WO2023010171A1 - Agent and method for treating a neurodegenerative disorder characterised by polymorphic variation in the timmdc1 gene - Google Patents

Abstract

An agent and method for treating neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the gene for the Translocase of Inner Mitochondrial Membrane Domain-Containing protein 1 (TIMMDC1) is disclosed. The agent comprises an antisense oligonucleotide functioning as a splice-switching oligonucleotide (SSO) to correct aberrant splicing of pre-messenger RNA transcripts of the TIMMDC1 gene.

Description

AGENT AND METHOD FOR TREATING A NEURODEGENERATIVE

DISORDER CHARACTERISED BY POLYMORPHIC VARIATION

IN THE TIMMDC1 GENE

TECHNICAL FIELD

[0001] The present disclosure relates to an agent and method for treating neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the gene for the TIMMDC1 protein located at chromosome 3ql3.33. This polymorphic variation is present in at least European and Middle Eastern populations at an approximate frequency of 1 in 5000 individuals.

PRIORITY DOCUMENT

[0002] The present application claims priority from Australian Provisional Patent Application No. 2021902402 titled "AGENT AND METHOD FOR TREATING A NEURODEGENERATIVE DISORDER" and filed on 4 August 2021, the content of which is hereby incorporated by reference in its entirety.

BACKGROUND

[0003] The pace, sensitivity, and accuracy of identifying variants, both in known and new disease genes, has improved dramatically during the last few years (Bamshad MJ et al., Am J Hum Genet 105:448-455, 2019). Further, rapid improvements in tools for combined analysis of genome sequencing (GS) and RNAseq data from patient-derived cells or disease-relevant tissues have been particularly effective in identifying disease variants with splicing or gene -regulatory effects (Gonorazky HD et al., Am J Hum Genet 104:1007, 2019a; Fresard L et al., Nat Med 25:911-919, 2019; and Kremer LS et al., Nat Commun 8:15824, 2017). However, clarifying the functional and clinical significance of the rapidly increasing number of detected gene variants remains a huge challenge that trails advances in variant identification.

[0004] Previously, in 2015, using identity by descent mapping (IBD) to 3ql3.13-21.1 and family-based whole genome sequencing (GS), the present Applicant(s) identified a unique homozygous syntaxinbinding protein 5-like missense variant (NM_001308330.2 (STXBP5L'):c.3055G>A (p.VallO19Ile), ClinVar:VCV000266019.1) in siblings with an infantile -onset neurodegenerative disorder manifesting a predominant sensorimotor axonal neuropathy, optic atrophy and cognitive deficit; the variant was heterozygous in their unaffected consanguineous parents (Kumar R et al., Hum Mol Genet 24:2000- 2010, 2015). Combined genetic and molecular functional evidence was consistent with the STXBP5L p.VallO19Ile variant being responsible for the disorder. However, the variant has uncertain clinical significance by current American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG) guidelines (Richards S et al., Genet Med 17:405-424, 2015).

[0005] TIMMDC1, located at chromosome 3ql3.33, encodes the Translocase of Inner Mitochondrial Membrane Domain-Containing protein 1 (TIMMDC1) subunit of complex I, the largest complex of the electron transport chain, 1.4Mb centromeric to STXBP5L. Three unrelated children with clinical features similar to the affected siblings mentioned in the previous paragraph were found to have a homozygous c.596+2146A>G TIMMDC1 variant (Kremer et al., 2017 supra), which is now recognised as the c.597-1340A>G TIMMDC1 variant (see, for example, Alston CL et al., J Pathol 254(4):430-442, 2021). This variant results in aberrant splicing of the TIMMDC1 transcript, inserting a poison exon that introduces a frameshift leading to a premature stop codon p.Glyl99_Thr200ins5* and thus nonsense- mediated decay (NMD) of the aberrant transcript in patient cells. Consequently, the TIMMDC1 protein is undetectable in patient cells (Kremer et al., 2017 supra), resulting in compromised complex I function. More recently, two affected children with compound heterozygous (c.385C>T, p.Argl29*; 596+2146A>G, p.Glyl99_Thr200ins5*) TIMMDC1 variants were published (Naber M et al., Eur J Med Genet 64:104120, 2021). The phenotypic similarity between these reported individuals and the siblings with the STXBP5L variant that the Applicant(s) described in 2015, together with the relative proximity between STXBP5L and TIMMDC1 within the region defined through IBD mapping, prompted a re-examination of the genetic results. Combining GS and RNAseq data from patient- and parent-derived cells, and RNA splicing prediction tools, the same deep intronic c.596+2146A>G TIMMDC1 variant was identified, and in work leading to the present disclosure, genetic, expression and functional data was obtained suggesting that the c.596+2146A>G TIMMDC1 variant is the primary cause of the disorder in this family.

[0006] As such, a possible strategy for treating individuals that are homozygous for the TIMMDC1 c.596+2146A>G/c.597-1340A>G variant might be to employ a method and agent for manipulating the aberrant splicing of the TIMMDC1 transcript that occurs in these individuals. Antisense oligonucleotides that alter alternative splicing by directing splice site selection have been investigated for other medical indications (eg for treating spinal muscular atrophy and amyotrophic lateral sclerosis; see Dhuri K et al., J Clin Med 9(6):2004, 2020, and Schoch KM and TM Miller, Neuron 94:1056-1070, 2017), and indeed, three examples of such splice -switching oligonucleotides (SSO) have received approval for clinical use from the US Food & Drug Administration (Roberts TC et al., Nat Rev Drug Discov 19:673-694, 2020). The Applicant(s) therefore sought to design SSOs for potentially treating patients that are homozygous for the TIMMDC1 c.596+2146A>G/c.597-1340A>G variant, and determine whether such oligonucleotides could restore splicing of normal TIMMDC1 mRNA transcripts, and in turn, the expression of normal (wild type; WT) TIMMDC1 protein and restoration of mitochondrial function. SUMMARY

[0007] According to a first aspect, the present disclosure provides an agent comprising an antisense oligonucleotide for treating a neurodegenerative disease in a subject, wherein said oligonucleotide is targeted to a c.597-1340A>G polymorphic variation in a gene encoding Translocase of Inner Mitochondrial Membrane Domain -Containing protein 1 (TIMMDC1) to correct aberrant splicing of pre-messenger RNA transcripts of said gene (ie the TIMMDC1 gene).

[0008] In some embodiments, the agent of the first aspect comprises a splice-switching oligonucleotide (SSO) which specifically binds to all or a portion of a nucleotide sequence comprising the TIMMDC1 c.597-1340A>G variant, as shown below (wherein the A>G variation is underlined):

TTTTTATTAGTTGGTGTTTGTCTGACTAGAAGA ( SEQ ID NO : 1 ) ; to correct aberrant splicing of pre-messenger RNA transcripts of the TIMMDC1 gene.

[0009] The agent may be readily formulated for therapeutic use in accordance with any of the methods known to those skilled in the art. In some embodiments, the agent may be minimally formulated by appropriately combining the agent with one or more suitable carrier, diluent and/or excipient.

[0010] In a second aspect, the present disclosure provides a pharmaceutical composition comprising an agent according to the first aspect in combination with a pharmaceutically acceptable carrier, diluent and/or excipient.

