiments, the antisense oligonucleotide comprises one or more N3'-P5' phosphoramidates. In other embodiments, the antisense oligonucleotide comprises one or more 2'-deoxy-2'-fluoro-p-d-arabino nucleic acids. In other embodiments, the antisense oligonucleotide comprises one or more cyclohexene nucleic acids (CeNAs). In other embodiments, the antisense oligonucleotide comprises one or more tricyclo-DNA (tcDNA) nucleic acids.
  • LNA locked nucleic acid
  • tcDNA tricyclo-DNA
  • the antisense oligonucleotide comprises one or more 2- amino-2’-deoxyadenosines (DAPs). In other embodiments, the antisense oligonucleotide comprises one or more 2’-deoxy-2’-fluoro-P-D-arabinonucleic acids (FANAs). In other embodiments, the antisense oligonucleotide comprises a ligand-conjugated antisense (LICA). In other embodiments, the antisense oligonucleotide comprises a combination of any of the chemical modifications described herein.
  • DAPs 2- amino-2’-deoxyadenosines
  • FANAs 2’-deoxy-2’-fluoro-P-D-arabinonucleic acids
  • the antisense oligonucleotide comprises a ligand-conjugated antisense (LICA). In other embodiments, the antisense oligonucleotide comprises a combination of any of the chemical modifications described here
  • the chemical modification is a modification of a sugar of the antisense oligonucleotide.
  • the sugar modification comprises 2'-modified and conformationally constrained nucleotides.
  • the chemical modification comprises a 2'-fluoro modification.
  • the chemical modification is a modification of a nucleobase of the antisense oligonucleotide. In some embodiments, the chemical modification is a modification of the 3’ terminal. In some embodiments, the chemical modification is a modification of the 5’ terminal. In some embodiment, the chemical modification is a combination of two or more of the modifications as described herein. In some embodiments, the oligonucleotide used in the compositions and methods as described herein is chimeric. In some embodiments, the oligonucleotide used in the compositions and methods as described herein comprises multiple types of modified nucleotides.
  • the oligonucleotide comprises mixtures of LNA/DNA or LNA/2'OMe/MOE-RNA. In other embodiments, the oligonucleotide comprises combinations of 2-thiothymidine, 3'-fluorohexitol nucleic acid (FHNA), cEt, a 5-modified pyrimidine base, and a,P constrained nucleic acid (a,[3-CNA). In some embodiments, the oligonucleotide comprises Fluoroarabinonucleic acid (2'F-ANA).
  • the oligonucleotide comprises a gapmer.
  • the gapmer antisense oligonucleotide is 12-15 nucleotides.
  • the chemical modification increases stability of the antisense oligonucleotide in a cell. In some embodiments, the chemical modification increases stability of the antisense oligonucleotide in vivo. In some embodiments, the chemical modification increases the antisense oligonucleotide’s ability to modulate splicing. In some embodiments, the chemical modification increases the antisense oligonucleotide’s ability to reduce exon skipping. In some embodiments, the chemical modification increases the half-life of the antisense oligonucleotide. In some embodiments, the chemical modification inhibits polymerase extension from the 3’ end of the antisense oligonucleotide.
  • the chemical modification inhibits recognition of the antisense oligonucleotide by a polymerase. In some embodiments, the chemical modification inhibits double-strand triggered degradation. In some embodiments, the chemically modified antisense oligonucleotide does not trigger nucleic acid double- stranded degradation upon binding a CFTR pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC- mediated degradation or any parallel nucleic acid degradation pathway.
  • a naked antisense oligonucleotide is delivered to cells.
  • the antisense oligonucleotide is bioconjugated or delivered via a nanocarrier.
  • the antisense oligonucleotide is non-covalently complexed with cationic polymers (for example, polyethylenimine), dendrimers, CPPs (for example, MPG-8, PepFect6, RVG-9R228, and Xentry-KALA).
  • the nanocarrier is a nanoparticle, which, in some embodiments, comprises a lipid nanoparticle.
  • the antisense oligonucleotide is covalently conjugated to celltargeting or cell-penetrating moieties.
  • the antisense oligonucleotide is delivered as part of a nanoparticle formulation.
  • the antisense oligonucleotide is delivered as part of an endogenous vesicle (exosome) loading.
  • the antisense oligonucleotide is delivered on spherical nucleic acids (SNAs).
  • SNAs spherical nucleic acids
  • nanotechnology applications for example, DNA cages
  • ‘smart’ materials are used for antisense oligonucleotide delivery.
  • the delivery potential of antisense oligonucleotides is enhanced through direct covalent conjugation of various moieties that promote intracellular uptake, target the antisense oligonucleotide to specific cells/tissues or reduce clearance from the circulation.
  • moieties include lipids (for example, cholesterol that facilitates interactions with lipoprotein particles in the circulation), peptides (for cell targeting and/or cell penetration), aptamers, antibodies and sugars (for example, N-acetylgalactosamine (GalNAc)).
  • the antisense oligonucleotide is devoid of a labeling moiety. In some embodiments, the antisense oligonucleotide is not labeled. In some embodiments, the antisense oligonucleotide does not emit a detectable signal or does not comprise moieties capable of being recognized so as to enable nucleic acid detection (e.g., digoxigenin and fluorescently labeled anti-DIG antibody). In some embodiments, a detectable signal comprises a dye or an emitting energy which provides detection of a compound, e.g., a polynucleotide, in vivo or in vitro.
  • a detectable signal comprises: a fluorescent signal, a chromatic signal, or a radioactive signal.
  • the antisense oligonucleotide is devoid of radioactive nucleobase(s); digoxigenin, streptavidin, biotin, a fluorophore, hapten label, CLICK label, amine label, or thiol label.
  • the antisense oligonucleotide comprises a labeling moiety as described hereinabove.
  • the antisense oligonucleotide comprises at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, at least 20 bases, at least 21 bases, at least 22 bases, at least 23 bases, at least 23 bases, or at least 25 bases, or any value and range therebetween.
  • Each possibility represents a separate embodiment of the invention.
  • the antisense oligonucleotide comprises 14 to 25 bases, 14 to 23 bases, 14 to 23 bases, 14 to 22 bases, 14 to 21 bases, 14 to 20 bases, 14 to 19 bases, or 14 to 18 bases, or 14 to 17 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the antisense oligonucleotide comprises 17 to 22 bases.
  • the antisense oligonucleotide is complementary to the CFTR mRNA or pre-mRNA of Accession number NM_000492.4.
  • the antisense oligonucleotide is complementary to a target region, wherein the target region comprises Exon 16, which in one embodiment, comprises gtggctgcttctttggttgtgctgtggctccttggaaa (SEQ ID NO: 91). In other embodiments, the target region comprises exon 16 and 70 nucleotide intronic sequences upstream and downstream of exon 16.
  • the target region comprises tagatgtgggcatgggaggaataggtgaagatgtagaaaaaaatcaactgtgtcttgttccattccaggtggtggctgcttetttggttgtgct gtggctcttggaaagtgagtattccatgtcctattgtgtagattgtgtttttatttctgttgattaaatattgtaatccactatg (SEQ ID NO:
  • the target region comprises tagatgtgggcatgggaggaataggtgaagatgttagaaaaaaatcaactgtgtcttgttccattccaggtggetgcttctttggttgtgct gtggctecttggaaagtgaatattccatgtcctattgtgtagattgtgttttttctgttgattaaatattgtaatccactatg (SEQ ID NO:
  • the target region comprises cccaggaacacaaagcaaaggaagatgaaattgtgtgtaccttgatattggtacacacatcaaatggtgtgatgtgaatttagatgtgggcat gggaggaataggtgaagatgttagaaaaaaatcaactgtgtcttgttccattccaggtggctgcttttggtttgtgctgtggctttggttgtgctgtggctcttgga aagtgagtattccatgtcctattgtgtagattgtgttttttttctgttgattaaatattgtaatccactatgttttgtatgtattgtattgtaatccacttttgttcatt tctcccaagcattatggtagtgga
  • the target region comprises cccaggaacacaaagcaaaggaagatgaaattgtgtgtaccttgatattggtacacacatcaaatggtgtgatgtgaatttagatgtgggcat gggaggaataggtgaagatgttagaaaaaaatcaactgtgtcttgttccattccaggtggtggctgcttttggtttgtgctgtggctctttggtttgtgctgtggctcttgga agtgaatattccatgtcctattgtgtagattgtgttttttttctgttgattaaatattgtaatccactatgttttgtatgtattgtaatccacttttgtttcatt tctcccaagcattatggtagtgga
  • the term “complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated.
  • the CFTR pre-mRNA is a wildtype pre-mRNA. In some embodiments, the pre-mRNA is a mutated pre-mRNA.
  • the antisense oligonucleotide is specific to a CFTR pre- mRNA.
  • the term “specific” refers to base pair specificity, gene specificity, or to both base pair and gene specificity.
  • the antisense oligonucleotide is specific to the CFTR gene.
  • the antisense oligonucleotide masks a splice inhibiting motif, sequence, or region of CFTR.
  • the antisense oligonucleotide as described herein prevents exon skipping.
  • the antisense oligonucleotide promotes exon insertion.
  • the antisense oligonucleotide masks a splice enhancing motif, sequence, or region of CFTR.
  • the antisense oligonucleotide binds the CFTR pre-mRNA with perfect or 100% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with greater than 90% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with greater than 95% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with greater than 98% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre- mRNA with greater than 99% complementarity.
  • the antisense oligonucleotide does not bind any gene product other than CFTR with perfect complementarity. In some embodiments, the antisense oligonucleotide does not bind any gene other than CFTR with a complementarity of greater than 70, 75, 80, 85, 90, 95, 97, er 99%. Each possibility represents a separate embodiment of the invention. In some embodiments, the antisense oligonucleotide does not bind any gene other than CFTR with a complementarity of greater than 90%.
  • the antisense oligonucleotide does not bind with perfect complementarity to anywhere in the genome of a cell other than within CFTR. In some embodiments, the antisense oligonucleotide does not bind with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, or 99% to anywhere in the genome of a cell other than within CFTR.
  • the cell is a mammalian cell. In some embodiments, the mammal is a human.
  • a mutated pre-mRNA comprises at least one mutation in an exon of the CFTR pre-mRNA. In other embodiments, a mutated pre-mRNA comprises at least one mutation in an intron of the CFTR pre-mRNA. In some embodiments, the mutated pre-mRNA comprises a splicing mutation. In some embodiments, the splicing mutation comprises a splicedonor sequence mutation. In other embodiments, the splicing mutation comprises a spliceacceptor sequence mutation. In other embodiments, the splicing mutation comprises a branch point mutation. In other embodiments, the splicing mutation comprises a polypyrimidine tract mutation.
  • the mutation comprises an early signal for termination of translation or a premature termination codon. In some embodiments, the mutation comprises a frameshift mutation. In some embodiments, the mutation comprises a missense mutation. In other embodiments, the mutation comprises a nonsense mutation. In some embodiments, the mutation comprises a substitution mutation in the CFTR encoding gene, pre-mRNA encoded therefrom, or protein product thereof.
  • the antisense oligonucleotide binds to an intronic sequence in the CFTR pre-mRNA. In some embodiments, the antisense oligonucleotide binds to an intronic sequence that is distant from an exon, an intron-exon junction, or both. In some embodiments, the binding of an antisense oligonucleotide to an intronic sequence in the CFTR pre-mRNA reduces exon skipping. In some embodiments, the antisense oligonucleotide may partially or fully bind (e.g., complement) to an intronic sequence within a gene other than CFTR. In some embodiments, an antisense oligonucleotide that partially or fully binds to an intronic sequence within a gene other than CFTR does not induce splicing or modify transcription in the non-CFTR gene.
  • distant comprises at least 50 base pairs (bp), at least 100 bp, at least 200 bp, at least 350 bp, at least 500 bp, at least 750 bp, at least 1,000 bp, at least 2,000 bp, at least 3,500 bp, at least 5,000 bp, at least 7,500 bp, or at least 10,000 bp upstream to an exon, an intro-exon junction, or both, or downstream to an exon, an intro-exon junction, or both, or any value and range therebetween.
  • bp base pairs
  • the antisense oligonucleotide modulates expression of CFTR. In some embodiments, the antisense oligonucleotide modulates splicing of CFTR. In some embodiments, the antisense oligonucleotide modulates splicing of an exon of CFTR. In some embodiments, the antisense oligonucleotide does not cause an off-target effect. In some embodiments, off-target is a target other than CFTR. In some embodiments, off-target is a target other than splicing of an exon of CFTR.
  • the antisense oligonucleotide does not substantially or significantly modulate expression of a gene other than CFTR. In some embodiments, the antisense oligonucleotide does not substantially or significantly modulate splicing of a gene other than CFTR. In some embodiments, the antisense oligonucleotide does not substantially or significantly modulate splicing of an exon other than an exon of CFTR. In some embodiments, substantial modulation of expression is a change in expression of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50%. Each possibility represents a separate embodiment of the invention. In some embodiments, substantial modulation of expression is a change in expression of at least 20%.
  • an antisense oligonucleotide as described herein, or a pharmaceutical composition comprising an antisense oligonucleotide as described herein is used in the modulation of splicing of a CFTR pre-mRNA transcribed from a CFTR gene.
  • modulation of splicing in some embodiments refers to affecting a change in the level of any RNA or mRNA variant produced by the CFTR native pre-mRNA.
  • modulation comprises causing an increase or decrease in the level of abnormal CFTR mRNA, causing an increase or decrease in the level of normal, full-length CFTR mRNA, causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a missense codon, and/or causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a premature termination codon (nonsense codon).
  • modulation comprises decreasing the level of abnormal CFTR mRNA.
  • the abnormal CFTR mRNA comprises a mutated exon.
  • modulation comprises decreasing the level of an abnormal CFTR mRNA comprising a mutated exon.
  • modulation comprises decreasing the level of an abnormal CFTR mRNA comprising a mutation that results in early translation termination.
  • the CFTR pre-mRNA is devoid of a mutation. In some embodiments, the CFTR pre-mRNA is a wildtype CFTR pre-mRNA.
  • antisense oligonucleotides as described herein are singlestranded.
  • oligonucleotides are modified by attachment of one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • Conjugate groups are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligonucleotide.
  • a conjugate group as described herein comprises intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, dyes or a combination thereof.
  • the antisense oligonucleotide comprises an active fragment of any one of SEQ ID Nos: 1-44.
  • the term “active fragment” refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the antisense oligonucleotide, providing that at least: 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original antisense oligonucleotide nucleotide sequence is retained, or any value and range therebetween.
  • active fragment refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the antisense oligonucleotide, providing that at least: 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original antisense oligonucleotide nucleotide sequence is retained, or any value and range therebetween.
  • the present invention also provides a vector comprising one or more oligonucleotides as described herein.
  • appropriate vectors include adenoviral, lentiviral, adeno- associated viral (AAV), poliovirus, herpes simplex vims (HSV), or murine Maloney-based viral vectors.
  • the vector is an adeno-associated vims vector.
  • these cassettes and vectors may be contained in a cell, such as a mammalian cell.
  • a non-human mammal cell may comprise the cassette or vector.
  • the present invention also provides a cell comprising one or more oligonucleotides as described herein.
  • the cell comprises a vector as described herein.
  • the cell comprises a mammalian cell.
  • a cell as described herein comprises nucleic acid molecules, expression cassettes or vectors as described herein.
  • a non-human mammal cell comprises the nucleic acid molecules, expression cassettes or vectors as described herein.
  • the present invention provides a nucleic acid, an expression cassette, a vector, or a composition as described herein for use in therapy, such as for treating cystic fibrosis.
  • composition comprising an antisense oligonucleotide as described herein.
  • the composition further comprises one or more non-toxic, pharmaceutically acceptable carriers and/or diluents and/or adjuvants (collectively referred to herein as “carrier” materials) and, if desired, other active ingredients.
  • carrier non-toxic, pharmaceutically acceptable carriers and/or diluents and/or adjuvants
  • pharmaceutically acceptable carrier in some embodiments refers to any of the standard pharmaceutical carriers known in the field such as sterile solutions, tablets, coated tablets, and capsules.
  • such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acids, or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients.
  • excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acids, or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients.
  • Such carriers may also include flavor and color additives or other ingredients.
  • examples of pharmaceutically acceptable carriers include, but are not limited to, the following: water, saline, buffers, inert, nontoxic solids (e.g., mannitol, talc).
  • compositions comprising such carriers are formulated by well-known conventional methods.
  • the compositions may be in the form of solid, semi-solid, or liquid dosage forms, such, for example, as powders, granules, crystals, liquids, suspensions, liposomes, nanoparticles, nano-emulsions, pastes, creams, salves, etc., and may be in unit-dosage forms suitable for administration of relatively precise dosages.
  • the pharmaceutical composition may be administered by any suitable route, preferably in the form of a pharmaceutical composition adapted to such a route, and in a dose effective for the treatment intended.
  • the carrier mixture may be filled into a gelatin capsule or compressed as a tablet.
  • the pharmaceutical composition may be administered as an oral dosage form or an infusion, for example.
  • the pharmaceutical composition is formulated for oral administration. In some embodiments, the pharmaceutical composition is formulated for nasal administration. In some embodiments, the pharmaceutical composition is formulated for administration by inhalation. In some embodiments, the pharmaceutical composition is formulated for intrapulmonary administration. In some embodiments, the pharmaceutical composition is formulated for oral inhalation. In some embodiments, the pharmaceutical composition is formulated for intranasal administration.
  • the pharmaceutical composition is formulated for abdominal administration. In some embodiments, the pharmaceutical composition is formulated for subcutaneous administration. In some embodiments, the pharmaceutical composition is formulated for intra-peritoneal administration. In some embodiments, the pharmaceutical composition is formulated for intravenous administration. In some embodiments, the pharmaceutical composition is formulated for intramuscular administration. In some embodiments, the pharmaceutical composition is formulated for mucosal administration. In some embodiments, parenteral administration comprises intravascular, intraperitoneal, subcutaneously, intramuscular, and intrastemal administration.
  • Any pharmaceutical composition contemplated herein can, for example, be delivered orally via any acceptable and suitable oral preparations.
  • exemplary oral preparations include, but are not limited to, for example, tablets, troches, lozenges, aqueous and oily suspensions, dispersible powders or granules, emulsions, hard and soft capsules, liquid capsules, syrups, and elixirs.
  • Exemplary injectable forms include, but are not limited to, for example, sterile aqueous solutions comprising acceptable vehicles and solvents, such as, for example, water, Ringer's solution, and isotonic sodium chloride solution; sterile oil-in-water microemulsions; and aqueous or oleaginous suspensions.
  • acceptable vehicles and solvents such as, for example, water, Ringer's solution, and isotonic sodium chloride solution