[0011] In a third aspect, the present disclosure provides a method for treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene in a subject, wherein the method comprises administering the agent of the first aspect or a pharmaceutical composition of the second aspect to the said subject.

[0012] In a fourth aspect, the present disclosure provides an agent of the first aspect for use in treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene.

[0013] And, in a fifth aspect, the present disclosure provides the use of the agent of the first aspect in the manufacture of a pharmaceutical composition for treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene. BRIEF DESCRIPTION OF FIGURES

[0014] Figure 1 is a diagrammatic representation showing that the TIMMDC1 rare intronic variant c.597-1340A>G segregates with the affected individuals. In particular, the figure shows the pedigree of an affected family showing the consanguineous parents (II- 1 and II-2) with the heterozygous variants (A/G) and two affected individuals (III-2 and III-6) with the homozygous variant (G). The slash symbol represents deceased individuals;

[0015] Figure 2 provides a schematic representation of the TIMMDC1 gene showing that the intronic variant c.597-1340A>G inserts a "poison exon" between exons 5 and 6. The locations of hybridisation with the PCR primers described hereinafter is also shown;

[0016] Figure 3 provides results showing that the TIMMDC1 c.597-1340A>G variant acts as a splice enhancer. Zoom in TIMMDC1 exon showing two cryptic splice acceptor sites (AGUU) 5' to the variant. Sequence reads from the parents (II- 1 and II-2) and affected children (III-2 and III-6) contain this variant suggesting it drives mis-splicing. The figure also shows the target sequences for antisense oligonucleotides SSO1 and SSO2 (solid bars);

[0017] Figure 4 provides "sashimi plots" demonstrating that the TIMMDC1 c.597-1340A>G variant enhances alternative splicing across exons 5 and 6, and thus inserts much higher levels of a poison exon in the affected individuals (III-2 and III-6) than in both parents (II- 1 and II-2) and that is almost absent in control mRNAs. Note: the number of mRNA reads are reduced in the homozygous patients (III-2 and III-6) and heterozygous parents (II- 1 and II-2) compared to the unrelated normal control;

[0018] Figure 5 provides results showing that TIMMDC1 antisense, splice-switching oligonucleotides can restore normal splicing in c.597-1340A>G affected fibroblasts. The figure particularly provides images of agarose gels showing semi -quantitative RT-PCR amplicons of normally and alternatively spliced mRNAs in SSO1-, SSO2- or NC5 (control) -treated affected (III-6 and III-2; lanes 1-6) and untreated parent (II- 1 and II-2) fibroblasts (lanes 7-8). Minus RT reactions of the affected fibroblast RNAs (lanes 9-10) are also shown. Left panel: Control PCR products from primers (P442/P443) located in exon 3-4 showing amplification from the unaltered mRNA region. Middle panel: PCR products from primers (P444/448) located in exon 5-6 showing increased levels of normally spliced TIMMDC1 mRNA in SSO1 and SSO2 (lanes 1-2 and 4-5) compared to NC5 (lane 3, 6 with predominantly poison exon containing mRNA) treated affected or untreated (lanes 7-8 with predominantly normal mRNA) parent fibroblasts. Right panel: PCR products from primers (P446 located within poison exon and P448 within exon 6) that specifically amplify mRNAs with the poison exon sequence; [0019] Figure 6 provides results of experiments showing that TIMMDC1 protein levels are restored in affected fibroblasts treated with TIMMDC1 antisense, splice-switching oligonucleotides. (A) Western blot showing significantly increased TIMMDC1 protein level in SSO1- and SSO2 -treated affected (III- 2 and III-6; lanes 1-2 and 4-5) compared to almost non-existent protein in the NC5 (control)-treated (lanes 3, 6; very low-level signal was detectable in the longer exposure) fibroblasts; (B) Comparative Western blots showing that there is no difference in the TIMMDC1 protein levels in SSO1-, SSO2- or NC5 (control)-treated normal unrelated individual's fibroblasts (lanes 7-8). The housekeeping protein P- tubulin was used as a loading control; and

[0020] Figure 7 provides graphical results showing that mitochondrial function can be restored in affected patient fibroblasts treated with TIMMDC1 antisense, splice-switching oligonucleotides. Oxygen consumption rate (pmol/min) at baseline conditions and then after oligomycin, carbonyl cyanide-p-trifluoromethoxy-phenylhydrazone (FCCP) and rotenone/antimycin A injections was measured in SSO1-, SSO2- or NC5-treated patient fibroblasts. Results are expressed as mean ± SEM. * p<0.05; ** p<0.01 (two-tail Student's t test).

DETAILED DESCRIPTION

[0021] In a first aspect, the present disclosure provides an agent comprising an antisense oligonucleotide for treating a neurodegenerative disease in a subject, wherein said oligonucleotide is targeted to a c.597-1340A>G polymorphic variation in a gene encoding Translocase of Inner Mitochondrial Membrane Domain -Containing protein 1 (TIMMDC1) to correct aberrant splicing of pre-messenger RNA transcripts of said gene (ie the TIMMDC1 gene).

[0022] The agent therefore comprises an antisense oligonucleotide functioning as a splice-switching oligonucleotide (SSO).

[0023] The agent may comprise one or more of such splice-switching oligonucleotides (eg the agent may comprise SSOs with two or more different oligonucleotide sequences targeted to the TIMMDC1 c.597-1340A>G variant).

[0024] While not wishing to be bound by theory, SSOs according to the disclosure may correct aberrant splicing of pre-messenger RNA transcripts of the TIMMDC1 gene within an affected cell, by binding sequence elements and blocking access to the transcript by the spliceosome (and possibly other splicing factors), in a manner so as to restore splicing of normal TIMMDC1 mRNA transcripts (although, as will be appreciated by those skilled in the art, aberrant splicing may not be completely ablated). In turn, the affected cell may express the normal (wild type; WT) TIMMDC1 protein leading to a restoration of mitochondrial function within the cell. As shown in the examples hereinafter, affected cells show mitochondrial complex 1 dysfunction (as indicated by biomarkers, particularly oxygen consumption rate (OCR) and ATP production) which could be ameliorated by administration of SSOs according to the disclosure.

[0025] It is to be understood that c.597-1340A>G as used herein refers to the variant previously annotated as c.596+2146A>G, and which is also known as chr3:119234712A>G (GRCh37).

[0026] In some embodiments, the agent of the first aspect comprises an SSO which specifically binds to all or a portion of a nucleotide sequence comprising the TIMMDC1 c.597-1340A>G variant, as shown below (wherein the A>G variation is underlined):

TTTTTATTAGTTGGTGTTTGTCTGACTAGAAGA ( SEQ ID NO : 1 ) ; to correct aberrant splicing of pre-messenger RNA transcripts of the TIMMDC1 gene.

[0027] Preferably, the SSO specifically binds to a portion of the nucleotide sequence of SEQ ID NO: 1 comprising at least 15 contiguous nucleotides including the c.597-1340A>G variant nucleotide. More preferably, the SSO specifically binds to a portion comprising at least 17 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1 including the c.597-1340A>G variant nucleotide, and most preferably, the SSO specifically binds to a portion comprising at least 20 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1. Thus, the SSO may be, for example, a 15-mer (ie an oligonucleotide consisting of 15 nucleotides), a 16-mer, a 17-mer, an 18-mer, a 19-mer or, more preferably, a 20-mer, although longer SSOs are also contemplated such that SSOs of a length in the range of, for example, 15 to 40 nucleotides, or more preferably, 18 to 30 nucleotides, also fall within the scope of the present disclosure.