  • sterile oil-in-water microemulsions such as, for example, water, Ringer's solution, and isotonic sodium chloride solution
  • sterile oil-in-water microemulsions such as, for example, water, Ringer's solution, and isotonic sodium chloride solution
  • sterile oil-in-water microemulsions such as, for example, water, Ringer's solution, and isotonic sodium chloride solution
  • sterile oil-in-water microemulsions such as, for example, water, Ringer'
  • the pharmaceutical composition is formulated as a nanoparticle, lipid nanoparticle, microparticle or liposome.
  • the pharmaceutical composition is formulated for systemic administration.
  • the pharmaceutical composition is formulated for administration to a subject.
  • the subject is a human subject. It will be understood by a skilled artisan that a pharmaceutical composition to be administered to a subject should have no or, in other embodiments, minimal off-target effects, e.g., effects other than the intended therapeutic ones.
  • the pharmaceutical composition is devoid of a substantial effect on a gene other than CFTR.
  • the pharmaceutical composition is devoid of a substantial effect on splicing of an exon other than an exon of CFTR.
  • a substantial effect is one with a phenotypic result.
  • a substantial effect is an effect that is deleterious to the health and/or wellbeing of the subject.
  • the composition is formulated for administration via inhalation. In some embodiments, the composition is a pharmaceutical composition.
  • the pharmaceutical composition comprises an antisense oligonucleotide as described herein.
  • the composition comprises at least 1 nM, at least 2.5 nM, at least 10 nM, at least 100 nM, at least 0.5 pM, at least 1 pM, at least 10 pM, at least 20 pM, at least 50 pM, at least 75 pM, at least 80 pM, at least 100 pM of the antisense oligonucleotide or any value and range therebetween.
  • the composition comprises 2.5 nM to 10 nM, 1 nM to 100 nM, 1 nM to 0.5 pM, 1 nM to 1 pM, 1 nM to 10 pM, 1 nM to 20 pM, or 1 nM to 50 pM, of the antisense oligonucleotide.
  • the composition comprises 5 nM to 25 nM, 10 nM to 50 nM, 20 nM to 100 nM, 50 nM to 0.5 pM of the antisense oligonucleotide.
  • Each possibility represents a separate embodiment of the invention.
  • a composition comprising an antisense oligonucleotide as described herein is prepared and/or administered at a concentration of 2.5, 3.75, 5, 7.5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 125, 130, or 140 mg/ml. In some embodiments, a composition as described herein is prepared and/or administered at a concentration of about 2.5 mg/ml to about 140 mg/ml.
  • the pharmaceutically active compounds of this invention can be processed in accordance with conventional methods of pharmacy to produce medicinal agents for administration to subjects, including humans and other mammals.
  • the pharmaceutical compositions may be subjected to conventional pharmaceutical operations such as sterilization and/or may contain conventional adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers, buffers etc. Tablets and pills can additionally be prepared with enteric coatings.
  • Such pharmaceutical compositions may also comprise adjuvants, such as wetting, sweetening, flavoring, and perfuming agents.
  • the amounts of compounds that are administered and the dosage regimen for treating a disease or condition of this invention depends on a variety of factors, including the age, weight, gender, the medical condition of the subject, the type of disease, the severity of the disease, the route and frequency of administration, and the particular compound employed. Thus, the dosage regimen may vary widely, but can be determined routinely using standard methods.
  • the active compounds of this invention are ordinarily combined with one or more adjuvants appropriate to the indicated route of administration.
  • the compounds may be admixed with lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia gum, sodium alginate, polyvinylpyrrolidone, and/or polyvinyl alcohol, and then tableted or encapsulated for convenient administration.
  • Such capsules or tablets may contain a controlled- release formulation as may be provided in a dispersion of active compound in hydroxypropylmethyl cellulose.
  • compositions as described herein comprise an oligonucleotide as described herein and one or more active pharmaceutical ingredients for the treatment of cystic fibrosis.
  • the additional active pharmaceutical ingredient comprises a CFTR modifier.
  • the CFTR modifier increases the duration of the opening of the CFTR gate, chloride flow through the CFTR gate, proper CFTR protein folding, the number of CFTR anchored to the cell membrane, or any combination thereof.
  • the modifier comprises a potentiator, a corrector, an amplifier, or a combination thereof.
  • the term "potentiator” refers to any agent that increases the probability that a defective CFTR will be open and therefore allows chloride ions to pass through the channel pore.
  • the CFTR potentiator comprises: N-(2,4-Di-tert-butyl-5- hydroxyphenyl)-4-oxo-l,4-dihydroquinoline-3-carboxamide (VX-770; Ivacaftor), QBW251, PTI- 808, or VX-561 (deuterated ivacaftor); GLPG1837; or a combination thereof.
  • the term "corrector" refers to any agent that assists in proper CFTR channel folding so as to enable its trafficking to the cell membrane.
  • the CFTR corrector comprises: 3- ⁇ 6- ⁇ [l-(2,2-difluoro-l,3- benzodioxol-5- yl)cyclopropanecarbonyl]amino ⁇ -3-methylpyridin-2-yl ⁇ benzoic acid (VX-809; Lumacaftor), l-(2,2- difluoro-l,3-benzodioxol-5-yl)- ⁇ N]-[l-[(2 ⁇ R ⁇ )-2,3-dihydroxypropyl]-6- fluoro-2-( 1 - hydroxy -2 -methylpropan-2-yl)indol-5 -yl]cyclopropane- 1 -carboxamide ( VX-661 ; Tezacaftor), VX-659, VX-445 (Elexacaftor), VX-152 and VX-440, GLPG2222 (corrector 1 [Cl]), GLPG3221
  • the term "amplifier” refers to any agent that induces a cell to increase its CFTR protein production rate or yield, leading to an increased amount of the CFTR protein.
  • the CFTR amplifier comprises PTI-428.
  • the additional active pharmaceutical ingredient comprises a drug or agent for the treatment of Cystic Fibrosis.
  • the drug or agent for the treatment of Cystic Fibrosis comprises a CFTR splicing modulator, a translational read-through agent, a sodium epithelial channel (ENaC) inhibitor, or a combination thereof.
  • the CFTR splicing modulator can induce or promote exon exclusion from the mature CFTR mRNA.
  • the CFTR splicing modulator comprises an antisense oligonucleotide as disclosed and as described herein.
  • the translational read-through agent comprises 3-[5-(2- fluorophenyl)-l,2,4-oxadiazol-3-yl]benzoic acid (Ataluren), ELX-02, or a combination thereof.
  • the ENaC inhibitor comprises VX-371 (P-1037) IONIS-ENAC-2.5Rx, or a combination thereof.
  • the combination therapies of the present invention may be administered together with other therapies useful in the treatment of cystic fibrosis or related diseases.
  • the invention herein further comprises use of a first composition and a second composition as described herein in preparing medicaments for the treatment of cystic fibrosis or related diseases.
  • the antisense oligonucleotides of the present invention can be formulated or co-administered with other therapeutic agents that are selected for their particular usefulness in addressing side effects associated with the conditions associated with cystic fibrosis.
  • compounds of the invention may be formulated with agents to treat or suppress infections, such as antibiotics.
  • other therapeutic agents comprise aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, or a combination thereof.
  • one or more therapeutic agents comprises a mucolytic agent, a bronchodialator, an antibiotic, an anti-infective agent, an anti-inflammatory agent, a corticosteroid, or a combination thereof.
  • the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject a composition as described herein.
  • the major pulmonary fibrosis disease comprises cystic fibrosis.
  • the major pulmonary fibrosis disease comprises idiopathic pulmonary fibrosis.
  • idiopathic pulmonary fibrosis is characterized by a chronic progressive decline in lung function, scarring of lung tissue, dyspnea (shortness of breath), or a combination thereof.
  • the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a composition as described herein.
  • the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject a composition as described herein.
  • the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a composition as described herein.
  • the present invention provides a method of modulating splicing or expression of a CFTR transcript in a cell comprising contacting the cell with an antisense oligonucleotide, a vector, a cell, or a composition as described herein.
  • modulation means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation.
  • modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression.
  • modulation of expression can include a change in splice site selection of pre- mRNA processing, resulting in a change in the absolute or relative amount of a particular splicevariant compared to the amount in the absence of modulation.
  • the methods as described herein comprise the step of administering a splicing modulator, which, in some embodiments, is an antisense oligonucleotide, which, in some embodiments, is a synthetic antisense oligonucleotide.
  • the methods as described herein comprise the step of contacting a cell with a splicing modulator, which, in some embodiments, is an antisense oligonucleotide, which, in some embodiments, is a synthetic antisense oligonucleotide.
  • contacting comprises contacting in vivo, in vitro, or ex vivo.
  • the cell is derived from the subject as described herein. In some embodiments, the cell comprises a cell line or a culture thereof. In some embodiments, the cell is an epithelial cell. In some embodiments, an epithelial cell comprises a respiratory epithelial cell. In some embodiments, a respiratory epithelial cell is derived from the upper respiratory system. In some embodiments, a respiratory epithelial cell is a ciliated columnar epithelial cell. In some embodiments, a respiratory epithelial cell is a ciliated pseudo stratified columnar epithelial cell. In some embodiments, a respiratory epithelial cell is selected from: a ciliated cell, a goblet cell, a club cell, an airway basal cell, or any combination thereof.
  • the subject has at least one CF-inducing mutation in the CFTR gene, or in the mRNA transcribed therefrom. In some embodiments, the subject is homozygous for one or more CF-inducing mutations. In some embodiments, the subject is heterozygous for one or more CF-inducing mutations.
  • the CFTR protein in the cells of the subject comprise a mixture of wild type, full-length, and fully functional CFTR protein encoded by the wild type allele and a mutated and deleterious CFTR protein encoded by the mutated allele.
  • a mutation refers to one or more nucleotide substitutions or modifications which render a partially or fully non-functional protein. In other embodiments, "a mutation” as described herein refers to one or more nucleotide substitutions or modifications which causes a "Cystic Fibrosis phenotype" in a subject harboring the mutation. [00107] In some embodiments, a modification comprises an insertion, deletion, inversion, or a combination thereof. In some embodiment, the modification results in a cystic fibrosis phenotype in a subject harboring or comprising the modification.
  • cystic fibrosis phenotype encompasses any symptom or manifestation related to cystic fibrosis. Methods for diagnosing cystic fibrosis and/or symptoms associated therewith are known in the art.
  • the subject is afflicted with, suffers from, or has cystic fibrosis. In other embodiments, the subject has symptoms of cystic fibrosis.
  • the method as described herein comprises a method of improving at least one clinical parameter of cystic fibrosis in the subject.
  • the clinical parameter comprises lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, change in the nasal potential difference (NPD), number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, the need for antibiotic therapy for sinopulmonary signs or symptoms, or a combination thereof.
  • BMI Body Mass Index
  • NPD nasal potential difference
  • the terms “treatment” or “treating” of a disease, disorder, or condition encompasses alleviation of at least one symptom of the disease, disorder, or condition.
  • treatment comprises a reduction in the severity of the disease, disorder, or condition.
  • treatment comprises inhibition of the progression of the disease, disorder, or condition.
  • treatment need not mean that the disease, disorder, or condition is completely cured.
  • a composition as described herein need only reduce the severity of a disease, disorder, or condition, reduce the severity of symptoms associated therewith, or provide improvement to a patient or subject’ s quality of life.
  • condition includes anatomic and physiological deviations from the normal anatomic and physiological states which constitute an impairment of the normal state of the living subject or one of its parts and/or that interrupts or modifies the performance of the bodily functions of the subject.
  • the terms “subject” or “individual” or “animal” or “patient” or “mammal,” refers to any subject, particularly a mammalian subject, for whom therapy is desired, for example, a human.
  • the subject is a primate, which in some embodiments, is a non-human primate.
  • the subject is murine, which in some embodiments is a mouse, and, in other embodiments is a rat.
  • the subject is canine, feline, bovine, equine, caprine, ovine, porcine, simian, ursine, vulpine, or lupine.
  • the subject is a chicken or fish.
  • the subject is male. In other embodiments, the subject is female.
  • the subject is a child. In other embodiments, the subject is an infant. In other embodiments, the subject is an adolescent. In other embodiments, the subject is an adult. In some embodiments, the adult subject is age 50 or over.
  • the present invention provides a method for reducing the level of non-functional CFTR mRNA. In some embodiments, the present invention provides a method for increasing the level of functional CFTR mRNA. In some embodiments, the present invention provides a method for correcting or improving chloride transport through the CFTR channel. In some embodiments, the present invention provides a method for increasing the production of functional CFTR protein. In some embodiments, the present invention provides a method for increasing the duration of the CFTR gate being open. In some embodiments, the present invention provides a method for increasing the chloride flow through the CFTR gate. In some embodiments, the present invention provides a method for increasing the proper folding of the CFTR protein. In some embodiments, the present invention provides a method for increasing the number of CFTR anchored to the cell membrane.
  • the present invention provides the use of an antisense oligonucleotide as described herein, or a pharmaceutical composition comprising the antisense oligonucleotide, for treating, suppressing or inhibiting cystic fibrosis in a subject.
  • an antisense oligonucleotide as described herein, or a pharmaceutical composition comprising the antisense oligonucleotide is used for improving at least one clinical parameter of cystic fibrosis.
  • alleviation of symptoms as described herein comprises a measured improvement of 15% -95%.
  • the measured improvement comprises a 15% improvement; a 20% improvement; a 25% improvement; a 30% improvement; a 35% improvement; improvement; a 40% improvement; a 45% improvement; a 50% improvement; a 55% improvement; a 60% improvement; a 65% improvement; a 70% improvement; a 75% improvement; a 80% improvement; a 85% improvement; a 90% improvement; or a 95% improvement.
  • the present invention provides a method of prolonging survival in a subject having cystic fibrosis, comprising the steps of administering to the subject one or more antisense oligonucleotides as described herein.
  • the present invention provides a method of delaying progression of cystic fibrosis in a subject having cystic fibrosis, comprising the steps of administering to the subject one or more antisense oligonucleotides as described herein.
  • the present invention provides a method of avoiding resistance to therapy in a subject having cystic fibrosis, comprising the steps of administering to the subject one or more antisense oligonucleotides as described herein.
  • the present invention provides a method of treating, suppressing or inhibiting cystic fibrosis in a subject comprising the step of administering to the subject a composition comprising one or more antisense oligonucleotides as described herein. In other embodiments, the present invention provides a method of treating, suppressing or inhibiting cystic fibrosis in a subject comprising the step of administering to the subject a composition consisting essentially of one or more antisense oligonucleotides as described herein.
  • the present invention provides a method of treating, suppressing or inhibiting cystic fibrosis in a subject comprising the step of administering to the subject a composition consisting of one or more antisense oligonucleotides as described herein.
  • the present invention provides the use of a therapeutically acceptable amount of the compositions as described herein for treating, suppressing or inhibiting cystic fibrosis in a subject. In other embodiments, the present invention provides the use of a therapeutically effective amount of the compositions as described herein for treating, suppressing or inhibiting cystic fibrosis in a subject. In other embodiments, the present invention provides the use of a synergistically effective amount of a combination therapy as described herein for treating, suppressing or inhibiting a cystic fibrosis in a subject.
  • the methods of the present invention further comprise the step of identifying a candidate subject for treatment with the compositions as described herein comprising the step of evaluating CFTR gene function or activity in the subject.
  • evaluating CFTR gene function comprises determining if there are CFTR mutations and if so, where the CFTR mutations are located.
  • evaluating CFTR gene function comprises RNA-seq or another RNA sequencing tool to reveal the presence and quantity of RNA in a biological sample at a given moment. In other embodiments, other methods of evaluating the quantity of CFTR RNA may be utilized, as are well known in the art.
  • the present invention provides a method of treating cystic fibrosis comprising the step of evaluating the genetic material in a biological sample from the subject using, in some embodiments, a DNA sequencing method, as are known in the art.
  • the biological sample comprises tissue.
  • the biological sample comprises blood cells.
  • the biological sample comprises skin cells.
  • the biological sample comprises epithelial cells, which, in some embodiments, are sampled from the inside of the subject’ s mouth.
  • the methods of the present invention are for treating, inhibiting, or suppressing cystic fibrosis in a subject.
  • the subject has atypical cystic fibrosis.
  • the subject has a CFTR mutation.
  • the CFTR mutation is a Class I CFTR mutation.
  • the CFTR mutation is a Class II CFTR mutation.
  • the CFTR mutation is a Class III CFTR mutation.
  • the CFTR mutation is a Class IV CFTR mutation.
  • the CFTR mutation is a Class V CFTR mutation.
  • the CFTR mutation is a Class VI CFTR mutation.
  • the subject has one or more of the following CFTR phenotypes: protein synthesis defect; maturation defect; gating defect; conductance defect; reduced quantity; reduced stability; or a combination thereof.
  • one or more of the antisense oligonucleotides as described herein is administered once per week. In other embodiments, one or more of the antisense oligonucleotides as described herein is administered once every two weeks. In some embodiments, a composition as described herein is administered to a subject once per day. In other embodiments, the composition is administered twice per day. In other embodiments, one or more of the compositions as described herein are administered in one to four doses per day. In other embodiments, one or more of the compositions as described herein are administered three times per day. In other embodiments, one or more of the compositions as described herein are administered four times per day. In other embodiments, one or more of the compositions as described herein are administered once every two days, once every three days, twice a week, once a week, once every 2 weeks, once every 3 weeks.
  • a composition as described herein is administered intermittently.
  • the intermittent administration comprises two days on/five days off. In other embodiments, the intermittent administration comprises three days on/four days.
  • compositions as described herein are chronically administered to a subject.
  • the composition is administered to the subject weekly.