[0028] In addition, preferably, the SSO specifically binds to a portion of the nucleotide sequence of SEQ ID NO: 1 comprising at least one, or at least two, or at least three, or at least four, or at least five nucleotides flanking each side of the c.597-1340A>G variant nucleotide. More preferably, the SSO specifically binds to a portion of the nucleotide sequence of SEQ ID NO: 1 comprising six or more nucleotides flanking each side of the c.597-1340A>G variant nucleotide.

[0029] In some preferred embodiments, the agent of the first aspect comprises an SSO selected from those shown in Table 1 below. [0030] Table 1

[0031] It will, of course, be understood that in the pre-messenger RNA transcripts of the TIMMDC1 gene, the target sequences shown as SEQ ID NOS: 1-3 will be present as follows (respectively):

UUUUUAUUAGUUGGUGUUUGUCUGACUAGAAGA ( SEQ ID NO : 6 ) ,

GUUGGUGUUUGUCUGACUAG ( SEQ ID NO : 7 ) , and

UUAGUUGGUGUUUGUCUGAC ( SEQ ID NO : 8 ) .

[0032] As mentioned above, preferably, the SSO specifically binds to a portion of the nucleotide sequence of SEQ ID NO: 1 including the c.597-1340A>G. By "specifically binds", it is to be understood that the SSO, under high stringency conditions, hybridises to the said portion of the nucleotide sequence of SEQ ID NO: 1 but does not substantially bind to the corresponding WT nucleotide sequence (ie lacking the variant nucleotide). In other words, the SSO may only hybridise to the WT sequence in minimal, trace, levels. High stringency conditions are well known to those skilled in the art and are typically characterised by high temperature (ie high annealing temperature) and low ionic strength (ie low salt concentration, especially of MgCl₂, KC1 and NaCl). For the purposes of the present disclosure, the term "high stringency conditions" may be understood as referring to conditions which: (1) employ low ionic strength and high temperature for washing, for example, 15 mM NaCl/1.5 mM sodium citrate/0.1% NaDodSO₄ at 50°C; (2) employ, during hybridisation, a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 m NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5X SSC (750 mM NaCl, 75 mM sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X Denhardt's solution, sonicated salmon sperm DNA (50 pg/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2X SSC (30 mM NaCl, 3 mM sodium citrate) and 0.1% SDS).

[0033] In some embodiments, the SSO will be deoxyribonucleic acid (DNA) but in some other embodiments, the SSO may be modified at one or more sites to provide one or more advantageous property. [0034] For example, the SSO may be modified so as resist or prevent degradation of the TIMMDC1 pre-mRNA when hybridised to the SSO by, for example, RNase H. Accordingly, in some embodiments, the oligonucleotide sugar-phosphate backbone may be modified by, for example, providing the SSO with one or more phosphorodiamidate morpholino (PMO) linkage and/or one or more peptide linkages such as found in peptide nucleic acid (PNA), or one or more of the sugar moieties of the nucleotides may be modified by, for example, one or more 2'O-methyl (2'0Me) or 2'-O-methoxyethyl (MOE) ribose modification. Other suitable modifications include those found in oligonucleotides known as locked nucleic acids (LNA; see, for example, Borges Pires V et al., PLoS One 12(7):e0181065, 2017), wherein the ribose sugar moiety of the molecules is altered such that a methylene bridge connects the 2'-0 with the 4'-C atoms in the furanose ring; such that the bridge enables the SSO to form a strictly N- type conformation that may enhance binding affinity to the target TIMMDC1 sequence. Suitable synthetic oligonucleotide chemistries such as these are well known to those skilled in the art (see, for example, Bauman J et al., Oligonucleotides 19( 1): 1 -13, 2009, and Havens MA and ML Hastings, Nuc Acids Res 44(14):6549-6563, 2016).

[0035] In another example, the SSO may also incorporate phosphorothioate (PS) linkages, which may not appreciably confer RNase H resistance, but which may contribute to increased serum stability and bioavailability (Bauman et al., 2009 supra). Increased stability and/or bioavailability may, for example, reduce the frequency of administration of the agent to the subject.

[0036] In yet another example, the SSO may also incorporate one or more 5' methylcytosine nucleotide(s), as it has been reported that such 5 '-methylcytosine modification can increase SSO specificity (Scoles DR et al., Neurology: Genetics 5(2):e323, 2019) and/or reduce immune stimulation (Aartsma-Rus A et al., Oligotherapeutics OTS Rare Disease N-of-1 + Workshop Briefing Document, 2021; and Kandimalla ER et al., Bioorg Med Chem (: 807-813, 2001).

[0037] In some particular embodiments, the SSO may include 2'0Me ribose modifications and PS linkages between the nucleotides. This type of oligonucleotide may be denoted as a "2'OMePS SSO". In some other particular embodiments, the SSO may comprise a fully phosphorothioate (PS) modified backbone and include a number of LNA-modified nucleotides (eg where 60% or more of the nucleotides are LNA-modified nucleotides; shown in some SSOs to enhance the desired spliceswitching activity (Borges Pires et al., 2017 supra)). Further, in some embodiments of this kind, it may be advantageous to include an LNA-modified nucleotide at one or both of the 3'- and 5'-terminals of the oligonucleotide.

[0038] In some embodiments, it may be desirable to provide the SSO with a cell-penetrating peptide (CPP) so as to enhance cellular uptake of the SSO. This may be particularly desirable where the SSO is to be administered in an uncomplexed "naked" form. CPPs and techniques for their non-covalent or covalent conjugation (eg through disulphide linkages or amide bonds) to an oligonucleotide are well known to those skilled in the art. Some suitable CCPs include penetratin (Derossi D et al. , J Biol Chem 271:18188-18193, 1996), octa-arginine (R8) and related CPPs such as (RXR)₄XB and (RXRRBR)₂XB peptides (where R is Arg, X is 6-aminohexanoic acid, and B is [3-alanine), cationic TAT peptides (eg TAT, TAT-HA and cTAT; Green M et al., Cell 58:215-223, 1989), Xentry (LCLRPVG; Montrose K et al., Sci Rep 3: 1661, 2013) and transportan 10 (TP10; Ruczyhski J et al., Sci Rep 9:3247, 2019).

[0039] Further, in some embodiments, it may be desirable to provide the SSO with a polypeptide comprising a nuclear localisation signal (NLS) to enhance delivery of the oligonucleotide to the nucleus of a cell. The NLS polypeptide may comprise all or an NLS -containing portion of a natural polypeptide comprising one or more NLS. For example, the NLS polypeptide may comprise all or an NLS- containing portion of the SV40 large T antigen (Kosugi S et al., J Biol Chem 284(l):478-485, 2009), which was the first NLS to be characterised (Kalderon D et al., Cell 39(3 Pt. 2):499-509, 1984). Other suitable nuclear localisation signals may include the NLS of nucleoplasmin (Dingwall C et al., J Cell Biol 107(3);841-849, 1988), EGL-13 or c-myc. The NLS may be conjugated to the oligonucleotide through a non-covalent or covalent linkage as are well known to those skilled in the art.