  • the composition is administered to the subject every 2 weeks.
  • one or more of the compositions as described herein are administered for a specified period of time to a subject. In some embodiments, one or more of the compositions as described herein are administered for 7 days to 28 days. In other embodiments, one or more of the compositions as described herein are administered for 7 days to 8 weeks. In other embodiments, one or more of the compositions as described herein are administered for 7 days to 50 days. In other embodiments, one or more of the compositions as described herein are administered for 7 days to six months. In other embodiments, one or more of the compositions as described herein are administered for 7 days to one and half years. In other embodiments, one or more of the compositions as described herein are administered for 14 days to 12 months.
  • one or more of the compositions as described herein are administered for 14 days to 3 years. In other embodiments, one or more of the first and second compositions as described herein are administered for several years. In other embodiments, one or more of the compositions as described herein are administered for one month to six months.
  • one or more of the compositions as described herein are administered for 7 days. In other embodiments, one or more of the compositions as described herein are administered for 14 days. In other embodiments, one or more of the compositions as described herein are administered for 21 days. In other embodiments, one or more of the compositions as described herein are administered for 28 days. In other embodiments, one or more of the compositions as described herein are administered for 50 days. In other embodiments, one or more of the compositions as described herein are administered for 56 days. In other embodiments, one or more of the compositions as described herein are administered for 84 days. In other embodiments, one or more of the compositions as described herein are administered for 90 days. In other embodiments, one or more of the compositions as described herein are administered for 120 days.
  • compositions disclosed herein are administered once to a subject in need thereof with a mild acute condition. In some embodiments, the compositions disclosed herein are administered more than once to a subject in need thereof with a moderate or severe acute condition. In the case wherein the subject's condition does not improve, upon the doctor's discretion the composition may be administered chronically, that is, for an extended period of time, including throughout the duration of the subject's life in order to ameliorate or otherwise control or limit the symptoms of the subject's disease or condition.
  • the composition may be administered continuously; or the dose of drug being administered may be temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday").
  • a drug holiday varies between 2 days and 1 year.
  • the dose reduction during a drug holiday may be from 10%- 100%, including by way of example only 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.
  • the first composition and the second composition are administered together in the methods of the present invention.
  • the first composition and the second composition are administered at separate sites or at separate times.
  • the first composition and the second composition are administered at separate sites.
  • the first composition and the second composition are administered at separate times.
  • the administration of a second composition comprising the additional cystic fibrosis therapeutic occurs prior to the administration of the first composition comprising antisense oligonucleotides as described herein. In other embodiments, the administration of a second composition comprising the additional cystic fibrosis therapeutic occurs concurrent with the administration of the first composition comprising antisense oligonucleotides. In other embodiments, the administration of a second composition occurs following the administration of the first composition. In some embodiments, concurrent administration comprises administering a single composition comprising the second composition and the first composition. In other embodiments, concurrent administration comprises administering separate compositions at approximately the same time.
  • the administration of the second composition occurs at the same site as the administration of the first composition.
  • the first composition is administered several days before and after the administration of the second composition. In some embodiments, the first composition is administered 1, 2, 3, 4, or 5 days prior to the administration of the second composition. In some embodiments, the first composition is administered 1, 2, 3, 4, or 5 days subsequent to the administration of the second composition.
  • the present invention provides a kit comprising a therapeutic or prophylactic composition containing an effective amount of one or more antisense oligonucleotides, as described herein, and optionally a second composition comprising one or more cystic fibrosis drugs.
  • the kit comprises a sterile container which contains therapeutic or prophylactic agents; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art.
  • Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
  • the composition(s) are provided together with instructions for administering the composition(s) to a subject having or at risk of developing a major pulmonary fibrosis disease.
  • the instructions will generally include information about the use of the composition for the treatment or prevention of a major pulmonary fibrosis disease.
  • the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of a major pulmonary fibrosis disease or symptoms thereof; precautions; warnings; indications; counter-indications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and/or references.
  • the instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
  • the instructions are present as an electronic storage data file present on a suitable computer readable storage medium.
  • the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g., via the internet, are provided.
  • An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
  • the present invention further provides a kit for identifying a candidate subject for treatment with a composition comprising one or more antisense oligonucleotides, as described herein, and, optionally, a second composition comprising one or more cystic fibrosis drugs, and further comprising an evaluator of CFTR gene function.
  • the evaluator comprises a DNA sequencing method, as is known in the art.
  • the evaluator comprises RNA-seq or another RNA sequencing tool to reveal the presence and quantity of RNA in a biological sample.
  • other methods of evaluating the quantity of downstream CFTR DNA, protein, or RNA may be utilized, as are well known in the art.
  • instructions for use are included in the kit.
  • the present invention provides combined preparations.
  • a combined preparation defines especially a “kit of parts” in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners i.e., simultaneously, concurrently, separately, or sequentially.
  • the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the ratio of the total amounts of the combination partners in some embodiments, can be administered in the combined preparation.
  • the kit of the invention comprises: at least one antisense oligonucleotide; and one or more CFTR modifiers; one or more cystic fibrosis drugs, or a combination thereof.
  • the antisense oligonucleotide is selected from SEQ ID NOs: 1-44.
  • the CFTR modifier is selected from: a CFTR potentiator, a CFTR corrector, a CFTR amplifier or a combination thereof.
  • the cystic fibrosis drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof.
  • Types and doses of cystic fibrosis drugs, such as an antibiotic, a bronchodilator, and a corticosteroid, would be apparent to one of ordinary skill in the art.
  • cystic fibrosis drugs such as antibiotics include, but are not limited to, cioxacillin, dicloxacillin, cephalosporin, trimethoprim, sulfamethoxazole, erythromycin, amoxicillin, clavulanate, ampicillin, tetracycline, linezolid, tobramycin or aztreonam lysine, fluoroquinolone, gentamicin, and monobactam with antip seudomonal activity.
  • antibiotics include, but are not limited to, cioxacillin, dicloxacillin, cephalosporin, trimethoprim, sulfamethoxazole, erythromycin, amoxicillin, clavulanate, ampicillin, tetracycline, linezolid, tobramycin or aztreonam lysine, fluoroquinolone, gentamicin, and monobactam with antip seudom
  • the components of the kit disclosed above are sterile.
  • sterile refers to a state of being free from biological contaminants. Any method of sterilization is applicable and would be apparent to one of ordinary skill in the art.
  • the components of the kit are packaged within a container.
  • the container is made of a material selected from the group consisting of thin-walled film or plastic (transparent or opaque), paperboard-based, foil, rigid plastic, metal (e.g., aluminum), glass, etc.
  • the content of the kit is packaged, as described below, to allow for storage of the components until they are needed.
  • kits may be packaged in suitable packaging to maintain sterility.
  • the components of the kit are stored in separate containers within the main kit containment element e.g., box or analogous structure, may or may not be an airtight container, e.g., to further preserve the sterility of some or all of the components of the kit.
  • the instructions may be recorded on a suitable recording medium or substrate.
  • the instructions may be printed on a substrate, such as paper or plastic, etc.
  • the present invention further comprises combinations of the compositions of the present invention and, optionally, one or more additional agents in kit form, e.g., where they are packaged together or placed in separate packages to be sold together as a kit, or where they are packaged to be formulated together.
  • kit form e.g., where they are packaged together or placed in separate packages to be sold together as a kit, or where they are packaged to be formulated together.
  • the terms “a” and “an” refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.
  • the term "administering” refers to bringing in contact with a compound of the present invention.
  • the compositions are applied locally. In other embodiments, the compositions are applied systemically. Administration can be accomplished to cells or tissue cultures, or to living organisms, for example humans.
  • parenteral administration refers to deliver one or more compounds or compositions to a subject parenterally, enterally, or topically.
  • parenteral administration include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion.
  • enteral administration include, but are not limited to oral, inhalation, intranasal, sublingual, and rectal administration.
  • topical administration include, but are not limited to, transdermal and vaginal administration.
  • an agent or composition is administered parenterally, optionally by intravenous administration or oral administration to a subject.
  • a composition of the present invention comprises a pharmaceutically acceptable composition.
  • pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, combinations, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • a composition or combination of the present invention is administered in a therapeutically effective amount.
  • a “therapeutically effective amount” is intended to include an amount of a compound of the present invention alone or an amount of the combination of compounds claimed or an amount of a compound of the present invention in combination with other active ingredients effective to increase WT CFTR, decrease mutated CFTR, or treat or prevent cystic fibrosis.
  • a "therapeutically effective amount" of a composition of the invention is that amount of composition which is sufficient to provide a beneficial effect to the subject to which the composition is administered.
  • “treating” or “treatment” cover the treatment of a disease-state in a mammal, particularly in a human, and include: (a) preventing the disease-state from occurring in a mammal, in particular, when such mammal is predisposed to the disease-state but has not yet been diagnosed as having it; (b) inhibiting the disease-state, i.e., arresting its development; and/or (c) relieving the disease-state, i.e., causing regression of the disease state.
  • the goal of treating is to prevent or lessen the targeted pathologic condition or disorder as described hereinabove.
  • “treating” refers inter alia to delaying progression, expediting remission, inducing remission, augmenting remission, speeding recovery, increasing efficacy of or decreasing resistance to alternative therapeutics, or a combination thereof.
  • “preventing” refers, inter alia, to delaying the onset of symptoms, preventing relapse to a disease, decreasing the number or frequency of relapse episodes, increasing latency between symptomatic episodes, or a combination thereof.
  • “suppressing” or “inhibiting”, refers inter alia to reducing the severity of symptoms, reducing the severity of an acute episode, reducing the number of symptoms, reducing the incidence of disease-related symptoms, reducing the latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging subject survival, or a combination thereof.
  • antisense compound or “antisense oligonucleotide” as used herein means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides.
  • an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
  • nucleoside as used herein means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
  • oligonucleoside refers to an oligonucleotide in which none of the intemucleoside linkages contains a phosphorus atom.
  • oligonucleotides include oligonucleosides.
  • a “vector” includes, inter alia, any viral vector, as well as any plasmid, cosmid, phage or binary vector in double or single stranded linear or circular form that may or may not be self transmissible or mobilizable, and that can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g., autonomous replicating plasmid with an origin of replication).
  • an “expression cassette” as used herein describes a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, which may include a promoter operably linked to the nucleotide sequence of interest that may be operably linked to termination signals.
  • the coding region usually codes for a functional RNA of interest, for example an siRNA.
  • the expression cassette including the nucleotide sequence of interest may be chimeric.
  • the expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of a regulatable promoter that initiates transcription only when the host cell is exposed to a particular stimulus.
  • the promoter can also be specific to a particular tissue or organ or stage of development.
  • Such expression cassettes can include a transcriptional initiation region linked to a nucleotide sequence of interest. Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regulation of the regulatory regions.
  • the expression cassette may additionally contain selectable marker genes.
  • the compositions as described herein comprise one or more antisense oligonucleotides as described herein. In other embodiments, the compositions as described herein consist of one or more antisense oligonucleotides as described herein. In other embodiments, the compositions as described herein consist essentially of one or more antisense oligonucleotides as described herein.
  • compositions, combinations and methods of the present invention comprising the elements or steps as described herein may, in other embodiments, consist of those elements or steps, or in other embodiments, consist essentially of those elements or steps.
  • each of the verbs, “comprise”, “include” and “have” and conjugates thereof are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.
  • the term “comprise” refers to the inclusion of the indicated active agents, such as the antisense oligonucleotide, as well as inclusion of other active agents, and pharmaceutically or physiologically acceptable carriers, excipients, emollients, stabilizers, etc., as are known in the pharmaceutical industry.
  • the term “consisting essentially of’ refers to a composition, whose only active ingredients are the indicated active ingredients. However, other compounds may be included which are for stabilizing, preserving, etc. the formulation, but are not involved directly in the therapeutic effect of the indicated active ingredients.
  • the term “consisting essentially of’ may refer to components which facilitate the release of the active ingredient.
  • the term “consisting of’ refers to a composition, which contains the active ingredients and a pharmaceutically acceptable carrier or excipient.
  • GripTiteTM 293 MSR Cell Line which is a genetically engineered Human Embryonic Kidney (HEK 293) cell line that expresses the human macrophage scavenger receptor and strongly adheres to standard tissue culture plates.
  • CFTR EMG il4-il8 plasmid (Sharma et al, PLoS Genet. 2018;14(11):el007723. Published 2018 Nov 16) carrying a mutated CFTR gene is transiently or stably transfected to the GripTiteTM 293 cells.
  • GripTiteTM 293 cells expressing the mutated CFTR EMG il4-il 8 plasmid cells were plated onto 6 well plates with 50,000 cells per well with 10% FCS DMEM and left overnight prior to transfection. Each antisense oligonucleotide as described herein was transfected into the cells using Lipofecatmine 2000 transfection reagent (Invitrogen) according to the lipofectamine 2000 reagent protocol.
  • RNA concentration was determined using a nanodrop.
  • Complementary DNA (cDNA) synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The cDNA was analyzed by PCR and qPCR.
  • Real-time PCR was performed in QuantStudio 3 Real-Time PCR System using TaqMan® Fast Advanced Master Mix (Applied Biosystems) with TaqMan probes specific for transcripts with or without the exon of interest. The expression level was normalized to the transcript levels of GUSb. Technical duplicates were analyzed for each sample. Analysis was performed using the double delta Ct analysis.
  • PCR was performed using the PlatinumTM SuperFiTM Green PCR Master Mix 12359- 10 (Invitrogen). PCR products were then separated on an agarose gel for detection of the correctly and aberrantly spliced transcripts. The gels were exposed to UV light for visualization, and the PCR products were recorded.
  • protein extracts were prepared from organoid-derived monolayer cells from a patient carrying the 2789 +5 G-to-A mutation and a healthy volunteer (HV) and analyzed by immunoblotting with anti-CFTR (596) and anti-calnexin antibodies. The gel was transferred to a nitrocellulose membrane, and antibody hybridization and chemiluminescence were performed according to standard procedures.
  • Intestinal organoids derived from a cystic fibrosis subject carrying the 2789 +5 G-to- A CFTR mutation and from a Healthy Volunteer (HV) were grown in monolayer on transwell filters. CFTR activity was analyzed using the Ussing chamber according to standard procedures.
  • ASO candidates were screened by transfecting lOOnM ASO into 293-GT cells carrying the EMG il4-il8 2789 +5 G-to-A mut plasmid. Following transfection, RNA was extracted, treated with DNase, and cleaned on RNeasy mini spin column. The effect on splicing modulation was analyzed by RT-PCR (Figure 2A) and RT-qPCR ( Figure 2B). The ASOs were tested relative to a negative control ASO (stuffer). The screen led to the identification of 6 new ASOs, SPL16-(28-33), that efficiently reduced the levels of transcripts without Exon 16 to less than 30% of control ASO as measured by RT-qPCR.
  • Organoids originating from patient derived biopsies Healthy volunteer (HV) and 2789+5 G-to-A (c.2657+5G>A) organoid-derived monolayer seeded on transwell filters (25*104 cells/0.33cm 2 transwell filter).
  • the second allele, Q359K T360K carries two missense mutations and therefore is not expected to produce mature CFTR protein.
  • the filters were grown in parallel for Ussing chamber assay, RNA extraction, and protein extraction. RNA extracts were analyzed by RT-qPCR and PCR, and proteins were detected by western blot.
  • HV organoids have a normal splicing pattern (data not shown), while 2789 organoids have low transcript levels that include Exon 16 and high transcripts levels without Exon 16 ( Figure 3A, data not shown).
  • Cells derived from HV organoids show high levels of mature glycosylated CFTR protein, while cells derived from 2789 organoids show low levels of mature CFTR protein ( Figure 3B).
  • CFTR activity of 2789 is only 4% of WT CFTR activity ( Figure 3C).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pulmonology (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides specific synthetic oligonucleotides, as well as vectors, cells, and pharmaceutical compositions comprising the oligonucleotides, and their use in methods of treating, suppressing, or inhibiting cystic fibrosis.

Description

ANTISENSE OLIGONUCLEOTIDES FOR MODULATING EXON SKIPPING IN CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (CFTR)
FIELD OF THE DISCLOSURE
[001] The present invention provides specific synthetic oligonucleotides, as well as vectors, cells, and pharmaceutical compositions comprising the oligonucleotides, and their use in methods of treating, suppressing, or inhibiting cystic fibrosis.
BACKGROUND
[002] Cystic fibrosis is a rare autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Approximately 100,000 children and adults worldwide are currently living with cystic fibrosis. The CFTR gene encodes a channel responsible for chloride transport in epithelial cells. Cystic fibrosis most severely affects the lungs, where there is insufficient CFTR function in the airway epithelium. More than 90% of cystic fibrosis mortality is related to the respiratory disease. Over 1,700 different mutations disrupting CFTR function have been identified worldwide in cystic fibrosis patients.
[003] Currently approved therapies for cystic fibrosis correct defects in CFTR protein processing (corrector: VX-809/Lumacaftor, VX-661/Tezacaftor, and VX-445/elexacaftor) and/or chloride channel function (potentiator: VX-770/Kalydeco). However, many patients do not respond to these therapies, possibly because of the many different types of mutations harbored by different patients. Therefore, additional therapies for targeting the many possible mutations leading to cystic fibrosis are needed in the art.
SUMMARY OF THE DISCLOSURE
[004] In some embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
[005] In other embodiments, the present invention provides a vector comprising a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
[006] In other embodiments, the present invention provides a cell comprising a synthetic oligonucleotide comprising SEQ ID NOs: 1-44. [007] In other embodiments, the present invention provides a pharmaceutical composition comprising a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
[008] In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
[009] In other embodiments, the present invention provides a method for suppressing or inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a synthetic oligonucleotide comprising SEQ ID NOs: 1-44.
BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1. Model depicting Exon 16 skipping in patients with the 2789 +5 G-to-A (2789) mutation in CFTR (left) and how antisense oligonucleotides can modulate splicing and rescue normal full-length CFTR transcripts.
[0011] Figures 2A-2B. 293-GT cells were transfected with EMG i 14-i 18 plasmid carrying a 2789 +5 G-to-A mutation and 24hrs later, transfected with lOOnM of one of the antisense oligonucleotides (ASOs). Following a 24-hour treatment with the indicated antisense oligonucleotide, RNA was extracted, treated with DNase, and cleaned on RNeasy mini spin column.
[0012] Figure 2A. The effect of ASO treatment on splicing modulation was analyzed by RT- PCR.
[0013] Figure 2B. The effect of ASO treatment on splicing modulation was analyzed by quantitative RT-PCR (RT-qPCR). The values shown are the average fold change (mean+SEM) from 3-4 independent experiments relative to cells treated with a control antisense oligonucleotide. Values were normalized against transcripts of GUSb gene. Statistical analysis was performed using Student's t test (1 tail, paired).
[0014] Figure 3A. RNA was extracted from organoid-derived monolayer cells from a patient carrying the 2789 +5 G-to-A mutation and a healthy volunteer (HV). The CFTR splicing pattern of transcripts containing exon 16 was analyzed using RT-qPCR. The values shown are the average fold change (Mean ± SEM) in 2789 +5 G-to-A mutated organoids relative to HV organoids (n=3). Values were normalized against transcripts of GUSb gene. [0015] Figure 3B. Protein was extracted from organoid-derived monolayer cells from a patient carrying the 2789 +5 G-to-A mutation and a healthy volunteer (HV), and the levels of CFTR protein was analyzed by immunoblotting with anti CFTR (596), and anti-calnexin antibodies.
[0016] Figure 3C. Intestinal organoids derived from a cystic fibrosis subject carrying a CFTR mutation were grown in monolayer on transwell filters. CFTR activity was measured using the Ussing chamber assay (n= 20 for HV (healthy volunteer), n=16 for mutant 2789 2789 +5 G- to-A subject).
DETAILED DESCRIPTION
[0017] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be understood by those skilled in the art that the present invention may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the present invention.
[0018] The present invention provides compositions and methods for treating cystic fibrosis in a subject by administering antisense oligonucleotides that alter the splicing in non-WT CFTR gene transcripts. In some embodiments, administration of the antisense oligonucleotides as described herein leads to cellular production of mRNA that codes for a CFTR protein with fully or partially restored CFTR function. In other embodiments, administration of the antisense oligonucleotides as described herein enhances expression levels of CFTR, cellular localization of CFTR, CFTR activity, function of CFTR, or a combination thereof.
Antisense Oligonucleotides
[0019] In some embodiments, the oligonucleotides, vectors, cells, compositions, methods, and kits as described herein comprise a splicing modulator or administration of a splicing modulator, which, in some embodiments, is an antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is a chemically modified antisense oligonucleotide.
[0020] In some embodiments, the disclosure provides an oligonucleotide having 8 to 30 linked nucleosides having a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 8 contiguous nucleobases complementary to an equal-length portion of a target region of a cystic fibrosis transmembrane conductance regulator (CFTR) transcript. [0021] In some embodiments, antisense oligonucleotides modulate target nucleic acids and may comprise chemical modifications and motifs. Antisense oligonucleotides may modulate protein expression by binding to a target messenger RNA (mRNA) encoding the protein. In some embodiments, the binding of an antisense oligonucleotide to its target mRNA results in the cleavage of the mRNA. In some embodiments, the binding of an antisense oligonucleotide to its target mRNA modulates the processing of pre-mRNA. In some embodiments, antisense oligonucleotides alter splicing, interfere with polyadenylation, or prevent formation of the 5'-cap of a pre-mRNA. In some embodiments, antisense oligonucleotides enhance inclusion or inhibit skipping of one or more CFTR exons.
[0022] As used herein, antisense oligonucleotide describes an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
[0023] As used herein, “antisense activity” describes any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. As used herein, “detecting” or “measuring” means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
[0024] In some embodiments, the present invention provides a synthetic oligonucleotide comprising any one or more of SEQ ID NOs: 1-44.
[0025] In other embodiments, the present invention provides a synthetic oligonucleotide comprising any one or more of SEQ ID NOs: 25-31.
[0026] In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 31. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 32. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 29. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 30. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 28. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 27. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 35. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 34. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 33. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 26. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 41. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 37. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 25. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 39. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 40. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 36. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 38. In other embodiments, the present invention provides a synthetic oligonucleotide comprising SEQ ID NO: 24.
[0027] In some embodiments, the antisense oligonucleotide comprises a chemical modification or is chemically modified. In some embodiments, the chemical modification comprises a modification of a backbone of the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises one or more phosphate-ribose. In other embodiments, the antisense oligonucleotide comprises one or more phosphate-deoxyriboses. In other embodiments, the antisense oligonucleotide comprises one or more phosphorothioates. In other embodiments, the antisense oligonucleotide comprises one or more phosphorothioate-deoxyriboses. In other embodiments, the antisense oligonucleotide comprises one or more 2'-O-methyl- phosphorothioates (2OMPs). In other embodiments, the antisense oligonucleotide comprises one or more phosphorodiamidates morpholino (PMOs). In other embodiments, the antisense oligonucleotide comprises one or more peptide nucleic acids (PNAs). In other embodiments, the antisense oligonucleotide comprises one or more 2-methoxyethyl phosphorothioates (MOEs). In other embodiments, the antisense oligonucleotide comprises a constrained ethyl (cET) backbone. In other embodiments, the antisense oligonucleotide comprises an alternating locked nucleic acid (LNA) backbone. In other embodiments, the antisense oligonucleotide comprises one or more N3'-P5' phosphoramidates. In other embodiments, the antisense oligonucleotide comprises one or more 2'-deoxy-2'-fluoro-p-d-arabino nucleic acids. In other embodiments, the antisense oligonucleotide comprises one or more cyclohexene nucleic acids (CeNAs). In other embodiments, the antisense oligonucleotide comprises one or more tricyclo-DNA (tcDNA) nucleic acids. In other embodiments, the antisense oligonucleotide comprises one or more 2- amino-2’-deoxyadenosines (DAPs). In other embodiments, the antisense oligonucleotide comprises one or more 2’-deoxy-2’-fluoro-P-D-arabinonucleic acids (FANAs). In other embodiments, the antisense oligonucleotide comprises a ligand-conjugated antisense (LICA). In other embodiments, the antisense oligonucleotide comprises a combination of any of the chemical modifications described herein.
[0028] In some embodiments, the chemical modification is a modification of a sugar of the antisense oligonucleotide. In some embodiments, the sugar modification comprises 2'-modified and conformationally constrained nucleotides. In other embodiments, the chemical modification comprises a 2'-fluoro modification.
[0029] In some embodiments, the chemical modification is a modification of a nucleobase of the antisense oligonucleotide. In some embodiments, the chemical modification is a modification of the 3’ terminal. In some embodiments, the chemical modification is a modification of the 5’ terminal. In some embodiment, the chemical modification is a combination of two or more of the modifications as described herein. In some embodiments, the oligonucleotide used in the compositions and methods as described herein is chimeric. In some embodiments, the oligonucleotide used in the compositions and methods as described herein comprises multiple types of modified nucleotides. In some embodiments, the oligonucleotide comprises mixtures of LNA/DNA or LNA/2'OMe/MOE-RNA. In other embodiments, the oligonucleotide comprises combinations of 2-thiothymidine, 3'-fluorohexitol nucleic acid (FHNA), cEt, a 5-modified pyrimidine base, and a,P constrained nucleic acid (a,[3-CNA). In some embodiments, the oligonucleotide comprises Fluoroarabinonucleic acid (2'F-ANA).
[0030] In some embodiments, the oligonucleotide comprises a gapmer. In some embodiments, the gapmer antisense oligonucleotide is 12-15 nucleotides.
[0031] In some embodiments, the chemical modification increases stability of the antisense oligonucleotide in a cell. In some embodiments, the chemical modification increases stability of the antisense oligonucleotide in vivo. In some embodiments, the chemical modification increases the antisense oligonucleotide’s ability to modulate splicing. In some embodiments, the chemical modification increases the antisense oligonucleotide’s ability to reduce exon skipping. In some embodiments, the chemical modification increases the half-life of the antisense oligonucleotide. In some embodiments, the chemical modification inhibits polymerase extension from the 3’ end of the antisense oligonucleotide. In some embodiments, the chemical modification inhibits recognition of the antisense oligonucleotide by a polymerase. In some embodiments, the chemical modification inhibits double-strand triggered degradation. In some embodiments, the chemically modified antisense oligonucleotide does not trigger nucleic acid double- stranded degradation upon binding a CFTR pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC- mediated degradation or any parallel nucleic acid degradation pathway.
[0032] In some embodiments, a naked antisense oligonucleotide is delivered to cells. In other embodiments, the antisense oligonucleotide is bioconjugated or delivered via a nanocarrier. In some embodiment, the antisense oligonucleotide is non-covalently complexed with cationic polymers (for example, polyethylenimine), dendrimers, CPPs (for example, MPG-8, PepFect6, RVG-9R228, and Xentry-KALA). In other embodiments, the nanocarrier is a nanoparticle, which, in some embodiments, comprises a lipid nanoparticle.
[0033] In some embodiments, the antisense oligonucleotide is covalently conjugated to celltargeting or cell-penetrating moieties. In other embodiments, the antisense oligonucleotide is delivered as part of a nanoparticle formulation. In other embodiments, the antisense oligonucleotide is delivered as part of an endogenous vesicle (exosome) loading. In other embodiments, the antisense oligonucleotide is delivered on spherical nucleic acids (SNAs). In other embodiments, nanotechnology applications (for example, DNA cages) and ‘smart’ materials are used for antisense oligonucleotide delivery.
[0034] In some embodiments, the delivery potential of antisense oligonucleotides is enhanced through direct covalent conjugation of various moieties that promote intracellular uptake, target the antisense oligonucleotide to specific cells/tissues or reduce clearance from the circulation. These include lipids (for example, cholesterol that facilitates interactions with lipoprotein particles in the circulation), peptides (for cell targeting and/or cell penetration), aptamers, antibodies and sugars (for example, N-acetylgalactosamine (GalNAc)).
[0035] In some embodiments, the antisense oligonucleotide is devoid of a labeling moiety. In some embodiments, the antisense oligonucleotide is not labeled. In some embodiments, the antisense oligonucleotide does not emit a detectable signal or does not comprise moieties capable of being recognized so as to enable nucleic acid detection (e.g., digoxigenin and fluorescently labeled anti-DIG antibody). In some embodiments, a detectable signal comprises a dye or an emitting energy which provides detection of a compound, e.g., a polynucleotide, in vivo or in vitro. In some embodiments, a detectable signal comprises: a fluorescent signal, a chromatic signal, or a radioactive signal. [0036] In some embodiments, the antisense oligonucleotide is devoid of radioactive nucleobase(s); digoxigenin, streptavidin, biotin, a fluorophore, hapten label, CLICK label, amine label, or thiol label.
[0037] In other embodiments, the antisense oligonucleotide comprises a labeling moiety as described hereinabove.
[0038] In some embodiments, the antisense oligonucleotide comprises at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, at least 20 bases, at least 21 bases, at least 22 bases, at least 23 bases, at least 23 bases, or at least 25 bases, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0039] In some embodiments, the antisense oligonucleotide comprises 14 to 25 bases, 14 to 23 bases, 14 to 23 bases, 14 to 22 bases, 14 to 21 bases, 14 to 20 bases, 14 to 19 bases, or 14 to 18 bases, or 14 to 17 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the antisense oligonucleotide comprises 17 to 22 bases.
[0040] In some embodiments, the antisense oligonucleotide is complementary to the CFTR mRNA or pre-mRNA of Accession number NM_000492.4.
[0041] In some embodiments, the antisense oligonucleotide is complementary to a target region, wherein the target region comprises Exon 16, which in one embodiment, comprises gtggctgcttctttggttgtgctgtggctccttggaaa (SEQ ID NO: 91). In other embodiments, the target region comprises exon 16 and 70 nucleotide intronic sequences upstream and downstream of exon 16. According to this aspect and in one embodiment, the target region comprises tagatgtgggcatgggaggaataggtgaagatgtagaaaaaaaatcaactgtgtcttgttccattccaggtggctgcttetttggttgtgct gtggctccttggaaagtgagtattccatgtcctattgtgtagattgtgttttatttctgttgattaaatattgtaatccactatg (SEQ ID NO:
92). In another embodiment, the target region comprises tagatgtgggcatgggaggaataggtgaagatgttagaaaaaaaatcaactgtgtcttgttccattccaggtggetgcttctttggttgtgct gtggctecttggaaagtgaatattccatgtcctattgtgtagattgtgttttatttctgttgattaaatattgtaatccactatg (SEQ ID NO:
93).
[0042] In another embodiment, the target region comprises cccaggaacacaaagcaaaggaagatgaaattgtgtgtaccttgatattggtacacacatcaaatggtgtgatgtgaatttagatgtgggcat gggaggaataggtgaagatgttagaaaaaaaatcaactgtgtcttgttccattccaggtggctgcttctttggttgtgctgtggctccttgga aagtgagtattccatgtcctattgtgtagattgtgttttatttctgttgattaaatattgtaatccactatgtttgtatgtattgtaatccactttgtttcatt tctcccaagcattatggtagtggaaagataaggttttttgtttaaatg (SEQ ID NO: 94). In still other embodiments, the target region comprises cccaggaacacaaagcaaaggaagatgaaattgtgtgtaccttgatattggtacacacatcaaatggtgtgatgtgaatttagatgtgggcat gggaggaataggtgaagatgttagaaaaaaaatcaactgtgtcttgttccattccaggtggctgcttctttggttgtgctgtggctccttgga aagtgaatattccatgtcctattgtgtagattgtgttttatttctgttgattaaatattgtaatccactatgtttgtatgtattgtaatccactttgtttcatt tctcccaagcattatggtagtggaaagataaggttttttgtttaaatg (SEQ ID NO: 95).
[0043] In some embodiments, the term “complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated.
[0044] In some embodiments, the CFTR pre-mRNA is a wildtype pre-mRNA. In some embodiments, the pre-mRNA is a mutated pre-mRNA.
[0045] In some embodiments, the antisense oligonucleotide is specific to a CFTR pre- mRNA. In some embodiments, the term “specific” refers to base pair specificity, gene specificity, or to both base pair and gene specificity. In some embodiments, the antisense oligonucleotide is specific to the CFTR gene. In some embodiments, the antisense oligonucleotide masks a splice inhibiting motif, sequence, or region of CFTR. In some embodiments, the antisense oligonucleotide as described herein prevents exon skipping. In some embodiments, the antisense oligonucleotide promotes exon insertion. In other embodiments, the antisense oligonucleotide masks a splice enhancing motif, sequence, or region of CFTR.
[0046] In some embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with perfect or 100% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with greater than 90% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with greater than 95% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre-mRNA with greater than 98% complementarity. In other embodiments, the antisense oligonucleotide binds the CFTR pre- mRNA with greater than 99% complementarity. Each possibility represents a separate embodiment of the invention. [0047] In some embodiments, the antisense oligonucleotide does not bind any gene product other than CFTR with perfect complementarity. In some embodiments, the antisense oligonucleotide does not bind any gene other than CFTR with a complementarity of greater than 70, 75, 80, 85, 90, 95, 97, er 99%. Each possibility represents a separate embodiment of the invention. In some embodiments, the antisense oligonucleotide does not bind any gene other than CFTR with a complementarity of greater than 90%.