[0040] In other embodiments, the SSO may be provided in a complexed form to enhance cellular uptake. For example, the SSO may be complexed with liposomes, lipids (especially cationic lipids) to form lipid nanoparticles (LNPs) in a process known as lipofection, lipopeptides (LPs) (see, for example, Adami RC et al., J Pharm Sci 87:678-683, 1998), suitable surfactants (eg a non-ionic block copolymer such as Pluronic® Fl 27; BASF, Ludwigshafen, Germany), and/or various coatings or polymers such as poly(glutamic acid)-based peptide coatings (Harris TJ et al., Biomaterials 31:998-1006, 2010) and polyethylene glycol (PEG) which may act as charge-neutralising agents. Some particular examples of polymeric charge -neutralising agent(s) that may be suitable for use with the agent of the present disclosure include derivatives of polyethylene glycol (PEG) incorporating a lipid component such as a phospholipid (eg phosphatidylethanolamine-PEG (PE-PEG) and distearoyl-phosphoethanolamine- (polyethylene glycol) (DSPE-PEG)), poly-amino acid polymers such as poly aspartic acids (PAAs) or polyglutamic acids (PGAs) and other anionic polymers such as poly( acrylic acid) polymers, and certain block copolymers comprising a negatively charged block and a neutral, hydrophilic block (eg block copolymers of poly (acrylic acid) and poly (hydroxypropyl methacrylamide) (polyHPMA), and block copolymers of poly (acrylic acid) and poly (2 -hydroxy ethyl methacrylamide) (poly HEM A)). The polymeric charge -neutralising agent(s) preferably show at least an acceptable level of biocompatibility and/or biodegradability within the body of the subject.

[0041] In some embodiments, the agent may optionally incorporate a receptor-mediated nucleic acid transfer ligand, antibody or engineered fragment(s) of antibodies for targeted delivery. The use of receptor-mediated nucleic acid transfer ligands aims to achieve cell or cell-specific delivery of the SSO by using ligands targeted to cell surface receptors. For use in treating a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene, it may be advantageous to target the SSO to certain cell types such as brain endothelium and neurons. In one example, the SSO may be targeted to neurons by including neurotensin which binds to neurotensin receptors located on the cell surface of neurons such as glutamatergic neurons in the brain. In another example, the SSO may be targeted to endothelial cells of the brain by including transferrin which binds to transferrin receptors located on the cell surface of endothelial cells in the brain (Johnsen KB et al., Sci Rep 7:10396, 2017).

[0042] In some particular embodiments, the agent may be provided in the form of cationic liposomes bearing surface -located transferrin or surface-located neurotensin. Suitable methods for the production of such agents is well known to those skilled in the art and have been described previously (see, for example, Ishida O et al., Pharm Res 18(7): 1042-1048, 2001, and van Rooy I et al., Int J Pharm 416(2):448-452, 2011).

[0043] The agent may be delivered to the subject using any of the methods well known to those skilled in the art, such as methods involving the use of a gene gun, electroporation, ultrasound or hydrodynamic delivery methodology. However, preferably, delivery of the agent is conducted by simple needle injection. In some particular embodiments, the agent is administered by needle injection directly to the eye or cerebrospinal fluid (CSF) (eg by lumbar puncture to the spinal cord). Direct injection of SSOs to the CSF by, for example, intracerebroventricular (ICV) injection or intrathecal (IT) injection, has been previously shown to be an effective way to achieve favourable distribution of SSOs throughout the CNS (Finkel RS et al., Lancet 388:3017-3026, 2016, and Havens et al., 2016 supra).

[0044] The agent may be readily formulated for therapeutic use in accordance with any of the methods known to those skilled in the art. In some embodiments, the agent may be formulated so as to be suitable for a certain route or routes of administration (eg ICV or IT injection). However, in a simple form, the agent may, for example, be minimally formulated by appropriately combining the agent with one or more suitable carrier, diluent and/or excipient.

[0045] In a second aspect, the present disclosure provides a pharmaceutical composition comprising an agent according to the first aspect in combination with a pharmaceutically acceptable carrier, diluent and/or excipient.

[0046] Examples of suitable carriers and diluents are well known to those skilled in the art, and are described in, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA 1995. Examples of suitable excipients may be found in the Handbook of Pharmaceutical Excipients, 2^nd Edition, (1994), Edited by A Wade and PJ Weller. Examples of suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.

[0047] In some embodiments, the pharmaceutical composition comprises the agent in combination with hexose as a pharmaceutically acceptable carrier. Hexose has been found to enhance SSO delivery (Han G et al., Nat Commun &: 10981 , 2016).

[0048] The pharmaceutical composition may further comprise any suitable binders, lubricants, suspending agents, coating agents and solubilising agents. Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free -flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Preservatives, stabilising agents, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Anti-oxidants and suspending agents may be also used.

[0049] The pharmaceutical composition will be administered to a subject with a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene in a therapeutically effective amount, that is an amount sufficient to effect beneficial or desired clinical results. A therapeutically effective amount can be administered in one or more administrations. Typically, a therapeutically effective amount will be sufficient for treating the neurodegenerative disease or otherwise to palliate, ameliorate, stabilise, reverse, slow or delay the progression of the disease. By way of example only, a therapeutically effective amount of the pharmaceutical composition may provide an amount of the SSO of between about 0.1 and about 250 mg/kg body weight per day. However, SSOs have been found to be well tolerated, particularly in the CNS, and have a long-lasting effect in vivo (Rigo F et al., Adv Exp Med Biol 825:303-352, 2014), so in some embodiments, the therapeutically effective amount of the pharmaceutical composition may be provided by administering a sufficient amount to provide 0.1 - 10 mg/kg, more preferably 1 - 3 mg/kg, body weight of the SSO at regular intervals (eg one week intervals, two week intervals, or three week intervals, or more preferably, at one month, two month or three month intervals). While a repeat administration regimen is generally undesirable for CNS delivery (as it is invasive and risky), repeated IT injections of SSOs in paediatric subjects have been shown to be well-tolerated (Hache M et al., J Child Neurol 131 :899-906, 2016). Thus, in some embodiments, the pharmaceutical composition is administered by ICV or IT injection every three months. The period of the interval may, however, vary from time to time across the duration of the subject's treatment. Further, and notwithstanding the above, it will be understood by those skilled in the art that the therapeutically effective amount may vary and depend upon a variety of factors including the activity of the particular SSO, the metabolic stability and length of action of the particular SSO, the age, body weight, sex and/or health of the subject, the route and time of administration, rate of excretion of the particular SSO, and the severity of the neurodegenerative disease to be treated.

[0050] In a third aspect, the present disclosure provides a method for treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene in a subject, wherein the method comprises administering the agent of the first aspect or a pharmaceutical composition of the second aspect to the said subject.

[0051] Preferably, the method is continued for the duration of the subject's life. Commencement of the method may be immediately following birth (eg within 1 -7 days of birth) or at a later date within the neonatal period, infancy or early childhood. As such, the method preferably comprises repeat administration of the agent or pharmaceutical composition.

[0052] In some preferred embodiments, the method comprises administering the agent or pharmaceutical composition to the subject at regular intervals (eg one week intervals, two week intervals, or three week intervals, or more preferably, at one month, two month or three month intervals) in a therapeutically effective amount (eg to provide 1- 3 mg/kg body weight of the SSO per administration) for the duration of the subject's life. Preferably, the agent or pharmaceutical composition is administered by ICV or IT injection every three months. The period of the interval may, however, vary from time to time across the duration of the subject's treatment.

[0053] In a fourth aspect, the present disclosure provides an agent of the first aspect for use in treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene.

[0054] In a fifth aspect, the present disclosure provides the use of the agent of the first aspect in the manufacture of a pharmaceutical composition for treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene.

[0055] The agent and method of the present disclosure is hereinafter further described with reference to the following non-limiting examples and accompanying figures. EXAMPLES

Example 1 Identification and characterisation of TIMMDC1 variant

Methods and Materials

[0056] Affected subjects

The genetic results obtained from a family affected with an infantile -onset neurodegenerative disorder and reported in 2015 (Kumar R et al., 2015 supra) were re-examined in view of the report of a c.597- 1340A>G TIMMDC1 variant (Kremer et al., 2017 supra), since the clinical phenotype of the affected siblings is consistent with TIMMDC1 -related disease and the wider spectrum of mitochondrial complex 1 dysfunction. In particular, these siblings, a brother and sister, and children of first cousin parents, had a mixed central and peripheral neurodegenerative disorder dominated by infantile -onset axonal neuropathy, optic atrophy, cognitive delay and generalised cerebral atrophy upon neuroimaging.

[0057] Cell culture - Fibroblast and LCL maintenance and transfections

Lymphoblastoid cell lines (LCLs) from all normal family members and one affected family member (III-6) were established by infecting peripheral blood lymphocytes with Epstein-Barr Virus using a published method (Neitzel H, Hum Genet 73:320-326, 1986). Established LCLs were maintained in RPMI-1640 (Sigma-Aldrich; St Louis, MO, United States of America) supplemented with 10% foetal bovine serum (ThermoFisher Scientific), 2 mM L-glutamine (Sigma- Aldrich), and 0.15 mg/ml benzylpenicillin (CSL Limited, Melbourne, Australia) at 37°C with 5% CO₂. Fibroblasts derived from the parents and two affected children were maintained in Dulbecco's Modified Eagle’s medium (Sigma- Aldrich) containing 2 mM L-glutamine, 1 mM sodium pyruvate, and 10% foetal bovine serum at 37°C with 5% CO₂.

[0058] Blood DNA PCR amplification and Sanger sequencing

The genomic region flanking the c.597-1340A>G TIMMDC1 variant was amplified from blood DNA of all family members using Platinum SuperFi PCR Master Mix (ThermoFisher Scientific Inc; Waltham, MA, United States of America) and primers P445/P448 (Table 2) under the following conditions: 95°C for 2 min; 36 cycles of 95°C for 15 s, 59°C for 15 s, 68°C for 2 min and final one cycle of 68°C for 10 min. The PCR products were then gel purified and subjected to Sanger sequencing. [0059] Table 2 PCR primers

[0060] RNA sequencing (RNAseq)

RNAseq reads data from a cohort of individuals with neurodevelopmental disorders (n = 171) and their healthy family members (n = 107) were generated from libraries constructed using a TruSeq Stranded mRNA (Illumina Inc; San Diego, CA, United States of America) of patient-derived fibroblast cell lines. Reads were mapped to the GRCh38 build of the human genome using STAR v2.7.3a (Dobin A et al., Bioinformatics 29:15-21, 2013). Read counts were generated using FeatureCounts vl.6.3 and detection of outliers was performed using edgeR v3.24.3 with outliers based on false discovery rate (FDR) of < 0.05. Detection of novel outlier splicing events was performed using LeafCutter vO.2.9 (Li YI et al., Nat Genet 50:151-158, 2018) with significant alternative introns defined by a cut off of FDR < 0.05. Sashimi plots showing splicing patterns were generated using Integrative Genomics Viewer (Broad Institute).

[0061] RNA extraction and RT-PCR

RNA was isolated from fibroblasts using RNeasy Mini Kit and on-column RNase-free DNase-treatment (Qiagen). cDNAs were generated from the total RNA (500ng each) using Superscript IV reverse transcriptase (ThermoFisher Scientific) and subjected to PCR amplification using different pairs of primers. PCR amplifications were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs; Ipswich, MA, United States of America) under the following conditions: 98°C for 30 s; 31 cycles of 98°C for 10 s, 58°C for 10 s, 72°C for 15 s and final one cycle of 72°C for 10 min. Some of the PCR products were gel purified and subjected to Sanger sequencing.

[0062] Genome Sequencing

Mapping of read data to the 1000 genomes project build 37 of the human genome (available from http://ftp.1000genomes.ebi.ac.uk/voll/ftp/technical/reference/human_glk_v37.fasta.gz) was performed as described as part the previous study (Kumar et al., 2015 supra). Variants located within a region starting 3.5kb upstream of TIMMDC1 and concluding at the end of the final exon according to the NM_016589.4 reference sequence (GRCh37 NC_000003.11 :119213926_l 19243175) were called using bcftools mpileup and bcftools call vl.9 with default settings and annotated from the resulting variant call format (VCF) file using ANNOVAR (Wang K et al., Nucleic Acids Res 38, el64, 2010) and SpliceAI (Jaganathan K et al., Cell 176:535-548, 2019). Read alignments were viewed with the Integrative Genomics Viewer (IGV) v.2.5.2 (Broad Institute; Cambridge, MA, United States of America).

[0063] Western blot assays

Fibroblasts were lysed in 50 rnM Tris-HCl pH7.5, 250 rnM NaCl, 0.1% Triton-X-100, 1 rnM EDTA, 50 rnM NaF, 0.1 rnM Na₃VO₄, lx Protease inhibitor/No EDTA and LCLs in 50 mM Tris-HCl pH7.5, 50 mM KC1, 0.1% NP40, 5 mM EDTA, 50 mM NaF, 0.1 mM Na₃VO₄,lx Protease inhibitor/No EDTA (Affar el B et al., Mol Cell Biol 26:3565-3581, 2006), sonicated with microtip (10 s 25% amplitude; Sonics Vibra-Cell VCX 130), cell debris removed by centrifugation at 15,000xg for 20 min at 4°C and proteins assayed using BCA assay kit (ThermoFisher Scientific). 8pg protein of each sample was resolved on 4-12% Bis-Tris protein gels (ThermoFisher Scientific), transferred to nitrocellulose membranes and Western blotted with rabbit monoclonal anti-TIMMDCl antibody (ab 171978; Abeam, Cambridge, United Kingdom) or anti-[3-Tubulin (Ab6046; Abeam) and polyclonal goat anti-rabbit IgG/HRP (P0448; Dako, Glostrup, Denmark) as secondary antibody. Signal was detected by Clarity Western ECL Substrate (Bio-Rad Laboratories; Hercules, CA, United States of America) and captured using Gel Documentation System (Bio-Rad Laboratories).

Results

[0064] Clinical phenotype

As noted above, the clinical phenotype of the affected siblings of the family studied in this example is consistent with TIMMDC1 -related disease and the wider spectrum of mitochondrial complex 1 dysfunction. While the clinical phenotype of the affected siblings studied in this example cannot be considered pathogenomic, the observed features demonstrated considerable overlap with other children manifesting TIMMDC1 -related disease (Kremer et al., 2017 supra-, and Naber et al., 2021 supra) and wider congruence with observed neurological and extra-neurological features of mitochondrial complex 1 deficiency (Fassone E and S Rahman, J Med Genet 49:578-590, 2012; and Janssen RJ et al., J Inherit Metab Dis 29:499-515, 2006). Classic biochemical markers of perturbed mitochondrial oxidative phosphorylation have proved inconspicuous in all cases reported (Kremer et al., 2017 supra-, Kumar et al., 2015 supra-, and Naber et al., 2021 supra)-, indeed, the sibship demonstrated serially normal venous and CSF lactate levels, with only a mild non-specific elevation of ketones and Kreb's cycle metabolites on a single urinary organic acid profile (III.6) - which were normal upon three independent sampling time -points. It is notable that, where documented, skeletal muscle Respiratory Chain enzymology confirmed isolated complex 1 deficiency, except for in the case of the siblings studied here where analyses proved inconclusive. Histopathological and ultrastructural features were similarly non-specific, reflecting features of muscle denervation only (Kremer et al., 2017 supra-, Kumar et al., 2015 supra-, and Naber et al., 2021 supra). Additionally, while a Leigh syndrome presentation has been described in one patient with a TIMMDC1 mutation and characteristic MR features of bilateral T2 hyperintensities in the basal ganglia and/or brainstem have been noted in two cases in T2 weighted sequences (Kremer et al., 2017 supra-, Kumar et al., 2015 supra-, and Naber et al., 2021 supra), such findings were not evident in the cases presented in this example, nor was elevated lactate present upon single voxel proton spectroscopy (TE 31 and 144 ms) of the striatal grey matter.

[0065] Identification of a pathogenic deep intronic TIMMDC1 variant

A targeted review of all coding and non-coding variants within TIMMDC1 was made according to a phenotype driven hypothesis. The results concurred with the previous observations that there were no rare pathogenic variants within the coding or consensus splice sites of TIMMDC1 (Kumar et al., 2015 supra), and the annotation of observed variants against the ClinVar database detected a previously recorded pathogenic variant NM_016589.4(77M MDCl):c.597- 1340A>G VCV000429020.2; identical to the previously published NM 016589.4(77ALWOC/):c.596+2146A>G variant (Kremer et al., 2017 supra) with genomic annotation NC_000003.11 :g.119234712A>G). Splice prediction algorithms predicted only modest effects from this variant (Table 3).

[0066] Table 3 Acceptor site usage prediction: chr3:119,234,705_119, 234,706AG

[0067] Segregation of the TIMMDC1 c.597 - 1340A>G variant within the affected family

Using blood DNA from all family members, the genomic region flanking the TIMMDC1 c.597- 1340A>G variant (Figure 1) was PCR amplified (using primers P445/P448; Table 2; Figures 1 and 2) and then sequenced using Sanger sequencing. The consanguineous parents (II- 1 and II-2) were heterozygous (A/G), the two affected individuals (III-2 and III-6) homozygous (G/G) and the unaffected siblings either heterozygous (A/G) (III- 1 , III-4, III-5) or homozygous (A/ A) (III-3) for the TIMMDC1 alleles (Figure 1). These results were consistent with autosomal recessive inheritance. [0068] The TIMMDC1 c.597-1340A>G variant acts as a splice enhancer

RNAseq data analysis identified TIMMDC1 as an expression outlier in a cohort of 200 fibroblast samples with log₂fold change -2.71 and adjusted p-value 1.68x10³⁵; however, no outlier splicing events were detected by LeafCutter. Manual inspection of the aligned RNAseq data of the parents, the two affected children and an unrelated individual showed two cryptic splice acceptor sites (AGUU) 5 bp (3:119,234,706) and 23 bp (3:119,234,688) 5', and a cryptic splice donor site 74 bp (3:119,234,786) 3' of the c.597-1340A>G TIMMDC1 intronic variant. Comparison of the total number of sequence reads mapped to these junctions indicated that the TIMMDC1 c.597-1340A>G variant acts as a splicing enhancer, causing aberrant splicing that leads to insertion of an 80bp, or to a lesser extent, a 98bp "poison exon" between exon 5 and exon 6 (Figures 2, 3 and 4). This is also clear from sashimi plots showing significantly higher TIMMDC1 mRNA read density for the poison exon in the affected individuals (average 89.4%: III-2 and III-6) homozygous for the intronic variant than in the parents (average 14.9%; II- 1 and II-2) heterozygous for the variant and in the unrelated homozygous normal control (1.9%) (Figure 4).

[0069] Semi -quantitative RT-PCR analysis that allowed simultaneous assessment of relative levels of TIMMDC1 transcripts with or without the poison exon was also performed. Using a primer pair which spans between exon 5 and exon 6, the two affected individuals (III-2 and III-6) had a predominant 195bp amplification product that represents the TIMMDC1 transcript with the poison exon, and low levels of a 115bp amplification product from the normally spliced transcript. The parents had both the 115bp normally spliced transcript and low levels (possibly due to PCR bias) of the 195bp aberrantly spliced transcript. The 195bp band was undetectable in an unrelated normal control individual who did not have the c.597-1340A>G allele. No amplification was observed from un-reverse transcribed RNA. That mRNA 5' to the aberrantly spliced sequence was unaltered by the intronic variant was checked by RT-PCR using primers (P442/P443) located within exon 3 and exon 4 (Figure 2).

[0070] RT-PCR was also performed with a poison exon-specific primer (P446) to determine the levels of TIMMDC1 transcript with the poison exon in patient, parent and control fibroblasts. The data showed higher levels of the poison transcript in patients than parents, and very low levels in the normal control (Figure 5), indicating the presence of a low level of aberrant splicing events from the cryptic donor site located at 3:119,234,786 even in the fibroblasts lacking the TIMMDC1 c.597-1340A>G variant. Sanger sequencing confirmed the presence of an 80bp poison exon sequence in the aberrantly spliced TIMMDC1 transcript (Figure 5).

[0071 ] TIMMDC1 protein levels are reduced in affected LCLs and fibroblasts

The TIMMDC1 poison exon introduces a frameshift resulting in a premature stop codon (p.Glyl99_Thr200ins5*) in TIMMDC1 transcripts that are likely degraded via nonsense-mediated mRNA decay (NMD) in patient cells. Consequently, the TIMMDC1 protein is undetectable in patient- derived cells (Kremer et al., 2017 supra). First, Western blotting was performed (using antibody against N-terminal 1-100 amino acids) on LCLs from one affected individual (available only for III-6), the parents and four siblings, and observed reduced levels of TIMMDC1 protein in the affected child compared to his family members. A slightly reduced TIMMDC1 protein was observed in one heterozygous sibling (III-5) that appeared to be due to sample-specific probing sensitivity. Second, the TIMMDC1 protein levels in patient, parent, and unrelated control fibroblasts were determined. TIMMDC1 protein levels were negligible in III-6 and III-2 affected fibroblasts (extremely low levels detectable only after very long Western blot exposure) compared to moderately reduced levels in LCLs from III-6. A reduced level of TIMMDC1 protein in fibroblasts was also observed from the heterozygous parents compared to fibroblasts from unrelated controls without the TIMMDC1 variant.

Discussion

[0072] The siblings described here were as previously reported by the Applicant(s) (Kumar et al., 2015 supra) to have a homozygous variant in STXBP5L (c.3127G>A, p.VallO43Ile) associated with a phenotype summarised as an infantile-onset neurodegenerative disorder, manifesting a predominant sensorimotor axonal neuropathy, optic atrophy and cognitive deficit. Re-examination of the siblings using the RNAseq data identified the same TIMMDC1 variant (ie c.596+2146A>G/c.597-1340A>G) in the patients as had been reported by Kremer et al., 2017 supra and Naber M et al., 2021 supra-, with subsequent molecular and cellular functional studies supporting pathogenicity, resulting from loss of TIMMDC1, a chaperone protein critical to assembly of the Mitochondrial Respiratory Chain Complex 1 (Guarani V et al., Mol Cell Biol 34:847-861, 2014), which is a multimeric complex comprising 45 subunits and the first enzyme of the mitochondrial respiratory chain critical to oxidative phosphorylation responsible for ATP synthesis. RT-PCR amplification revealed that the TIMMDC1 c.597-1340A>G variant indeed enhances insertion of an underutilised (poison) exon into the TIMMDC1 mRNAs in patient fibroblasts. However, it appears that a low level of normal TIMMDC1 transcript, and thus the translated protein, is sufficient for minimal mitochondrial function and thus enough for survival of affected fibroblasts and individuals, albeit at the expense of severe, and ultimately fatal, clinical features. In contrast, parents show almost half of the aberrant TIMMDC1 transcript levels, consistent with the observation that the parents have half the TIMMDC1 protein (compared to normal controls, which is sufficient for sustaining normal life. Example 2 Treatment of affected TIMMDC1 c.597-1340A>G variant cells with spliceswitching oligonucleotides

Methods and Materials

[0073] Oligonucleotide design and synthesis

TIMMDC1 splice- switching oligonucleotides (SSOs) were designed to target sequences of the TIMMDC1 variant as shown in Table 4, and synthesised according to standard methodologies known to those skilled in the art. The SSOs comprised phosphorothioate (PS) linkages throughout. All nucleotides included 2'-O-methoxyethyl (MOE) ribose modification. In addition, the cytosine nucleotides were methylated (ie 5'-methyIcytosine; MeC). Experiments were conducted using the nonspecific control oligonucleotide NC5 (Integrated DNA Technologies, Inc.; Coralville, IA, United States of America). Like the SSOs, the NC5 control oligonucleotide comprised PS linkages throughout, and all nucleotides included 2'-O-methoxyethyl (MOE) ribose modification (with cytosine nucleotides being methylated).

[0074] Table 4 Antisense splice-switching oligonucleotides (SSOs)

[0075] Fibroblast transfections

Fibroblasts (10⁵/well) were plated in six -well dishes and, on the next day, transfected with 100 nM of the TIMMDC1 splice-switching oligonucleotides SSO1 or SSO2, or the non-specific control oligonucleotide NC5 using Lipofectamine RNAiMAX (ThermoFisher Scientific) following the manufacturer's protocol and harvested 48 h later.

[0076] Mito Stress assay

Mitochondrial function was assayed by measuring the oxygen consumption rate (OCR) in adherent fibroblasts with Seahorse XF96 Extracellular Flux Analyser kit (Agilent Technologies; Santa Clara, CA, United States of America). Fibroblasts (6 wells for each treatment) were seeded in 96-well culture microplate (Seahorse Technologies) pre-treated overnight with 5pg/ml fibronectin (Sigma-Aldrich) at 10,000 cells/well in 100 pl DMEM (D5671; Sigma-Aldrich) with 1 mM sodium pyruvate, 2 mM L- glutamine and 10% FCS, and incubated for 24 h at 37°C in 5% CO₂. Next day, the cells were transfected with 100 nM TIMMDC1 SS01, SSO2 or NC5 antisense oligonucleotides using Lipofectamine 3000 (ThermoFisher Scientific) following the manufacturer's protocol. Forty-eight hours later, the growth medium was replaced with 180pl bicarbonate-free pre-warmed Seahorse XF DMEM medium pH 7.4 supplemented with 1 mM sodium pyruvate, 2 m L-glutamine and 10 mM glucose, and incubated at 37°C for 40 min in CO₂-free incubator before starting the assay. All assay procedures were as recommended for the Agilent Seahorse XF cell mito stress kit. The basal respiration rate and the data from cells sequentially treated with 1 pM oligomycin (ATP synthase inhibitor), 0.5 pM FCCP (electron transport uncoupler) and 1 pM rotenone/antimycin A (complex I and complex III inhibitors, respectively) were collected. The data was analysed using XF Wave software according to manufacturer's instructions.

Results

[0077] SSOs restore normal splicing in patient cells with the c.597-1340A>G TIMMDC1 variant Two TIMMDC1 SSOs targeting the variant sequence were designed to explore the possibility of inhibiting aberrant splicing caused by the deep intronic c.597-1340A>G TIMMDC1 variant (Figure 3). Semi -quantitative RT-PCR analysis was performed (as described in Example 1) on fibroblasts transfected with the SSOs targeting the variant sequence or the negative control sequence NC5, and relative levels of TIMMDC1 transcripts determined with or without the poison exon. The results are shown in Figure 5). First, the presence of an 89bp RT-PCR product (amplified using primers P442/P443 that bind to exon 3 and exon 4; the unaltered region of the transcript) showed no aberrant splicing in the mRNA sequence 5' to the variant and that the TIMMDC1 mRNA levels were increased in SSO1- and SSO2 -treated fibroblasts compared to the NC5-treated patient fibroblasts (Figure 5; left panel). Secondly, the SSO1- and SSO2-treated affected fibroblasts (III-2 and III-6) showed complete disappearance of the 195bp PCR product (representing the transcripts with the poison exon present in NC5 treated fibroblasts; middle panel, lanes 3, 6) with concomitant appearance of the normally spliced 115bp RT-PCR product (lanes 1-2, 4-5 and untreated parent fibroblasts lanes 7-8). Thirdly, the levels of 122bp RT-PCR product, reflecting amplification of TIMMDC1 mRNA with the poison exon, were reduced in SSO1- and SSO2-treated (right panel; lanes 1-2, 4-5) compared to NC5-treated (lanes 3, 6) patient fibroblasts. Notably, the levels of reduction of TIMMDC1 mRNA with the poison exon in patient fibroblasts approached the levels present in untreated parent fibroblasts (right panel; lanes 7-8).

[0078] TIMMDC1 protein levels are restored in patient cells treated with SSOs

Having shown the restoration of normal splicing in the affected fibroblasts, experiments were conducted to determine if TIMMDC1 protein levels also recovered. It was found that TIMMDC1 protein levels were indeed recovered in SSO1- and SSO2-treated affected fibroblasts that had negligible basal levels as observed in NC5-treated fibroblasts (Figure 6A; compare lanes 1-2 with 3 and 4-5 with 6). Interestingly, TIMMDC1 protein levels also increased in the SSO1- and SSO2- but not NC5-treated heterozygous parent fibroblasts (Figure 6A; top panel, compare lanes 7-8 with 9 and 10-11 with 12). Further, a comparison was made between the levels of TIMMDC1 protein recovery in SSO1- and SSO2 -treated parent fibroblasts (heterozygous for the variant) with the homozygous normal control fibroblasts; there was a nearly two-fold increase in TIMMDC1 protein levels in SSO1- and SSO2- treated cells compared to NC5-treated parent fibroblasts (Figure7A; compare lane 1-2 with 3 and 4-5 with 6). However, no such increase was observed in SSO1- and SSO2-treated cells, compared to NC5- treated, normal control fibroblasts (Figure 6B; compare lanes 7-8 with 9).

[0079] Mitochondrial function is restored in SSOs treated patient fibroblasts

Since TIMMDC1 deficiency had been previously shown to affect the levels of other complex I proteins and consequently cause a significant reduction in mitochondrial function (see, for example, Fang H et al., Cell Rep 35:108963, 2021; and Guarani V et al., 2014 supra), and the TIMMDC1 protein had been found to be barely detectable in the patient fibroblasts, it was suspected that a substantial loss of mitochondrial function, particularly ATP production, would be observed in these fibroblasts. Further, as it had been possible to restore normal TIMMDC1 splicing and protein levels in SSO-treated patient fibroblasts, experiments were undertaken to determine if SSO treatment also restored mitochondrial function. This involved measuring oxygen consumption rate (OCR; pmol/min), ATP production and maximal respiration at baseline conditions and then after oligomycin, FCCP and rotenone/antimycin A injections in SSO1-, SSO2- or NC5-treated patient fibroblasts. The results are shown in Figure 7. It was found that patient fibroblasts showed low basal levels of OCR, ATP production and maximal respiration, and that these were significantly increased in SSO1- or SSO2-treated, but not NC5-treated, patient fibroblasts.

Discussion

[0080] It is considered that the extremely low TIMMDC1 protein level in fibroblasts homozygous for the c.597-1340A>G variant, and the observations of reduced ATP production in patient fibroblasts, indicate that TIMMDC1 protein levels in the nervous system are insufficient to sustain normal neurological function (due to reduction in mitochondrial function), resulting in the observed neurodegenerative disorder. Targeted therapies for mitochondrial disease remain unmet, but here it has been demonstrated that SSOs targeting the TIMMDC1 c.597-1340A>G variant can restore mitochondrial function in patient cells, indicating that the functional effect of the aberrant splicing can be repaired. Indeed, the near complete disappearance of poison exon TIMMDC1 transcripts and concomitant restoration of TIMMDC1 protein levels (in fact, to above parental levels) in the SSO1- and SSO2 -treated, but not in the NC5 (control)-treated fibroblasts, indicates successful suppression of aberrant splicing. Compared with the NC5 control treatment, the SSO1 and SSO2 treatments showed an almost two-fold TIMMDC1 protein increase in heterozygous parental but not in homozygous normal control fibroblasts, which is consistent with suppression of aberrant splicing of mRNAs transcribed from the TIMMDC1 variant allele. Accordingly, the use of SSOs for treating patients with the TIMMDC1 c.597-1340A>G variant, and cognate variants (ie equivalent variants in other individuals), has considerable potential.

[0081] Throughout the specification and the claims that follow, unless the context requires otherwise, the words "comprise" and "include" and variations such as "comprising" and "including" will be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers.

[0082] The reference to any prior art in this specification is not, and should not be taken as, an acknowledgement of any form of suggestion that such prior art forms part of the common general knowledge.

[0083] It will be readily appreciated by those skilled in the art that the agent and methods of the present disclosure are not restricted in their use to the particular application described. Neither is the agent or methods restricted in their preferred embodiment(s) with regard to the particular elements and/or features described or depicted herein. Further, it will be readily appreciated that the agent and methods are not limited to the embodiment(s) disclosed, but are capable of numerous rearrangements, modifications and substitutions without departing from the scope of the present disclosure.

Claims

CLAIMS:

1. An agent comprising an antisense oligonucleotide for treating a neurodegenerative disease in a subject, wherein said oligonucleotide is targeted to a c.597-1340A>G polymorphic variation in a gene encoding Translocase of Inner Mitochondrial Membrane Domain -Containing protein 1 (TIMMDC1) to correct aberrant splicing of pre-messenger RNA transcripts of said gene (ie the TIMMDC1 gene).

2. The agent of claim 1, wherein the agent comprises a splice-switching oligonucleotide (SSO) which specifically binds to all or a portion of a nucleotide sequence comprising the TIMMDC1 c.597- 1340A>G variant, as shown below:

TTTTTATTAGTTGGTGTTTGTCTGACTAGAAGA ( SEQ I D NO : 1 ) .

3. The agent of claim 2, wherein the SSO specifically binds to a portion of the nucleotide sequence of SEQ ID NO: 1 comprising at least 15 contiguous nucleotides including the c.597-1340A>G variant nucleotide.

4. The agent of claim 3, wherein the SSO is of a length in the range of 15 to 40 nucleotides.

5. The agent of claim 3, wherein the SSO is of a length in the range of 18 to 30 nucleotides.

6. The agent of any one of claims 2 to 5, wherein the SSO is a 20-mer.

7. The agent of claim 6, wherein the SSO is selected from CTAGTCAGACAAACACCAAC ( SEQ I D

NO : 4 ) and GTCAGACAAACACCAACTAA ( SEQ I D NO : 5 ) .

8. The agent of any one of claims 2 to 7, wherein the SSO includes one or more nucleotide with a 2'0-methyl (2'0Me) or 2'-O-methoxyethyl (MOE) ribose modification.

9. The agent of any one of claims 2 to 8, wherein the SSO includes one or more LNA-modified nucleotide.

10. The agent of any one of claims 2 to 9, wherein the SSO includes one or more 5 '-methylcytosine (MeC) nucleotide.

11. The agent of any one of claims 2 to 10, wherein the SSO includes one or more phosphorothioate (PS) linkage.

12. The agent of any one of claims 2 to 11, wherein the SSO includes phosphorothioate (PS) linkages throughout.

23

13. The agent of any one of claims 2 to 12, wherein the SSO is complexed with liposome.

14. A pharmaceutical composition comprising an agent according to any one of claims 1 to 13 in combination with a pharmaceutically acceptable carrier, diluent and/or excipient.

15. A composition of claim 14 suitable for administration by intracerebro ventricular (ICV) injection or intrathecal (IT) injection.

16. A method for treating or preventing a neurodegenerative disease characterised by a c.597- 1340A>G polymorphic variation in the TIMMDC1 gene in a subject, wherein the method comprises administering the agent of any one of claims 1 to 13 or the pharmaceutical composition of claim 14 or 15 to the said subject.

17. The method of claim 16, wherein the method comprises repeat administration of the agent or pharmaceutical composition.

18. The method of claim 16 or 17, wherein the agent or pharmaceutical composition is administered by ICV or IT injection every three months.

19. An agent of any one of claims 1 to 13 for use in treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene.

20. The use of the agent of any one of claim 1 to 13 in the manufacture of a pharmaceutical composition for treating or preventing a neurodegenerative disease characterised by a c.597-1340A>G polymorphic variation in the TIMMDC1 gene.