[0048] In some embodiments, the antisense oligonucleotide does not bind with perfect complementarity to anywhere in the genome of a cell other than within CFTR. In some embodiments, the antisense oligonucleotide does not bind with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, or 99% to anywhere in the genome of a cell other than within CFTR. Each possibility represents a separate embodiment of the invention. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammal is a human.
[0049] In some embodiments, a mutated pre-mRNA comprises at least one mutation in an exon of the CFTR pre-mRNA. In other embodiments, a mutated pre-mRNA comprises at least one mutation in an intron of the CFTR pre-mRNA. In some embodiments, the mutated pre-mRNA comprises a splicing mutation. In some embodiments, the splicing mutation comprises a splicedonor sequence mutation. In other embodiments, the splicing mutation comprises a spliceacceptor sequence mutation. In other embodiments, the splicing mutation comprises a branch point mutation. In other embodiments, the splicing mutation comprises a polypyrimidine tract mutation.
[0050] In some embodiments, the mutation comprises an early signal for termination of translation or a premature termination codon. In some embodiments, the mutation comprises a frameshift mutation. In some embodiments, the mutation comprises a missense mutation. In other embodiments, the mutation comprises a nonsense mutation. In some embodiments, the mutation comprises a substitution mutation in the CFTR encoding gene, pre-mRNA encoded therefrom, or protein product thereof.
[0051] In some embodiments, the antisense oligonucleotide binds to an intronic sequence in the CFTR pre-mRNA. In some embodiments, the antisense oligonucleotide binds to an intronic sequence that is distant from an exon, an intron-exon junction, or both. In some embodiments, the binding of an antisense oligonucleotide to an intronic sequence in the CFTR pre-mRNA reduces exon skipping. In some embodiments, the antisense oligonucleotide may partially or fully bind (e.g., complement) to an intronic sequence within a gene other than CFTR. In some embodiments, an antisense oligonucleotide that partially or fully binds to an intronic sequence within a gene other than CFTR does not induce splicing or modify transcription in the non-CFTR gene.
[0052] In some embodiments, distant comprises at least 50 base pairs (bp), at least 100 bp, at least 200 bp, at least 350 bp, at least 500 bp, at least 750 bp, at least 1,000 bp, at least 2,000 bp, at least 3,500 bp, at least 5,000 bp, at least 7,500 bp, or at least 10,000 bp upstream to an exon, an intro-exon junction, or both, or downstream to an exon, an intro-exon junction, or both, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0053] In some embodiments, the antisense oligonucleotide modulates expression of CFTR. In some embodiments, the antisense oligonucleotide modulates splicing of CFTR. In some embodiments, the antisense oligonucleotide modulates splicing of an exon of CFTR. In some embodiments, the antisense oligonucleotide does not cause an off-target effect. In some embodiments, off-target is a target other than CFTR. In some embodiments, off-target is a target other than splicing of an exon of CFTR. In some embodiments, the antisense oligonucleotide does not substantially or significantly modulate expression of a gene other than CFTR. In some embodiments, the antisense oligonucleotide does not substantially or significantly modulate splicing of a gene other than CFTR. In some embodiments, the antisense oligonucleotide does not substantially or significantly modulate splicing of an exon other than an exon of CFTR. In some embodiments, substantial modulation of expression is a change in expression of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50%. Each possibility represents a separate embodiment of the invention. In some embodiments, substantial modulation of expression is a change in expression of at least 20%.
[0054] In some embodiments, an antisense oligonucleotide as described herein, or a pharmaceutical composition comprising an antisense oligonucleotide as described herein, is used in the modulation of splicing of a CFTR pre-mRNA transcribed from a CFTR gene.
[0055] The phrase “modulation of splicing” in some embodiments refers to affecting a change in the level of any RNA or mRNA variant produced by the CFTR native pre-mRNA. For example, modulation comprises causing an increase or decrease in the level of abnormal CFTR mRNA, causing an increase or decrease in the level of normal, full-length CFTR mRNA, causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a missense codon, and/or causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a premature termination codon (nonsense codon). It is therefore evident that any change in ratio between certain CFTR splicing variants is also considered to be the result of splicing modulation. Each possibility represents a separate embodiment of the invention. In certain embodiments, modulation comprises decreasing the level of abnormal CFTR mRNA. In some embodiments, the abnormal CFTR mRNA comprises a mutated exon. In some embodiments, modulation comprises decreasing the level of an abnormal CFTR mRNA comprising a mutated exon. In some embodiments, modulation comprises decreasing the level of an abnormal CFTR mRNA comprising a mutation that results in early translation termination.
[0056] In other embodiments, the CFTR pre-mRNA is devoid of a mutation. In some embodiments, the CFTR pre-mRNA is a wildtype CFTR pre-mRNA.
[0057] In some embodiments, antisense oligonucleotides as described herein are singlestranded.
[0058] In some embodiments, oligonucleotides are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligonucleotide including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligonucleotide. A conjugate group as described herein comprises intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, dyes or a combination thereof.
[0059] In some embodiments, the antisense oligonucleotide comprises an active fragment of any one of SEQ ID Nos: 1-44.
[0060] In some embodiments, the term “active fragment” refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the antisense oligonucleotide, providing that at least: 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original antisense oligonucleotide nucleotide sequence is retained, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.
[0061 ] The present invention also provides a vector comprising one or more oligonucleotides as described herein. Examples of appropriate vectors include adenoviral, lentiviral, adeno- associated viral (AAV), poliovirus, herpes simplex vims (HSV), or murine Maloney-based viral vectors. In one embodiment, the vector is an adeno-associated vims vector. In some embodiments, these cassettes and vectors may be contained in a cell, such as a mammalian cell. In some embodiments, a non-human mammal cell may comprise the cassette or vector.
[0062] In some embodiments, the present invention also provides a cell comprising one or more oligonucleotides as described herein. In other embodiments, the cell comprises a vector as described herein. In some embodiments, the cell comprises a mammalian cell. In some embodiments, a cell as described herein comprises nucleic acid molecules, expression cassettes or vectors as described herein. In some embodiments, a non-human mammal cell comprises the nucleic acid molecules, expression cassettes or vectors as described herein.
[0063] In some embodiments, the present invention provides a nucleic acid, an expression cassette, a vector, or a composition as described herein for use in therapy, such as for treating cystic fibrosis.
Pharmaceutical Compositions
Formulations
[0064] According to some embodiments, there is provided a composition comprising an antisense oligonucleotide as described herein.
[0065] In some embodiments, the composition further comprises one or more non-toxic, pharmaceutically acceptable carriers and/or diluents and/or adjuvants (collectively referred to herein as “carrier” materials) and, if desired, other active ingredients.
[0066] The term “pharmaceutically acceptable carrier” in some embodiments refers to any of the standard pharmaceutical carriers known in the field such as sterile solutions, tablets, coated tablets, and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acids, or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Examples of pharmaceutically acceptable carriers include, but are not limited to, the following: water, saline, buffers, inert, nontoxic solids (e.g., mannitol, talc). Compositions comprising such carriers are formulated by well-known conventional methods. Depending on the intended mode of administration and the intended use, the compositions may be in the form of solid, semi-solid, or liquid dosage forms, such, for example, as powders, granules, crystals, liquids, suspensions, liposomes, nanoparticles, nano-emulsions, pastes, creams, salves, etc., and may be in unit-dosage forms suitable for administration of relatively precise dosages. [0067] In some embodiments, the pharmaceutical composition may be administered by any suitable route, preferably in the form of a pharmaceutical composition adapted to such a route, and in a dose effective for the treatment intended. The carrier mixture may be filled into a gelatin capsule or compressed as a tablet. The pharmaceutical composition may be administered as an oral dosage form or an infusion, for example.
[0068] In some embodiments, the pharmaceutical composition is formulated for oral administration. In some embodiments, the pharmaceutical composition is formulated for nasal administration. In some embodiments, the pharmaceutical composition is formulated for administration by inhalation. In some embodiments, the pharmaceutical composition is formulated for intrapulmonary administration. In some embodiments, the pharmaceutical composition is formulated for oral inhalation. In some embodiments, the pharmaceutical composition is formulated for intranasal administration.
[0069] In some embodiments, the pharmaceutical composition is formulated for abdominal administration. In some embodiments, the pharmaceutical composition is formulated for subcutaneous administration. In some embodiments, the pharmaceutical composition is formulated for intra-peritoneal administration. In some embodiments, the pharmaceutical composition is formulated for intravenous administration. In some embodiments, the pharmaceutical composition is formulated for intramuscular administration. In some embodiments, the pharmaceutical composition is formulated for mucosal administration. In some embodiments, parenteral administration comprises intravascular, intraperitoneal, subcutaneously, intramuscular, and intrastemal administration.
[0070] Any pharmaceutical composition contemplated herein can, for example, be delivered orally via any acceptable and suitable oral preparations. Exemplary oral preparations, include, but are not limited to, for example, tablets, troches, lozenges, aqueous and oily suspensions, dispersible powders or granules, emulsions, hard and soft capsules, liquid capsules, syrups, and elixirs.
[0071] Exemplary injectable forms include, but are not limited to, for example, sterile aqueous solutions comprising acceptable vehicles and solvents, such as, for example, water, Ringer's solution, and isotonic sodium chloride solution; sterile oil-in-water microemulsions; and aqueous or oleaginous suspensions.
[0072] In other embodiments, the pharmaceutical composition is formulated as a nanoparticle, lipid nanoparticle, microparticle or liposome. [0073] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject. In some embodiments, the subject is a human subject. It will be understood by a skilled artisan that a pharmaceutical composition to be administered to a subject should have no or, in other embodiments, minimal off-target effects, e.g., effects other than the intended therapeutic ones. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on a gene other than CFTR. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on splicing of an exon other than an exon of CFTR. In some embodiments, a substantial effect is one with a phenotypic result. In some embodiments, a substantial effect is an effect that is deleterious to the health and/or wellbeing of the subject.
[0074] In some embodiments, the composition is formulated for administration via inhalation. In some embodiments, the composition is a pharmaceutical composition.
[0075] In some embodiments, the pharmaceutical composition comprises an antisense oligonucleotide as described herein. In some embodiments, the composition comprises at least 1 nM, at least 2.5 nM, at least 10 nM, at least 100 nM, at least 0.5 pM, at least 1 pM, at least 10 pM, at least 20 pM, at least 50 pM, at least 75 pM, at least 80 pM, at least 100 pM of the antisense oligonucleotide or any value and range therebetween. In some embodiments, the composition comprises 2.5 nM to 10 nM, 1 nM to 100 nM, 1 nM to 0.5 pM, 1 nM to 1 pM, 1 nM to 10 pM, 1 nM to 20 pM, or 1 nM to 50 pM, of the antisense oligonucleotide. In other embodiments, the composition comprises 5 nM to 25 nM, 10 nM to 50 nM, 20 nM to 100 nM, 50 nM to 0.5 pM of the antisense oligonucleotide. Each possibility represents a separate embodiment of the invention.
[0076] In other embodiments, a composition comprising an antisense oligonucleotide as described herein is prepared and/or administered at a concentration of 2.5, 3.75, 5, 7.5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 125, 130, or 140 mg/ml. In some embodiments, a composition as described herein is prepared and/or administered at a concentration of about 2.5 mg/ml to about 140 mg/ml.
[0077] The pharmaceutically active compounds of this invention can be processed in accordance with conventional methods of pharmacy to produce medicinal agents for administration to subjects, including humans and other mammals. The pharmaceutical compositions may be subjected to conventional pharmaceutical operations such as sterilization and/or may contain conventional adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers, buffers etc. Tablets and pills can additionally be prepared with enteric coatings. Such pharmaceutical compositions may also comprise adjuvants, such as wetting, sweetening, flavoring, and perfuming agents.
[0078] The amounts of compounds that are administered and the dosage regimen for treating a disease or condition of this invention depends on a variety of factors, including the age, weight, gender, the medical condition of the subject, the type of disease, the severity of the disease, the route and frequency of administration, and the particular compound employed. Thus, the dosage regimen may vary widely, but can be determined routinely using standard methods.
[0079] For therapeutic purposes, the active compounds of this invention are ordinarily combined with one or more adjuvants appropriate to the indicated route of administration. If administered orally, the compounds may be admixed with lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia gum, sodium alginate, polyvinylpyrrolidone, and/or polyvinyl alcohol, and then tableted or encapsulated for convenient administration. Such capsules or tablets may contain a controlled- release formulation as may be provided in a dispersion of active compound in hydroxypropylmethyl cellulose.
Combination Treatments/Therapies
[0080] In some embodiments, compositions as described herein comprise an oligonucleotide as described herein and one or more active pharmaceutical ingredients for the treatment of cystic fibrosis. In some embodiments, the additional active pharmaceutical ingredient comprises a CFTR modifier.
[0081] In some embodiments, the CFTR modifier increases the duration of the opening of the CFTR gate, chloride flow through the CFTR gate, proper CFTR protein folding, the number of CFTR anchored to the cell membrane, or any combination thereof. Each possibility represents a separate embodiment of the invention.
[0082] In some embodiments, the modifier comprises a potentiator, a corrector, an amplifier, or a combination thereof.
[0083] In some embodiments, the term "potentiator" refers to any agent that increases the probability that a defective CFTR will be open and therefore allows chloride ions to pass through the channel pore. [0084] In some embodiments, the CFTR potentiator comprises: N-(2,4-Di-tert-butyl-5- hydroxyphenyl)-4-oxo-l,4-dihydroquinoline-3-carboxamide (VX-770; Ivacaftor), QBW251, PTI- 808, or VX-561 (deuterated ivacaftor); GLPG1837; or a combination thereof.
[0085] In some embodiments, the term "corrector" refers to any agent that assists in proper CFTR channel folding so as to enable its trafficking to the cell membrane.
[0086] In some embodiments, the CFTR corrector comprises: 3-{6-{[l-(2,2-difluoro-l,3- benzodioxol-5- yl)cyclopropanecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (VX-809; Lumacaftor), l-(2,2- difluoro-l,3-benzodioxol-5-yl)-~{N]-[l-[(2~{R})-2,3-dihydroxypropyl]-6- fluoro-2-( 1 - hydroxy -2 -methylpropan-2-yl)indol-5 -yl]cyclopropane- 1 -carboxamide ( VX-661 ; Tezacaftor), VX-659, VX-445 (Elexacaftor), VX-152 and VX-440, GLPG2222 (corrector 1 [Cl]), GLPG3221 (corrector 2 [C2]), FDL169, PTI-801, VX-809, VX-661, or a combination thereof.
[0087] In some embodiments, the term "amplifier" refers to any agent that induces a cell to increase its CFTR protein production rate or yield, leading to an increased amount of the CFTR protein.
[0088] In some embodiments, the CFTR amplifier comprises PTI-428.
[0089] In some embodiments, the additional active pharmaceutical ingredient comprises a drug or agent for the treatment of Cystic Fibrosis.
[0090] In other embodiments, the drug or agent for the treatment of Cystic Fibrosis comprises a CFTR splicing modulator, a translational read-through agent, a sodium epithelial channel (ENaC) inhibitor, or a combination thereof. In some embodiments, the CFTR splicing modulator can induce or promote exon exclusion from the mature CFTR mRNA. In some embodiments, the CFTR splicing modulator comprises an antisense oligonucleotide as disclosed and as described herein. In some embodiments, the translational read-through agent comprises 3-[5-(2- fluorophenyl)-l,2,4-oxadiazol-3-yl]benzoic acid (Ataluren), ELX-02, or a combination thereof. In some embodiments, the ENaC inhibitor comprises VX-371 (P-1037) IONIS-ENAC-2.5Rx, or a combination thereof.
[0091] Accordingly, the combination therapies of the present invention may be administered together with other therapies useful in the treatment of cystic fibrosis or related diseases. The invention herein further comprises use of a first composition and a second composition as described herein in preparing medicaments for the treatment of cystic fibrosis or related diseases. [0092] In other embodiments, the antisense oligonucleotides of the present invention can be formulated or co-administered with other therapeutic agents that are selected for their particular usefulness in addressing side effects associated with the conditions associated with cystic fibrosis. For example, compounds of the invention may be formulated with agents to treat or suppress infections, such as antibiotics. In other embodiments, other therapeutic agents comprise aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, or a combination thereof. In other embodiments, one or more therapeutic agents comprises a mucolytic agent, a bronchodialator, an antibiotic, an anti-infective agent, an anti-inflammatory agent, a corticosteroid, or a combination thereof.
[0093] The above other therapeutic agents, when employed in combination with the compounds of the present invention, may be used, for example, in those amounts indicated in the Physicians' Desk Reference (PDR) or as otherwise determined by one of ordinary skill in the art.
Methods of Use
[0094] In some embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for treating a major pulmonary fibrosis disease in a subject, comprising the step of administering to said subject a composition as described herein.
[0095] In some embodiments, the major pulmonary fibrosis disease comprises cystic fibrosis.
In other embodiments, the major pulmonary fibrosis disease comprises idiopathic pulmonary fibrosis. In some embodiments, idiopathic pulmonary fibrosis is characterized by a chronic progressive decline in lung function, scarring of lung tissue, dyspnea (shortness of breath), or a combination thereof.
[0096] In some embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for treating cystic fibrosis in a subject, comprising the step of administering to said subject a composition as described herein.
[0097] In some embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for suppressing cystic fibrosis in a subject, comprising the step of administering to said subject a composition as described herein.
[0098] In some embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject an oligonucleotide as described herein. In other embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a vector as described herein. In other embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a cell as described herein. In other embodiments, the present invention provides a method for inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject a composition as described herein.
[0099] In other embodiments, the present invention provides a method of modulating splicing or expression of a CFTR transcript in a cell comprising contacting the cell with an antisense oligonucleotide, a vector, a cell, or a composition as described herein.
[00100] In some embodiments, "modulation" as used herein means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre- mRNA processing, resulting in a change in the absolute or relative amount of a particular splicevariant compared to the amount in the absence of modulation.
[00101] In some embodiments, the methods as described herein comprise the step of administering a splicing modulator, which, in some embodiments, is an antisense oligonucleotide, which, in some embodiments, is a synthetic antisense oligonucleotide. In other embodiments, the methods as described herein comprise the step of contacting a cell with a splicing modulator, which, in some embodiments, is an antisense oligonucleotide, which, in some embodiments, is a synthetic antisense oligonucleotide.
[00102] In some embodiments, contacting comprises contacting in vivo, in vitro, or ex vivo.
[00103] In some embodiments, the cell is derived from the subject as described herein. In some embodiments, the cell comprises a cell line or a culture thereof. In some embodiments, the cell is an epithelial cell. In some embodiments, an epithelial cell comprises a respiratory epithelial cell. In some embodiments, a respiratory epithelial cell is derived from the upper respiratory system. In some embodiments, a respiratory epithelial cell is a ciliated columnar epithelial cell. In some embodiments, a respiratory epithelial cell is a ciliated pseudo stratified columnar epithelial cell. In some embodiments, a respiratory epithelial cell is selected from: a ciliated cell, a goblet cell, a club cell, an airway basal cell, or any combination thereof.
[00104] In some embodiments, the subject has at least one CF-inducing mutation in the CFTR gene, or in the mRNA transcribed therefrom. In some embodiments, the subject is homozygous for one or more CF-inducing mutations. In some embodiments, the subject is heterozygous for one or more CF-inducing mutations.
[00105] In some embodiments, the CFTR protein in the cells of the subject comprise a mixture of wild type, full-length, and fully functional CFTR protein encoded by the wild type allele and a mutated and deleterious CFTR protein encoded by the mutated allele.
[00106] In some embodiments, "a mutation" as described herein refers to one or more nucleotide substitutions or modifications which render a partially or fully non-functional protein. In other embodiments, "a mutation" as described herein refers to one or more nucleotide substitutions or modifications which causes a "Cystic Fibrosis phenotype" in a subject harboring the mutation. [00107] In some embodiments, a modification comprises an insertion, deletion, inversion, or a combination thereof. In some embodiment, the modification results in a cystic fibrosis phenotype in a subject harboring or comprising the modification.
[00108] In some embodiments, the term "cystic fibrosis phenotype" encompasses any symptom or manifestation related to cystic fibrosis. Methods for diagnosing cystic fibrosis and/or symptoms associated therewith are known in the art.
[00109] In some embodiments, the subject is afflicted with, suffers from, or has cystic fibrosis. In other embodiments, the subject has symptoms of cystic fibrosis.
[00110] In some embodiments, the method as described herein comprises a method of improving at least one clinical parameter of cystic fibrosis in the subject. In some embodiments, the clinical parameter comprises lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, change in the nasal potential difference (NPD), number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, the need for antibiotic therapy for sinopulmonary signs or symptoms, or a combination thereof.
[00111] In some embodiments, the terms “treatment” or “treating” of a disease, disorder, or condition encompasses alleviation of at least one symptom of the disease, disorder, or condition. In other embodiments, treatment comprises a reduction in the severity of the disease, disorder, or condition. In other embodiments, treatment comprises inhibition of the progression of the disease, disorder, or condition. In some embodiments, treatment need not mean that the disease, disorder, or condition is completely cured. In some embodiments, to be an effective treatment, a composition as described herein need only reduce the severity of a disease, disorder, or condition, reduce the severity of symptoms associated therewith, or provide improvement to a patient or subject’ s quality of life.
[00112] In some embodiments, the term "condition" includes anatomic and physiological deviations from the normal anatomic and physiological states which constitute an impairment of the normal state of the living subject or one of its parts and/or that interrupts or modifies the performance of the bodily functions of the subject.
[00113] In some embodiments, the terms “subject” or “individual” or “animal” or “patient” or “mammal,” refers to any subject, particularly a mammalian subject, for whom therapy is desired, for example, a human. In other embodiments, the subject is a primate, which in some embodiments, is a non-human primate. In other embodiments, the subject is murine, which in some embodiments is a mouse, and, in other embodiments is a rat. In other embodiments, the subject is canine, feline, bovine, equine, caprine, ovine, porcine, simian, ursine, vulpine, or lupine. In some embodiments, the subject is a chicken or fish.
[00114] In some embodiments, the subject is male. In other embodiments, the subject is female.
[00115] In some embodiments, the subject is a child. In other embodiments, the subject is an infant. In other embodiments, the subject is an adolescent. In other embodiments, the subject is an adult. In some embodiments, the adult subject is age 50 or over.
[00116] In some embodiments, the present invention provides a method for reducing the level of non-functional CFTR mRNA. In some embodiments, the present invention provides a method for increasing the level of functional CFTR mRNA. In some embodiments, the present invention provides a method for correcting or improving chloride transport through the CFTR channel. In some embodiments, the present invention provides a method for increasing the production of functional CFTR protein. In some embodiments, the present invention provides a method for increasing the duration of the CFTR gate being open. In some embodiments, the present invention provides a method for increasing the chloride flow through the CFTR gate. In some embodiments, the present invention provides a method for increasing the proper folding of the CFTR protein. In some embodiments, the present invention provides a method for increasing the number of CFTR anchored to the cell membrane.
[00117] In some embodiments, the present invention provides the use of an antisense oligonucleotide as described herein, or a pharmaceutical composition comprising the antisense oligonucleotide, for treating, suppressing or inhibiting cystic fibrosis in a subject. In some embodiments, an antisense oligonucleotide as described herein, or a pharmaceutical composition comprising the antisense oligonucleotide, is used for improving at least one clinical parameter of cystic fibrosis.
[00118] In some embodiments, alleviation of symptoms as described herein comprises a measured improvement of 15% -95%. In other embodiments, the measured improvement comprises a 15% improvement; a 20% improvement; a 25% improvement; a 30% improvement; a 35% improvement; improvement; a 40% improvement; a 45% improvement; a 50% improvement; a 55% improvement; a 60% improvement; a 65% improvement; a 70% improvement; a 75% improvement; a 80% improvement; a 85% improvement; a 90% improvement; or a 95% improvement.
[00119] In other embodiments, the present invention provides a method of prolonging survival in a subject having cystic fibrosis, comprising the steps of administering to the subject one or more antisense oligonucleotides as described herein. In other embodiments, the present invention provides a method of delaying progression of cystic fibrosis in a subject having cystic fibrosis, comprising the steps of administering to the subject one or more antisense oligonucleotides as described herein. In other embodiments, the present invention provides a method of avoiding resistance to therapy in a subject having cystic fibrosis, comprising the steps of administering to the subject one or more antisense oligonucleotides as described herein.
[00120] In other embodiments, the present invention provides a method of treating, suppressing or inhibiting cystic fibrosis in a subject comprising the step of administering to the subject a composition comprising one or more antisense oligonucleotides as described herein. In other embodiments, the present invention provides a method of treating, suppressing or inhibiting cystic fibrosis in a subject comprising the step of administering to the subject a composition consisting essentially of one or more antisense oligonucleotides as described herein. In other embodiments, the present invention provides a method of treating, suppressing or inhibiting cystic fibrosis in a subject comprising the step of administering to the subject a composition consisting of one or more antisense oligonucleotides as described herein.
[00121] In some embodiments, the present invention provides the use of a therapeutically acceptable amount of the compositions as described herein for treating, suppressing or inhibiting cystic fibrosis in a subject. In other embodiments, the present invention provides the use of a therapeutically effective amount of the compositions as described herein for treating, suppressing or inhibiting cystic fibrosis in a subject. In other embodiments, the present invention provides the use of a synergistically effective amount of a combination therapy as described herein for treating, suppressing or inhibiting a cystic fibrosis in a subject.
[00122] In some embodiments, the methods of the present invention further comprise the step of identifying a candidate subject for treatment with the compositions as described herein comprising the step of evaluating CFTR gene function or activity in the subject. In some embodiments, evaluating CFTR gene function comprises determining if there are CFTR mutations and if so, where the CFTR mutations are located. [00123] In some embodiments, evaluating CFTR gene function comprises RNA-seq or another RNA sequencing tool to reveal the presence and quantity of RNA in a biological sample at a given moment. In other embodiments, other methods of evaluating the quantity of CFTR RNA may be utilized, as are well known in the art. In other embodiments, the present invention provides a method of treating cystic fibrosis comprising the step of evaluating the genetic material in a biological sample from the subject using, in some embodiments, a DNA sequencing method, as are known in the art. In some embodiments, the biological sample comprises tissue. In some embodiments, the biological sample comprises blood cells. In other embodiments, the biological sample comprises skin cells. In other embodiments, the biological sample comprises epithelial cells, which, in some embodiments, are sampled from the inside of the subject’ s mouth.
[00124] In some embodiments, the methods of the present invention are for treating, inhibiting, or suppressing cystic fibrosis in a subject. In some embodiments, the subject has atypical cystic fibrosis. In other embodiments, the subject has a CFTR mutation. In some embodiments, the CFTR mutation is a Class I CFTR mutation. In other embodiments, the CFTR mutation is a Class II CFTR mutation. In other embodiments, the CFTR mutation is a Class III CFTR mutation. In other embodiments, the CFTR mutation is a Class IV CFTR mutation. In other embodiments, the CFTR mutation is a Class V CFTR mutation. In other embodiments, the CFTR mutation is a Class VI CFTR mutation.
[00125] In some embodiments, the subject has one or more of the following CFTR phenotypes: protein synthesis defect; maturation defect; gating defect; conductance defect; reduced quantity; reduced stability; or a combination thereof.
Timing and Site of Administration
[00126] In some embodiments, one or more of the antisense oligonucleotides as described herein is administered once per week. In other embodiments, one or more of the antisense oligonucleotides as described herein is administered once every two weeks. In some embodiments, a composition as described herein is administered to a subject once per day. In other embodiments, the composition is administered twice per day. In other embodiments, one or more of the compositions as described herein are administered in one to four doses per day. In other embodiments, one or more of the compositions as described herein are administered three times per day. In other embodiments, one or more of the compositions as described herein are administered four times per day. In other embodiments, one or more of the compositions as described herein are administered once every two days, once every three days, twice a week, once a week, once every 2 weeks, once every 3 weeks.
[00127] In other embodiments, in the methods of the present invention, a composition as described herein is administered intermittently. In some embodiments, the intermittent administration comprises two days on/five days off. In other embodiments, the intermittent administration comprises three days on/four days.
[00128] In some embodiments, one or more of the compositions as described herein are chronically administered to a subject. In one embodiment, the composition is administered to the subject weekly. In another embodiment, the composition is administered to the subject every 2 weeks.
[00129] In other embodiments, one or more of the compositions as described herein are administered for a specified period of time to a subject. In some embodiments, one or more of the compositions as described herein are administered for 7 days to 28 days. In other embodiments, one or more of the compositions as described herein are administered for 7 days to 8 weeks. In other embodiments, one or more of the compositions as described herein are administered for 7 days to 50 days. In other embodiments, one or more of the compositions as described herein are administered for 7 days to six months. In other embodiments, one or more of the compositions as described herein are administered for 7 days to one and half years. In other embodiments, one or more of the compositions as described herein are administered for 14 days to 12 months. In other embodiments, one or more of the compositions as described herein are administered for 14 days to 3 years. In other embodiments, one or more of the first and second compositions as described herein are administered for several years. In other embodiments, one or more of the compositions as described herein are administered for one month to six months.
[00130] In some embodiments, one or more of the compositions as described herein are administered for 7 days. In other embodiments, one or more of the compositions as described herein are administered for 14 days. In other embodiments, one or more of the compositions as described herein are administered for 21 days. In other embodiments, one or more of the compositions as described herein are administered for 28 days. In other embodiments, one or more of the compositions as described herein are administered for 50 days. In other embodiments, one or more of the compositions as described herein are administered for 56 days. In other embodiments, one or more of the compositions as described herein are administered for 84 days. In other embodiments, one or more of the compositions as described herein are administered for 90 days. In other embodiments, one or more of the compositions as described herein are administered for 120 days.
[00131] The number of times a composition is administered to a subject in need thereof depends on the discretion of a medical professional, the disorder, the severity of the disorder, and the subject's response to the formulation. In some embodiments, the compositions disclosed herein are administered once to a subject in need thereof with a mild acute condition. In some embodiments, the compositions disclosed herein are administered more than once to a subject in need thereof with a moderate or severe acute condition. In the case wherein the subject's condition does not improve, upon the doctor's discretion the composition may be administered chronically, that is, for an extended period of time, including throughout the duration of the subject's life in order to ameliorate or otherwise control or limit the symptoms of the subject's disease or condition.
[00132] In the case wherein the subject's status does improve, upon the doctor's discretion, the composition may be administered continuously; or the dose of drug being administered may be temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). In some embodiments, the length of the drug holiday varies between 2 days and 1 year. The dose reduction during a drug holiday may be from 10%- 100%, including by way of example only 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.
[00133] In some embodiments in which two compositions are administered to the subject, the first composition and the second composition are administered together in the methods of the present invention. In some embodiments, in the methods of the present invention, the first composition and the second composition are administered at separate sites or at separate times. In some embodiments, in the methods of the present invention, the first composition and the second composition are administered at separate sites. In some embodiments, in the methods of the present invention, the first composition and the second composition are administered at separate times.
[00134] In some embodiments, the administration of a second composition comprising the additional cystic fibrosis therapeutic occurs prior to the administration of the first composition comprising antisense oligonucleotides as described herein. In other embodiments, the administration of a second composition comprising the additional cystic fibrosis therapeutic occurs concurrent with the administration of the first composition comprising antisense oligonucleotides. In other embodiments, the administration of a second composition occurs following the administration of the first composition. In some embodiments, concurrent administration comprises administering a single composition comprising the second composition and the first composition. In other embodiments, concurrent administration comprises administering separate compositions at approximately the same time.
[00135] In some embodiments, the administration of the second composition occurs at the same site as the administration of the first composition.
[00136] In some embodiments, the first composition is administered several days before and after the administration of the second composition. In some embodiments, the first composition is administered 1, 2, 3, 4, or 5 days prior to the administration of the second composition. In some embodiments, the first composition is administered 1, 2, 3, 4, or 5 days subsequent to the administration of the second composition.
Kits
[00137] In some embodiments, the present invention provides a kit comprising a therapeutic or prophylactic composition containing an effective amount of one or more antisense oligonucleotides, as described herein, and optionally a second composition comprising one or more cystic fibrosis drugs. In certain embodiments, the kit comprises a sterile container which contains therapeutic or prophylactic agents; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
[00138] If desired, the composition(s) are provided together with instructions for administering the composition(s) to a subject having or at risk of developing a major pulmonary fibrosis disease. The instructions will generally include information about the use of the composition for the treatment or prevention of a major pulmonary fibrosis disease. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of a major pulmonary fibrosis disease or symptoms thereof; precautions; warnings; indications; counter-indications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium. In other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g., via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
[00139] In other embodiments, the present invention further provides a kit for identifying a candidate subject for treatment with a composition comprising one or more antisense oligonucleotides, as described herein, and, optionally, a second composition comprising one or more cystic fibrosis drugs, and further comprising an evaluator of CFTR gene function. In some embodiments, the evaluator comprises a DNA sequencing method, as is known in the art. In other embodiments, the evaluator comprises RNA-seq or another RNA sequencing tool to reveal the presence and quantity of RNA in a biological sample. In other embodiments, other methods of evaluating the quantity of downstream CFTR DNA, protein, or RNA may be utilized, as are well known in the art. In some embodiments, instructions for use are included in the kit.
[00140] In some embodiments, the present invention provides combined preparations. In some embodiments, “a combined preparation” defines especially a “kit of parts” in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners i.e., simultaneously, concurrently, separately, or sequentially. In some embodiments, the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts. The ratio of the total amounts of the combination partners, in some embodiments, can be administered in the combined preparation.
[00141] In some embodiments, the kit of the invention comprises: at least one antisense oligonucleotide; and one or more CFTR modifiers; one or more cystic fibrosis drugs, or a combination thereof. In some embodiments, the antisense oligonucleotide is selected from SEQ ID NOs: 1-44. In some embodiments, the CFTR modifier is selected from: a CFTR potentiator, a CFTR corrector, a CFTR amplifier or a combination thereof.
[00142] In some embodiments, the cystic fibrosis drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof. [00143] Types and doses of cystic fibrosis drugs, such as an antibiotic, a bronchodilator, and a corticosteroid, would be apparent to one of ordinary skill in the art. Non-limiting examples of cystic fibrosis drugs, such as antibiotics include, but are not limited to, cioxacillin, dicloxacillin, cephalosporin, trimethoprim, sulfamethoxazole, erythromycin, amoxicillin, clavulanate, ampicillin, tetracycline, linezolid, tobramycin or aztreonam lysine, fluoroquinolone, gentamicin, and monobactam with antip seudomonal activity.
[00144] In some embodiments, the components of the kit disclosed above are sterile. In some embodiments, the term "sterile" refers to a state of being free from biological contaminants. Any method of sterilization is applicable and would be apparent to one of ordinary skill in the art.
[00145] In some embodiments, the components of the kit are packaged within a container.
[00146] In some embodiments, the container is made of a material selected from the group consisting of thin-walled film or plastic (transparent or opaque), paperboard-based, foil, rigid plastic, metal (e.g., aluminum), glass, etc.
[00147] In some embodiments, the content of the kit is packaged, as described below, to allow for storage of the components until they are needed.
[00148] In some embodiments, some or all components of the kit may be packaged in suitable packaging to maintain sterility.
[00149] In some embodiments, the components of the kit are stored in separate containers within the main kit containment element e.g., box or analogous structure, may or may not be an airtight container, e.g., to further preserve the sterility of some or all of the components of the kit.
[00150] In some embodiments, the instructions may be recorded on a suitable recording medium or substrate. For example, the instructions may be printed on a substrate, such as paper or plastic, etc.
[00151] In some embodiments, the present invention further comprises combinations of the compositions of the present invention and, optionally, one or more additional agents in kit form, e.g., where they are packaged together or placed in separate packages to be sold together as a kit, or where they are packaged to be formulated together. Definitions
[00152] The definitions set forth herein take precedence over definitions set forth in any patent, patent application, and/or patent application publication incorporated herein by reference.
[00153] Listed below are definitions of various terms used to describe the present invention. These definitions apply to the terms as they are used throughout the specification (unless they are otherwise limited in specific instances) either individually or as part of a larger group.
[00154] In some embodiments, the terms “a” and “an” refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.
[00155] In some embodiments, the term "administering" refers to bringing in contact with a compound of the present invention. In some embodiments, the compositions are applied locally. In other embodiments, the compositions are applied systemically. Administration can be accomplished to cells or tissue cultures, or to living organisms, for example humans.
[00156] In some embodiments, the terms "administering," "administer," or "administration" refer to deliver one or more compounds or compositions to a subject parenterally, enterally, or topically. Illustrative examples of parenteral administration include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion. Illustrative examples of enteral administration include, but are not limited to oral, inhalation, intranasal, sublingual, and rectal administration. Illustrative examples of topical administration include, but are not limited to, transdermal and vaginal administration. In particular embodiments, an agent or composition is administered parenterally, optionally by intravenous administration or oral administration to a subject.
[00157] In some embodiments, a composition of the present invention comprises a pharmaceutically acceptable composition. In some embodiments, the phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, combinations, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[00158] In some embodiments, a composition or combination of the present invention is administered in a therapeutically effective amount. In some embodiments, a “therapeutically effective amount” is intended to include an amount of a compound of the present invention alone or an amount of the combination of compounds claimed or an amount of a compound of the present invention in combination with other active ingredients effective to increase WT CFTR, decrease mutated CFTR, or treat or prevent cystic fibrosis. In some embodiments, a "therapeutically effective amount" of a composition of the invention is that amount of composition which is sufficient to provide a beneficial effect to the subject to which the composition is administered.
[00159] In some embodiments, “treating” or “treatment” cover the treatment of a disease-state in a mammal, particularly in a human, and include: (a) preventing the disease-state from occurring in a mammal, in particular, when such mammal is predisposed to the disease-state but has not yet been diagnosed as having it; (b) inhibiting the disease-state, i.e., arresting its development; and/or (c) relieving the disease-state, i.e., causing regression of the disease state.
[00160] In some embodiments, the goal of treating is to prevent or lessen the targeted pathologic condition or disorder as described hereinabove.
[00161] Thus, in some embodiments, “treating” refers inter alia to delaying progression, expediting remission, inducing remission, augmenting remission, speeding recovery, increasing efficacy of or decreasing resistance to alternative therapeutics, or a combination thereof. In some embodiments, “preventing” refers, inter alia, to delaying the onset of symptoms, preventing relapse to a disease, decreasing the number or frequency of relapse episodes, increasing latency between symptomatic episodes, or a combination thereof. In some embodiments, “suppressing” or “inhibiting”, refers inter alia to reducing the severity of symptoms, reducing the severity of an acute episode, reducing the number of symptoms, reducing the incidence of disease-related symptoms, reducing the latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging subject survival, or a combination thereof.
[00162] In some embodiments, "antisense compound" or "antisense oligonucleotide" as used herein means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity. [00163] In some embodiments, "oligonucleotide" as used herein refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
[00164] In some embodiments, "nucleoside" as used herein means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
[00165] In some embodiments, "oligonucleoside" as used herein refers to an oligonucleotide in which none of the intemucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.
[00166] In some embodiments, a “vector” includes, inter alia, any viral vector, as well as any plasmid, cosmid, phage or binary vector in double or single stranded linear or circular form that may or may not be self transmissible or mobilizable, and that can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g., autonomous replicating plasmid with an origin of replication).
[00167] In some embodiments, an “expression cassette” as used herein describes a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, which may include a promoter operably linked to the nucleotide sequence of interest that may be operably linked to termination signals. The coding region usually codes for a functional RNA of interest, for example an siRNA. The expression cassette including the nucleotide sequence of interest may be chimeric. The expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of a regulatable promoter that initiates transcription only when the host cell is exposed to a particular stimulus. In the case of a multicellular organism, the promoter can also be specific to a particular tissue or organ or stage of development.
[00168] Such expression cassettes can include a transcriptional initiation region linked to a nucleotide sequence of interest. Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes. [00169] In some embodiments, the compositions as described herein comprise one or more antisense oligonucleotides as described herein. In other embodiments, the compositions as described herein consist of one or more antisense oligonucleotides as described herein. In other embodiments, the compositions as described herein consist essentially of one or more antisense oligonucleotides as described herein.
[00170] It is to be understood that the compositions, combinations and methods of the present invention comprising the elements or steps as described herein may, in other embodiments, consist of those elements or steps, or in other embodiments, consist essentially of those elements or steps.
[00171] In the description and claims of the present application, each of the verbs, “comprise”, “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb. In some embodiments, the term “comprise” refers to the inclusion of the indicated active agents, such as the antisense oligonucleotide, as well as inclusion of other active agents, and pharmaceutically or physiologically acceptable carriers, excipients, emollients, stabilizers, etc., as are known in the pharmaceutical industry.
[00172] As used herein, the term “consists essentially of’, or variations such as “consist essentially of’ or “consisting essentially of’, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure, or composition. According to this embodiment, the term “consisting essentially of’ refers to a composition, whose only active ingredients are the indicated active ingredients. However, other compounds may be included which are for stabilizing, preserving, etc. the formulation, but are not involved directly in the therapeutic effect of the indicated active ingredients. In some embodiments, the term “consisting essentially of’ may refer to components which facilitate the release of the active ingredient.
[00173] In some embodiments, the term “consisting of’ refers to a composition, which contains the active ingredients and a pharmaceutically acceptable carrier or excipient.
[00174] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.
[00175] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about”. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[00176] Other terms as used herein are meant to be defined by their well-known meanings in the art.
[00177] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments unless the embodiment is inoperative without those elements.
[00178] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.
[00179] It should be understood that the disclosure presented herein is not limited to the particular methodologies, protocols and reagents, and examples described herein. The terminology and examples used herein is for the purpose of describing particular embodiments only, for the intent and purpose of providing guidance to the skilled artisan and is not intended to limit the scope of the disclosure presented herein. EXAMPLES
[00180] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); "Monoclonal Antibodies: Methods and Protocols". Vincent Ossipow, Nicolas Fischer. Humana Press (2014); "Monoclonal Antibodies: Methods and Protocols". Maher Albitar. Springer Science & Business Media (2007), all of which are incorporated by reference. Other general references are provided throughout this document.
Materials and Methods
Oligonucleotide Synthesis
[00181] 2M0E modified oligonucleotides on a phosphorothioate backbone were synthesized using methods well known in the art. The oligonucleotides as described in Table 1 were synthesized and used in subsequent experiments. Table 1. Antisense oligonucleotides
Figure imgf000038_0001
GripTite™ 293 MSR Cell Line System Studies
[00182] In order to analyze the ability of the antisense oligonucleotides to induce or prevent exon skipping, the inventors used the GripTite™ 293 MSR Cell Line, which is a genetically engineered Human Embryonic Kidney (HEK 293) cell line that expresses the human macrophage scavenger receptor and strongly adheres to standard tissue culture plates. CFTR EMG il4-il8 plasmid (Sharma et al, PLoS Genet. 2018;14(11):el007723. Published 2018 Nov 16) carrying a mutated CFTR gene is transiently or stably transfected to the GripTite™ 293 cells.
Transfection
[00183] GripTite™ 293 cells expressing the mutated CFTR EMG il4-il 8 plasmid cells were plated onto 6 well plates with 50,000 cells per well with 10% FCS DMEM and left overnight prior to transfection. Each antisense oligonucleotide as described herein was transfected into the cells using Lipofecatmine 2000 transfection reagent (Invitrogen) according to the lipofectamine 2000 reagent protocol.
[00184] In each experiment, the effect of treatment with SEQ ID NOs: 1-44 on the GripTite™ 293 cells was analyzed in comparison to treatment with a control antisense oligonucleotide.
RNA Extraction
[00185] Twenty -four (24) hr following transfection, total RNA was extracted using RNeasy Mini Kit (QIAGEN), followed by DNase treatment. RNA concentration was determined using a nanodrop. Complementary DNA (cDNA) synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The cDNA was analyzed by PCR and qPCR.
Quantitative Detection of Correctly and Aberrantly Spliced CFTR Transcripts (qPCR)
[00186] Real-time PCR was performed in QuantStudio 3 Real-Time PCR System using TaqMan® Fast Advanced Master Mix (Applied Biosystems) with TaqMan probes specific for transcripts with or without the exon of interest. The expression level was normalized to the transcript levels of GUSb. Technical duplicates were analyzed for each sample. Analysis was performed using the double delta Ct analysis.
PCR
[00187] PCR was performed using the Platinum™ SuperFi™ Green PCR Master Mix 12359- 10 (Invitrogen). PCR products were then separated on an agarose gel for detection of the correctly and aberrantly spliced transcripts. The gels were exposed to UV light for visualization, and the PCR products were recorded.
Western blot analysis
[00188] For protein analysis, protein extracts were prepared from organoid-derived monolayer cells from a patient carrying the 2789 +5 G-to-A mutation and a healthy volunteer (HV) and analyzed by immunoblotting with anti-CFTR (596) and anti-calnexin antibodies. The gel was transferred to a nitrocellulose membrane, and antibody hybridization and chemiluminescence were performed according to standard procedures.
Functional analysis
[00189] Intestinal organoids derived from a cystic fibrosis subject carrying the 2789 +5 G-to- A CFTR mutation and from a Healthy Volunteer (HV) were grown in monolayer on transwell filters. CFTR activity was analyzed using the Ussing chamber according to standard procedures.
EXAMPLE 1
CFTR transcript levels in 293-GT cells following transfection with 2789 +5 G-to-A mutation plasmid and antisense oligonucleotides (ASOs)
[00190] ASO candidates were screened by transfecting lOOnM ASO into 293-GT cells carrying the EMG il4-il8 2789 +5 G-to-A mut plasmid. Following transfection, RNA was extracted, treated with DNase, and cleaned on RNeasy mini spin column. The effect on splicing modulation was analyzed by RT-PCR (Figure 2A) and RT-qPCR (Figure 2B). The ASOs were tested relative to a negative control ASO (stuffer). The screen led to the identification of 6 new ASOs, SPL16-(28-33), that efficiently reduced the levels of transcripts without Exon 16 to less than 30% of control ASO as measured by RT-qPCR.
EXAMPLE 2
Establishment of Organoids as Screening System for Ranking ASOs According to Their Effect on CFTR Function.
[00191] Organoids originating from patient derived biopsies: Healthy volunteer (HV) and 2789+5 G-to-A (c.2657+5G>A) organoid-derived monolayer seeded on transwell filters (25*104 cells/0.33cm2 transwell filter). The second allele, Q359K T360K, carries two missense mutations and therefore is not expected to produce mature CFTR protein. The filters were grown in parallel for Ussing chamber assay, RNA extraction, and protein extraction. RNA extracts were analyzed by RT-qPCR and PCR, and proteins were detected by western blot.
[00192] The sensitivity of the CFTR splicing pattern, protein, and activity between organoid- derived monolayer cells from a healthy volunteer (HV) and an organoid from a CF patient carrying the 2789 +5 G-to-A (2789) mutation was assessed (Figure 3). HV organoids have a normal splicing pattern (data not shown), while 2789 organoids have low transcript levels that include Exon 16 and high transcripts levels without Exon 16 (Figure 3A, data not shown). Cells derived from HV organoids show high levels of mature glycosylated CFTR protein, while cells derived from 2789 organoids show low levels of mature CFTR protein (Figure 3B). Finally, CFTR activity of 2789 is only 4% of WT CFTR activity (Figure 3C).
[00193] The data demonstrate that as expected, there was a significant decrease in CFTR protein levels and activity as well as a decrease in Exon 16-containing mRNA in and 2789 organoid-derived monolayer cells compared to HV organoid-derived monolayer cells.
[00194] The findings demonstrate that organoid-derived monolayer is a suitable cellular system for ASO ranking in patients carrying the 2789 mutation and that ASO penetration by free uptake protocol is efficient (data not shown).
[00195] Altogether, the results highlight the potential therapeutic of AS O-based exon 16 inclusion for CF patients carrying the 2789 mutation.

Claims

CLAIMS What is claimed is:
1. A synthetic antisense oligonucleotide, wherein said oligonucleotide is any one of SEQ ID NOs: 1-44 or a combination thereof.
2. The oligonucleotide of claim 1, wherein said oligonucleotide is any one of SEQ ID NOs: 25-31 or a combination thereof.
3. The oligonucleotide of claim 2, wherein said oligonucleotide is SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, or a combination thereof.
4. The oligonucleotide of any one of claims 1 to 3, wherein said polynucleotide comprises a chemically modified backbone.
5. The oligonucleotide of claim 4, wherein said chemically modified backbone comprises: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate- deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2- methoxyethyl phosphorothioate backbone, a constrained ethyl backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-p-d- arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, ligand- conjugated antisense, or a combination thereof.
6. The oligonucleotide of claim 4, wherein said chemically modified backbone comprises: 2'-O-methoxyethylribose (MOE).
7. A vector comprising one or more of the oligonucleotides of any one of claims 1-6.
8. A cell comprising one or more of the oligonucleotides of any one of claims 1-6 or the vector of claim 7.
9. A pharmaceutical composition comprising one or more of the oligonucleotides of any one of claims 1-6.
10. The composition of claim 9, wherein said composition is formulated for intrapulmonary administration.
11. The composition of claim 9, wherein said composition is formulated for oral inhalation or intranasal administration.
12. A method for treating cystic fibrosis in a subject, comprising the step of administering to said subject the oligonucleotide of any one of claims 1-6, the vector of claim 7, the cell of claim 8, or the composition of any one of claims 9-11.
13. A method for suppressing or inhibiting cystic fibrosis in a subject, comprising the step of administering to said subject the oligonucleotide of any one of claims 1-6, the vector of claim 7, the cell of claim 8, or the composition of any one of claims 9-11.
14. The method of any one of claims 12 to 13, wherein said subject has one or more mutations in the CFTR.
15. The method of claim 14, wherein said subject is heterozygous for said one or more mutations.
16. The method of any one of claims 12 to 15, further comprising the step of administering one or more additional cystic fibrosis treatments to said subject.
17. The method of claim 16, wherein said additional cystic fibrosis treatment comprises administering one or more CFTR modifiers to said subject.
18. The method of claim 17, wherein said CFTR modifier increases the duration of the opening of the CFTR gate, chloride flow through the CFTR gate, proper CFTR protein folding, the number of CFTR anchored to the cell membrane, or any combination thereof.
19. The method of any one of claims 17-18, wherein said CFTR modifier comprises a CFTR potentiator, a CFTR corrector, a CFTR amplifier, a translational read-through agent, or a combination thereof.
20. The method of any one of claims 17-19, wherein said CFTR modifier comprises ivacaftor, GLPG2222, GLPG3221, GLPG1837, lumacaftor, tezacaftor, elexacaftor, VX- 659, VX-152, VX-440, VX-809, VX-661, QBW251, PTI-808, VX-561; FDL169, PTI-801, PTI-428, or a combination thereof.
21. The method of any one of claims 16-20, wherein said additional cystic fibrosis treatment comprises an antibiotic drug, a bronchodilator, a corticosteroid, or a combination thereof.
22. The method of any one of claims 12-21, wherein said subject is human.
23. The method of any one of claims 12-22, wherein the administration step is via inhalation.
24. The method of any one of claims 12-23, wherein said treating comprises improving lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms.
25. The method of any one of claims 12-24, wherein said treating, suppressing or inhibiting cystic fibrosis comprises improving symptoms comprising coughing, recurring chest colds, wheezing, shortness of breast, frequent sinus infections, or a combination thereof.
26. The method of any one of claims 12-25, wherein said cystic fibrosis comprises atypical cystic fibrosis.
27. The method of any one of claims 12-25, wherein said subject having cystic fibrosis has a Class I, II, or III CFTR mutation.
28. The method of any one of claims 12-25, wherein said subject having cystic fibrosis has a Class IV, V, or VI CFTR mutation.
29. The method of any one of claims 27-28, wherein said subject has one or more of the following CFTR phenotypes: protein synthesis defect; maturation defect; gating defect; conductance defect; reduced quantity; reduced stability; or a combination thereof.
30. The method of any one of claims 12-29, wherein said subject is male.
31. The method of any one of claims 12-29, wherein said subject is female.
32. The method of any one of claims 12-31, wherein said subject is a child or an adolescent.
33. The method of any one of claims 12-31, wherein said subject is an adult.
34. The method of claim 33, wherein said subject is age 50 or over.
PCT/IL2022/050864 2021-08-09 2022-08-08 Antisense oligonucleotides for modulating exon skipping in cystic fibrosis transmembrane conductance regulator (cftr) WO2023017512A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163230880P 2021-08-09 2021-08-09
US63/230,880 2021-08-09
US202263346911P 2022-05-30 2022-05-30
US63/346,911 2022-05-30

Publications (1)

Publication Number Publication Date
WO2023017512A1 true WO2023017512A1 (en) 2023-02-16

Family

ID=85200605

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2022/050864 WO2023017512A1 (en) 2021-08-09 2022-08-08 Antisense oligonucleotides for modulating exon skipping in cystic fibrosis transmembrane conductance regulator (cftr)

Country Status (1)

Country Link
WO (1) WO2023017512A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016134021A1 (en) * 2015-02-20 2016-08-25 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting genes associated with cystic fibrosis
WO2018134301A1 (en) * 2017-01-19 2018-07-26 Proqr Therapeutics Ii B.V. Oligonucleotide complexes for use in rna editing

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016134021A1 (en) * 2015-02-20 2016-08-25 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting genes associated with cystic fibrosis
WO2018134301A1 (en) * 2017-01-19 2018-07-26 Proqr Therapeutics Ii B.V. Oligonucleotide complexes for use in rna editing

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SUSANA IGREJA; LUKA A. CLARKE; HUGO M. BOTELHO; LUÍS MARQUES; MARGARIDA D. AMARAL: "Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides", HUMAN MUTATION, JOHN WILEY & SONS, INC., US, vol. 37, no. 2, 2 December 2015 (2015-12-02), US , pages 209 - 215, XP071975973, ISSN: 1059-7794, DOI: 10.1002/humu.22931 *

Similar Documents

Publication Publication Date Title
EP3155124B1 (en) Reducing intron retention
US20220040219A1 (en) Compositions and methods for treating cystic fibrosis
US20220064647A1 (en) Compositions and methods for treating cystic fibrosis
US20190142860A1 (en) Nucleic acid based tia-1 inhibitors
TW201821125A (en) Agent for treating skin fibrosis
JP5606318B2 (en) Transfection agent
US20220220486A1 (en) Combination treatments for cystic fibrosis characterized by a 3849 + 10kb c-to-t cftr mutation
WO2023017512A1 (en) Antisense oligonucleotides for modulating exon skipping in cystic fibrosis transmembrane conductance regulator (cftr)
US20230142669A1 (en) Compositions and methods for treating cystic fibrosis
JP6490077B2 (en) Modulator of intracellular chloride concentration for treating Down's syndrome
US20220213479A1 (en) Restoration of the cftr function by splicing modulation
KR20180068524A (en) SS18-SSX fusion gene specific siRNA and pharmaceutical composition for preventing or treating of cancer containing the same
CA3163139A1 (en) Compositions and methods for treating cancer
WO2021199028A1 (en) Compositions and methods for treating cystic fibrosis
WO2023105527A1 (en) Muc5-targeted antisense oligonucleotides and related methods for modulating expression of muc5ac and muc5b
US20230407297A1 (en) Bioengineered wnt5a therapeutics for advanced cancers
US20220196660A1 (en) Methods for Modulation of Acetyltransferase Activity and Applications Thereof Including Treatments
US20220054610A1 (en) Slow-cycling cell-rna based nanoparticle vaccine to treat cancer
US10561679B2 (en) Double-stranded nucleic acid molecule, DNA, vector, cancer cell growth inhibitor, cancer cell migration inhibitor, and drug
WO2024081884A1 (en) Splice switching oligonucleotides to restore phkg2 expression in glycogen storage disease ix
WO2024009306A1 (en) Compositions and methods for treating primary ciliary dyskinesia
CN117897482A (en) Compositions and methods for treating cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22855657

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE