WO2023003805A1 - Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder - Google Patents
Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder Download PDFInfo
- Publication number
- WO2023003805A1 WO2023003805A1 PCT/US2022/037453 US2022037453W WO2023003805A1 WO 2023003805 A1 WO2023003805 A1 WO 2023003805A1 US 2022037453 W US2022037453 W US 2022037453W WO 2023003805 A1 WO2023003805 A1 WO 2023003805A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleotide
- nucleotides
- antisense strand
- phosphate
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03015—(S)-2-Hydroxy-acid oxidase (1.1.3.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01027—L-Lactate dehydrogenase (1.1.1.27)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y105/00—Oxidoreductases acting on the CH-NH group of donors (1.5)
- C12Y105/05—Oxidoreductases acting on the CH-NH group of donors (1.5) with a quinone or similar compound as acceptor (1.5.5)
Definitions
- Oxalate (C 2 O 4 2- ) is the salt-forming ion of oxalic acid (C 2 H 2 O 4 ) that is widely distributed in both plants and animals. It is an unavoidable component of the human diet and a ubiquitous component of plants and plant-derived foods. Oxalate can also be synthesized endogenously via the metabolic pathways that occur in the liver. Dietary and endogenous contributions to urinary oxalate excretion are equal.
- Glyoxylate is an immediate precursor to oxalate and is derived from the oxidation of glycolate by the enzyme glycolate oxidase (GO), also known, and referred to herein, as hydroxyacid oxidase (HAO1), or by catabolism of hydroxyproline, a component of collagen, by proline dehydrogenase 2 (PRODH2, also known as HYPDH).
- GO glycolate oxidase
- PRODH2 proline dehydrogenase 2
- AZA proline dehydrogenase 2
- AXT alanine-glyoxylate aminotransferase
- Excess glyoxylate is converted to oxalate by lactate dehydrogenase A (LDHA).
- LDHA lactate dehydrogenase A
- CaOx crystals contribute to the formation of diffuse renal calcifications (nephrocalcinosis) and stones (nephrolithiasis). Subjects having diffuse renal calcifications or non-obstructing stones typically have no symptoms. However, obstructing stones can cause severe pain. Moreover, over time, these CaOx crystals cause injury and progressive inflammation to the kidney and, when secondary complications such as obstruction are present, these CaOx crystals may lead to decreased renal function and in severe cases even to end-stage renal failure and the need for dialysis.
- Primary hyperoxaluria is a well-known disease associated with high levels of oxalate. Specifically, primary hyperoxaluria is characterized by impaired glyoxylate metabolism resulting in overproduction and accumulation of oxalate throughout the body, typically manifesting as kidney and bladder stones. There are three major types of primary hyperoxaluria that differ in their severity and genetic cause. Autosomal recessive mutations in the AGXT gene cause primary hyperoxaluria type 1 (PHI); autosomal recessive mutations in the GRHPR gene cause primary hyperoxaluria type 2 (PH2); and autosomal recessive mutations in the HOGA1 gene cause primary hyperoxaluria type 3 (PH3) (see, Figure 1).
- PHI primary hyperoxaluria type 1
- PH2 primary hyperoxaluria type 2
- PH3 primary hyperoxaluria type 3
- RNA interference RNA interference
- GO glycolate oxidase
- RNAi RNA interference
- CaOx crystals can form and be deposited in renal tissue or collecting system, even in the presence of normal levels of oxalate and contribute to the formation of diffuse renal calcifications (nephrocalcinosis) and stones (nephrolithiasis).
- comorbidities such as a metabolic disorder, e.g., diabetes, Crohn’s disease, or bariatric surgery
- subjects having such comorbidities may be at risk of developing, e.g., obstructing stones, progressive inflammation of the kidney, decreased renal function and end-stage renal failure.
- LDHA lactate dehydrogenase A
- PRODH2 proline dehydrogenase 2
- HAO1 hydroxyacid oxidase
- the present invention is based, at least in part, on the discovery that agents that reduce oxalate levels, such as a nucleic acid inhibitor of lactate dehydrogenase A (LDHA), a nucleic acid inhibitor of hydroxy acid oxidase (HAO1) and/or a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), can be used to treat subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder, such as a subject having normal urinary oxlate levels, e.g., normal urinary calcium oxlatae levels, or elevated urinary oxalate levels, e.g., elevated urinary calcium oxalate levels, e.g., supersaturated urinary calcium oxlalate levels, e.g., a subject having a kidney stone disease, e.g., calcium oxalate kidney stone disease, such as recurrent calcium oxalate kidney stone disease.
- the present invention provides methods for inhibiting the expression of hydroxy acid oxidase (HAO1) in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, methods for reducing urinary oxalate levels in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, and methods for treating a subject having having or at risk of developing a nonprimary hyperoxaluria disease or disorder that would benefit from reduction in oxalate, and compositions comprising nucleic acid inhibitors, e.g., double stranded ribonucleic acid (dsRNA) agents or single stranded antisense polynucleotide agents targeting lactate dehydrogenase A (LDHA), hydroxy acid oxidase (HAO1) and/or proline dehydrogenase 2 (PRODH2).
- nucleic acid inhibitors e.g., double stranded
- the present invention provides a method for inhibiting the expression of hydroxy acid oxidase (HAO1) in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, thereby inhibiting the expression of HAO1 in the subject.
- dsRNA double stranded ribonucleic acid
- the present invention provides a method for reducing urinary oxalate levels in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, thereby reducing urinary oxalate levels in the subject.
- dsRNA double stranded ribonucleic acid
- the urinary oxalate is urinary calcium oxalate.
- the reduction in urinary calcium oxalate is reduction in urinary calcium oxalate supersaturation.
- the present invention provides a method for treating a subject having a nonprimary hyperoxaluria disease or disorder that would benefit from reduction in oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, thereby treating the subject having the non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- dsRNA double stranded ribonucleic acid
- the non-primary hyperoxaluria disease or disorder is selected from the group consisting of secondary hyperolxaluria, a kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, ethylene glycol poisoning, planned kidney transplantation, and previous kidney transplantation.
- CKD chronic kidney disease
- ESRD end-stage renal disease
- coronary artery disease cutaneous oxalate deposition
- ethylene glycol poisoning planned kidney transplantation
- previous kidney transplantation previous kidney transplantation
- the non-primary hyperoxaluria disease or disorder is a kidney stone disease.
- the kidney stone disease is calcium oxalate kidney stone disease.
- the calcium oxalate kidney stone disease is recurrent calcium oxalate kidney stone disease.
- administration of the dsRNA agent, or salt thereof, to the subject reduces urinary oxalate levels.
- the urinary oxalate is urinary calcium oxalate.
- the reduction in urinary calcium oxalate is reduction in urinary calcium oxalate supersaturation.
- administration of the dsRNA agent, or salt thereof, to the subject reduces clinical and radiographic kidney stone events.
- the subject is a human.
- the dsRNA agent, or salt thereof is administered to the subject at an interval of once every six months.
- the dsRNA agent, or salt thereof is administered to the subject initially, at three months, and every six months thereafter.
- the fixed dose of the dsRNA agent, or salt thereof is about 284 mg.
- the fixed dose of the dsRNA agent, or salt thereof is about 567 mg.
- the dsRNA agent, or salt thereof is administered to the subject subcutaneously.
- the subcutaneous administration is subcutaneous injection.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region
- the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO: 21
- the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the corresponding portion of nucleotide sequence of SEQ ID NO: 22 such that the sense strand is complementary to the at least 15 contiguous nucleotides in the antisense strand.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 4-14.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence differing by no more than 3 nucleotides from the nucleotide sequence 5’- GACUUUCAUCCUGGAAAUAUA -3’ (SEQ ID NO:33) and the antisense strand comprises a nucleotide sequence differing by no more than 3 nucleotides from the nucleotide sequence 5’- UAUAUUUCCAGGAUGAAAGUCCA -3’ (SEQ ID NO:34).
- the dsRNA agent comprises at least one modified nucleotide.
- no more than five of the sense strand nucleotides and no more than five of the nucleotides of the antisense strand are unmodified nucleotides.
- substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides.
- all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
- At least one of the modified nucleotides is selected from the group a deoxy-nucleotide, a 3 ’-terminal deoxy-thymine (dT) nucleotide, a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2 ’-amino-modified nucleotide, a 2’-0-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, 2’-hydroxly-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-0-alkyl- modified
- the dsRNA agent, or salt thereof further comprises at least one phosphorothioate internucleotide linkage.
- the phosphorothioate or methylphosphonate internucleotide linkage is at the 3 '-terminus of one strand.
- the phosphorothioate or methylphosphonate internucleotide linkage is at the 5 '-terminus of one strand.
- the phosphorothioate or methylphosphonate internucleotide linkage is at the both the 5'- and 3'-terminus of one strand
- the dsRNA agent, or salt thereof comprises 6-8 phosphorothioate internucleotide linkages.
- At least one strand of the dsRNA agent, or salt thereof further comprises a ligand.
- the ligand is attached to the 3' end of the sense strand.
- the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives.
- the one or more GalNAc derivatives is attached through a monovalent, bivalent, or trivalent branched linker.
- the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
- the dsRNA agent, or salt thereof is conjugated to the ligand as shown in the following schematic
- the X is O.
- the nucleotide sequence of the sense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36), wherein Af is a 2'-fluoroadenosine-3'-phosphate; Afs is 2'-fluoroadenosine-3'- phosphorothioate; Cf is a 2'-fluorocytidine-3'-phosphate; U is a Uridine-3'-phosphate; Uf is a 2'- fluorouridine-3'-phosphate; a is a 2'-0-methyla
- the nucleotide sequence of the sense strand differs by no more than 2 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 2 nucleotides from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the nucleotide sequence of the sense strand differs by no more than 1 nucleotide from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 1 nucleotide from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the nucleotide sequence of the sense strand comprises the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the dsRNA agent, or salt thereof is conjugated to a ligand as shown in the following schematic and, wherein X is O or S.
- the present invention provides a method for inhibiting the expression of hydroxy acid oxidase (HAO1) in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, wherein the dsRNA agent, or salt thereof, comprises a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 3 nucleotides from the nucleo
- the present invention provides a method for reducing urinary oxalate levels in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, wherein the dsRNA agent, or salt thereof, comprises a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-us
- the urinary oxalate is urinary calcium oxalate.
- the reduction in urinary calcium oxalate is reduction in urinary calcium oxalate supersaturation.
- the present invention provides a method for treating a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, wherein the dsRNA agent, or salt thereof, comprises a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 3 nucleotides from the nucleotide sequence 5’-usAfsuauUfuCfCf
- the non-primary hyperoxaluria disease or disorder is selected from the group consisting of secondary hyperolxaluria, a kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, ethylene glycol poisoning, planned kidney transplantation, and previous kidney transplantation.
- CKD chronic kidney disease
- ESRD end-stage renal disease
- coronary artery disease cutaneous oxalate deposition
- ethylene glycol poisoning planned kidney transplantation
- previous kidney transplantation previous kidney transplantation
- the non-primary hyperoxaluria disease or disorder is a kidney stone disease.
- the kidney stone disease is calcium oxalate kidney stone disease.
- the calcium oxalate kidney stone disease is recurrent calcium oxalate kidney stone disease.
- administration of the dsRNA agent, or salt thereof, to the subject reduces urinary oxalate levels.
- the urinary oxalate is urinary calcium oxalate.
- the reduction in urinary calcium oxalate is reduction in urinary calcium oxalate supersaturation.
- administration of the dsRNA agent, or salt thereof, to the subject reduces clinical and radiographic kidney stone events.
- the subject is a human.
- the dsRNA agent, or salt thereof is administered to the subject at an interval of once every six months.
- the dsRNA agent, or salt thereof is administered to the subject initially, at three months, and every six months thereafter.
- the fixed dose of the dsRNA agent, or salt thereof is about 284 mg.
- the fixed dose of the dsRNA agent, or salt thereof is about 567 mg.
- the dsRNA agent, or salt thereof is administered to the subject subcutaneously.
- the subcutaneous administration is subcutaneous injection.
- the nucleotide sequence of the sense strand differs by no more than 2 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 2 nucleotides from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the nucleotide sequence of the sense strand differs by no more than 1 nucleotide from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 1 nucleotide from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the nucleotide sequence of the sense strand comprises the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the dsRNA agent, or salt thereof is conjugated to a ligand as shown in the following schematic and, wherein X is O or S.
- the X is O.
- the dsRNA agent is in salt form.
- the dsRNA agent, or salt thereof is administered to the subject in a pharmaceutical formulation.
- the method of the invention further comprise administering an additional therapeutic to the subject.
- the present invention provides a method for reducing calcium oxalate kidney stone incidence in a subject, the method comprising subcutaneously administering to the subject a fixed dose of about 284 mg or about 567 mg of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the antisense strand comprises the nucleotide sequence 5’- usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36), wherein Af is a 2'-fluoroadenosine-3'- phosphate; Afs is 2'-fluoroadenosine-3'-phosphorothio
- the subject has suffered 2 or more oxalate stone events.
- the subject has elevated urinary oxalate levels.
- the subject has suffered 2 or more oxalate stone events and has elevated urinary oxalate levels.
- the dsRNA agent, or salt thereof is administered to the subject once every six months.
- the dsRNA agent, or salt thereof is administered to the subject initially, at three months, and every six months thereafter.
- the present invention provides a method for treating a subject having a nonprimary hyperoxaluria disease or disorder that would benefit from reduction in oxalate, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of hydroxy acid oxidase (HAO1) and/or a nucleic acid inhibitor of Proline Dehydrogenase 2 (PRODH2), thereby treating the subject having the non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- HEO1 hydroxy acid oxidase
- PRODH2 Proline Dehydrogenase 2
- the non-primary hyperoxaluria disease or disorder is selected from the group consisting of a secondary hyperolxaluria, a kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, ethylene glycol poisoning, planned kidney transplantation, and previous kidney transplantation.
- CKD chronic kidney disease
- ESRD end-stage renal disease
- coronary artery disease cutaneous oxalate deposition
- ethylene glycol poisoning planned kidney transplantation
- previous kidney transplantation previous kidney transplantation
- the present invention provides a method of treating a subject at risk of developing a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of lactate dehydrogenase A (LDHA), a nucleic acid inhibitor of hydroxy acid oxidase (HAO1), and/or a nucleic acid inhibitor of Proline Dehydrogenase 2 (PRODH2), thereby treating the subject at risk of developing the non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- LDHA lactate dehydrogenase A
- HEO1 hydroxy acid oxidase
- PRODH2 Proline Dehydrogenase 2
- subject at risk of developing a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate suffers from Crohn’s disease, inflammatory bowel disease, a bariatric surgery, fibromyalgia, an autoimmune disease, coronary artery disease, a kidney stone disease, end-stage renal disease (ESRD), diabetes, obesity, HIV, or ethylene glycol poisoning.
- Crohn’s disease inflammatory bowel disease
- fibromyalgia an autoimmune disease
- coronary artery disease a kidney stone disease
- ESRD end-stage renal disease
- diabetes obesity
- HIV HIV
- ethylene glycol poisoning ethylene glycol poisoning
- the subject is a human.
- the nucleic acid inhibitor is a double stranded ribonucleic acid (dsRNA) agent that inhibits the expression of HAO1.
- dsRNA double stranded ribonucleic acid
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region
- the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO: 21
- the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the corresponding portion of nucleotide sequence of SEQ ID NO: 22 such that the sense strand is complementary to the at least 15 contiguous nucleotides in the antisense strand.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 4-14.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GACUUUCAUCCUGGAAAUAUA -3’ (SEQ ID NO:33) and the antisense strand comprises the nucleotide sequence 5’-UAUAUUUCCAGGAUGAAAGUCCA -3’ (SEQ ID NO:34).
- the nucleic acid inhibitor is a double stranded ribonucleic acid (dsRNA) agent that inhibits the expression of LDHA.
- dsRNA double stranded ribonucleic acid
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region
- the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO: 1
- the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the corresponding portion of nucleotide sequence of SEQ ID NO: 2 such that the sense strand is complementary to the at least 15 contiguous nucleotides in the antisense strand.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-3.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC -3’ (SEQ ID NO:31), and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- UCAGAUAAAAAGGACAACAUGG -3’ (SEQ ID NO: 32).
- the nucleic acid inhibitor is a double stranded ribonucleic acid (dsRNA) agent that inhibits the expression of PRODH2.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region
- the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO: 4641
- the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the corresponding portion of nucleotide sequence of SEQ ID NO: 4642 such that the sense strand is complementary to the at least 15 contiguous nucleotides in the antisense strand.
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 15-16.
- the nucleic acid inhibitor is a dual targeting double stranded ribonucleic acid (dsRNA) agent that inhibits the expression of LDHA and HAO1.
- dsRNA dual targeting double stranded ribonucleic acid
- the dual targeting dsRNA agent comprises a first double stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactic dehydrogenase A (LDHA) comprising a sense strand and an antisense strand; and a second double stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAO1) comprising a sense strand and an antisense strand, wherein the first dsRNA agent and the second dsRNA agent are covalently attached, wherein the sense strand of the first dsRNA agent comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:l, and the antisense strand of the first dsRNA agent comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleo
- the dual targeting dsRNA agent comprises a first double stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactic dehydrogenase A (LDHA) comprising a sense strand and an antisense strand; and a second double stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAO1) comprising a sense strand and an antisense strand, wherein the first dsRNA agent and the second dsRNA agent are covalently attached, wherein the antisense strand of the first dsRNA agent comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-3, and wherein the antisense strand of the second dsRNA agent comprises at least 15 contiguous nucleotides differing by no more than 3 nucleo
- the dsRNA agent comprises at least one modified nucleotide.
- no more than five of the sense strand nucleotides and no more than five of the nucleotides of the antisense strand are unmodified nucleotides.
- all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
- At least one of the modified nucleotides is selected from the group a deoxy-nucleotide, a 3 ’-terminal deoxythimidine (dT) nucleotide, a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2 ’-amino-modified nucleotide, a 2’-0-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, 2’-hydroxly-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-0-alkyl- modified nucleot
- the dsRNA agent further comprises at least one phosphorothioate internucleotide linkage.
- the dsRNA agent comprises 6-8 phosphorothioate internucleotide linkages.
- At least one strand of the dsRNA agent further comprises a ligand.
- the ligand is attached to the 3' end of the sense strand.
- the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives.
- the one or more GalNAc derivatives is attached through a monovalent, bivalent, or trivalent branched linker.
- the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
- the dsRNA agent is conjugated to the ligand as shown in the following schematic
- the X is O.
- the sense strand comprises the nucleotide sequence 5’- gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the antisense strand comprises the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36), wherein Af is a 2'-fluoroadenosine-3'-phosphate; Afs is 2'-fluoroadenosine-3'-phosphorothioate; Cf is a 2'-fluorocytidine-3'-phosphate; U is a Uridine-3'-phosphate; Uf is a 2'-fluorouridine-3'-phosphate; a is a 2'-0-methyladenosine-3'-phosphate; as is a 2'-0-methyladenosine-3'-phosphorothioate; c is a 2
- the dsRNA agent is conjugated to the ligand as shown in the following schematic
- the dsRNA agent comprises at least one modified nucleotide.
- all of the nucleotides of the dsRNA agent are modified nucleotides.
- the modified nucleotide comprises a 2'- modification.
- the 2 '-modification is a 2'-fluoro or 2'-0- methyl modification.
- one or more of the following positions are modified with a 2'-0-methyl: positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, or 31-36 of the sense strand and/or positions 1, 6, 8, 11-13,
- all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and all of the positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with a 2'-0-methyl.
- one or more of the following positions are modified with a 2'-fluoro: positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and/or positions 2-5, 7, 9, 10, 14, 16, or 18 of the antisense strand.
- all of positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and all of positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with a 2'-fluoro.
- the dsRNA agent comprises at least one modified internucleotide linkage.
- the at least one modified internucleotide linkage is a phosphorothioate linkage.
- the dsRNA agent has a phosphorothioate linkage between one or more of: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
- the dsRNA agent has a phosphorothioate linkage between each of: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
- the uridine at the first position of the antisense strand comprises a phosphate analog.
- the dsRNA comprises the following structure at position 1 of the antisense strand:
- one or more of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.
- each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.
- the -GAAA- motif comprises the structure:
- L represents a bond, click chemistry handle, or a linker of 1 to 20, inclusive, consecutive, covalently bonded atoms in length, selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; and X is a O, S, or N.
- L is an acetal linker.
- X is O.
- the -G AAA- sequence comprises the structure:
- the dsRNA comprises an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 32) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 31), wherein all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and all of positions 1, 6,
- the oligonucleotide has a phosphorothioate linkage between each of: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand;
- the dsRNA agent comprises the following structure at position 1 of the antisense strand: wherein each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety comprising the structure: In one embodiment, the dsRNA agent is present in
- the nucleic acid inhibitor is a single stranded antisense polynucleotide agent that inhibits the expression of LDHA.
- the single stranded antisense polynucleotide agent comprises at least 15 contiguous nucleotide differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-3.
- the nucleic acid inhibitor is a single stranded antisense polynucleotide agent that inhibits the expression of PRODH2.
- the single stranded antisense polynucleotide agent comprises at least 15 contiguous nucleotide differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 15-16.
- the single stranded antisense polynucleotide agent is about 8 to about 50 nucleotides in length.
- substantially all of the nucleotides of the single stranded antisense polynucleotide agent are modified nucleotides.
- all of the nucleotides of the single stranded antisense polynucleotide agent are modified nucleotides.
- the modified nucleotide comprises a modified sugar moiety selected from the group consisting of: a 2'-0-methoxyethyl modified sugar moiety, a 2'-0-alkyl modified sugar moiety, and a bicyclic sugar moiety.
- the bicyclic sugar moiety has a ( — CRH — )n group forming a bridge between the 2' oxygen and the 4' carbon atoms of the sugar ring, wherein n is 1 or 2 and wherein R is H, CH 3 or CH3OCH3.
- n 1 and R is CH3.
- the modified nucleotide is a 5-methylcytosine.
- the single stranded antisense polynucleotide agent comprises a modified internucleoside linkage.
- the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
- the single stranded antisense polynucleotide agent comprises a plurality of 2'-deoxynucleotides flanked on each side by at least one nucleotide having a modified sugar moiety.
- the single stranded antisense polynucleotide agent is a gapmer comprising a gap segment comprised of linked 2'-deoxynucleotides positioned between a 5' and a 3' wing segment.
- the modified sugar moiety is selected from the group consisting of a 2'- O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-0-alkyl modified sugar moiety, and a bicyclic sugar moiety.
- the nucleic acid inhibitor is present in a pharmaceutical formulation.
- the methods of the invention further comprise administering an additional therapeutic to the subject.
- the nucleic acid inhibitor is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg.
- the nucleic acid inihibitor is administered to the subject subcutaneously.
- the present invention also provides methods for treating a subject having chronic kidney disease (CKD).
- the methods include administering to the subject a weight-based dose of a dsRNA agent, or salt thereof, which inhibits the expression of HAO1 in a doing regimen which includes a loading phase of closely spaced administrations that may be followed by a maintenance phase, in which the the dsRNA agent, or salt thereof, is administred at longer spaced intervals.
- CKD chronic kidney disease
- the present invention provides a method for inhibiting the expression of hydroxyacid oxidase (HAO1) in a subject having chronic kidney disease (CKD), comprising administering to the subject a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1 in a dosing regimen that includes a loading phase followed by a maintenance phase, wherein the subject has a body weight of less than about 10 kilograms (kg) and the loading phase comprises administering a dose of about 6 milligram per kilogram (mg/kg) of the double stranded RNAi agent, or salt thereof, to the subject about once a month for about three months, and the maintenance phase comprises administering a dose of about 3 mg/kg of the double stranded RNAi agent, or salt thereof, to the subject about once a month; or wherein the subject has a body weight of between about 10 kg to about less than 20 kg and the loading phase comprises administering a dose of about 6 mg
- dsRNA
- the present invention provides a method for reducing urinary oxalate levels in a subject having chronic kidney disease, comprising administering to the subject a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1 in a dosing regimen that includes a loading phase followed by a maintenance phase, wherein the subject has a body weight of less than about 10 kilograms (kg) and the loading phase comprises administering a dose of about 6 milligram per kilogram (mg/kg) of the double stranded RNAi agent, or salt thereof, to the subject about once a month for about three months, and the maintenance phase comprises administering a dose of about 3 mg/kg of the double stranded RNAi agent, or salt thereof, to the subject about once a month; or wherein the subject has a body weight of between about 10 kg to about less than 20 kg and the loading phase comprises administering a dose of about 6 mg/kg of the double stranded RNAi agent,
- the present invention provides a method for treating a subject having chronic kidney disease, comprising administering to the subject a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1 in a dosing regimen that includes a loading phase followed by a maintenance phase, wherein the subject has a body weight of less than about 10 kilograms (kg) and the loading phase comprises administering a dose of about 6 milligram per kilogram (mg/kg) of the double stranded RNAi agent, or salt thereof, to the subject about once a month for about three months, and the maintenance phase comprises administering a dose of about 3 mg/kg of the double stranded RNAi agent, or salt thereof, to the subject about once a month; or wherein the subject has a body weight of between about 10 kg to about less than 20 kg and the loading phase comprises administering a dose of about 6 mg/kg of the double stranded RNAi agent, or salt thereof, to the subject about once a month;
- the subject is a human.
- the dsRNA agent, or salt thereof is administered to the subject subcutaneously.
- the subcutaneous administration is subcutaneous injection.
- the nucleotide sequence of the sense strand differs by no more than 2 nucleotides from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 2 nucleotides from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the nucleotide sequence of the sense strand differs by no more than 1 nucleotide from the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand differs by no more than 1 nucleotide from the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the nucleotide sequence of the sense strand comprises the nucleotide sequence 5’-gsascuuuCfaUfCfCfuggaaauaua-3’ (SEQ ID NO:35) and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5’-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3’ (SEQ ID NO:36).
- the dsRNA agent, or salt thereof is conjugated to a ligand as shown in the following schematic and, wherein X is O or S.
- the X is O.
- the dsRNA agent is in salt form.
- the dsRNA agent, or salt thereof is administered to the subject in a pharmaceutical formulation.
- the nmethods further comprise administering an additional therapeutic to the subject.
- Figure 1 is a schematic of the endogenous pathways for oxalate synthesis.
- the present invention is based, at least in part, on the discovery that agents that reduce oxalate levels, such as a nucleic acid inhibitor of lactate dehydrogenase A (LDHA), a nucleic acid inhibitor of hydroxy acid oxidase (HAO1) and/or a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), can be used to treat subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder, such as a subject having normal urinary oxlate levels, e.g., normal urinary calcium oxlatae levels, or elevated urinary oxalate levels, e.g., elevated urinary calcium oxalate levels, e.g., supersaturated urinary calcium oxlalate levels, e.g., a subject having a kidney stone disease, e.g., calcium oxalate kidney stone disease, such as recurrent calcium oxalate kidney stone disease.
- the present invention provides methods for inhibiting the expression of hydroxy acid oxidase (HAO1) in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, methods for reducing urinary oxalate levels in a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate, and methods for treating a subject having having or at risk of developing a nonprimary hyperoxaluria disease or disorder that would benefit from reduction in oxalate, and compositions comprising nucleic acid inhibitors, e.g., double stranded ribonucleic acid (dsRNA) agents or single stranded antisense polynucleotide agents targeting lactate dehydrogenase A (LDHA), hydroxy acid oxidase (HAO1) and/or proline dehydrogenase 2 (PRODH2).
- nucleic acid inhibitors e.g., double stranded
- compositions containing iRNAs to inhibit the expression of an HAO1gene, an LDHA gene, a PRODH2 gene, and/or both an LDHA gene and an HAO1 gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of these genes.
- an element means one element or more than one element, e.g., a plurality of elements.
- the term “at least”, “no less than” or “or more” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context.
- the number of nucleotides in a nucleic acid molecule must be an integer.
- “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property.
- nucleotide overhang As used herein, “no more than” or “or less” is understood as the value adjacent to the phrase and logical lower values or intergers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.
- the indicated sequence takes precedence.
- hyperoxaluria refers to a condition characterized by increased urinary excretion of oxalate. Generally, hyperoxaluria can be divided into two categories: primary and secondary hyperoxaluria.
- Primary hyperoxaluria refers to autosomal recessive disorders of glyoxylate metabolism.
- Primary hyperoxaluria is the result of inherited enzyme deficiencies leading to increased endogenous oxalate synthesis.
- Primary hyperoxaluria can be divided into primary hyperoxaluria Type 1 (PHI); primary hyperoxaluria Type 2 (PH2); primary hyperoxaluria Type 3 (PH3); or primary hyperoxaluria Non-Type 1, Non-Type 2, Non-Type 3 (PH-Non-Type 1, Non-Type 2, Non-Type 3).
- PHI is a hereditary disorder caused by mutations in alanine glyoxylate aminotransferase (AGT).
- PH2 is due to mutations in glyoxylate reductase/hydroxypyruvate reductase (GRHPR).
- PH3 is caused by mutations in HOGA1 (formerly DHDPSL).
- Subjects having PH-Non-Type 1, Non-Type 2, Non-Type 3 have clinical characteristics indistinguishable from type 1, 2, and 3, but with normal AGT, GRHPR, and HOGA1 liver enzyme activity, yet the etiology of the marked hyperoxaluria in such subjects remains to be elucidated.
- a deficiency in either AGT or GRHPR activities results in an excess of glyoxylate and oxalate (see, e.g., Knight et al., (2011) Am J Physiol Renal Physiol 302(6): F688-F693). Therefore, inhibition of glycolate oxidase (HAO1) and proline dehydrogenase 2 (PRODH2) will reduce the level of glyoxylate. In addition, inhibition of LDHA expression and/or activity will decrease the level of excess oxalate.
- HEO1 glycolate oxidase
- PRODH2 proline dehydrogenase 2
- LDHA expression and/or activity will decrease the level of excess oxalate.
- the buildup of oxalate in subjects having PH causes increased excretion of oxalate, which in turn results in renal and bladder stones.
- kidney damage e.g., onset in teenage years to early adulthood
- patients may get deposits of oxalate in the bones, joints and bone marrow. Severe cases may develop hematological problems such as anaemia and thrombocytopaenia.
- the deposition of oxalate in the body is sometimes called “oxalosis" to be distinguished from “oxaluria” which refers to oxalate in the urine.
- Renal failure is a serious complication requiring treatment in its own right. Dialysis can control renal failure but tends to be inadequate to dispose of excess oxalate. Renal transplant is more effective and this is the primary treatment of severe hyperoxaluria. Liver transplantation (often in addition to renal transplant) may be able to control the disease by correcting the metabolic defect. In a proportion of patients with primary hyperoxaluria type 1, pyridoxine treatment (vitamin B6) may also decrease oxalate excretion and prevent kidney stone formation.
- a non-primary hyperoxaluria disease or disorder refers to a disease, disorder or condition thereof, that is associated with oxalate metabolism, and would benefit from reduction in oxalate and/or from a decrease in the gene expression, replication, or protein activity of lactate dehydrogenase A (LDHA), hydroxy acid oxidase (HAO1) and/or proline dehydrogenase 2 (PRODH2).
- LDHA lactate dehydrogenase A
- HEO1 hydroxy acid oxidase
- PRODH2 proline dehydrogenase 2
- a non-primary hyperoxaluria disease or disorder does not include primary hyperoxaluria, e.g., primary hyperoxaluria 1 (PHI), primary hyperoxaluria 2 (PH2), or primary hyperoxaluria 3 (PH3).
- primary hyperoxaluria e.g., primary hyperoxaluria 1 (PHI), primary hyperoxaluria 2 (PH2), or primary hyperoxaluria 3 (PH3).
- Subjects having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate include subjects having an elevated level of oxalate, e.g., a mild hyperoxaluria condition, i.e., a urinary calcium oxalate excretion level of about 40 to about 60 mg/day, or a high hyperoxaluria condition, i.e., a urinary calcium oxalate excretion level of greater than about 60 mg/day.
- a mild hyperoxaluria condition i.e., a urinary calcium oxalate excretion level of about 40 to about 60 mg/day
- a high hyperoxaluria condition i.e., a urinary calcium oxalate excretion level of greater than about 60 mg/day.
- subjects having a high hyperoxaluria condition have a supersaturation level of calcium oxalate, e.g., calcium oxalate (i.e., the concentration in urine is above the solubility of oxalate that drives crystallization and kidney stone formation).
- subjects having a high hyperoxaluria condition do not have a supersaturation level of calcium oxalate, e.g., calcium oxalate.
- subjects at risk of develoiong a non-primary hyperoxaluria disease or disorder are subjects having a normal level of urinary oxalate excretion, i.e., a urinary oxalate excretion level of ⁇ 40mg/day and would still benefit from a reduction in oxalate.
- Such subjects include those who suffer from a secondary hyperolxaluria, e.g., enteric hyperoxaluria, dietary hyperoxaluria, or idiopathic hyperoxaluria, a kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, or ethylene glycol poisoning.
- CKD chronic kidney disease
- ESRD end-stage renal disease
- coronary artery disease e.g., a chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, or ethylene glycol poisoning.
- Such subjects also include those who are planning to undergo kidney trasnplanation or have undergone kidney transplantation.
- the subject suffers from a kidney stone disease, e.g., a calcium oxalate kidney stone disease, e.g., recurrent calcium oxalate kidney stone disease.
- the methods of the invention reduce the level of urinary oxalate, e.g., urinary calcium oxalate, by about >20% from baseline as assessed in a 24-hour urinary oxalate analysis.
- urinary oxalate e.g., urinary calcium oxalate
- the methods of the invention reduce the level of urinary oxalate, e.g., urinary calcium oxalate, supersaturation from baseline as assessed in a 24-hour urinary oxalate analysis.
- urinary oxalate e.g., urinary calcium oxalate
- kidney stone disease refers to a disease in which kidney stones (also called renal stones or urinary stones) form in one or both kidneys of the subject. Kidney stones are small, hard deposits which are made up of minerals or other compounds found in urine. Kidney stones vary in size, shape, and color. To be cleared from the body (or "passed"), the stones need to travel through ducts that carry urine from the kidneys to the bladder (ureters) and be excreted.
- kidney stones Depending on their size, kidney stones generally take days to weeks to pass out of the body. There are four main types of kidney stones which are classified by the material they are made of. Up to 75 percent of all kidney stones are composed primarily of calcium. Stones can also be made up of uric acid (a normal waste product), cystine (a protein building block), or struvite (a phosphate mineral). Stones form when there is more of the compound in the urine than can be dissolved. This imbalance can occur when there is an increased amount of the material in the urine, a reduced amount of liquid urine, or a combination of both. People are most likely to develop kidney stones between ages 40 and 60, though the stones can appear at any age. Research shows that 35 to 50 percent of people who have one kidney stone will develop additional stones, usually within 10 years of the first stone.
- the kidney stone disease is a calcium oxalate kidney stone disease. In another embodiment, the kidney stone disease is a non-calcium oxalate kidney stone disease.
- the kidney stone disease (either calcium oxalate kidney stone disease or non-calcium oxalate kidney stone disease) is non-recurrent kidney stone disease. In other embodiments, the kidney stone disease (either calcium oxalate kidney stone disease or non-calcium oxalate kidney stone disease) is recurrent kidney stone disease.
- kidney stone disease refers to kidney stone disease newly diagnosed in a subject, i.e., the subject was not previously diagnosed as having had kidney stone disease.
- recurrent kidney stone disease refers to kidney stone disease that returns in a subject that previously had kidney stone disease and was successfully treated for the disease (e.g., surgically treated to remove the kidney stone) or passed a kidney stone.
- Recurrent kidney stone disease may return at any time interval following treatment of the subject for kidney stone disease.
- recurrent kidney stone disease is >2 stone events within a 5 year period.
- CKD Chiney kidney disease
- CRF chronic renal failure
- KDOQI Kidney Disease Outcomes Quality Initiative
- GFR glomerular filtration rate
- the different stages of CKD form a continuum.
- the stages of CKD are classified as: Stage 1: Kidney damage with normal or increased GFR (>90 mL/min/1.73 m 2 ); Stage 2: Mild reduction in GFR (60-89 mL/min/1.73 m 2 ); Stage 3a: Moderate reduction in GFR (45-59 mL/min/1.73 m 2 ); Stage 3b: Moderate reduction in GFR (30-44 mL/min/1.73 m 2 ); Stage 4: Severe reduction in GFR (15-29 mL/min/1.73 m 2 ); Stage 5: Kidney failure (GFR ⁇ 15 mL/min/1.73 m 2 or dialysis).
- End-stage renal disease is the last stage of chronic kidney disease. Patients with end-stage renal disease will need dialysis or a kidney transplant in order to survive. In most cases, kidney failure is caused by other health problems, e.g., diabetes, or high blood pressure, that have done permanent damage to the kidneys over time.
- “Secondary hyperoxaluria” results from over absorption of oxalate from the diet and is further characterized either as enteric, resulting from a chronic and unremediable underlying GI disorder associated with malabsorption, such as bariatric surgery complications or Crohn’s disease, which predisposes patients to excess oxalate absorption, or idiopathic, meaning the underlying cause is unknown.
- Enteric hyperoxaluria is the more severe type of secondary hyperoxaluria. Secondary hyperoxaluria may also result from conditions underlying increased intestinal oxalate absorption, such as alterations in intestinal oxalate-degrading microorganisms, and genetic variations of intestinal oxalate transporters.
- hyperoxaluria may also occur following renal transplantation because of rapid clearance of accumulated oxalate.
- a non-primary hyperoxaluria disease or disorder is enteric hyperoxaluria.
- Enteric hyperoxaluria is the formation of calcium oxalate calculi in the urinary tract due to excessive absorption of oxalate from the colon, occurring as a result of intestinal bacterial overgrowth syndromes, fat malabsorption, chronic biliary or pancreatic disease, various intestinal surgical procedures, gastric bypass surgery, inflammatory bowel disease, or any medical condition that causes chronic diarrhea, e.g., Crohn’s disease or ulcerative colitis).
- a non-primary hyperoxaluria disease or disorder is dietary hyperoxaluria, e.g., hyperoxaluria as a result of too much oxalate in the diet, e.g., from too much spinach, rhubarb, almonds, bulgur, millet, corn grits, soy flour, cornmeal, navy beans, etc.
- a non-primary hyperoxaluria disease or disorder is idiopathic hyperoxaluria.
- Subjects having idiopathic hyperoxaluria have above normal levels of urinary oxalate of unknown cause, but still develop stones.
- a non-primary hyperoxaluria disease or disorder is a calcium oxalate tissue deposition disease.
- GFR glomerular filtration rate
- renal capacity to excrete calcium oxalate is significantly impaired.
- calcium oxalate starts to deposit in extrarenal tissues.
- Calcium oxalate deposits may occur in the thyroid, breasts, kidneys, bones, bone marrow, myocardium, or cardiac conduction system. This leads to cardiomyopathy, heart block and other cardiac conduction defects, vascular diseases, retinopathy, synovitis, oxalate osteopathy and anemia that is noted to be resistant to treatment.
- the deposition of calcium oxalate mat be systemic or tissue specific.
- Subjects having arthritis, sarcoidosis, end-stage renal disease are at risk of developing systemic calcium oxalate tissue deposition disease.
- Subjects at risk of developing tissue specific depositions in the kidney include subjects having medullary sponge kidney, nephrocalcinosis, renal tubular acidosis (RTA), and transplant recipients, e.g., kidney transplant receipients.
- subjects at risk of developing tissue specific depositions include subjects having coronary artery disease or other vascular diseases, especially in patients with end- stage renal disease, HIV and other conditions where oxalate deposition occurs in plaques or in the vasculature.
- a non-primary hyperoxaluria disease or disorder is cutaneous oxalate deposition.
- Oxalate deposition in the skin can contribute to livedo reticularis, ulceration, and distal ischemia.
- patients with primary hyperoxalria wherein oxalosis rarely occurs in the skin
- patients with systemic oxalosis of chronic renal failure are more likely to present with extravascular calcified deposits of the skin, including dermal and subcutaneous nodules, tender subungual nodules, and skin-colored to yellow macules and papules usually in an acral distribution or on the face.
- the non-primary hyperoxaluria disease or disorder is cutaneous oxalate deposition in the setting of dialysis.
- a non-primary hyperoxaluria disease or disorder is ethylene glycol poisoning.
- Ethylene glycol is an important cause of metabolic acidosis and subsequent acute renal failure, and the toxicity results from the depressant effects of ethylene glycol on the central nervous system.
- metabolic acidosis and renal failure are caused by the conversion of ethylene glycol to noxious metabolites. Oxidative reactions convert ethylene glycol to glycoaldehyde, and then to glycolic acid, which is the major cause of metabolic acidosis. Both of these steps promote the production of lactate from pyruvate.
- the conversion of glycolic acid to glyoxylic acid proceeds slowly, further increasing the serum concentration of glycolic acid.
- Glyoxylic acid is eventually converted to oxalic acid and glycine. Oxalic acid does not contribute to the metabolic acidosis, but it is deposited as calcium oxalate crystals in many tissues.
- a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose).
- a subject is a human subject
- treating refers to a beneficial or desired result, such as inhibiting oxalate accumulation and/or lowering urinary excretion levels of oxalate in a subject.
- treating also include, but are not limited to, alleviation or amelioration of one or more symptoms of a non-primary hyperoxaluria disease or disorder, such as, e.g., slowing the course of the disease; reducing the severity of later-developing disease; and/or preventing further oxalate tissue deposition.
- Treatment can also mean prolonging survival as compared to expected survival in the absence of treatment.
- the term “lower” in the context of a disease marker or symptom refers to a statistically significant decrease in such level.
- the decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more and is a decrease to a level accepted as within the range of normal for an individual without such disorder.
- prevention when used in reference to a disease refers to a reduction in the likelihood that a subject will develop a symptom associated with such disease, disorder, or condition, e.g., oxalate accumulation or stone formation.
- the likelihood of, e.g., oxalate accumulation or stone formation is reduced, for example, when an individual having one or more risk factors for stone formation either fails to develop stones or develops stones with less severity relative to a population having the same risk factors and not receiving treatment as described herein.
- the failure to develop a disease or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.
- “Therapeutically effective amount,” as used herein, is intended to include the amount of an inhibitor that, when administered to a subject having a non-primary hyperoxaluria disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease).
- the “therapeutically effective amount” may vary depending on the inhibitor, how the inhibitor is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.
- “Prophylactically effective amount,” as used herein, is intended to include the amount of an inhibitor that, when administered to a subject having a non-primary hyperoxaluria disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease.
- the “prophylactically effective amount” may vary depending on the inhibitor, how the inhibitor is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
- a "therapeutically-effective amount” or “prophylacticaly effective amount” also includes an amount of an inhibitor that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
- Inhibitors employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
- the therapeutically effective amount of the first dsRNA agent may be the same or different than the therapeutically effective amount of the second dsRNA agent.
- the prophylacticly effective amountof the first dsRNA agent may be the same or different than the prophylacticaly effective amount of the second dsRNA agent.
- the therapeutically effective amount of the first single stranded antisense polynucleotide agent may be the same or different than the therapeutically effective amount of the second single stranded antisense polynucleotide agent.
- the prophylacticly effective amountof the first single stranded antisense polynucleotide agent may be the same or different than the prophylacticaly effective amount of the second single stranded antisense polynucleotide agent.
- nucleic acid inhibitor includes iRNA agents and antisense polynucleotide agents.
- RNAi agent refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway.
- RISC RNA-induced silencing complex
- RNA interference is a process that directs the sequence-specific degradation of mRNA. RNAi modulates, e.g., inhibits, the expression of LDHA, PRODH2 and/or HAO1 in a cell, e.g., a cell within a subject, such as a subject suffering from a non-primary hyperoxaluria disease or disorder.
- an RNAi agent of the disclosure includes a single stranded RNAi that interacts with a target RNA sequence, e.g., an LDHA, PRODH2, and/or HAO1 target mRNA sequence, to direct the cleavage of the target RNA.
- a target RNA sequence e.g., an LDHA, PRODH2, and/or HAO1 target mRNA sequence
- siRNAs double-stranded short interfering RNAs
- Dicer Type III endonuclease known as Dicer
- Dicer a ribonuclease-III-like enzyme, processes these dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al, (2001) Cell 107:309).
- RISC RNA-induced silencing complex
- the disclosure relates to a single stranded RNA (ssRNA) (the antisense strand of a siRNA duplex) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., an LDHA, PRODH2 and/or HAO1 gene.
- siRNA single stranded RNA
- the RNAi agent may be a single-stranded RNA that is introduced into a cell or organism to inhibit a target mRNA.
- Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA.
- the single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAs are described in U.S. Patent No. 8,101,348 and in Lima et al, (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al, (2012) Cell 150:883-894.
- RNAi agent for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”.
- dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., an LDHA, PRODH2 and/or HAO1 gene.
- a double stranded RNA triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
- an “iRNA” for use in the compositions and methods of the invention is a “dual targeting RNAi agent.”
- the term “dual targeting RNAi agent” refers to a molecule comprising a first dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a first target RNA, i.e., an LDHA gene, covalently attached to a molecule comprising a second dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a second target RNA, i.e., an HAO1 gene.
- a dual targeting RNAi agent triggers the degradation of the first and the second target RNAs, e.g., mRNAs, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
- polynucleotide agent refers to an agent comprising a single-stranded oligonucleotide that contains RNA as that term is defined herein, and which targets nucleic acid molecules encoding LDHA, PRODH2 and/or HAO1 (e.g., mRNA encoding LDHA, PRODH2 and/or HAO1).
- the antisense polynucleotide agents specifically bind to the target nucleic acid molecules via hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) and interfere with the normal function of the targeted nucleic acid (e.g., by an antisense mechanism of action).
- hydrogen bonding e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding
- antisense inhibition This interference with or modulation of the function of a target nucleic acid by the polynucleotide agents of the present invention is referred to as “antisense inhibition.”
- the functions of the target nucleic acid molecule to be interfered with may include functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an LDHA gene, a PRODH2 gene, or an HAO1 gene, including mRNA that is a product of RNA processing of a primary transcription product.
- the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an LDHA gene. In another embodment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a PRODH2 gene.
- the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an HAO1 gene.
- the target sequence of an LDHA gene, a PRODH2 gene or an HAO1 gene may be from about 19-36 nucleotides in length, e.g., about 19-30 nucleotides in length.
- the target sequence can be about 19-30 nucleotides, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19- 22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length.
- the target sequence is 19-23 nucleotides in length, optionally 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
- the length of the LDHA target sequence may be the same as the HAO1 target sequence or different.
- a target sequence may be from about 4-50 nucleotides in length, e.g., 8-45, 10-45, 10-40, 10- 35, 10-30, 10-20, 11-45, 11-40, 11-35, 11-30, 11-20, 12-45, 12-40, 12-35, 12-30, 12-25, 12-20, 13-45, 13-40, 13-35, 13-30, 13-25, 13-20, 14-45, 14-40, 14-35, 14-30, 14-25, 14-20, 15-45, 15-40, 15-35, 15- 30, 15-25, 15-20, 16-45, 16-40, 16-35, 16-30, 16-25, 16-20, 17-45, 17-40, 17-35, 17-30, 17-25, 17-20, 18-45, 18-40, 18-35, 18-30, 18-25, 18-20, 19-45, 19-40, 19-35, 19-30, 19-25, 19-20, e.g., 4, 5, 6, 7, 8,
- complementary refers to the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
- a nucleic acid inhibitor that is “substantially complementary to at least part of’ a messenger RNA refers to a nucleic acid inhibitor that is substantially complementary to a contiguous portion of the mRNA of interest (e.g ., an mRNA encoding LDHA, an mRNA encoding PRODH2, and/or an mRNA encoding HAO1).
- mRNA messenger RNA
- a polynucleotide is complementary to at least a part of an HAO1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding HAO1.
- region of complementarity refers to the region of the nucleic acid inhibito that is substantially complementary to a sequence, for example a target sequence, e.g., an LDHA nucleotide sequence, a PRODH2 nucleotide sequence and/or an HAO1 nucleotide sequence, as defined herein.
- a target sequence e.g., an LDHA nucleotide sequence, a PRODH2 nucleotide sequence and/or an HAO1 nucleotide sequence, as defined herein.
- the mismatches can be in the internal or terminal regions of the molecule.
- the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and/or 3’ -terminus of the polynucleotide.
- first nucleotide sequence refers to the ability of a polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the second nucleotide sequence, as will be understood by the skilled person.
- conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al.
- Complementary sequences include those nucleotide sequences of a nucleic acid inhibitor of the invention that base -pair to a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 2 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of target gene expression.
- “Complementary” sequences can also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled.
- Such non- Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogsteen base pairing.
- strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
- G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively.
- deoxyribonucleotide can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1).
- nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil.
- nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of the agents featured in the invention by a nucleotide containing, for example, inosine.
- adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.
- nucleoside is a base-sugar combination.
- the “nucleobase” (also known as “base”) portion of the nucleoside is normally a heterocyclic base moiety.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
- Polynucleotides also referred to as “oligonucleotides,” are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide.
- the phosphate groups are commonly referred to as forming the internucleoside linkages of the polynucleotide.
- nucleic acid inhibitors In general, the majority of nucleotides of the nucleic acid inhibitors are ribonucleotides, but as described in detail herein, the inhibitors may also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide.
- a “nucleic acid inhibitor” may include nucleotides (e.g., ribonucleotides or deoxyribonucleotides) with chemical modifications; a nucleic acid inhibitor may include substantial modifications at multiple nucleotides.
- modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or modified nucleobase.
- modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases.
- the modifications suitable for use in the nucleic acid inhibitors of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in nucleotides, are encompassed by “nucleic acid inhibitor” for the purposes of this specification and claims.
- LDHA (used interchangeable herein with the term “Ldha”), also known as Cell Proliferation-Inducing Gene 19 Protein, Renal Carcinoma Antigen NY -REN-59, LDH Muscle Subunit, EC 1.1.1.27461, LDH-A, LDH-M, Epididymis Secretory Sperm Binding Protein Li 133P,
- L -Lactate Dehydrogenase A Chain, Proliferation-Inducing Gene 19, Lactate Dehydrogenase M, HEL- S-133P, EC 1.1.1, GSD11, PIG19, and LDHM refers to the well known gene encoding a lactate dehydrogenase A from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise.
- the term also refers to fragments and variants of native LDHA that maintain at least one in vivo or in vitro activity of a native LDHA.
- the term encompasses full-length unprocessed precursor forms of LDHA as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing.
- GenBank Accession No. GI: 207028493 (NM_001135239.1; SEQ ID NO:l)
- GenBank Accession No. GI: 260099722 (NM_001165414.1; SEQ ID NOG)
- GenBank Accession No. GI: 260099724 (NM_001165415.1; SEQ ID NOG)
- GenBank Accession No. GI: 260099726 (NM_001165416.1;
- GenBank Accession No. GI: 207028465 (NM_005566.3; SEQ ID NO:9)
- sequence of a mouse LDHA mRNA transcript can be found at, for example, GenBank Accession No. GI: 257743038 (NM_001136069.2; SEQ ID NO: 11), GenBank Accession No. GI: 257743036(NM_010699.2; SEQ ID NO: 13);
- sequence of a rat LDHA mRNA transcript can be found at, for example, GenBank Accession No.
- GI: 8393705 (NM_017025.1; SEQ ID NO:15); and the sequence of a monkey LDHA mRNA transcript can be found at, for example, GenBank Accession No. GI: 402766306 (NM_001257735.2; SEQ ID NO: 17), GenBank Accession No. GI: 545687102 (NM_001283551.1; SEQ ID NO: 19).
- LDHA mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM.
- LDHA refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the LDHA gene, such as a single nucleotide polymorphism in the LDHA gene. Numerous SNPs within the LDHA gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp).
- HA01 refers to the well known gene encoding the enzyme hydroxyacid oxidase 1 from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise.
- Other gene names include GO, GOX, GOX1, HAO, and HAOX1.
- the protein is also known as glycolate oxidase and (S) -2 -hydroxy-acid oxidase.
- the term also refers to fragments and variants of native HAO1 that maintain at least one in vivo or in vitro activity of a native HAO1.
- the term encompasses full-length unprocessed precursor forms of HAO1 as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing.
- the sequence of a human HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI: 11184232 (NM_017545.2; SEQ ID NO:21); the sequence of a monkey HAO1 mRNA transcript can be found at, for example, GenBank Accession No.
- GI:544464345 (XM_005568381.1; SEQ I DNO:23); the sequence of a mouse HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI:133893166 (NM_010403.2; SEQ ID NO:25); and the sequence of a rat HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI: 166157785 (NM_001107780.2; SEQ ID NO:27).
- HA01 also refers to naturally occurring DNA sequence variations of the HAO1 gene, such as a single nucleotide polymorphism (SNP) in the HAO1 gene.
- SNP single nucleotide polymorphism
- Exemplary SNPs may be found in the NCBI dbSNP Short Genetic Variations database available at www.ncbi.nIm.nih.gov/proleets/SNP ⁇
- proline dehydrogenase 2 used interchangeably with the term “PRODH2,” refers to the enzyme which catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through food intake and collagen turnover.
- Glyoxylate is one of the downstream products of hydroxyproline catabolism, which in people with disorders of glyoxalate metabolism can lead to an increase in oxalate levels and the formation of calcium-oxalate kidney stones.
- PRODH2 is also known as proline dehydrogenase, HYPDH, HSPOX1, and hydroxyproline dehydrogenase.
- the sequence of a human PRODH2 mRNA transcript can be found at, for example, GenBank Accession No. GI: 1818882103 (NM_021232.2; SEQ ID NO:4641; reverse complement, SEQ ID NO: 4642).
- the sequence of mouse PRODH2 mRNA can be found at, for example, GenBank Accession No. GI: 142372879 (NM_019546.5; SEQ ID NO:4643; reverse complement, SEQ ID NO: 4644).
- the sequence of rat PRODH2 mRNA can be found at, for example, GenBank Accession No. GI: 198278487 (NM_001038588.1; SEQ ID NO:4645; reverse complement, SEQ ID NO: 4646).
- the sequence of Macaca fascicularis PRODH2 mRNA can be found at, for example, GenBank Accession No. GI: 982316449 (XM_005588902.2; SEQ ID NO: 4647; reverse complement, SEQ ID NO: 4648).
- the sequence of Macaca mulatta PRODH2 mRNA can be found at, for example, GenBank Accession No. GI: 1622893613 (XM_015123711.2; SEQ ID NO: 4649; reverse complement, SEQ ID NO: 4650). Additional examples of PRODH2 mRNA sequences are readily available through publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.
- the present invention provides a method for inhibiting the expression of hydroxyacid oxidase (HAO1) in a subject, e.g., a human subject, having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate.
- the present invention also provides a method for reducing urinary oxalate levels, e.g., urinary oxalate is urinary calcium oxalate, e.g., urinary calcium oxalate supersaturation in a subject, e.g., a human subject, having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in urinary oxalate.
- the present invention provides a method for treating a subject, e.g., a human subject, having a nonprimary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- the methods include administering, e.g., subcutaneously administering, e.g., subcutaneous injection, to the subject a fixed dose of about 200 mg to about 600 mg, e.g., about 284 mg or about 567 mg, of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, which inhibits the expression of of HAO1, thereby inhibiting the expression of HAO1 in the subject.
- dsRNA double stranded ribonucleic acid
- the present invention also provides a method for treating a subject having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- the method includes administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of hydroxyacid oxidase (HAO1) and/or a nucleic acid inhibitor of Proline Dehydrogenase 2 (PRODH2), thereby treating the subject having the non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- HEO1 hydroxyacid oxidase
- PRODH2 Proline Dehydrogenase 2
- the present invention also provides a method of treating a subject at risk of developing a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- the method includes administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of lactate dehydrogenase A (LDHA), a nucleic acid inhibitor of hydroxyacid oxidase (HAO1), and/or a nucleic acid inhibitor of Proline Dehydrogenase 2 (PRODH2), thereby treating the subject at risk of developing the non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate.
- LDHA lactate dehydrogenase A
- HEO1 hydroxyacid oxidase
- PRODH2 Proline Dehydrogenase 2
- Subjects having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate include subjects having an elevated level of oxalate, e.g., a mild hyperoxaluria condition, i.e., a urinary calcium oxalate excretion level of about 40 to about 60 mg/day, or a high hyperoxaluria condition, i.e., a urinary calcium oxalate excretion level of greater than about 60 mg/day.
- a mild hyperoxaluria condition i.e., a urinary calcium oxalate excretion level of about 40 to about 60 mg/day
- a high hyperoxaluria condition i.e., a urinary calcium oxalate excretion level of greater than about 60 mg/day.
- subjects having a high hyperoxaluria condition have a supersaturation level of calcium oxalate, e.g., calcium oxalate (i.e., the concentration in urine is above the solubility of oxalate that drives crystallization and kidney stone formation).
- subjects having a high hyperoxaluria condition do not have a supersaturation level of calcium oxalate, e.g., calcium oxalate.
- subjects at risk of develoiong a non-primary hyperoxaluria disease or disorder are subjects having a normal level of urinary oxalate excretion, i.e., a urinary oxalate excretion level of ⁇ 40mg/day and would still benefit from a reduction in oxalate.
- Such subjects include those who suffer from a secondary hyperolxaluria, e.g., enteric hyperoxaluria, dietary hyperoxaluria, or idiopathic hyperoxaluria, a kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, or ethylene glycol poisoning.
- a secondary hyperolxaluria e.g., enteric hyperoxaluria, dietary hyperoxaluria, or idiopathic hyperoxaluria
- kidney stone disease chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, or ethylene glycol poisoning.
- CKD chronic kidney disease
- ESRD end-stage renal disease
- coronary artery disease cutaneous oxalate deposition
- ethylene glycol poisoning e.g., ethylene glycol poisoning.
- suubjects having a non-primary hyperoxaluria disease or disorder that would benefit from reduction in oxalate do not have primary hyperoxaluria (PH), i.e., PHI, PH2, or PH3.
- PH primary hyperoxaluria
- the non-primary hyperoxaluria disease or disorder is a kidney stone disease, e.g., calcium oxalate kidney stone disease, e.g., recurrent calcium oxalate kidney stone disease.
- Administration of the dsRNA agent, or salt thereof, is to a subject may be repeated on a regular basis, for example, at an interval of once every three months, or once every six monthes.
- the dsRNA agent, or salt thereof is administered to the subject at an interval of once every six months.
- the dsRNA agent, or salt thereof is administered to the subject initially, at three months, and every six months thereafter.
- Administration of the dsRNA, or salt thereof, to the subject may, e.g., reduce urinary oxalate levels, e.g., urinary calcium oxalate, urinary calcium oxalate supersaturation, e.g., by about >20% from baseline as assessed in a 24-hour urinary oxalate analysis, and/or reduce clinical and radiographic kidney stone events.
- urinary oxalate levels e.g., urinary calcium oxalate, urinary calcium oxalate supersaturation, e.g., by about >20% from baseline as assessed in a 24-hour urinary oxalate analysis, and/or reduce clinical and radiographic kidney stone events.
- the nucleic acid inhibitor can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
- intracranial e.g., intraventricular, intraparenchymal and intrathecal
- intravenous intramuscular
- subcutaneous e.g., transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
- the compositions are administered by intravenous infusion or injection.
- the compositions are administered by subcutaneous injection.
- the administration is via a depot injection.
- a depot injection may release the nucleic acid inhibitor in a consistent way over a prolonged time period.
- a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of LDHA or HAO1 or PRODH2, or a desired inhibition of both LDHA and HAO1, or a therapeutic or prophylactic effect.
- a depot injection may also provide more consistent serum concentrations.
- Depot injections may include subcutaneous injections or intramuscular injections. In certain embodiments, the depot injection is a subcutaneous injection.
- the administration is via a pump.
- the pump may be an external pump or a surgically implanted pump.
- the pump is a subcutaneously implanted osmotic pump.
- the pump is an infusion pump.
- An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions.
- the infusion pump is a subcutaneous infusion pump.
- the pump is a surgically implanted pump that delivers the nucleic acid inhibitor to the liver.
- a nucleic acid inhibitor of the invention may be present in a pharmaceutical composition, such as in a suitable buffer solution.
- the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
- the buffer solution is phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- a nucleic acid inhibitor of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
- the mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated.
- the route and site of administration may be chosen to enhance targeting.
- the methods (and uses) of the invention include administering to the subject, e.g., a human, a therapeutically effective amount of a nucleic acid inhibitor, e.g.., a dsRNA agent, a dual targeting iRNA agent, a single stranded antisense polynucleotide agent, or a pharmaceutical composition comprising a nucleic acid inhibitor, e.g.., a dsRNA, a pharmaceutical composition comprising a dual targeting RNAi agent, a pharmaceutical composition of the invention comprising a first dsRNA agent that inhibits expression of LDHA and a second dsRNA agent that inhibits expression of HAO1, or a pharmaceutical composition of the invention comprising a single stranded antisense polynucleotide agent.
- a nucleic acid inhibitor e.g.., a dsRNA agent, a dual targeting iRNA agent, a single stranded antisense polynucleotide agent.
- Subjects that would benefit from the methods of the invention include subjects having or at risk of developing a non-primary hyperoxaluria disease.
- the first and second nucleic acid inhibitor may be formulated in the same composition or different compositions and may administered to the subject in the same composition or in separate compositions.
- the nucleic acid inhibitor may be administered to the subject at a dose of about 0.1 mg/kg to about 50 mg/kg.
- a suitable dose will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, such as about 0.3 mg/kg and about 3.0 mg/kg.
- the first and second nucleic acid inhibitor may be administered to a subject at the same dose or different doses.
- the nucleic acid inhibitor can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis.
- a nucleic acid inhibitor can reduce LDHA levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
- administration of the nucleic acid inhibitor can reduce LDHA levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.
- a nucleic acid inhibitor can reduce HAO1 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
- administration of the nucleic acid inhibitor can reduce HAO1 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.
- nucleic acid inhibitor can reduce PRODH2 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
- administration of the nucleic acid inhibitor can reduce PRODH2 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.
- a first nucleic acid inhibitor e.g., a dsRNA agent targeting LDHA
- a second nucleic acid inhibitor e.g., a dsRNA agent targeting HAO1
- the level of inhibition of LDHA may be the same or different that the level of inhibition of HAO1.
- the dual targeting RNAi agent may inhibit expression of the LDHA gene and the HAO1 gene to a level substantially the same as the level of inhibition of expression obtained by the contacting of a cell with both dsRNA agents individually, or the dual targeting RNAi agent may inhibit expression of the LDHA gene and the HAO1 gene to a level higher than the level of inhibition of expression obtained by the contacting of a cell with both dsRNA agents individually.
- patients Before administration of a full dose of the nucleic acid inhibitor, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction.
- a smaller dose such as a 5% infusion reaction
- adverse effects such as an allergic reaction.
- the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.
- cytokine e.g., TNF-alpha or INF-alpha
- the nucleic acid inhibitor can be administered subcutaneously, i.e., by subcutaneous injection.
- One or more injections may be used to deliver the desired dose of nucleic acid inhibitor to a subject.
- the injections may be repeated over a period of time.
- the administration may be repeated on a regular basis.
- after an initial treatment regimen the treatments can be administered on a less frequent basis.
- a repeat-dose diagramine may include administration of a therapeutic amount of nucleic acid inhibitor on a regular basis, such as every other day, on a monthly basis, or once a year.
- thenucleic acid inhibitor is administered about once per month to about once per quarter (i.e., about once every three months).
- the method includes administering a composition featured herein such that expression of the target LDHA gene, the target PRODH2 gene and/or the target HAO1 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or abour 36 hours.
- expression of the target LDHA gene, the target PRODH2 gene and/or the HAO1 gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer.
- the nucleic acid inhibitors useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target LDHA, PRODH2 and/or HAO1 genes.
- Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein.
- nucleic acid inhibitors may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a kidney stone disease.
- reduction in this context is meant a statistically significant decrease in such level.
- the reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
- Efficacy of treatment or prevention of kidney stone disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
- a nucleic acid inhibitor or pharmaceutical composition thereof "effective against” indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating a kidney stone disease and the related causes.
- a treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated.
- a favorable change of at least 10% in a measurable parameter of disease and such as, at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment.
- Efficacy for a given nucleic acid inhibitor or formulation of that nucleic acid inhibitor can also be judged using an experimental animal model for the given disease as known in the art, such as alanine-glyoxylate amino trasferase deficient (Agxt knockout) mice (see, e.g., Salido, et al.
- the invention further provides methods for the use of a nucleic acid inhibitor or a pharmaceutical composition of the invention, e.g., for treating a subject having or at risk of developing a non-primary hyperoxaluria disease that would benefit from reduction in oxalate, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders.
- a nucleic acid inhibitor or pharmaceutical composition of the invention is administered in combination with, e.g., pyridoxine, an ACE inhibitor (angiotensin converting enzyme inhibitors), e.g., benazepril (Lotensin); an angiotensin II receptor antagonist (ARB) (e.g., losartan potassium, such as Merck & Co.
- ACE inhibitor angiotensin converting enzyme inhibitors
- ARB an angiotensin II receptor antagonist
- losartan potassium such as Merck & Co.
- Cozaar® e.g., Candesartan (Atacand); an HMG-CoA reductase inhibitor (e.g., a statin); dietary oxalate degrading compounds, e.g., Oxalate decarboxylase (Oxazyme); calcium binding agents, e.g., Sodium cellulose phosphate (Calcibind); diuretics, e.g., thiazide diuretics, such as hydrochlorothiazide (Microzide); phosphate binders, e.g., Sevelamer (Renagel); magnesium and Vitamin B6 supplements; potassium citrate; orthophosphates, bisphosphonates; oral phosphate and citrate solutions; high fluid intake, urinary tract endoscopy; extracorporeal shock wave lithotripsy; kidney dialysis; kidney stone removal (e.g., surgery); and kidney/liver transplant; or a combination of any of the foregoing.
- Double Stranded Ribonucleic Acid Agents of the Invention A. Double Stranded Ribonucleic Acid Agents of the Invention
- a nucleic acid inhibitor for use in the methods of the invention is a dsRNA agent.
- the dsRNA agent targets an LDHA gene.
- the dsRNA agent targets a PRODH2 gene.
- the dsRNA agent targets an HAO1 gene.
- the dsRNA agent is a dual targeting dsRNA agent targeting an LDHA gene and an HAO1 gene.
- Suitable dsRNA agents for use in the methods of the invention are known in the art and described in, for example, U.S. Patent Publication No. 20200113927 (Alnylam Pharmaceuticals, Inc.); U.S. Patent Publication Nos. 2017/0304446 (Lumasiran) (Alnylam Pharmaceuticals, Inc.), 2017/0306332 (Dicerna Pharmaceuticals), and 2019/0323014 (Dicerna Pharmaceuticals); U.S. Patent Nos. 10,478,500 (Lumasiran) (Alnylam Pharmaceuticals, Inc.) and 10,351,854 (Dicerna Pharmaceuticals); and PCT Publication Nos.
- WO 2019/014530 (Attorney Docket No.: 121301-07520) and WO 2019/075419 (Dicerna Pharmaceuticals), the entire contents of each of which are incorporated herein by reference. Any of these agents may further comprise a ligand.
- a suitable dsRNA agent is nedosiran (formerly referred to as DCR-PHXC) (Dicerna Pharmaceuticals) .
- a nucleic acid inhibitor of the present invention is a dsRNA agent which inhibits the expression of an LDHA gene and is selected from the group of agents listed in any one of Tables 2-3.
- a nucleic acid inhibitor of the present invention is a dsRNA agent which inhibits the expression of an HAO1 gene and is selected from the group of agents listed in any one of Tables 4-12.
- a nucleic acid inhibitor of the present invention is a dsRNA agent which inhibits the expression of a PRODH2 gene and is selected from the group of agents listed in any one of Tables 15-16.
- nucleic acid inhibitor of the present invention is an dual targeting iRNA agent that inhibits the expression of an LDHA gene and an HAO1 gene, wherein the first dsRNA inhibits expression of an LDHA gene and is selected from the group of agents listed in any one of Tables 2-3, and the first dsRNA inhibits expression of an HAO1 gene and is selected from the group of agents listed in any one of Tables 4-12.
- the dsRNAs of the invention targeting LDHA may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15- 27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at
- the dsRNAs of the invention targeting HAO1 may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15- 27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at
- the dsRNAs of the invention targeting PRODH2 may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15- 27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at
- the agent targeting LDHA may include an antisense strand comprising a region of complementarity to LDHA which is the same length or a different length from the region of complementarity of the antisense strand of the agent targeting HAOL
- one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of an LDHA gene.
- such dsRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
- one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of an HAO1 gene.
- such dsRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
- the duplex lengths of the first agent and the second agent may be the same or different.
- the use of these dsRNA agents described herein enables the targeted degradation of mRNAs of an LDHA gene, a PRODH2 gene and/or an HAO1 gene in mammals.
- the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an LDHA gene or an HAO1 gene or a PRODH2 gene.
- the region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length).
- the iRNA Upon contact with a cell expressing the target gene, the iRNA inhibits the expression of the target gene (e.g., a human, a primate, a non-primate, or a bird target gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flowcytometric techniques.
- the target gene e.g., a human, a primate, a non-primate, or a bird target gene
- a dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used.
- One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence.
- the target sequence can be derived from the sequence of an mRNA formed during the expression of an LDHA gene or an HAO1 gene or a PRODH2 gene.
- the other strand includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
- the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
- the duplex structure is between 15 and 30 base pairs in length, e.g., between, 15- 29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19- 25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
- the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18- 20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21- 23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
- the dsRNA is between about 15 and about 23 nucleotides in length, or between about 25 and about 30 nucleotides in length.
- the dsRNA is long enough to serve as a substrate for the Dicer enzyme.
- dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer.
- the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule.
- a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).
- duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36,
- an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA.
- a miRNA is a dsRNA.
- a dsRNA is not a naturally occurring miRNA.
- an iRNA agent useful to target LDHA or HAO1 or PRODH2 expression or LDHA and HAO1 expression is not generated in the target cell by cleavage of a larger dsRNA.
- a dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts.
- a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
- the overhang(s) can be on the sense strand, the antisense strand or any combination thereof.
- the nucleotide(s) of an overhang can be present on the 5'-end, 3'- end or both ends of either an antisense or sense strand of a dsRNA.
- a dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.
- a dsRNA of the invention may be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.
- a dsRNA of the invention targets an LDHA gene and includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence.
- the sense strand sequence is selected from the group of sequences provided in any one of Tables 2-3 and the corresponding nucleotide sequence of the antisense strand is selected from the group of sequences of any one of Tables 2-3.
- one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of an LDHA gene.
- a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 2-3 and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 2-3.
- the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides.
- the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
- a dsRNA of the invention targets an HAO1 gene and includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence.
- the sense strand sequence is selected from the group of sequences provided in any one of Tables 4-14 and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of any one of Tables 4-14.
- one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of an HAO1 gene.
- a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 4-14 and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 4-14.
- the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides.
- the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
- a dsRNA of the invention targets a PRODH2 gene and includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence.
- the sense strand sequence is selected from the group of sequences provided in any one of Tables 15-16 and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of any one of Tables 15-16.
- one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a PRODH2 gene.
- a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 15-16 and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 15-16.
- the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides.
- the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
- RNA of the dsRNA of the invention e.g., a dsRNA of the invention
- a dsRNA of the invention may comprise any one of the sequences set forth in any one of Table 2-16 that is un-modified, un-conjugated, and/or modified and/or conjugated differently than described therein.
- dsRNAs having a duplex structure of between about 20 and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888).
- RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714- 1719; Kim et al. (2005) Nat Biotech 23:222-226).
- dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides.
- dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of an LDHA gene or an HAO1 gene or a PRODH2 gene by not more than about 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present invention.
- RNAs described in any one of Tables 2-3 identify a site(s) in an LDHA transcript that is susceptible to RISC-mediated cleavage
- the RNAs described in any one of Tables 4- 14 identify a site(s) in an HAO1 transcript that is susceptible to RISC-mediated cleavage
- those RNAs described in any one of Tables 15-16 identify a site(s) in a PRODH2 transcript that is susceptible to RISC-mediated cleavage.
- the present invention further features iRNAs that target within this site(s).
- an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site.
- Such an iRNA will generally include at least about 15 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the gene.
- target sequence is generally about 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA.
- Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences.
- the sequence “window” By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected.
- This process coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression.
- the sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
- optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.
- modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.
- a dsRNA agent as described herein can contain one or more mismatches to the target sequence.
- an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5’- or 3 ’-end of the region of complementarity.
- the strand which is complementary to a region of an LDHA gene or an HAO1 gene or a PRODH2 gene generally does not contain any mismatch within the central 13 nucleotides.
- the methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an LDHA gene, a PRODH2 gene and/or an HAO1 gene.
- a PRODH2 gene and/or an HAO1 gene is important, especially if the particular region of complementarity in an LDHA gene, a PRODH2 gene and/or HAO1 gene is known to have polymorphic sequence variation within the population.
- the dual targeting RNAi agents of the invention which include two dsRNA agents, are covalently attached via, e.g., a covalent linker.
- Covalent linkers are well known in the art and include, e.g., nucleic acid linkers, peptide linkers, carbohydrate linkers, and the like.
- the covalent linker can include RNA and/or DNA and/or a peptide.
- the linker can be single stranded, double stranded, partially single strands, or partially double stranded. Modified nucleotides or a mixture of nucleotides can also be present in a nucleic acid linker.
- Suitable linkers for use in the dual targeting agent of the invention include those described in U.S. Patent No, 9,187,746, the entire contents of which are incorporated herein by reference.
- the linker includes a disulfide bond.
- the linker can be cleavable or non- cleavable.
- the linker can be a polyRNA, such as poly(5'-adenyl-3'-phosphate-AAAAAAAA) or poly(5'- cytidyl-3'-phosphate-5'-uridyl-3'-phosphate — CUCUCUCU)), e.g., Xn single stranded poly RNA linker wherein n is an integer from 2-50 inclusive, such as, 4-15 inclusive, or 7-8 inclusive. Modified nucleotides or a mixture of nucleotides can also be present in said polyRNA linker.
- a polyRNA such as poly(5'-adenyl-3'-phosphate-AAAAAAAA) or poly(5'- cytidyl-3'-phosphate-5'-uridyl-3'-phosphate — CUCUCUCU)
- Xn single stranded poly RNA linker wherein n is an integer from 2-50 inclusive, such as, 4-15 inclusive, or 7-8 inclusive.
- the covalent linker can be a polyDNA, such as poly(5'-2'deoxythymidyl-3'-phosphate-TTTTTT), e.g., wherein n is an integer from 2-50 inclusive, such as 4-15 inclusive, or 7-8 inclusive. Modified nucleotides or a mixture of nucleotides can also be present in said polyDNA linker, a single stranded polyDNA linker wherein n is an integer from 2-50 inclusive, such as 4-15 inclusive, or 7-8 inclusive. Modified nucleotides or a mixture of nucleotides can also be present in said polyDNA linker.
- the linker can include a disulfide bond, optionally a bis-hexyl-disulfide linker.
- the disulfide linker is
- the linker can include a peptide bond, e.g., include amino acids.
- the covalent linker is a 1-10 amino acid long linker, such as, comprising 4-5 amino acids, optionally X- Gly-Phe-Gly-Y wherein X and Y represent any amino acid.
- the linker can include HEG, a hexaethylenglycol linker.
- the covalent linker can attach the sense strand of the first dsRNA agent to the sense strand of the second dsRNA agent; the antisense strand of the first dsRNA agent to the antisense strand of the second dsRNA agent; the sense strand of the first dsRNA agent to the antisense strand of the second dsRNA agent; or the antisense strand of the first dsRNA agent to the sense strand of the second dsRNA agent.
- the covalent linker further comprises at least one ligand, described below. i ' . Modified dsRNA Agent of the Invention
- the nucleic acid, e.g., RNA, of a nucleic acid inhibitor of the invention is un-modified, and does not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein.
- the nucleic acid, e.g., RNA, of a nucleic acid inhibitor of the invention is chemically modified to enhance stability or other beneficial characteristics.
- substantially all of the nucleotides of a nucleic acid inhibitor of the invention are modified.
- all of the nucleotides of a nucleic acid inhibitor of the invention are modified.
- Nucleic acid inhibitors of the invention in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
- a first nucleic acid inhibitor e.g., dsRNA agent targeting LDHA
- a second nucleic acid inhibitor e.g., dsRNA agent targeting HAO1
- substantially all of the nucleotides of the first agent and substantially all of the nucleotides of the second agent may be independently modified; all of the nucleotides of the first agent may be modified and all of the nucleotides of the second agent may be independently modified; substantially all of the nucleotides of the first agent and all of the nucleotides of the second agent may be independently modified; or all of the nucleotides of the first agent may be modified and substantially all of the nucleotides of the second agent may be independently modified.
- nucleic acid inhibitors comprise no more than 10 nucleotides comprising 2’-fluoro modifications (e.g., no more than 92 ' -fluoro modifications, no more than 8 2'- fluoro modifications, no more than 72 ' -fluoro modifications, no more than 62 ' -fluoro modifications, no more than 5 2 ' -fluoro modifications, no more than 42 ' -fluoro modifications, no more than 5 2'- fluoro modifications, no more than 42 ' -fluoro modifications, no more than 3 2 ' -fluoro modifications, or no more than 22 ' -fluoro modifications).
- 2’-fluoro modifications e.g., no more than 92 ' -fluoro modifications, no more than 8 2'- fluoro modifications, no more than 72 ' -fluoro modifications, no more than 62 ' -fluoro modifications, no more than 5 2 ' -fluoro modifications, no more than 42 ' -
- the sense strand comprises no more than 4 nucleotides comprising 2 ' -fluoro modifications (e.g., no more than 3 2'- fluoro modifications, or no more than 22 ' -fluoro modifications).
- the antisense strand comprises no more than 6 nucleotides comprising 2 ' -fluoro modifications (e.g., no more than 5 2 ' -fluoro modifications, no more than 42 ' -fluoro modifications, no more than 42 ' -fluoro modifications, or no more than 22 ' 'fluoro modifications).
- a first nucleic acid inhibitor e.g., dsRNA agent targeting LDHA
- a second nucleic acid inhibitor e.g., dsRNA agent targeting HAO1
- substantially all of the nucleotides of the first agent and/or substantially all of the nucleotides of the second agent may be independently modified and the first and second agents may independently comprise no more than 10 nucleotides comprising 2’-fluoro modifications.
- nucleic acid inhibitors comprise no more than 10 nucleotides comprising 2’-fluoro modifications (e.g., no more than 92 / -fluoro modifications, no more than 8 2'- fluoro modifications, no more than 72 ' -fluoro modifications, no more than 62 / -fluoro modifications, no more than 5 2 ' -fluoro modifications, no more than 42 / -fluoro modifications, no more than 5 2'- fluoro modifications, no more than 42 ' -fluoro modifications, no more than 3 2 / -fluoro modifications, or no more than 22 ' -fluoro modifications).
- 2’-fluoro modifications e.g., no more than 92 / -fluoro modifications, no more than 8 2'- fluoro modifications, no more than 72 ' -fluoro modifications, no more than 62 / -fluoro modifications, no more than 5 2 ' -fluoro modifications, no more than 42 / -
- a first nucleic acid inhibitor e.g., dsRNA agent targeting LDHA
- a second nucleic acid inhibitor e.g., dsRNA agent targeting HAO1
- all of the nucleotides of the first agent and/or all of the nucleotides of the second agent may be independently modified and the first and second agents may independently comprise no more than 10 nucleotides comprising 2’-fluoro modifications.
- a nucleic acid inhibitor of the invention further comprises a 5 ’-phosphate or a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand.
- the double stranded RNAi agent further comprises a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand.
- the 5 ’-phosphate mimic is a 5 ’-vinyl phosphonate (5’- VP).
- the first agent may further comprise a 5 ’-phosphate or a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand;
- the second agent may further comprise a 5’- phosphate or a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand; or the first agent and the second agent may further independently comprise a 5 ’-phosphate or a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand.
- nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference.
- Modifications include, for example, end modifications, e.g., 5’ -end modifications (phosphorylation, conjugation, inverted linkages) or 3 ’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.) ⁇ , base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’ -position or 4’- position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages.
- end modifications e.g., 5’ -end modifications (phosphorylation, conjugation, inverted linkages) or 3 ’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.)
- base modifications e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal
- nucleic acid inhibitor compounds useful in the embodiments described herein include, but are not limited to nucleic acid inhibitors containing modified backbones or no natural internucleoside linkages.
- Nucleic acid inhibitors having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
- modified nucleic acid inhibitors that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
- a modified nucleic acid inhibitor will have a phosphorus atom in its internucleoside backbone.
- Modified nucleic acid inhibitor backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
- Various salts, mixed salts and free acid forms are also included.
- Modified nucleic acid inhibitor backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
- alkene containing backbones sulfamate backbones
- sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
- U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
- RNA mimetics are contemplated for use in nucleic acid inhibitors, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound.
- a peptide nucleic acid PNA
- PNA peptide nucleic acid
- the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
- nucleic acid inhibitors e.g., RNAs, with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular — CH2-NH— CH2-, — CH2— N(CH3)— O— CH2-[known as a methylene (methylimino) or MMI backbone], -CH 2 -0-N(CH 3 )-CH 2 -, -CH2-N(CH 3 )-N(CH 3 )-CH2- and -N(CH 3 )-CH 2 -CH 2 - of the above- referenced U.S. Patent No.
- RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Patent No. 5,034,506.
- the native phosphodiester backbone can be represented as 0-P(0)(0H)-0CH2-.
- Modified nucleic acid inhibitors can also contain one or more substituted sugar moieties.
- the nucleic acid inhibitors e.g., dsRNAs, featured herein can include one of the following at the 2'- position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C 1 to C 10 alkyl or C 1 to C 10 alkenyl and alkynyl.
- Exemplary suitable modifications include 0[(CH 2 ) n O] m CH3, 0(CH 2 ). n 0CH 3 , 0(CH 2 ) n NH 2 , 0(CH 2 ) n CH 3 , 0(CH 2 ) n 0NH 2 , and 0(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
- dsRNAs include one of the following at the 2' position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of a nucleic acid inhibitor, and other substituents having similar properties.
- the modification includes a 2'-methoxyethoxy (2'-0— CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group.
- Another exemplary modification is 2'- dimethylaminooxy ethoxy, i.e., a 0(CH 2 ) 2 0N(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0— CH2— O— CH2— N(CH3)2-
- Further exemplary modifications include : 5’-Me-2’-F nucleotides, 5’-Me-2’-OMe nucleotides, 5’-Me-2’- deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N- methylacetamide) .
- modifications include 2'-methoxy (2'-OCH 3 ), 2'-aminopropoxy (2'-OCH 2 CH 2 CH 2 NH 2 ) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of a nucleic acid inhibitor, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. Nucleic acid inhibitors can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to,
- nucleotides having modified or substituted sugar moieties for use in the nucleic acid inhibitors of the invention include nucleotides comprising a bicyclic sugar.
- a “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms.
- A“bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.
- a nucleic acid inhibitor may include one or more locked nucleic acids.
- a “locked nucleic acid” (“LNA”) is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons.
- an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4’-CH 2 -0-2’ bridge.
- This structure effectively "locks" the ribose in the 3’-endo structural conformation.
- the addition of locked nucleic acids to polynucleotide agents has been shown to increase polynucleotide agent stability in serum, and to reduce off-target effects (Elmen, J. et al. , (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
- the nucleic acid inhibitors of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
- 4' to 2' bridged bicyclic nucleosides include but are not limited to 4'-(CH2)— 0-2' (LNA); 4'-(CH2)— S-2'; 4'-(CH2)2— 0-2' (ENA); 4'- CH(CH3) — 0-2' (also referred to as “constrained ethyl” or “cEt”) and 4'-CH(CH20CH3) — 0-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3) — 0-2' (and analogs thereof; see e.g., US Patent No.
- bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example ⁇ -L-ribofuranose and b-D-ribofuranose (see WO 99/14226).
- a nucleic acid inhibitor can include one or more constrained ethyl nucleotides.
- a "constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4’-CH(CH 3 )-0-2’ bridge.
- a constrained ethyl nucleotide is in an S conformation and is referred to as an “S- constrained ethyl nucleotide” or “S-cEt.”
- Modified nucleotides included in the nucleic acid inhibitors of the invention can also contain one or more sugar mimetics.
- the nucleic acid inhibitor may include a “modified tetrahydropyran nucleotide” or “modified THP nucleotide.”
- a “modified tetrahydropyran nucleotide” has a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleotides (a sugar surrogate).
- Modified THP nucleotides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see, e.g., Leumann, Bioorg. Med.
- sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
- nucleotides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al, Biochemistry, 2002, 41, 4503-4510; and U.S. Patent Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506).
- Morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
- Such sugar surrogates are referred to herein as “modified morpholinos.”
- a nucleic acid inhibitor comprises one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides.
- Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem.
- a nucleic acid inhibitor of the invention can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-
- nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
- nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention.
- These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
- a nucleic acid inhibitor of the invention can also be modified to include one or more locked nucleic acids (LNA).
- LNA locked nucleic acids
- a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation.
- the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al, (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al, (2003) Nucleic Acids Research 31(12):3185-3193).
- a nucleic acid inhibitor of the invention can also be modified to include one or more bicyclic sugar moities.
- a “bicyclic sugar” is a furanosyl ring modified by a aring formed by the bridging of two carbons, whether adjacent or non-adjacent.
- A“bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a ring formed by bridgeing two carbon, whether adjacent or non- adjacent, of the sugar ring, thereby forming a bicyclic ring system.
- the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring, optionally, via the 2’ -acyclic oxygen atom.
- an agent of the invention may include one or more locked nucleic acids (LNA).
- LNA locked nucleic acids
- a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons.
- an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4’-CH2-0-2’ bridge. This structure effectively "locks" the ribose in the 3’-endo structural conformation.
- the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J.
- bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
- the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
- a locked nucleoside can be represented by the structure (omitting stereochemistry), wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2’- carbon to the 4’ -carbon of the ribose ring.
- 4' to 2' bridged bicyclic nucleosides include but are not limited to 4'-(CH2)— 0-2' (LNA); 4'-(CH2)— S-2'; 4'-(CH2)2— 0-2' (ENA); 4'- CH(CH3) — 0-2' (also referred to as “constrained ethyl” or “cEt”) and 4'-CH(CH20CH3) — 0-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3) — 0-2' (and analogs thereof; see e.g., US Patent No.
- bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and b-D-ribofuranose (see WO 99/14226).
- a nucleic acid inhibitor of the invention can also be modified to include one or more constrained ethyl nucleotides.
- a "constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2' bridge (i.e., L in the preceding structure).
- a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”
- a nucleic acid inhibitor of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”).
- CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to rnRNA.
- the linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
- a nucleic acid inhibitor of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides.
- UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar” residue.
- UNA also encompasses monomer with bonds between CP-C4’ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the CP and C4’ carbons).
- the C2’- C3’ bond i.e. the covalent carbon-carbon bond between the C2’ and C3’ carbons
- nucleic acid inhibitors can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2’-0-deoxythymidine (ether), N- (aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.
- nucleic acid inhibitor of the invention examples include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’-terminal phosphate or phosphate mimic on the antisense strand of an a nucleic acid inhibitor.
- Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.
- nucleic acid inhibitors of the invention may be optionally conjugated with a ligand, such as a GalNAc derivative ligand, as described below.
- a ligand such as a GalNAc derivative ligand
- a nucleic acid inhibitor that contains conjugations of one or more carbohydrate moieties to a nucleic acid inhibitor can optimize one or more properties of the inhibitor.
- the carbohydrate moiety will be attached to a modified subunit of the nucleic acid inhibitor.
- the ribose sugar of one or more ribonucleotide subunits of an inhibitor can be replaced with another moiety, e.g., a non-carbohydrate (such as, cyclic) carrier to which is attached a carbohydrate ligand.
- a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS).
- a cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur.
- the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
- the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
- the ligand may be attached to thenucleic acid inhibitor via a carrier.
- the carriers include (i) at least one “backbone attachment point,” such as, two “backbone attachment points” and (ii) at least one “tethering attachment point.”
- a “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid.
- a “tethering attachment point” in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety.
- the moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide.
- the selected moiety is connected by an intervening tether to the cyclic carrier.
- the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
- a functional group e.g., an amino group
- another chemical entity e.g., a ligand to the constituent ring.
- the nucleic acid inhibitors may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; in some embodiments, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; in some embodiments, the acyclic group is selected from serinol backbone or diethanolamine backbone.
- the double stranded RNAi agents of the invention include agents with chemical modifications as disclosed, for example, in WO 2013/075035, filed on November 16, 2012, the entire contents of which are incorporated herein by reference.
- the first agent may comprise any one or more of the motifs described below
- the second agent may comprise any one or more of the motifs described below
- both the first agent and the second agent may independently comprise any one or more of the motifs described below.
- the invention provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., an LDHA gene, an HAO1 gene, a PRODH2 gene, or both an LDHA gene and an HAO1 gene) in vivo.
- a target gene i.e., an LDHA gene, an HAO1 gene, a PRODH2 gene, or both an LDHA gene and an HAO1 gene
- the RNAi agent comprises a sense strand and an antisense strand.
- Each strand of the RNAi agent may range from 12-30 nucleotides in length.
- each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
- RNAi agent a duplex double stranded RNA
- the duplex region of an RNAi agent may be 12-30 nucleotide pairs in length.
- the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
- the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
- the RNAi agent may contain one or more overhang regions and/or capping groups at the 3 ’-end, 5 ’-end, or both ends of one or both strands.
- the overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
- the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
- the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
- the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
- the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2 ’-sugar modified, such as, 2-F, 2’-Omethyl, thymidine (T), 2' -O-mcthoxycthyl -5 -methyl uridine (Teo), 2 -0- methoxyethyladenosine (Aeo), 2' -O-mcthoxycthyl -5- methy ley tidine (m5Ceo), and any combinations thereof.
- TT can be an overhang sequence for either end on either strand.
- the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
- the 5’ - or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated.
- the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
- the overhang is present at the 3 ’-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3 ’-overhang is present in the antisense strand. In one embodiment, this 3 ’-overhang is present in the sense strand.
- the RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
- the single-stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand.
- the RNAi may also have a blunt end, located at the 5 ’-end of the antisense strand (or the 3 ’-end of the sense strand) or vice versa.
- the antisense strand of the RNAi has a nucleotide overhang at the 3 ’-end, and the 5 ’-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5 ’-end of the antisense strand and 3 ’-end overhang of the antisense strand favor the guide strand loading into RISC process.
- the RNAi agent is a double blunt-ended of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5’end.
- the antisense strand contains at least one motif of three 2’-0-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5’end.
- the RNAi agent is a double blunt-ended of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5’end.
- the antisense strand contains at least one motif of three 2’-0-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5’end.
- the RNAi agent is a double blunt-ended of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5’end.
- the antisense strand contains at least one motif of three 2 ’-O-methyl modifications on three consecutive nucleotides at positions 11,
- the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5’end; the antisense strand contains at least one motif of three 2 ’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.
- the 2 nucleotide overhang is at the 3 ’-end of the antisense strand.
- the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5 ’-end of the sense strand and at the 5 ’-end of the antisense strand.
- every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides.
- each residue is independently modified with a 2’ -O-methyl or 2’-fluoro, e.g., in an alternating motif.
- the RNAi agent further comprises a ligand (such as GalNAcs).
- the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10- 30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10
- the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-0-methyl modifications on three consecutive nucleotides at position 11, 12, and 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent results in an siRNA comprising the 3’
- the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
- the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.
- the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’-end.
- the motifs of three identical modifications may occur at the 9, 10, and 11 positions; 10, 11, and 12 positions; 11, 12, and 13 positions; 12, 13, and 14 positions; or 13, 14, and 15 positions of the antisense strand, the count starting from the first nucleotide from the 5 ’-end of the antisense strand, or, the count starting from the first paired nucleotide within the duplex region from the 5’- end of the antisense strand.
- the cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5 ’-end.
- the sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand.
- the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand.
- at least two nucleotides may overlap, or all three nucleotides may overlap.
- the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides.
- the first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification.
- the term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides.
- each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
- the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand.
- This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.
- the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3 ’-end, 5 ’-end or both ends of the strand.
- the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3 ’-end, 5 ’-end or both ends of the strand.
- the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
- the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications
- the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.
- every nucleotide in the sense strand and antisense strand of the RNAi agent may be modified.
- Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
- nucleic acids are polymers of subunits
- many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety.
- the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not.
- a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand.
- a modification may occur in a double strand region, a single strand region, or in both.
- a modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA.
- a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini.
- the 5’ end or ends can be phosphorylated.
- nucleotides or nucleotide surrogates may be included in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both.
- all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein.
- Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, , 2’-deoxy-2’-fluoro (2’-F) or 2’-0-methyl modified instead of the ribosugar of the nucleobase , and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.
- each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2’-methoxyethyl, 2’- O-methyl, 2’-0-allyl, 2’- C- allyl, 2’-deoxy, 2 ’-hydroxyl, or 2’-fluoro.
- the strands can contain more than one modification.
- each residue of the sense strand and antisense strand is independently modified with 2’- O-methyl or 2’-fluoro.
- At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2’- O-methyl or 2’-fluoro modifications, or others.
- the N a and/or N b comprise modifications of an alternating pattern.
- alternating motif refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand.
- the alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern.
- A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “AB AB AB AB AB AB AB ... ,” “AABBAABBAABB ... ,” “AABAABAABAAB “AAABAAABAAAB...,” “AAABBB AAABBB ... ,” or “ABC ABC ABC ABC...,” etc.
- the type of modifications contained in the alternating motif may be the same or different.
- the alternating pattern i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB...”, “ACACAC...” “BDBDBD...” or “CDCDCD...,” etc.
- the RNAi agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted.
- the shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa.
- the sense strand when paired with the antisense strand in the dsRNA duplex the alternating motif in the sense strand may start with “ABABAB” from 5 ’-3’ of the strand and the alternating motif in the antisense strand may start with “BAB ABA” from 5’-3’of the strand within the duplex region.
- the alternating motif in the sense strand may start with “AABBAABB” from 5 ’-3’ of the strand and the alternating motif in the antisenese strand may start with “BBAABBAA” from 5 ’-3’ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.
- the RNAi agent comprises the pattern of the alternating motif of 2'-0-methyl modification and 2’-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'-0-methyl modification and 2’-F modification on the antisense strand initially, i.e., the 2'-0-methyl modified nucleotide on the sense strand base pairs with a 2'-F modified nucleotide on the antisense strand and vice versa.
- the 1 position of the sense strand may start with the 2'-F modification
- the 1 position of the antisense strand may start with the 2'- O-methyl modification.
- the introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand interrupts the initial modification pattern present in the sense strand and/or antisense strand.
- This interruption of the modification pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense strand surprisingly enhances the gene silencing acitivty to the target gene.
- the modification of the nucleotide next to the motif is a different modification than the modification of the motif.
- the portion of the sequence containing the motif is “...N a YYYN b ...,” where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and “N a ” and “N t ,” represent a modification to the nucleotide next to the motif “ggg” that is different than the modification of Y, and where N a and N b can be the same or different modifications.
- N a and/or N b may be present or absent when there is a wing modification present.
- the RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage.
- the phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands in any position of the strand.
- the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern.
- alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.
- a double-standed RNAi agent comprises 6-8phosphorothioate internucleotide linkages.
- the antisense strand comprises two phosphorothioate internucleotide linkages at the 5 ’-terminus and two phosphorothioate internucleotide linkages at the 3 ’-terminus, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5 ’-terminus or the 3 ’-terminus.
- the RNAi comprises a phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region.
- the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.
- Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region.
- the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
- terminal three nucleotides may be at the 3 ’-end of the antisense strand, the 3 ’-end of the sense strand, the 5 ’-end of the antisense strand, and/or the 5 ’end of the antisense strand.
- the 2 nucleotide overhang is at the 3 ’-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide.
- the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5 ’-end of the sense strand and at the 5 ’-end of the antisense strand.
- the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof.
- the mistmatch may occur in the overhang region or the duplex region.
- the base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
- A:U is preferred over G:C
- G:U is preferred over G:C
- Mismatches e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
- the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’ - end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5 ’-end of the duplex.
- the nucleotide at the 1 position within the duplex region from the 5 ’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT.
- at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
- the first base pair within the duplex region from the 5’ - end of the antisense strand is an AU base pair.
- nucleotide at the 3 ’-end of the sense strand is deoxythimidine (dT).
- nucleotide at the 3 ’-end of the antisense strand is deoxythimidine (dT).
- the sense strand sequence may be represented by formula (I):
- n p -N a -(X X X )i-N b -Y Y Y -N b -(Z Z Z ) j N a -n q 3’ (I) wherein: i and j are each independently 0 or 1 ; p and q are each independently 0-6; each N a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n p and n q independently represent an overhang nucleotide; wherein Nb and Y do not have the same modification; and
- XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides.
- YYY is all 2’-F modified nucleotides.
- the N a and/or N b comprise modifications of alternating pattern.
- the YYY motif occurs at or near the cleavage site of the sense strand.
- the YYY motif can occur at or the vicinity of the cleavage site (e.g. : can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11,12 or 11, 12, 13) of - the sense strand, the count starting from the 1 st nucleotide, from the 5 ’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’ - end.
- i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1.
- the sense strand can therefore be represented by the following formulas:
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each N b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- N b is 0, 1, 2, 3, 4, 5 or 6.
- Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- Each of X, Y and Z may be the same or different from each other.
- each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- the antisense strand sequence of the RNAi may be represented by formula (II):
- n q .-N a '-(Z’Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X')i-N' a -n p ' 3’ (II) wherein: k and 1 are each independently 0 or 1 ; p’ and q’ are each independently 0-6; each N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n p ' and n q ' independently represent an overhang nucleotide; wherein N b ’ and Y’ do not have the same modification; and
- X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
- the N a ’ and/or N b ’ comprise modifications of alternating pattern.
- the Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand.
- the Y'Y'Y' motif can occur at positions 9, 10, 11 ; 10, 11, 12; 11, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count starting from the 1 st nucleotide, from the 5 ’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’ - end.
- the Y'Y'Y' motif occurs at positions 11, 12, 13.
- Y'Y'Y' motif is all 2’-OMe modified nucleotides.
- k is 1 and 1 is 0, or k is 0 and 1 is 1 , or both k and 1 are 1.
- the antisense strand can therefore be represented by the following formulas:
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each N b ’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- N b is 0, 1, 2, 3, 4, 5 or 6.
- k is 0 and 1 is 0 and the antisense strand may be represented by the formula:
- each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- Each of X', Y' and Z' may be the same or different from each other.
- Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2’-methoxyethyl, 2’-0-methyl, 2’-0-allyl, 2’-C- allyl, 2’-hydroxyl, or 2’-fluoro.
- each nucleotide of the sense strand and antisense strand is independently modified with 2’-0-methyl or 2’-fluoro.
- Each X, Y, Z, X', Y' and Z' in particular, may represent a 2’-0-methyl modification or a 2’-fluoro modification.
- the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1 st nucleotide from the 5 ’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’- end; and Y represents 2’-F modification.
- the sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’-OMe modification or 2’-F modification.
- the antisense strand may contain U ⁇ ' motif occurring at positions 11 , 12, 13 of the strand, the count starting from the 1st nucleotide from the 5’ end, or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5’- end; and Y' represents 2’-0- methyl modification.
- the antisense strand may additionally contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region; and X'X'X' and Z'Z'Z' each independently represents a 2’-OMe modification or 2’-F modification.
- the sense strand represented by any one of the above formulas (la), (lb), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (Ila), (lib), (He), and (lid), respectively.
- the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III): sense: 5’ np -Na-(X X X)i -Nb- Y Y Y -Nb -(Z Z Z)j-Na-nq 3’ antisense: 3’ np’-Na’-(X’X'X')k-Nb’ -U ⁇ '-Nb’ -(Z'Z'Z')l-Na’-nq’ 5’
- each Na and Na’ independently represents an oligonucleotide sequence comprising 0- 25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb and Nb’ independently represents an oligonucleotide sequence comprising 0- 10 modified nucleotides; wherein each np’, np, nq’, and nq, each of which may or may not be present, independently represents an overhang nucleotide; and
- XXX, YYY, ZZZ, C'C'C', U ⁇ ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
- i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1.
- k is 0 and 1 is 0; or k is 1 and 1 is 0; k is 0 and 1 is 1 ; or both k and 1 are 0; or both k and 1 are 1.
- RNAi duplex Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
- each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each Nb independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides.
- Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
- Each Na, Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- Each of Na, Na’, Nb and Nb’ independently comprises modifications of alternating pattern.
- Each of X, Y and Z in formulas (III), (Ilia), (Illb), (IIIc), and (IIId) may be the same or different from each other.
- RNAi agent When the RNAi agent is represented by formula (III), (Ilia), (Illb), (IIIc), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y' nucleotides.
- RNAi agent When the RNAi agent is represented by formula (Illb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.
- RNAi agent When the RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.
- the modification on the Y nucleotide is different than the modification on the Y’ nucleotide
- the modification on the Z nucleotide is different than the modification on the Z’ nucleotide
- the modification on the X nucleotide is different than the modification on the X’ nucleotide.
- the Na modifications are 2 ' -0-methyl or 2 ' -fluoro modifications.
- the Na modifications are 270-methyl or 2 ' -fhroro modifications and np' >0 and at least one np' is linked to a neighboring nucleotide a via phosphorothioate linkage.
- the Na modifications are 270-methyl or 27fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is 'onjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker (described below).
- the Na modifications are 2 ' -0-methyl or 2 ' -fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
- the Na modifications are 2'-0-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
- the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (Ilia), (Illb), (IIIc), and (IIId), wherein the duplexes are connected by a linker.
- the linker can be cleavable or non-cleavable.
- the multimer further comprises a ligand.
- Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
- the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (Ilia), (Illb), (IIIc), and (IIId), wherein the duplexes are connected by a linker.
- the linker can be cleavable or non-cleavable.
- the multimer further comprises a ligand.
- Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
- two RNAi agents represented by formula (III), (Ilia), (Illb), (IIIc), and (IIId) are linked to each other at the 5’ end, and one or both of the 3’ ends and are optionally conjugated to to a ligand.
- Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
- an RNAi agent of the invention may contain a low number of nucleotides containing a 2’-fluoro modification, e.g., 10 or fewer nucleotides with 2’-fluoro modification.
- the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2’-fluoro modification.
- the RNAi agent of the invention contains 10 nucleotides with a 2’-fluoro modification, e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 6 nucleotides with a 2’-fluoro modification in the antisense strand.
- the RNAi agent of the invention contains 6 nucleotides with a 2’-fluoro modification, e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand.
- an RNAi agent of the invention may contain an ultra low number of nucleotides containing a 2’-fluoro modification, e.g., 2 or fewer nucleotides containing a 2’-fluoro modification.
- the RNAi agent may contain 2, 1 of 0 nucleotides with a 2’-fluoro modification.
- the RNAi agent may contain 2 nucleotides with a 2’-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand.
- RNAi agents that can be used in the methods of the invention.
- Such publications include W02007/091269, US Patent No. 7858769, W02010/141511, W02007/117686, W02009/014887 and WO2011/031520 the entire contents of each of which are hereby incorporated herein by reference.
- compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein.
- VP vinyl phosphonate
- a 5 ’-vinyl phosphonate modified nucleotide of the disclosure has the structure: wherein X is O or S;
- R is hydrogen, hydroxy, fluoro, or C 1-20 alkoxy (e.g., methoxy or n-hexadecyloxy);
- R 5 C(H)-P(0)(OH) 2 and the double bond between the C5’ carbon and R 5 is in the E or Z orientation (e.g., E orientation);
- B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.
- a vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure.
- a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5’ end of the antisense strand of the dsRNA.
- the RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent.
- the carbohydrate moiety will be attached to a modified subunit of the RNAi agent.
- the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (such as, cyclic) carrier to which is attached a carbohydrate ligand.
- a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS).
- a cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur.
- the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
- the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
- the ligand may be attached to the polynucleotide via a carrier.
- the carriers include (i) at least one “backbone attachment point,” such as, two “backbone attachment points” and (ii) at least one “tethering attachment point.”
- a “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid.
- a “tethering attachment point” in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety.
- the moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide.
- the selected moiety is connected by an intervening tether to the cyclic carrier.
- the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
- a functional group e.g., an amino group
- another chemical entity e.g., a ligand to the constituent ring.
- RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; in some embodiments, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; in some embodiments, the acyclic group is selected from serinol backbone or diethanolamine backbone.
- a nucleic acid inhibitor molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand.
- seed region means at positions 2-9 of the 5 ’-end of the referenced strand.
- thermally destabilizing modifications can be incorporated in the seed region of the antisense strand to reduce or inhibit off-target gene silencing.
- thermally destabilizing modification! s) includes modification(s) that would result with a dsRNA with a lower overall melting temperature (T m ) than the T m of the dsRNA without having such modification(s).
- T m overall melting temperature
- the thermally destabilizing modification(s) can decrease the T m of the dsRNA by 1 - 4 °C, such as one, two, three or four degrees Celcius.
- thermally destabilizing nucleotide refers to a nucleotide containing one or more thermally destabilizing modifications.
- the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5’ region of the antisense strand.
- one or more thermally destabilizing modification(s) of the duplex is/are located in positions 2-9, such as, positions 4-8, from the 5’-end of the antisense strand.
- the thermally destabilizing modification(s) of the duplex is/are located at position 6, 7 or 8 from the 5 ’-end of the antisense strand. In still some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5 ’-end of the antisense strand. In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5’-end of the antisense strand.
- an iRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides.
- the RNAi agent may be represented by formula (L):
- Bl, B2, B3, B 1', B2’, B3’, and B4’ each are independently a nucleotide containing a modification selected from the group consisting of 2’-0-alkyl, 2 ’-substituted alkoxy, 2 ’-substituted alkyl, 2’ -halo, ENA, and BNA/LNA.
- Bl, B2, B3, B 1', B2’, B3’, and B4’ each contain 2’-OMe modifications.
- Bl, B2, B3, B 1', B2’, B3’, and B4’ each contain 2’-OMe or 2’-F modifications.
- at least one of Bl, B2, B3, B 1', B2’, B3’, and B4’ contain 2'-0-N-methylacetamido (2'-0-NMA) modification.
- Cl is a thermally destabilizing nucleotide placed at a site opposite to the seed region of the antisense strand (i.e., at positions 2-8 of the 5’-end of the antisense strand).
- Cl is at a position of the sense strand that pairs with a nucleotide at positions 2-8 of the 5 ’-end of the antisense strand.
- Cl is at position 15 from the 5 ’-end of the sense strand.
- Cl nucleotide bears the thermally destabilizing modification which can include abasic modification; mismatch with the opposing nucleotide in the duplex; and sugar modification such as 2’-deoxy modification or acyclic nucleotide e.g., unlocked nucleic acids (UNA) or glycerol nucleic acid (GNA).
- Cl has thermally destabilizing modification selected from the group consisting of: i) mismatch with the opposing nucleotide in the antisense strand; ii) abasic modification selected from the group consisting of: and iii) sugar modification selected from the group consisting of:
- the thermally destabilizing modification in Cl is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2’-deoxy nucleobase.
- the thermally destabilizing modification in Cl is GNA or
- Tl, TT, T2’, and T3’ each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less or equal to the steric bulk of a 2’-OMe modification.
- a steric bulk refers to the sum of steric effects of a modification. Methods for determining steric effects of a modification of a nucleotide are known to one skilled in the art.
- the modification can be at the 2’ position of a ribose sugar of the nucleotide, or a modification to a non-ribose nucleotide, acyclic nucleotide, or the backbone of the nucleotide that is similar or equivalent to the 2’ position of the ribose sugar, and provides the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2’-OMe modification.
- Tl, T 1', T2’, and T3’ are each independently selected from DNA, RNA, LNA, 2’-F, and 2’-F-5’-methyl.
- Tl is DNA.
- Tl’ is DNA, RNA or LNA.
- T2’ is DNA or RNA.
- T3’ is DNA or RNA.
- n 1 , n 3 , and q 1 are independently 4 to 15 nucleotides in length.
- n 5 , q 3 , and q 7 are independently 1-6 nucleotide(s) in length.
- n 4 , q 2 , and q 6 are independently 1-3 nucleotide(s) in length; alternatively, n 4 is 0.
- q 5 is independently 0-10 nucleotide(s) in length.
- n 2 and q 4 are independently 0-3 nucleotide(s) in length.
- n 4 is 0-3 nucleotide(s) in length. In one embodiment, n 4 can be 0. In one example, n 4 is 0, and q 2 and q 6 are 1. In another example, n 4 is 0, and q 2 and q 6 are 1 , with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 ’-end of the antisense strand).
- n 4 , q 2 , and q 6 are each 1.
- n 2 , n 4 , q 2 , q 4 , and q 6 are each 1.
- Cl is at position 14-17 of the 5 ’-end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 4 is 1. In one embodiment, Cl is at position 15 of the 5 ’-end of the sense strand
- T3’ starts at position 2 from the 5’ end of the antisense strand. In one example, T3’ is at position 2 from the 5’ end of the antisense strand and q 6 is equal to 1.
- TT starts at position 14 from the 5’ end of the antisense strand. In one example, TT is at position 14 from the 5’ end of the antisense strand and q 2 is equal to 1.
- T3’ starts from position 2 from the 5’ end of the antisense strand and TT starts from position 14 from the 5’ end of the antisense strand.
- T3’ starts from position 2 from the 5’ end of the antisense strand and q 6 is equal to 1 and TT starts from position 14 from the 5’ end of the antisense strand and q 2 is equal to 1.
- TT and T3’ are separated by 11 nucleotides in length (i.e. not counting the TT and T3’ nucleotides).
- TT is at position 14 from the 5’ end of the antisense strand. In one example, TT is at position 14 from the 5’ end of the antisense strand and q 2 is equal to 1, and the modification at the 2’ position or positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2’-OMe ribose.
- T3’ is at position 2 from the 5’ end of the antisense strand. In one example, T3’ is at position 2 from the 5’ end of the antisense strand and q 6 is equal to 1, and the modification at the 2’ position or positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2’-OMe ribose.
- T1 is at the cleavage site of the sense strand. In one example, T1 is at position 11 from the 5’ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand at position 11 from the 5’ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1,
- T2’ starts at position 6 from the 5’ end of the antisense strand. In one example, T2’ is at positions 6-10 from the 5’ end of the antisense strand, and q 4 is 1.
- T1 is at the cleavage site of the sense strand, for instance, at position 11 from the 5’ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1; TT is at position 14 from the 5’ end of the antisense strand, and q 2 is equal to 1, and the modification to TT is at the 2’ position of a ribose sugar or at positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2’-OMe ribose; T2’ is at positions 6-10 from the 5’ end of the antisense strand, and q 4 is 1; and T3’ is at position 2 from the 5’ end of the antisense strand, and q 6 is equal to 1, and the modification to T3’ is at the 2’ position or at positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a
- T2’ starts at position 8 from the 5’ end of the antisense strand. In one example, T2’ starts at position 8 from the 5’ end of the antisense strand, and q 4 is 2.
- T2’ starts at position 9 from the 5’ end of the antisense strand. In one example, T2’ is at position 9 from the 5’ end of the antisense strand, and q 4 is 1.
- B 1' is 2’-OMe or 2’-F
- q 1 is 9, TT is 2’-F
- q 2 is 1, B2’ is 2’-OMe or 2’-F
- q 3 is 4, T2’ is 2’-F
- q 4 is 1, B3’ is 2’-OMe or 2’-F
- q 5 is 6, T3’ is 2’-F
- q 6 is 1, B4’ is 2’-OMe
- q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 ’-end of the antisense strand).
- n 4 is 0, B3 is 2’-OMe, n 5 is 3, B 1' is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 6, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 ’-end of the antisense strand
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T 1' is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 6 1
- B4’ is 2’-OMe
- q 7 1
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications
- B1 is 2’-OMe or 2’-F
- n 1 is 6, T1 is 2’F
- n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B 1' is 2’-OMe or 2’-F, q 1 is 7, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is
- B1 is 2’-OMe or 2’-F
- n 1 is 6, T1 is 2’F
- n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B 1' is 2’-OMe or 2’-F, q 1 is 7, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 1, B3’ is 2’-OMe or 2’-F
- q 5 6
- T3’ is 2’-F
- q 7 1
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 1, B3’ is 2’-OMe or 2’-F
- q 5 6
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 5, T2’ is 2’-F
- q 4 1, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 is 1; optionally with at least 2 additional TT at the 3 ’-end of the antisense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 5, T2’ is 2’-F
- q 5 5
- T3’ 2’-F
- q 7 is 1; optionally with at least 2 additional TT at the 3 ’-end of the antisense strand; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 6 1
- B4’ is 2’-F
- q 7 1
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleo
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the dsRNA agent can comprise a phosphorus-containing group at the 5 ’-end of the sense strand or antisense strand.
- the 5’-end phosphorus-containing group can be 5’-end phosphate (5’-P),
- the 5 ’-VP can be either 5’ -E-VP isomer (i.e., trans-vinylphosphonate. 5’-Z-VP isomer (i.e., cis- vinylphosphonate, , or mixtures thereof.
- the RNAi agent comprises a phosphorus-containing group at the 5 ’-end of the sense strand. In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5 ’-end of the antisense strand.
- the RNAi agent comprises a 5’-P. In one embodiment, the RNAi agent comprises a 5’-P in the antisense strand.
- the RNAi agent comprises a 5 ’-PS. In one embodiment, the RNAi agent comprises a 5 ’-PS in the antisense strand.
- the RNAi agent comprises a 5 ’-VP. In one embodiment, the RNAi agent comprises a 5 ’-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5' -E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-Z-VP in the antisense strand.
- the RNAi agent comprises a 5’-PS 2 . In one embodiment, the RNAi agent comprises a 5’-PS 2 in the antisense strand.
- the RNAi agent comprises a 5’-PS 2 . In one embodiment, the RNAi agent comprises a 5’-deoxy-5’-C-malonyl in the antisense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’ -PS.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’-P.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5 ’-VP.
- the 5 ’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’- PS2.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’-P.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the dsRNA agent also comprises a 5 ’-PS.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5 ’-VP.
- the 5 ’-VP may be 5’-f?-VP, 5’-Z-VP, or combination thereof.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’- PS2.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- the RNAi agent also comprises a 5’-P.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’ - P.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 6 1
- B4’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’ - PS.
- B1 is 2’-OMe or 2’-F
- n 1 is 8
- T1 is 2’F
- n 2 is 3
- B2 is 2’-OMe
- n 3 is 7,
- n 4 is 0,
- B3 is 2’OMe
- n 5 is 3
- B 1' is 2’-OMe or 2’-F
- q 1 9, T1’ is 2’-F
- q 2 is 1, B2’ is 2’-OMe or 2’-F
- q 3 4, T2’ is 2’-F, q 4 is 2,
- B3’ is 2’-OMe or 2’-F
- q 5 is 5, T3’ is 2’-F
- q 6 is 1, B4’ is 2’-F
- q 7 is 1.
- the RNAi agent also comprises a 5’- VP.
- the 5 ’-VP may be 5’-£-VP, 5’-Z
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the dsRNAi RNA agent also comprises a 5’ - PS2.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 is 0,
- B3 is 2’OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- the RNAi agent also comprises a 5’- VP.
- the 5 ’-VP may be 5’-£-VP, 5’-Z-VP, or combination thereof.
- B1 is 2’-OMe or 2’-F
- n 1 is 8
- T1 is 2’F
- n 2 is 3
- B2 is 2’-OMe
- n 3 is 7,
- n 4 is 0,
- B3 is 2’-OMe
- n 5 3, B 1' is 2’-OMe or 2’-F
- q 1 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2,
- B3’ is 2’-OMe or 2’-F
- q 5 is 5, T3’ is 2’-F
- q 6 is 1
- B4’ is 2’-F
- q 7 is 1; with two phosphorothioate intern
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’- P.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’- PS.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’- VP.
- the 5 ’-VP may be 5’-f?-VP, 5’-Z-VP, or combination thereof.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’- PS2.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7
- T3’ 2’-F
- q 7 1
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl.
- B1 is 2’-OMe or 2’-F
- n 1 is 8
- T1 is 2’F
- n 2 is 3
- B2 is 2’-OMe
- n 3 is 7,
- n 4 is 0,
- B3 is 2’-OMe
- n 5 is 3
- B 1' is 2’-OMe or 2’-F
- q 1 9, T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, T2’ is 2’-F, q 4 is 2,
- B3’ is 2’-OMe or 2’-F
- q 5 is 5, T3’ is 2’-F
- q 6 is 1, B4’ is 2’-OMe
- q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand
- the RNAi agent also comprises a 5’-P and a targeting ligand.
- the 5’-P is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- the RNAi agent also comprises a 5’ -PS and a targeting ligand.
- the 5’- PS is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- the RNAi agent also comprises a 5 ’-VP (e.g., a 5’-£-VP, 5’-Z-VP, or combination thereof), and a targeting ligand.
- a 5 ’-VP e.g., a 5’-£-VP, 5’-Z-VP, or combination thereof
- the 5 ’-VP is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- the RNAi agent also comprises a 5’- PS2 and a targeting ligand.
- the 5’- PS2 is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7
- n 4 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 4 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl and a targeting ligand.
- the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- the RNAi agent also comprises a 5’-P and a targeting ligand.
- the 5’-P is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- the RNAi agent also comprises a 5’-PS and a targeting ligand.
- the 5 ’-PS is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- the RNAi agent also comprises a 5 ’-VP (e.g., a 5’-f?-VP, 5’-Z-VP, or combination thereof) and a targeting ligand.
- a 5 ’-VP e.g., a 5’-f?-VP, 5’-Z-VP, or combination thereof
- the 5 ’-VP is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- the RNAi agent also comprises a 5’-PS 2 and a targeting ligand.
- the 5’-PS 2 is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucle
- the RNAi agent also comprises a 5’-deoxy-5’- C-malonyl and a targeting ligand.
- the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- the RNAi agent also comprises a 5’-P and a targeting ligand.
- the 5’-P is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- the RNAi agent also comprises a 5’ -PS and a targeting ligand.
- the 5’- PS is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1 ; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleo
- the RNAi agent also comprises a 5 ’-VP (e.g., a 5’-f?-VP, 5’-Z-VP, or combination thereof) and a targeting ligand.
- a 5 ’-VP e.g., a 5’-f?-VP, 5’-Z-VP, or combination thereof
- the 5 ’-VP is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- the RNAi agent also comprises a 5’-PS 2 and a targeting ligand.
- the 5’- PS2 is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8
- T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4,
- T2’ is 2’-F
- q 4 2,
- B3’ is 2’-OMe or 2’-F
- q 5 5
- T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleot
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl and a targeting ligand.
- the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the RNAi agent also comprises a 5’-P and a targeting ligand.
- the 5’-P is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the RNAi agent also comprises a 5’- PS and a targeting ligand.
- the 5 ’-PS is at the 5’- end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the RNAi agent also comprises a 5’- VP (e.g ., a 5’-£-VP, 5’-Z-VP, or combination thereof) and a targeting ligand.
- a 5’-VP e.g ., a 5’-£-VP, 5’-Z-VP, or combination thereof
- the 5 ’-VP is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the RNAi agent also comprises a 5’- PS2 and a targeting ligand.
- the 5’-PS 2 is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- B1 is 2’-OMe or 2’-F
- n 1 8 T1 is 2’F
- n 2 3
- B2 is 2’-OMe
- n 3 7, n 4 is 0,
- B3 is 2’-OMe
- n 5 3
- B 1' 2’-OMe or 2’-F
- q 1 9
- T1’ is 2’-F
- q 2 1, B2’ is 2’-OMe or 2’-F
- q 3 4, q 4 is 0, B3’ is 2’-OMe or 2’-F
- q 5 7, T3’ is 2’-F
- q 7 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5 ’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothio
- the RNAi agent also comprises a 5’-deoxy-5’-C-malonyl and a targeting ligand.
- the 5’-deoxy-5’-C-malonyl is at the 5 ’-end of the antisense strand
- the targeting ligand is at the 3 ’-end of the sense strand.
- an RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- an RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- aRNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agentsof the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a four nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- RNAi agent of the present invention comprises:
- an ASGPR ligand attached to the 3 ’-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
- RNAi agents have a two nucleotide overhang at the 3 ’-end of the antisense strand, and a blunt end at the 5 ’-end of the antisense strand.
- a nucleic acid inhibitor for use in the methods of the invention is a single stranded antisense polynucleotide agent that targets LDHA, a single stranded antisense polynucleotide agent that targets PRODH2, and/or a single stranded antisense polynucleotide agent that targets HAO1.
- Suitable antisense polynucleotide agent for use in the methods of the invention are known in the art and described in, for example, U.S. Patent Publication No. 2018/0092990 (Attorney Docket No. 121301-03602), the entire contents of which are incorporated herein by reference.
- a nucleic acid inhibitor of the present invention is a single stranded antisense polynucleotide agent which inhibits the expression of an LDHA gene and is selected from the group of antisense sequence listed in any one of Tables 2-3.
- a nucleic acid inhibitor of the present invention is a single stranded antisense polynucleotide agent which inhibits the expression of an HAO1 gene and is selected from the group of antisense sequence listed in any one of Tables 4-14.
- a nucleic acid inhibitor of the present invention is a single stranded antisense polynucleotide agent which inhibits the expression of a PRODH2 gene and is selected from the group of antisense sequence listed in any one of Tables 15-16. Any of these agents may further comprise a ligand.
- the polynucleotide agents of the invention include a nucleotide sequence which is about 4 to about 50 nucleotides or less in length and which is about 80% complementary to at least part of an mRNA transcript of an LDHA gene, a PRODH2 gene and/or HAO1 gene.
- the use of these polynucleotide agents enables the targeted inhibition of RNA expression and/or activity of a corresponding gene in subjects, such as human subjects.
- the polynucleotide agents e.g., antisense polynucleotide agents, and compositions comprising such agents, of the invention target an LDHA gene, a PRODH2 gene and/or an HAO1 gene and inhibit the expression of the gene.
- the polynucleotide agents inhibit the expression of the gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having or at risk of developing a non-primary hyperoxaluria disease or disorder.
- the polynucleotide agents of the invention include a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an LDHA gene, a PRODH2 gene and/or an HAO1 gene.
- the region of complementarity may be about 50 nucleotides or less in length (e.g., about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 nucleotides or less in length).
- the polynucleotide agent Upon contact with a cell expressing the gene, the polynucleotide agent inhibits the expression of the gene (e.g., a human, a primate, a non-primate, or a bird LDHA gene, PRODH2 gene and/or HAO1 gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western Blotting or flow cytometric techniques.
- the gene e.g., a human, a primate, a non-primate, or a bird LDHA gene, PRODH2 gene and/or HAO1 gene
- the gene e.g., a human, a primate, a non-primate, or a bird LDHA gene, PRODH2 gene and/or HAO1 gene
- the gene e.g., a human, a prim
- the region of complementarity between a polynucleotide agent and a target sequence may be substantially complementary (e.g., there is a sufficient degree of complementarity between the polynucleotide agent and a target nucleic acid to so that they specifically hybridize and induce a desired effect), but is generally fully complementary to the target sequence.
- the target sequence can be derived from the sequence of an mRNA formed during the expression of an LDHA gene, a PRODH2 gene and/or an HAO1 gene.
- an antisense polynucleotide agent specifically hybridizes to a target nucleic acid molecule, such as the mRNA encoding LDHA, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of SEQ ID NOs:l, 3, 5, 7, or 9, or a fragment of SEQ ID NOs:l, 3, 5, 7, or 9.
- an antisense polynucleotide agent specifically hybridizes to a target nucleic acid molecule, such as the mRNA encoding HAO1, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of SEQ ID NO:21, or a fragment of SEQ ID NO:21.
- an antisense polynucleotide agent specifically hybridizes to a target nucleic acid molecule, such as the mRNA encoding PRODH2, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of SEQ ID NO:4641, or a fragment of SEQ ID NO:4641.
- the polynucleotide agents of the invention may be substantially complementary to the target sequence.
- a polynucleotide agent that is substantially complementary to the target sequence may include a contiguous nucleotide sequence comprising no more than 5 mismatches (e.g., no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches) when hybridizing to a target sequence, such as to the corresponding region of a nucleic acid which encodes a mammalian LDHA mRNA, a mammalian PRODH2 mRNA, and/or a mammalian HAO1 mRNA.
- no more than 5 mismatches e.g., no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches
- the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, such as the corresponding region of a nucleic acid which encodes a mammalian LDHA mRNA, a mammalian PRODH2 mRNA, and/or a mammalian HAO1 mRNA.
- the polynucleotide agents of the invention that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs:l, 3, 5, 7, or 9, or a fragment of SEQ ID NOs:l, 3, 5, 7, or 9, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
- a polynucleotide agent comprises a contiguous nucleotide sequence which is fully complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs:l, 3, 5, 7, or 9 (or a fragment of SEQ ID NOs:l, 3, 5, 7, or 9).
- the polynucleotide agents of the invention that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:21, or a fragment of SEQ ID NO:21, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
- a polynucleotide agent comprises a contiguous nucleotide sequence which is fully complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:21(or a fragment of SEQ ID NO:21).
- the polynucleotide agents of the invention that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:4641, or a fragment of SEQ ID NO:4641, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
- a polynucleotide agent comprises a contiguous nucleotide sequence which is fully complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:4641 (or a fragment of SEQ ID NO:4641).
- a polynucleotide agent may comprise a contiguous nucleotide sequence of about 4 to about 50 nucleotides in length, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.
- a polynucleotide agent may comprise a contiguous nucleotide sequence of no more than 22 nucleotides, such as no more than 21 nucleotides, 20 nucleotides, 19 nucleotides, or no more than 18 nucleotides.
- the polynucleotide agenst of the invention comprises less than 20 nucleotides. In other embodiments, the polynucleotide agents of the invention comprise 20 nucleotides.
- a polynucleotide agent of the invention targeting LDHA includes a sequence selected from the group of antisense sequences provided in any one of Tables 2-3.
- a polynucleotide agent of the invention targeting HAO1 includes a sequence selected from the group of antisense sequences provided inany one of Tables 4-14.
- a polynucleotide agent of the invention targeting PRODH2 includes a sequence selected from the group of antisense sequences provided in any one of Tables 15-16.
- a polynucleotide agent of the invention may also comprise any one of the sequences set forth in Tables 2-16 that is un-modified, un-conjugated, and/or modified and/or conjugated differently than described therein.
- polynucleotide agents of the invention may include one of the sequences of Tables 2-16 minus only a few nucleotides on one or both ends and yet remain similarly effective as compared to the polynucleotide agents described above.
- polynucleotide agents provided in Tables 2 -16 identify a region(s) in an LDHA transcript, a PRODH2 transcript and/or an HAO1 transcript that is susceptible to antisense inhibition (e.g., the regions in SEQ ID NO: 1 or SEQ ID NO:21 or SEQ ID NO: 4641 which the polynucleitde agents may target).
- the present invention further features polynucleotide agents that target within one of these sites.
- a polynucleotide agent is said to target within a particular site of an RNA transcript if the polynucleotide agent promotes antisense inhibition of the target at that site.
- Such a polynucleotide agent will generally include at least about 15 contiguous nucleotides from one of the sequences provided in Tables 2-16 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the target gene.
- target sequence is generally about 4-50 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing antisense inhibition of any given target RNA.
- Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 20 nucleotides) is literally or figuratively (including, e.g., in silico ) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences.
- the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected.
- This process coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with a polynucleotide agent, mediate the best inhibition of target gene expression.
- sequences identified represent effective target sequences
- further optimization of antisense inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
- Such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in length, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.
- modified nucleotides as described herein or as known in the art, addition or changes in length, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.
- i. Single Stranded Polynucleotide Agents Comprising Motif
- At least one of the contiguous nucleotides of the antisense polynucleotide agents of the invention may be a modified nucleotide. Suitable nucleotide modifications for use in the single stranded antisense polynucletiude agents of the invention are described in Section A(ii), above.
- the modified nucleotide comprises one or more modified sugars.
- the modified nucleotide comprises one or more modified nucleobases.
- the modified nucleotide comprises one or more modified internucleoside linkages.
- the modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In one embodiment, the patterns of modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another.
- Polynucleotide agents having modified oligonucleotides arranged in patterns, or motifs may, for example, confer to the agents properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
- such agents may contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
- a second region of such agents may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
- An exemplary polynucleotide agent having modified oligonucleotides arranged in patterns, or motifs is a gapmer.
- a gapmer In a “gapmer”, an internal region or "gap" having a plurality of linked nucleotides that supports RNaseFl cleavage is positioned between two external flanking regions or "wings" having a plurality of linked nucleotides that are chemically distinct from the linked nucleotides of the internal region.
- the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleotides.
- the three regions of a gapmer motif form a contiguous sequence of nucleotides and may be described as “X-Y-Z”, wherein “X” represents the length of the 5-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3’- wing.
- a gapmer described as “X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment.
- Any of the compounds, e.g., antisense compounds, described herein can have a gapmer motif.
- X and Z are the same, in other embodiments they are different.
- the regions of a gapmer are differentiated by the types of modified nucleotides in the region.
- the modified nucleotides of each of the wings may differ from at least some of the modified nucleotides of the gap.
- at least some of the modified nucleotides of each wing that are closest to the gap differ from the modified nucleotides of the neighboring gap nucleotides, thus defining the boundary between the wings and the gap.
- the modified nucleotides within the gap are the same as one another.
- the gap includes one or more modified nucleotides that differ from the modified nucleotides of one or more other nucleotides of the gap.
- the length of the 5’- wing (X) of a gapmer may be 1 to 6 nucleotides in length, e.g., 2 to 6, 2 to 5, 3 to 6, 3 to 5, 1 to 5, 1 to 4, 1 to 3, 2 to 4 nucleotides in length, e.g., 1, 2, 3, 4, 5, or 6 nucleotides in length.
- the length of the 3’- wing (Z) of a gapmer may be 1 to 6 nucleotides in length, e.g., 2 to 6, 2- 5, 3 to 6, 3 to 5, 1 to 5, 1 to 4, 1 to 3, 2 to 4 nucleotides in length, e.g., 1, 2, 3, 4, 5, or 6 nucleotides in length.
- the length of the gap (Y) of a gapmer may be 5 to 14 nucleotides in length, e.g., 5 to 13, 5 to
- X consists of 2, 3, 4, 5 or 6 nucleotides
- Y consists of 7, 8, 9, 10, 11, or 12 nucleotides
- Z consists of 2, 3, 4, 5 or 6 nucleotides.
- gapmers include (X-Y-Z) 2-7-2, 2-7-3, 2-7-4, 2-7-5, 2-7-6, 3-7-2, 3-7-3, 3-7-4, 3-7-5, 3-7-6, 4-7-3, 4-7-4, 4-7-5, 4-7-6,
- polynucleotide agents of the invention include a 5-10- 5 gapmer motif. In other embodiments of the invention, polynucleotide agents of the invention include a 4-10-4 gapmer motif. In another embodiment of the invention, polynucleotide agents of the invention include a 3-10-3 gapmer motif. In yet other embodiments of the invention, polynucleotide agents of the invention include a 2-10-2 gapmer motif.
- the 5'- wing and/or 3 ’-wing of a gapmer may independently include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.
- the 5’ -wing of a gapmer includes at least one modified nucleotide. In one embodiment, the 5'- wing of a gapmer comprises at least two modified nucleotides. In another embodiment, the 5'- wing of a gapmer comprises at least three modified nucleotides. In yet another embodiment, the 5'- wing of a gapmer comprises at least four modified nucleotides. In another embodiment, the 5'- wing of a gapmer comprises at least five modified nucleotides. In certain embodiments, each nucleotide of the 5'-wing of a gapmer is a modified nucleotide.
- the 3 ’-wing of a gapmer includes at least one modified nucleotide. In one embodiment, the 3'- wing of a gapmer comprises at least two modified nucleotides. In another embodiment, the 3'- wing of a gapmer comprises at least three modified nucleotides. In yet another embodiment, the 3'- wing of a gapmer comprises at least four modified nucleotides. In another embodiment, the 3'- wing of a gapmer comprises at least five modified nucleotides. In certain embodiments, each nucleotide of the 3'-wing of a gapmer is a modified nucleotide.
- the regions of a gapmer are differentiated by the types of sugar moieties of the nucleotides.
- the nucleotides of each distinct region comprise uniform sugar moieties.
- the nucleotides of each distinct region comprise different sugar moieties.
- the sugar nucleotide modification motifs of the two wings are the same as one another.
- the sugar nucleotide modification motifs of the 5'-wing differs from the sugar nucleotide modification motif of the 3'-wing.
- the 5’-wing of a gapmer may include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.
- at least one modified nucleotide of the 5'-wing of a gapmer is a bicyclic nucleotide, such as a constrained ethyl nucleotide, or an LNA.
- the 5 ’-wing of a gapmer includes 2, 3, 4, or 5 bicyclic nucleotides.
- each nucleotide of the 5'- wing of a gapmer is a bicyclic nucleotide.
- the 5 ’-wing of a gapmer includes at least 1, 2, 3, 4, or 5 constrained ethyl nucleotides. In some embodiments, each nucleotide of the 5'- wing of a gapmer is a constrained ethyl nucleotide.
- the 5'-wing of a gapmer comprises at least one LNA nucleotide.
- the 5’-wing of a gapmer includes 2, 3, 4, or 5 LNA nucleotides.
- each nucleotide of the 5'- wing of a gapmer is an LNA nucleotide.
- At least one modified nucleotide of the 5'- wing of a gapmer is a non-bicyclic modified nucleotide, e.g., a 2 '-substituted nucleotide.
- a “2 '-substituted nucleotide” is a nucleotide comprising a modification at the 2 ’-position which is other than H or OH, such as a 2’-OMe nucleotide, or a 2’-MOE nucleotide.
- the 5’-wing of a gapmer comprises 2, 3, 4, or 52 '-substituted nucleotides.
- each nucleotide of the 5 ’-wing of a gapmer is a 2 '-substituted nucleotide.
- the 5'- wing of a gapmer comprises at least one 2’-OMe nucleotide. In one embodiment, the 5'- wing of a gapmer comprises at least 2, 3, 4, or 5 2’-OMe nucleotides. In one embodiment, each of the nucleotides of the 5'- wing of a gapmer comprises a 2’-OMe nucleotide.
- the 5'- wing of a gapmer comprises at least one 2’- MOE nucleotide. In one embodiment, the 5'- wing of a gapmer comprises at least 2, 3, 4, or 5 2’- MOE nucleotides. In one embodiment, each of the nucleotides of the 5'- wing of a gapmer comprises a 2’- MOE nucleotide.
- the 5'- wing of a gapmer comprises at least one 2'-deoxynucleotide. In certain embodiments, each nucleotide of the 5'- wing of a gapmer is a 2'-deoxynucleotide. In a certain embodiments, the 5'- wing of a gapmer comprises at least one ribonucleotide. In certain embodiments, each nucleotide of the 5'- wing of a gapmer is a ribonucleotide.
- the 3’-wing of a gapmer may include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.
- At least one modified nucleotide of the 3'-wing of a gapmer is a bicyclic nucleotide, such as a constrained ethyl nucleotide, or an LNA.
- the 3’ -wing of a gapmer includes 2, 3, 4, or 5 bicyclic nucleotides.
- each nucleotide of the 3’- wing of a gapmer is a bicyclic nucleotide.
- the 3 ’-wing of a gapmer includes at least one constrained ethyl nucleotide. In another embodiment, the 3’-wing of a gapmer includes 2, 3, 4, or 5 constrained ethyl nucleotides. In some embodiments, each nucleotide of the 3 ’-wing of a gapmer is a constrained ethyl nucleotide. In one embodiment, the 3 ’-wing of a gapmer comprises at least one LNA nucleotide. In another embodiment, the 3’-wing of a gapmer includes 2, 3, 4, or 5 LNA nucleotides. In other embodiments, each nucleotide of the 3’ -wing of a gapmer is an LNA nucleotide.
- At least one modified nucleotide of the 3 ’-wing of a gapmer is a non- bicyclic modified nucleotide, e.g., a 2 '-substituted nucleotide.
- the 3’ -wing of a gapmer comprises 2, 3, 4, or 5 2 '-substituted nucleotides.
- each nucleotide of the 3 ’-wing of a gapmer is a 2 '-substituted nucleotide.
- the 3 ’-wing of a gapmer comprises at least one 2’-OMe nucleotide. In one embodiment, the 3’-wing of a gapmer comprises at least 2, 3, 4, or 52’-OMe nucleotides. In one embodiment, each of the nucleotides of the 3 ’-wing of a gapmer comprises a 2’-OMe nucleotide.
- the 3 ’-wing of a gapmer comprises at least one 2’- MOE nucleotide. In one embodiment, the 3’-wing of a gapmer comprises at least 2, 3, 4, or 52’- MOE nucleotides. In one embodiment, each of the nucleotides of the 3’-wing of a gapmer comprises a 2’- MOE nucleotide.
- the 3'-wing of a gapmer comprises at least one 2'-deoxynucleotide. In certain embodiments, each nucleotide of the 3'-wing of a gapmer is a 2'-deoxynucleotide. In a certain embodiments, the 3'-wing of a gapmer comprises at least one ribonucleotide. In certain embodiments, each nucleotide of the 3'-wing of a gapmer is a ribonucleotide.
- the gap of a gapmer may include 5-14 modified nucleotides, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 modified nucleotides.
- the gap of a gapmer comprises at least one 5-methylcytosine. In one embodiment, the gap of a gapmer comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 5- methylcytosines. In one embodiment, all of the nucleotides of the the gap of a gapmer are 5- methylcytosines.
- the gap of a gapmer comprises at least one 2'-deoxynucleotide. In one embodiment, the gap of a gapmer comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 2'- deoxynucleotides. In one embodiment, all of the nucleotides of the the gap of a gapmer are 2'- deoxynucleotides .
- a gapmer may include one or more modified internucleotide linkages.
- a gapmer includes one or more phosphodiester internucleotide linkages.
- a gapmer includes one or more phosphorothioate internucleotide linkages.
- each nucleotide of a 5 ’-wing of a gapmer are linked via a phosphorothioate internucleotide linkage.
- each nucleotide of a 3 ’-wing of a gapmer are linked via a phosphorothioate internucleotide linkage.
- each nucleotide of a gap segment of a gapmer is linked via a phosphorothioate internucleotide linkage.
- all of the nucleotides in a gapmer are linked via phosphorothioate internucleotide linkages.
- a polynucleotide agent comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising five nucleotides and a 3’ -wing segment comprising 5 nucleotides.
- a polynucleotide agent comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising four nucleotides and a 3’ -wing segment comprising four nucleotides.
- a polynucleotide agent comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising three nucleotides and a 3 ’-wing segment comprising three nucleotides.
- a polynucleotide agent comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising two nucleotides and a 3 ’-wing segment comprising two nucleotides.
- each nucleotide of a 5-wing flanking a gap segment of 102'- deoxyribonucleotides comprises a modified nucleotide.
- each nucleotide of a 3-wing flanking a gap segment of 102'-deoxyribonucleotides comprises a modified nucleotide.
- each of the modified 5 ’-wing nucleotides and each of the modified 3 ’-wing nucleotides comprise a 2'-sugar modification.
- the 2'-sugar modification is a 2’- OMe modification.
- the 2'-sugar modification is a 2’-MOE modification.
- each of the modified 5 ’-wing nucleotides and each of the modified 3 ’-wing nucleotides comprise a bicyclic nucleotide.
- the bicyclic nucleotide is a constrained ethyl nucleotide.
- the bicyclic nucleotide is an LNA nucleotide.
- each cytosine in a polynucleotide agent is a 5-methylcytosine.
- a polynucleotide agent comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising five nucleotides comprising a 2’OMe modification and a 3 ’-wing segment comprising five nucleotides comprising a 2’OMe modification, wherein each internucleotde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- the agent further comprises a ligand.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising five nucleotides comprising a 2’MOE modification and a 3 ’-wing segment comprising five nucleotides comprising a 2’MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- the agent further comprises a ligand.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising five constrained ethyl nucleotides and a 3 ’-wing segment comprising five constrained ethyl nucleotides, wherein each internucleoitde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising five LNA nucleotides and a 3 ’-wing segment comprising five LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising four nucleotides comprising a 2’OMe modification and a 3 ’-wing segment comprising four nucleotides comprising a 2’OMe modification, wherein each internucleotde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent tof the invention comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising four nucleotides comprising a 2’MOE modification and a 3 ’-wing segment comprising four nucleotides comprising a 2’MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising four constrained ethyl nucleotides and a 3 ’-wing segment comprising four constrained ethyl nucleotides, wherein each internucleoitde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising four LNA nucleotides and a 3 ’-wing segment comprising four LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising three nucleotides comprising a 2’OMe modification and a 3 ’-wing segment comprising three nucleotides comprising a 2’OMe modification, wherein each internucleotde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising three nucleotides comprising a 2’MOE modification and a 3 ’-wing segment comprising three nucleotides comprising a 2’MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5- methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising three constrained ethyl nucleotides and a 3 ’-wing segment comprising three constrained ethyl nucleotides, wherein each internucleoitde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising three LNA nucleotides and a 3 ’-wing segment comprising three LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising two nucleotides comprising a 2’OMe modification and a 3 ’-wing segment comprising two nucleotides comprising a 2’OMe modification, wherein each internucleotde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'- deoxyribonucleotides positioned immediately adjacent to and between a 5 ’-wing segment comprising two nucleotides comprising a 2’MOE modification and a 3 ’-wing segment comprising two nucleotides comprising a 2’MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising two constrained ethyl nucleotides and a 3 ’-wing segment comprising two constrained ethyl nucleotides, wherein each internucleoitde linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- a polynucleotide agent of the invention comprises a gap segment of ten 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5’-wing segment comprising two LNA nucleotides and a 3’ -wing segment comprising two LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage.
- each cytosine of the agent is a 5-methylcytosine.
- nucleic acid inhibitor of the invention involves chemically linking to the nucleic acid inhibitor one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of th enucleic acid inhibitor.
- moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem.
- a thioether e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl.
- Acids Res., 20:533-538 an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl.
- a phospholipid e.g., di-hexadecyl-rac- g
- Acids Res., 18:3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).
- one or both of the dsRNA agents may independently comprise one or more ligands.
- a ligand alters the distribution, targeting or lifetime of a nucleic acid inhibitor into which it is incorporated.
- a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
- ligands will not take part in duplex pairing in a duplexed nucleic acid.
- Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or a lipid.
- the ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.
- polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-gly colied) copolymer, di vinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine.
- PLL polylysine
- poly L-aspartic acid poly L-glutamic acid
- styrene-maleic acid anhydride copolymer poly(L-lactide-co-gly colied) copolymer
- di vinyl ether-maleic anhydride copolymer di vinyl ether-maleic
- polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide -polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
- Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
- a cell or tissue targeting agent e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
- a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, poly glutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
- ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g.
- intercalating agents e.g. acridines
- cross-linkers e.g. psoralene, mitomycin C
- porphyrins TPPC4, texaphyrin, Sapphyrin
- polycyclic aromatic hydrocarbons e.g., phenazine, dihydrophenazine
- artificial endonucleases e.g.
- EDTA lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, l,3-Bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03- (oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEGK polyamino, alkyl, substituted al
- biotin e.g., aspirin, vitamin E, folic acid
- transport/absorption facilitators e.g., aspirin, vitamin E, folic acid
- synthetic ribonucleases e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine- imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
- Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell.
- Ligands can also include hormones and hormone receptors. They can also include non- peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.
- the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.
- the ligand can be a substance, e.g., a drug, which can increase the uptake of the nucleic acid inhibitor into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, and/or intermediate filaments.
- the drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
- a ligand attached to a nucleic acid inhibitor as described herein acts as a pharmacokinetic modulator (PK modulator).
- PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc.
- Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialky lglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc.
- Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases,
- ligands e.g. as PK modulating ligands
- aptamers that bind serum components are also suitable for use as PK modulating ligands in the embodiments described herein.
- Ligand-conjugated nucleic acid inhibitors of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below).
- This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
- oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.
- the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside -conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand- bearing building blocks.
- the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
- the ligand or conjugate is a lipid or lipid-based molecule.
- a lipid or lipid-based molecule binds a serum protein, e.g., human serum albumin (HSA).
- HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a nonkidney target tissue of the body.
- the target tissue can be the liver, including parenchymal cells of the liver.
- Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used.
- a lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.
- a serum protein e.g., HSA.
- a lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue.
- a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body.
- a lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
- the lipid based ligand binds HSA.
- HSA binds HSA with a sufficient affinity such that the conjugate will be distributed to a non-kidney tissue.
- the affinity it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.
- the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be distributed to the kidney.
- Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
- the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell.
- a target cell e.g., a proliferating cell.
- Exemplary vitamins include vitamin A, E, and K.
- Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells.
- B vitamin e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells.
- LDL low density lipoprotein
- the ligand is a cell-permeation agent, such as, a helical cell-permeation agent.
- the agent is amphipathic.
- An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids.
- the helical agent is an alpha-helical agent, which may have a lipophilic and a lipophobic phase.
- the ligand can be a peptide or peptidomimetic.
- a peptidomimetic also referred to herein as an oligopeptidomimetic is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide.
- the attachment of peptide and peptidomimetics to nucleic acid inhibitors can affect pharmacokinetic distribution of the nucleic acid inhibitor, such as by enhancing cellular recognition and absorption.
- the peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
- a peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g. , consisting primarily of Tyr, Trp or Phe).
- the peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide.
- the peptide moiety can include a hydrophobic membrane translocation sequence (MTS).
- An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 4154).
- An RFGF analogue e.g., amino acid sequence AAFFPVFFAAP (SEQ ID NO: 4151) containing a hydrophobic MTS can also be a targeting moiety.
- the peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes.
- sequences from the HIV Tat protein GRKKRRQRRRPPQ (SEQ ID NO: 4152) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 4153) have been found to be capable of functioning as delivery peptides.
- a peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage -display library, or one -bead-one -compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991).
- OBOC -bead-one -compound
- Examples of a peptide or peptidomimetic tethered to a nucleic acid inhibitor via an incorporated monomer unit for cell targeting purposes is an arginine -glycine-aspartic acid (RGD)-peptide, or RGD mimic.
- a peptide moiety can range in length from about 5 amino acids to about 40 amino acids.
- the peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
- RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glyciosylated or methylated, to facilitate targeting to a specific tissue(s).
- RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics.
- RGD one can use other moieties that target the integrin ligand. Exemplary conjugates of this ligand target PECAM-1 or VEGF.
- a “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell.
- a microbial cell-permeating peptide can be, for example, a a-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond- containing peptide (e.g., a -defensin, b-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin).
- a cell permeation peptide can also include a nuclear localization signal (NLS).
- NLS nuclear localization signal
- a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
- a nucleic acid inhibitor further comprises a carbohydrate.
- the carbohydrate conjugated nucleic acid inhibitors are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.
- “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
- Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums.
- Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
- one or both of the dsRNA agents may independently comprise one or more carbohydrate ligands.
- a carbohydrate conjugate for use in the compositions and In certain embodiments, a carbohydrate conjugate comprises a monosaccharide.
- the monosaccharide is an N-acetylgalactosamine (GalNAc).
- GalNAc conjugates which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in US 8,106,022, the entire content of which is hereby incorporated herein by reference.
- the GalNAc conjugate serves as a ligand that targets the nucleic acid inhibitor to particular cells.
- the GalNAc conjugate targets the nucleic acid inhibitor to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).
- the carbohydrate conjugate comprises one or more GalNAc derivatives.
- the GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker.
- the GalNAc conjugate is conjugated to the 3’ end of the sense strand.
- the GalNAc conjugate is conjugated to the nucleic acid inhibitor (e.g., to the 3’ end of the sense strand) via a linker, e.g., a linker as described herein.
- the GalNAc conjugate is conjugated to the 5’ end of the sense strand.
- the GalNAc conjugate is conjugated to the nucleic acid inhibitor (e.g., to the 5’ end of the sense strand) via a linker, e.g., a linker as described herein.
- the GalNAc or GalNAc derivative is attached to a nucleic acid inhibitor of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to a nucleic acid inhibitor of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to a nucleic acid inhibitor of the invention via a trivalent linker. In other embodiments of the invention, the GalNAc or GalNAc derivative is attached to a nucleic acid inhibitor of the invention via a tetravalent linker.
- the nucleic acid inhibitors of the invention comprise one GalNAc or GalNAc derivative attached to the nucleic acid inhibitor.
- the nucleic acid inhibitors of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the nucleic acid inhibitor through a plurality of monovalent linkers.
- each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
- the hairpin loop may also be formed by an extended overhang in one strand of the duplex.
- each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
- the hairpin loop may also be formed by an extended overhang in one strand of the duplex.
- the GalNAc conjugate is Formula II.
- the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S
- the RNAi agent is conjugated to L96 as defined in Table 1 and shown below:
- a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
- a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.
- the monosaccharide is an N- acetylgalactosamine, such as Formula II.
- Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,
- a suitable ligand is a ligand disclosed in WO 2019/055633, the entire contents of which are incorporated herein by reference.
- the ligand comprises the structure below:
- the nucleic acid inhibitors of the disclosure may include GalNAc ligands, even if such GalNAc ligands are currently projected to be of limited value for the intrathecal/CNS delivery route(s) of the instant disclosure.
- the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.
- Additional carbohydrate conjugates and linkers suitable for use in the present invention include those described in WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.
- one or both of the dsRNA agents may independently comprise a GalNAc or GalNAc derivative ligand.
- the conjugate or ligand described herein can be attached to a nucleic acid inhibitor with various linkers that can be cleavable or non cleavable.
- linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.
- Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(0)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylaryl
- a cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together.
- the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
- a first reference condition which can, e.g., be selected to mimic or represent intracellular conditions
- a second reference condition which can, e.g., be selected to mimic or represent conditions found in the blood or serum.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024503387A JP2024528659A (ja) | 2021-07-19 | 2022-07-18 | 非原発性高シュウ酸尿症疾患または障害を有するまたは発症するリスクがある対象を治療するための方法および組成物 |
| EP22754232.1A EP4373934A1 (en) | 2021-07-19 | 2022-07-18 | Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder |
| US18/403,862 US20240344070A1 (en) | 2021-07-19 | 2024-01-04 | Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163223278P | 2021-07-19 | 2021-07-19 | |
| US63/223,278 | 2021-07-19 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/403,862 Continuation US20240344070A1 (en) | 2021-07-19 | 2024-01-04 | Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023003805A1 true WO2023003805A1 (en) | 2023-01-26 |
Family
ID=82851707
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/037453 Ceased WO2023003805A1 (en) | 2021-07-19 | 2022-07-18 | Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20240344070A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4373934A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024528659A (cg-RX-API-DMAC7.html) |
| TW (1) | TW202333748A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023003805A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2026011785A1 (zh) * | 2024-07-10 | 2026-01-15 | 凯莱英医药集团(天津)股份有限公司 | 一种Nedosiran的制备方法 |
Citations (208)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US513030A (en) | 1894-01-16 | Machine for waxing or coating paper | ||
| US564562A (en) | 1896-07-21 | Joseph p | ||
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
| US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
| US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5177195A (en) | 1991-01-08 | 1993-01-05 | Imperial Chemical Industries Plc | Disazo dyes |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| WO1994002595A1 (en) | 1992-07-17 | 1994-02-03 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for treatment of animal diseases |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5405939A (en) | 1987-10-22 | 1995-04-11 | Temple University Of The Commonwealth System Of Higher Education | 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5455233A (en) | 1989-11-30 | 1995-10-03 | University Of North Carolina | Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
| US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5519126A (en) | 1988-03-25 | 1996-05-21 | University Of Virginia Alumni Patents Foundation | Oligonucleotide N-alkylphosphoramidates |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| US5541316A (en) | 1992-02-11 | 1996-07-30 | Henkel Kommanditgesellschaft Auf Aktien | Process for the production of polysaccharide-based polycarboxylates |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
| WO1997030731A2 (en) | 1996-02-21 | 1997-08-28 | The Immune Response Corporation | Method of preparing polynucleotide-carrier complexes for delivery to cells |
| US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5698685A (en) | 1985-03-15 | 1997-12-16 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
| US5705188A (en) | 1993-02-19 | 1998-01-06 | Nippon Shinyaku Company, Ltd. | Drug composition containing nucleic acid copolymer |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| WO1999014226A2 (en) | 1997-09-12 | 1999-03-25 | Exiqon A/S | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
| US6028188A (en) | 1993-11-16 | 2000-02-22 | Genta Incorporated | Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages |
| WO2000022114A1 (en) | 1998-10-09 | 2000-04-20 | Ingene, Inc. | PRODUCTION OF ssDNA $i(IN VIVO) |
| WO2000022113A1 (en) | 1998-10-09 | 2000-04-20 | Ingene, Inc. | ENZYMATIC SYNTHESIS OF ssDNA |
| US6054299A (en) | 1994-04-29 | 2000-04-25 | Conrad; Charles A. | Stem-loop cloning vector and method |
| US6124445A (en) | 1994-11-23 | 2000-09-26 | Isis Pharmaceuticals, Inc. | Phosphotriester oligonucleotides, amidities and method of preparation |
| US6160109A (en) | 1995-10-20 | 2000-12-12 | Isis Pharmaceuticals, Inc. | Preparation of phosphorothioate and boranophosphate oligomers |
| US6169170B1 (en) | 1994-03-18 | 2001-01-02 | Lynx Therapeutics, Inc. | Oligonucleotide N3′→N5′Phosphoramidate Duplexes |
| US6172209B1 (en) | 1997-02-14 | 2001-01-09 | Isis Pharmaceuticals Inc. | Aminooxy-modified oligonucleotides and methods for making same |
| US6191105B1 (en) | 1993-05-10 | 2001-02-20 | Protein Delivery, Inc. | Hydrophilic and lipophilic balanced microemulsion formulations of free-form and/or conjugation-stabilized therapeutic agents such as insulin |
| US6239265B1 (en) | 1990-01-11 | 2001-05-29 | Isis Pharmaceuticals, Inc. | Oligonucleotides having chiral phosphorus linkages |
| WO2001049687A2 (en) | 1999-12-30 | 2001-07-12 | K. U. Leuven Research & Development | Cyclohexene nucleic acids |
| US6268490B1 (en) | 1997-03-07 | 2001-07-31 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogues |
| US6277603B1 (en) | 1991-12-24 | 2001-08-21 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
| US6294664B1 (en) | 1993-07-29 | 2001-09-25 | Isis Pharmaceuticals, Inc. | Synthesis of oligonucleotides |
| US6320017B1 (en) | 1997-12-23 | 2001-11-20 | Inex Pharmaceuticals Corp. | Polyamide oligomers |
| US6326199B1 (en) | 1991-12-24 | 2001-12-04 | Isis Pharmaceuticals, Inc. | Gapped 2′ modified oligonucleotides |
| US6346614B1 (en) | 1992-07-23 | 2002-02-12 | Hybridon, Inc. | Hybrid oligonucleotide phosphorothioates |
| US6444423B1 (en) | 1996-06-07 | 2002-09-03 | Molecular Dynamics, Inc. | Nucleosides comprising polydentate ligands |
| US20030027780A1 (en) | 1999-02-23 | 2003-02-06 | Hardee Gregory E. | Multiparticulate formulation |
| US6525191B1 (en) | 1999-05-11 | 2003-02-25 | Kanda S. Ramasamy | Conformationally constrained L-nucleosides |
| US6531590B1 (en) | 1998-04-24 | 2003-03-11 | Isis Pharmaceuticals, Inc. | Processes for the synthesis of oligonucleotide compounds |
| US6534639B1 (en) | 1999-07-07 | 2003-03-18 | Isis Pharmaceuticals, Inc. | Guanidinium functionalized oligonucleotides and method/synthesis |
| US6576752B1 (en) | 1997-02-14 | 2003-06-10 | Isis Pharmaceuticals, Inc. | Aminooxy functionalized oligomers |
| US6608035B1 (en) | 1994-10-25 | 2003-08-19 | Hybridon, Inc. | Method of down-regulating gene expression |
| US6670461B1 (en) | 1997-09-12 | 2003-12-30 | Exiqon A/S | Oligonucleotide analogues |
| US6747014B2 (en) | 1997-07-01 | 2004-06-08 | Isis Pharmaceuticals, Inc. | Compositions and methods for non-parenteral delivery of oligonucleotides |
| US6770748B2 (en) | 1997-03-07 | 2004-08-03 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogue |
| US6783931B1 (en) | 1990-01-11 | 2004-08-31 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US20040171570A1 (en) | 2002-11-05 | 2004-09-02 | Charles Allerson | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
| US6858715B2 (en) | 1999-02-04 | 2005-02-22 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
| US6867294B1 (en) | 1998-07-14 | 2005-03-15 | Isis Pharmaceuticals, Inc. | Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages |
| US6878805B2 (en) | 2002-08-16 | 2005-04-12 | Isis Pharmaceuticals, Inc. | Peptide-conjugated oligomeric compounds |
| US20050130923A1 (en) | 2003-09-18 | 2005-06-16 | Balkrishen Bhat | 4'-thionucleosides and oligomeric compounds |
| US6998484B2 (en) | 2000-10-04 | 2006-02-14 | Santaris Pharma A/S | Synthesis of purine locked nucleic acid analogues |
| US7015315B1 (en) | 1991-12-24 | 2006-03-21 | Isis Pharmaceuticals, Inc. | Gapped oligonucleotides |
| US7037646B1 (en) | 1990-01-11 | 2006-05-02 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| WO2006047842A2 (en) | 2004-11-08 | 2006-05-11 | K.U. Leuven Research And Development | Modified nucleosides for rna interference |
| US7053207B2 (en) | 1999-05-04 | 2006-05-30 | Exiqon A/S | L-ribo-LNA analogues |
| US20060128646A1 (en) | 2002-11-18 | 2006-06-15 | Santaris Pharma A/S | Antisense design |
| US7063860B2 (en) | 2001-08-13 | 2006-06-20 | University Of Pittsburgh | Application of lipid vehicles and use for drug delivery |
| US7070802B1 (en) | 1996-01-22 | 2006-07-04 | Pliva, Inc. | Pharmaceutical compositions for lipophilic drugs |
| US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
| US7157099B2 (en) | 2000-05-26 | 2007-01-02 | Italfarmaco S.P.A. | Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds |
| WO2007091269A2 (en) | 2006-02-08 | 2007-08-16 | Quark Pharmaceuticals, Inc. | NOVEL TANDEM siRNAS |
| US7273933B1 (en) | 1998-02-26 | 2007-09-25 | Isis Pharmaceuticals, Inc. | Methods for synthesis of oligonucleotides |
| WO2007117686A2 (en) | 2006-04-07 | 2007-10-18 | Idera Pharmaceuticals, Inc. | Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8 |
| WO2007134181A2 (en) | 2006-05-11 | 2007-11-22 | Isis Pharmaceuticals, Inc. | 5'-modified bicyclic nucleic acid analogs |
| US20080015162A1 (en) | 2006-05-05 | 2008-01-17 | Sanjay Bhanot | Compounds and methods for modulating gene expression |
| US7321029B2 (en) | 2000-01-21 | 2008-01-22 | Geron Corporation | 2′-arabino-fluorooligonucleotide N3′→P5′ phosphoramidates: their synthesis and use |
| US20080039618A1 (en) | 2002-11-05 | 2008-02-14 | Charles Allerson | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
| US7399845B2 (en) | 2006-01-27 | 2008-07-15 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| WO2008101157A1 (en) | 2007-02-15 | 2008-08-21 | Isis Pharmaceuticals, Inc. | 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom |
| US7427672B2 (en) | 2003-08-28 | 2008-09-23 | Takeshi Imanishi | Artificial nucleic acids of n-o bond crosslinkage type |
| US7427605B2 (en) | 2005-03-31 | 2008-09-23 | Calando Pharmaceuticals, Inc. | Inhibitors of ribonucleotide reductase subunit 2 and uses thereof |
| WO2009014887A2 (en) | 2007-07-09 | 2009-01-29 | Idera Pharmaceuticals, Inc. | Stabilized immune modulatory rna (simra) compounds |
| US7569686B1 (en) | 2006-01-27 | 2009-08-04 | Isis Pharmaceuticals, Inc. | Compounds and methods for synthesis of bicyclic nucleic acid analogs |
| WO2010036696A1 (en) | 2008-09-24 | 2010-04-01 | Isis Pharmaceuticals, Inc. | Cyclohexenyl nucleic acid analogs |
| US20100210712A1 (en) | 2007-03-22 | 2010-08-19 | Santaris Pharma A/S | Short RNA Antagonist Compounds for the Modulation of Target mRNA |
| WO2010141511A2 (en) | 2009-06-01 | 2010-12-09 | Halo-Bio Rnai Therapeutics, Inc. | Polynucleotides for multivalent rna interference, compositions and methods of use thereof |
| US7858769B2 (en) | 2004-02-10 | 2010-12-28 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA) |
| WO2011005861A1 (en) | 2009-07-07 | 2011-01-13 | Alnylam Pharmaceuticals, Inc. | Oligonucleotide end caps |
| WO2011031520A1 (en) | 2009-08-27 | 2011-03-17 | Idera Pharmaceuticals, Inc. | Composition for inhibiting gene expression and uses thereof |
| US20110313020A1 (en) | 2008-12-03 | 2011-12-22 | Marina Biotech, Inc. | UsiRNA Complexes |
| US8101348B2 (en) | 2002-07-10 | 2012-01-24 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | RNA-interference by single-stranded RNA molecules |
| US8106022B2 (en) | 2007-12-04 | 2012-01-31 | Alnylam Pharmaceuticals, Inc. | Carbohydrate conjugates as delivery agents for oligonucleotides |
| US20120157511A1 (en) | 2009-07-07 | 2012-06-21 | Alnylam Pharmaceuticals, Inc. | 5' phosphate mimics |
| US8278425B2 (en) | 2007-05-30 | 2012-10-02 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
| US8278283B2 (en) | 2007-07-05 | 2012-10-02 | Isis Pharmaceuticals, Inc. | 6-disubstituted or unsaturated bicyclic nucleic acid analogs |
| US8278426B2 (en) | 2007-06-08 | 2012-10-02 | Isis Pharmaceuticals, Inc. | Carbocyclic bicyclic nucleic acid analogs |
| US8314227B2 (en) | 2007-05-22 | 2012-11-20 | Marina Biotech, Inc. | Hydroxymethyl substituted RNA oligonucleotides and RNA complexes |
| US20130011922A1 (en) | 2007-03-02 | 2013-01-10 | F/K/A Mdrna, Inc. | Nucleic acid compounds for inhibiting gene expression and uses thereof |
| WO2013036868A1 (en) | 2011-09-07 | 2013-03-14 | Marina Biotech Inc. | Synthesis and uses of nucleic acid compounds with conformationally restricted monomers |
| WO2013075035A1 (en) | 2011-11-18 | 2013-05-23 | Alnylam Pharmaceuticals | Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases |
| US20130190383A1 (en) | 2010-04-26 | 2013-07-25 | Marina Biotech, Inc. | Nucleic acid compounds with conformationally restricted monomers and uses thereof |
| WO2013159108A2 (en) | 2012-04-20 | 2013-10-24 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
| WO2014179627A2 (en) | 2013-05-01 | 2014-11-06 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulating hbv and ttr expression |
| WO2015100436A1 (en) * | 2013-12-27 | 2015-07-02 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of glycolate oxidase (hao1) by double-stranded rna |
| US9187746B2 (en) | 2009-09-22 | 2015-11-17 | Alnylam Pharmaceuticals, Inc. | Dual targeting siRNA agents |
| WO2016205323A1 (en) * | 2015-06-18 | 2016-12-22 | Alnylam Pharmaceuticals, Inc. | Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof |
| US20170306332A1 (en) | 2014-10-10 | 2017-10-26 | Dicerna Pharmaceuticals, Inc. | Therapeutic inhibition of lactate dehydrogenase and agents therefor |
| US20170304446A1 (en) | 2014-10-10 | 2017-10-26 | Alnylam Pharmaceuticals, Inc. | Compositions and Methods for Inhibition of HAO1 (Hydroxyacid Oxidase 1 (Glycolate Oxidase)) Gene Expression |
| WO2019014491A1 (en) * | 2017-07-13 | 2019-01-17 | Alnylam Pharmaceuticals, Inc. | METHODS OF INHIBITING GENE EXPRESSION OF HAO1 (HYDROXYACID OXIDASE 1 (GLYCOLATE OXIDASE)) |
| WO2019014530A1 (en) | 2017-07-13 | 2019-01-17 | Alnylam Pharmaceuticals Inc. | LACTATE DEHYDROGENASE A (LDHA) RNAI COMPOSITIONS AND METHODS OF USE |
| WO2019055633A1 (en) | 2017-09-14 | 2019-03-21 | Arrowhead Pharmaceuticals, Inc. | RNAI AGENTS AND COMPOSITIONS FOR INHIBITING ANALOGUE EXPRESSION OF ANGIOPOIETIN 3 (ANGPTL3) AND METHODS OF USE |
| WO2019075419A1 (en) | 2017-10-13 | 2019-04-18 | Dicerna Pharmaceuticals, Inc. | METHODS AND COMPOSITIONS FOR INHIBITING LDHA EXPRESSION |
| WO2022119873A1 (en) * | 2020-12-01 | 2022-06-09 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression |
-
2022
- 2022-07-18 WO PCT/US2022/037453 patent/WO2023003805A1/en not_active Ceased
- 2022-07-18 TW TW111126889A patent/TW202333748A/zh unknown
- 2022-07-18 EP EP22754232.1A patent/EP4373934A1/en active Pending
- 2022-07-18 JP JP2024503387A patent/JP2024528659A/ja active Pending
-
2024
- 2024-01-04 US US18/403,862 patent/US20240344070A1/en active Pending
Patent Citations (247)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US513030A (en) | 1894-01-16 | Machine for waxing or coating paper | ||
| US564562A (en) | 1896-07-21 | Joseph p | ||
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| US4789737A (en) | 1982-08-09 | 1988-12-06 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives and production thereof |
| US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US5541313A (en) | 1983-02-22 | 1996-07-30 | Molecular Biosystems, Inc. | Single-stranded labelled oligonucleotides of preselected sequence |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
| US5552538A (en) | 1984-10-16 | 1996-09-03 | Chiron Corporation | Oligonucleotides with cleavable sites |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| US5578717A (en) | 1984-10-16 | 1996-11-26 | Chiron Corporation | Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5698685A (en) | 1985-03-15 | 1997-12-16 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5286717A (en) | 1987-03-25 | 1994-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US5405939A (en) | 1987-10-22 | 1995-04-11 | Temple University Of The Commonwealth System Of Higher Education | 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| US5519126A (en) | 1988-03-25 | 1996-05-21 | University Of Virginia Alumni Patents Foundation | Oligonucleotide N-alkylphosphoramidates |
| US5453496A (en) | 1988-05-26 | 1995-09-26 | University Patents, Inc. | Polynucleotide phosphorodithioate |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US5416203A (en) | 1989-06-06 | 1995-05-16 | Northwestern University | Steroid modified oligonucleotides |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5466786B1 (en) | 1989-10-24 | 1998-04-07 | Gilead Sciences | 2' Modified nucleoside and nucleotide compounds |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5455233A (en) | 1989-11-30 | 1995-10-03 | University Of North Carolina | Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US6900297B1 (en) | 1990-01-11 | 2005-05-31 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US7037646B1 (en) | 1990-01-11 | 2006-05-02 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US6783931B1 (en) | 1990-01-11 | 2004-08-31 | Isis Pharmaceuticals, Inc. | Amine-derivatized nucleosides and oligonucleosides |
| US6239265B1 (en) | 1990-01-11 | 2001-05-29 | Isis Pharmaceuticals, Inc. | Oligonucleotides having chiral phosphorus linkages |
| US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5563253A (en) | 1990-03-08 | 1996-10-08 | Worcester Foundation For Biomedical Research | Linear aminoalkylphosphoramidate oligonucleotide derivatives |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| US5536821A (en) | 1990-03-08 | 1996-07-16 | Worcester Foundation For Biomedical Research | Aminoalkylphosphorothioamidate oligonucleotide deratives |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5567810A (en) | 1990-08-03 | 1996-10-22 | Sterling Drug, Inc. | Nuclease resistant compounds |
| US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
| US5177195A (en) | 1991-01-08 | 1993-01-05 | Imperial Chemical Industries Plc | Disazo dyes |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5393878A (en) | 1991-10-17 | 1995-02-28 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US6277603B1 (en) | 1991-12-24 | 2001-08-21 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
| US6326199B1 (en) | 1991-12-24 | 2001-12-04 | Isis Pharmaceuticals, Inc. | Gapped 2′ modified oligonucleotides |
| US7015315B1 (en) | 1991-12-24 | 2006-03-21 | Isis Pharmaceuticals, Inc. | Gapped oligonucleotides |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
| US5541316A (en) | 1992-02-11 | 1996-07-30 | Henkel Kommanditgesellschaft Auf Aktien | Process for the production of polysaccharide-based polycarboxylates |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5700920A (en) | 1992-07-01 | 1997-12-23 | Novartis Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| WO1994002595A1 (en) | 1992-07-17 | 1994-02-03 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for treatment of animal diseases |
| US6683167B2 (en) | 1992-07-23 | 2004-01-27 | University Of Massachusetts Worcester | Hybrid oligonucleotide phosphorothioates |
| US6346614B1 (en) | 1992-07-23 | 2002-02-12 | Hybridon, Inc. | Hybrid oligonucleotide phosphorothioates |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| US5705188A (en) | 1993-02-19 | 1998-01-06 | Nippon Shinyaku Company, Ltd. | Drug composition containing nucleic acid copolymer |
| US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
| US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
| US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US6191105B1 (en) | 1993-05-10 | 2001-02-20 | Protein Delivery, Inc. | Hydrophilic and lipophilic balanced microemulsion formulations of free-form and/or conjugation-stabilized therapeutic agents such as insulin |
| US6294664B1 (en) | 1993-07-29 | 2001-09-25 | Isis Pharmaceuticals, Inc. | Synthesis of oligonucleotides |
| US6028188A (en) | 1993-11-16 | 2000-02-22 | Genta Incorporated | Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
| US6169170B1 (en) | 1994-03-18 | 2001-01-02 | Lynx Therapeutics, Inc. | Oligonucleotide N3′→N5′Phosphoramidate Duplexes |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| US6054299A (en) | 1994-04-29 | 2000-04-25 | Conrad; Charles A. | Stem-loop cloning vector and method |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5591584A (en) | 1994-08-25 | 1997-01-07 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US6608035B1 (en) | 1994-10-25 | 2003-08-19 | Hybridon, Inc. | Method of down-regulating gene expression |
| US6124445A (en) | 1994-11-23 | 2000-09-26 | Isis Pharmaceuticals, Inc. | Phosphotriester oligonucleotides, amidities and method of preparation |
| US6160109A (en) | 1995-10-20 | 2000-12-12 | Isis Pharmaceuticals, Inc. | Preparation of phosphorothioate and boranophosphate oligomers |
| US7070802B1 (en) | 1996-01-22 | 2006-07-04 | Pliva, Inc. | Pharmaceutical compositions for lipophilic drugs |
| WO1997030731A2 (en) | 1996-02-21 | 1997-08-28 | The Immune Response Corporation | Method of preparing polynucleotide-carrier complexes for delivery to cells |
| US6444423B1 (en) | 1996-06-07 | 2002-09-03 | Molecular Dynamics, Inc. | Nucleosides comprising polydentate ligands |
| US6172209B1 (en) | 1997-02-14 | 2001-01-09 | Isis Pharmaceuticals Inc. | Aminooxy-modified oligonucleotides and methods for making same |
| US6576752B1 (en) | 1997-02-14 | 2003-06-10 | Isis Pharmaceuticals, Inc. | Aminooxy functionalized oligomers |
| US6268490B1 (en) | 1997-03-07 | 2001-07-31 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogues |
| US6770748B2 (en) | 1997-03-07 | 2004-08-03 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogue |
| US6887906B1 (en) | 1997-07-01 | 2005-05-03 | Isispharmaceuticals, Inc. | Compositions and methods for the delivery of oligonucleotides via the alimentary canal |
| US6747014B2 (en) | 1997-07-01 | 2004-06-08 | Isis Pharmaceuticals, Inc. | Compositions and methods for non-parenteral delivery of oligonucleotides |
| US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
| US7034133B2 (en) | 1997-09-12 | 2006-04-25 | Exiqon A/S | Oligonucleotide analogues |
| WO1999014226A2 (en) | 1997-09-12 | 1999-03-25 | Exiqon A/S | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
| US6670461B1 (en) | 1997-09-12 | 2003-12-30 | Exiqon A/S | Oligonucleotide analogues |
| US6320017B1 (en) | 1997-12-23 | 2001-11-20 | Inex Pharmaceuticals Corp. | Polyamide oligomers |
| US7273933B1 (en) | 1998-02-26 | 2007-09-25 | Isis Pharmaceuticals, Inc. | Methods for synthesis of oligonucleotides |
| US6531590B1 (en) | 1998-04-24 | 2003-03-11 | Isis Pharmaceuticals, Inc. | Processes for the synthesis of oligonucleotide compounds |
| US6867294B1 (en) | 1998-07-14 | 2005-03-15 | Isis Pharmaceuticals, Inc. | Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages |
| USRE39464E1 (en) | 1998-07-14 | 2007-01-09 | Isis Pharmaceuticals Inc. | Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages |
| WO2000022114A1 (en) | 1998-10-09 | 2000-04-20 | Ingene, Inc. | PRODUCTION OF ssDNA $i(IN VIVO) |
| WO2000022113A1 (en) | 1998-10-09 | 2000-04-20 | Ingene, Inc. | ENZYMATIC SYNTHESIS OF ssDNA |
| US6858715B2 (en) | 1999-02-04 | 2005-02-22 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
| US7041816B2 (en) | 1999-02-04 | 2006-05-09 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
| US20030027780A1 (en) | 1999-02-23 | 2003-02-06 | Hardee Gregory E. | Multiparticulate formulation |
| US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
| US7053207B2 (en) | 1999-05-04 | 2006-05-30 | Exiqon A/S | L-ribo-LNA analogues |
| US6525191B1 (en) | 1999-05-11 | 2003-02-25 | Kanda S. Ramasamy | Conformationally constrained L-nucleosides |
| US6534639B1 (en) | 1999-07-07 | 2003-03-18 | Isis Pharmaceuticals, Inc. | Guanidinium functionalized oligonucleotides and method/synthesis |
| WO2001049687A2 (en) | 1999-12-30 | 2001-07-12 | K. U. Leuven Research & Development | Cyclohexene nucleic acids |
| US7321029B2 (en) | 2000-01-21 | 2008-01-22 | Geron Corporation | 2′-arabino-fluorooligonucleotide N3′→P5′ phosphoramidates: their synthesis and use |
| US7157099B2 (en) | 2000-05-26 | 2007-01-02 | Italfarmaco S.P.A. | Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds |
| US6998484B2 (en) | 2000-10-04 | 2006-02-14 | Santaris Pharma A/S | Synthesis of purine locked nucleic acid analogues |
| US7063860B2 (en) | 2001-08-13 | 2006-06-20 | University Of Pittsburgh | Application of lipid vehicles and use for drug delivery |
| US8101348B2 (en) | 2002-07-10 | 2012-01-24 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | RNA-interference by single-stranded RNA molecules |
| US6878805B2 (en) | 2002-08-16 | 2005-04-12 | Isis Pharmaceuticals, Inc. | Peptide-conjugated oligomeric compounds |
| US20080039618A1 (en) | 2002-11-05 | 2008-02-14 | Charles Allerson | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
| US20040171570A1 (en) | 2002-11-05 | 2004-09-02 | Charles Allerson | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
| US20060128646A1 (en) | 2002-11-18 | 2006-06-15 | Santaris Pharma A/S | Antisense design |
| US20140128586A1 (en) | 2002-11-18 | 2014-05-08 | Santaris Pharma A/S | Amino-lna, thio-lna and alpha-l-oxy-ln |
| US7687617B2 (en) | 2002-11-18 | 2010-03-30 | Santaris Pharma A/S | Oligonucleotides with alternating segments of locked and non-locked nucleotides |
| US20090209748A1 (en) | 2002-11-18 | 2009-08-20 | Santaris Pharma A/S | Oligonucleotides with alternating segments of locked and non-locked nucleotides |
| US20140128591A1 (en) | 2002-11-18 | 2014-05-08 | Santaris Pharma A/S | Antisense design |
| US7427672B2 (en) | 2003-08-28 | 2008-09-23 | Takeshi Imanishi | Artificial nucleic acids of n-o bond crosslinkage type |
| US20050130923A1 (en) | 2003-09-18 | 2005-06-16 | Balkrishen Bhat | 4'-thionucleosides and oligomeric compounds |
| US7858769B2 (en) | 2004-02-10 | 2010-12-28 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA) |
| WO2006047842A2 (en) | 2004-11-08 | 2006-05-11 | K.U. Leuven Research And Development | Modified nucleosides for rna interference |
| US7427605B2 (en) | 2005-03-31 | 2008-09-23 | Calando Pharmaceuticals, Inc. | Inhibitors of ribonucleotide reductase subunit 2 and uses thereof |
| US7741457B2 (en) | 2006-01-27 | 2010-06-22 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| US8022193B2 (en) | 2006-01-27 | 2011-09-20 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| US7569686B1 (en) | 2006-01-27 | 2009-08-04 | Isis Pharmaceuticals, Inc. | Compounds and methods for synthesis of bicyclic nucleic acid analogs |
| US20090012281A1 (en) | 2006-01-27 | 2009-01-08 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| US7399845B2 (en) | 2006-01-27 | 2008-07-15 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| WO2007091269A2 (en) | 2006-02-08 | 2007-08-16 | Quark Pharmaceuticals, Inc. | NOVEL TANDEM siRNAS |
| WO2007117686A2 (en) | 2006-04-07 | 2007-10-18 | Idera Pharmaceuticals, Inc. | Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8 |
| US20080015162A1 (en) | 2006-05-05 | 2008-01-17 | Sanjay Bhanot | Compounds and methods for modulating gene expression |
| US8030467B2 (en) | 2006-05-11 | 2011-10-04 | Isis Pharmaceuticals, Inc. | 5′-modified bicyclic nucleic acid analogs |
| WO2007134181A2 (en) | 2006-05-11 | 2007-11-22 | Isis Pharmaceuticals, Inc. | 5'-modified bicyclic nucleic acid analogs |
| WO2008101157A1 (en) | 2007-02-15 | 2008-08-21 | Isis Pharmaceuticals, Inc. | 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom |
| US20130011922A1 (en) | 2007-03-02 | 2013-01-10 | F/K/A Mdrna, Inc. | Nucleic acid compounds for inhibiting gene expression and uses thereof |
| US8580756B2 (en) | 2007-03-22 | 2013-11-12 | Santaris Pharma A/S | Short oligomer antagonist compounds for the modulation of target mRNA |
| US20100210712A1 (en) | 2007-03-22 | 2010-08-19 | Santaris Pharma A/S | Short RNA Antagonist Compounds for the Modulation of Target mRNA |
| US20130096289A1 (en) | 2007-05-22 | 2013-04-18 | Marina Biotech, Inc. | Hydroxymethyl substituted rna oligonucleotides and rna complexes |
| US8314227B2 (en) | 2007-05-22 | 2012-11-20 | Marina Biotech, Inc. | Hydroxymethyl substituted RNA oligonucleotides and RNA complexes |
| US8278425B2 (en) | 2007-05-30 | 2012-10-02 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
| US8278426B2 (en) | 2007-06-08 | 2012-10-02 | Isis Pharmaceuticals, Inc. | Carbocyclic bicyclic nucleic acid analogs |
| US8278283B2 (en) | 2007-07-05 | 2012-10-02 | Isis Pharmaceuticals, Inc. | 6-disubstituted or unsaturated bicyclic nucleic acid analogs |
| WO2009014887A2 (en) | 2007-07-09 | 2009-01-29 | Idera Pharmaceuticals, Inc. | Stabilized immune modulatory rna (simra) compounds |
| US8106022B2 (en) | 2007-12-04 | 2012-01-31 | Alnylam Pharmaceuticals, Inc. | Carbohydrate conjugates as delivery agents for oligonucleotides |
| WO2010036696A1 (en) | 2008-09-24 | 2010-04-01 | Isis Pharmaceuticals, Inc. | Cyclohexenyl nucleic acid analogs |
| US20110313020A1 (en) | 2008-12-03 | 2011-12-22 | Marina Biotech, Inc. | UsiRNA Complexes |
| WO2010141511A2 (en) | 2009-06-01 | 2010-12-09 | Halo-Bio Rnai Therapeutics, Inc. | Polynucleotides for multivalent rna interference, compositions and methods of use thereof |
| WO2011005861A1 (en) | 2009-07-07 | 2011-01-13 | Alnylam Pharmaceuticals, Inc. | Oligonucleotide end caps |
| US20120157511A1 (en) | 2009-07-07 | 2012-06-21 | Alnylam Pharmaceuticals, Inc. | 5' phosphate mimics |
| WO2011031520A1 (en) | 2009-08-27 | 2011-03-17 | Idera Pharmaceuticals, Inc. | Composition for inhibiting gene expression and uses thereof |
| US9187746B2 (en) | 2009-09-22 | 2015-11-17 | Alnylam Pharmaceuticals, Inc. | Dual targeting siRNA agents |
| US20130190383A1 (en) | 2010-04-26 | 2013-07-25 | Marina Biotech, Inc. | Nucleic acid compounds with conformationally restricted monomers and uses thereof |
| WO2013036868A1 (en) | 2011-09-07 | 2013-03-14 | Marina Biotech Inc. | Synthesis and uses of nucleic acid compounds with conformationally restricted monomers |
| WO2013075035A1 (en) | 2011-11-18 | 2013-05-23 | Alnylam Pharmaceuticals | Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases |
| WO2013159108A2 (en) | 2012-04-20 | 2013-10-24 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
| WO2014179620A1 (en) | 2013-05-01 | 2014-11-06 | Isis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| WO2014179627A2 (en) | 2013-05-01 | 2014-11-06 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulating hbv and ttr expression |
| WO2015100436A1 (en) * | 2013-12-27 | 2015-07-02 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of glycolate oxidase (hao1) by double-stranded rna |
| US10351854B2 (en) | 2014-10-10 | 2019-07-16 | Dicerna Pharmaceuticals, Inc. | Therapeutic inhibition of lactate dehydrogenase and agents therefor |
| US20170306332A1 (en) | 2014-10-10 | 2017-10-26 | Dicerna Pharmaceuticals, Inc. | Therapeutic inhibition of lactate dehydrogenase and agents therefor |
| US20170304446A1 (en) | 2014-10-10 | 2017-10-26 | Alnylam Pharmaceuticals, Inc. | Compositions and Methods for Inhibition of HAO1 (Hydroxyacid Oxidase 1 (Glycolate Oxidase)) Gene Expression |
| US10478500B2 (en) | 2014-10-10 | 2019-11-19 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibition of HAO1 (Hydroxyacid Oxidase 1 (Glycolate Oxidase)) gene expression |
| US20190323014A1 (en) | 2014-10-10 | 2019-10-24 | Dicerna Pharmaceuticals, Inc. | Therapeutic inhibition of lactate dehydrogenase and agents therefor |
| WO2016205323A1 (en) * | 2015-06-18 | 2016-12-22 | Alnylam Pharmaceuticals, Inc. | Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof |
| US20180092990A1 (en) | 2015-06-18 | 2018-04-05 | Alnylam Pharmaceuticals, Inc. | Polynucleotide agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof |
| WO2019014491A1 (en) * | 2017-07-13 | 2019-01-17 | Alnylam Pharmaceuticals, Inc. | METHODS OF INHIBITING GENE EXPRESSION OF HAO1 (HYDROXYACID OXIDASE 1 (GLYCOLATE OXIDASE)) |
| WO2019014530A1 (en) | 2017-07-13 | 2019-01-17 | Alnylam Pharmaceuticals Inc. | LACTATE DEHYDROGENASE A (LDHA) RNAI COMPOSITIONS AND METHODS OF USE |
| US20200113927A1 (en) | 2017-07-13 | 2020-04-16 | Alnylam Pharmaceuticals, Inc. | LACTATE DEHYDROGENASE A (LDHA) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
| WO2019055633A1 (en) | 2017-09-14 | 2019-03-21 | Arrowhead Pharmaceuticals, Inc. | RNAI AGENTS AND COMPOSITIONS FOR INHIBITING ANALOGUE EXPRESSION OF ANGIOPOIETIN 3 (ANGPTL3) AND METHODS OF USE |
| WO2019075419A1 (en) | 2017-10-13 | 2019-04-18 | Dicerna Pharmaceuticals, Inc. | METHODS AND COMPOSITIONS FOR INHIBITING LDHA EXPRESSION |
| WO2022119873A1 (en) * | 2020-12-01 | 2022-06-09 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression |
Non-Patent Citations (117)
| Title |
|---|
| ABIGAIL LIEBOW ET AL: "An Investigational RNAi Therapeutic Targeting Glycolate Oxidase Reduces Oxalate Production in Models of Primary Hyperoxaluria", JOURNAL OF THE AMERICAN SOCIETY OF NEPHROLOGY, vol. 28, no. 2, 18 July 2016 (2016-07-18), US, pages 494 - 503, XP055633228, ISSN: 1046-6673, DOI: 10.1681/ASN.2016030338 * |
| AIGNER, A., J. BIOMED. BIOTECHNOL., 2006, pages 71659 |
| AKANEYA,Y. ET AL., J. NEUROPHYSIOL., vol. 93, 2005, pages 594 - 602 |
| AKHTAR S. AND JULIAN RL., TRENDS CELL. BIOL., vol. 2, no. 5, 1992, pages 139 - 144 |
| ALLEN, LV.POPOVICH NG.ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS |
| ANN INTERN MED., vol. 150, no. 9, 5 May 2009 (2009-05-05), pages 604 - 12 |
| ARNOLD, AS ET AL., J. HYPERTENS., vol. 25, 2007, pages 197 - 205 |
| BELOSTOTSKY RUTH ET AL: "Novel therapeutic approaches for the primary hyperoxalurias", PEDIATRIC NEPHROLOGY, vol. 36, no. 9, 6 November 2020 (2020-11-06), pages 2593 - 2606, XP037540811, ISSN: 0931-041X, [retrieved on 20201106], DOI: 10.1007/S00467-020-04817-8 * |
| BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363 |
| BITKO, V. ET AL., NAT. MED., vol. 11, 2005, pages 50 - 55 |
| BONNET ME. ET AL., PHARM. RES., 2008 |
| BORGH ET AL., N ENGL J MED., vol. 346, no. 2, 10 January 2002 (2002-01-10), pages 77 - 84 |
| BRAASCH ET AL., BIOCHEMISTRY, vol. 41, 2002, pages 4503 - 4510 |
| BUUR ET AL., J. CONTROL REL., vol. 14, 1990, pages 43 - 51 |
| CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134 |
| CHIEN, PY. ET AL., CANCER GENE THER., vol. 12, 2005, pages 321 - 328 |
| CHURANA, RNA, vol. 14, 2007, pages 1714 - 1719 |
| CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385 - 1390 |
| COUTURE, A ET AL., TIG., vol. 12, 1996, pages 5 - 10 |
| CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937 |
| CURHANTAYLOR, KIDNEY INT., vol. 73, no. 4, February 2008 (2008-02-01), pages 489 - 96 |
| DHONDUP ET AL., AM J KIDNEY DIS., vol. 72, no. 6, December 2018 (2018-12-01), pages 790 - 72018 |
| DORN, G. ET AL., NUCLEIC ACIDS, vol. 32, 2004, pages e49 |
| EL HARIRI ET AL., J. PHARM. PHARMACOL., vol. 44, 1992, pages 651 - 654 |
| ELBASHIR ET AL., EMBO J., vol. 20, 2001, pages 6877 - 6888 |
| ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 |
| FERRAR ET AL., J UROL., vol. 200, no. 5, November 2018 (2018-11-01), pages 1082 - 7 |
| FLUITER ET AL., MOL. BIOSYST., vol. 10, 2009, pages 1039 |
| GASSMANN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 1292 |
| GRUNWELLER, A. ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 2003, pages 3185 - 3193 |
| GU ET AL., NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 24, no. 5-7, 2005, pages 993 - 998 |
| GU ET AL., OLIGONUCLEOTIDES, vol. 13, no. 6, 2003, pages 479 - 489 |
| GU ET AL., TETRAHEDRON, vol. 60, no. 9, 2004, pages 2111 - 2123 |
| HEILBERG ET AL., ENDOCRINOL METABOL., vol. 50, no. 4, August 2006 (2006-08-01), pages 823 - 31 |
| HO ET AL., J. PHARM. SCI., vol. 85, 1996, pages 138 - 143 |
| HORVATH ET AL., TETRAHEDRON LETTERS, vol. 48, 2007, pages 3621 - 3623 |
| JARRETT, J. CHROMATOGR., vol. 618, 1993, pages 315 - 339 |
| KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330 |
| KATDARE, A. ET AL.: "Excipient development for pharmaceutical, biotechnology, and drug delivery", 2006, CRC PRESS |
| KIM ET AL., NAT BIOTECH, vol. 23, 2005, pages 222 - 226 |
| KIM SH. ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 129, no. 2, 2008, pages 107 - 116 |
| KIM, WJ. ET AL., MOL. THER., vol. 14, 2006, pages 476 - 484 |
| KNIGHT ET AL., AM J PHYSIOL RENAL PHYSIOL, vol. 302, no. 6, 2011, pages F688 - F693 |
| KUBO, T. ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 365, no. 1, 2007, pages 54 - 61 |
| LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84 |
| LEE ET AL., CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, 1991, pages 92 |
| LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 |
| LETSINGER ET AL., PROC. NATL. ACID. SCI. USA, vol. 86, 1989, pages 6553 - 6556 |
| LEUMANN, BIOORG. MED. CHEM., vol. 10, 2002, pages 841 - 854 |
| LEUNGSHAH: "Controlled Release of Drugs: Polymers and Aggregate Systems", 1989, VCH PUBLISHERS, pages: 185 - 215 |
| LI XINGSHENG ET AL: "Metabolism of13C5-hydroxyproline in mouse models of Primary Hyperoxaluria and its inhibition by RNAi therapeutics targeting liver glycolate oxidase and hydroxyproline dehydrogenase", BIOCHIMICA ET BIOPHYSICA ACTA. MOLECULAR BASIS OF DISEASE, vol. 1862, no. 2, 2 December 2015 (2015-12-02), pages 233 - 239, XP029375493, ISSN: 0925-4439, DOI: 10.1016/J.BBADIS.2015.12.001 * |
| LI, S. ET AL., MOL. THER., vol. 15, 2007, pages 515 - 523 |
| LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894 |
| LIU, S., MOL. PHARM., vol. 3, 2006, pages 472 - 487 |
| MAKIMURA, H., BMC NEUROSCI., vol. 3, 2002, pages 18 |
| MALMSTEN, M.: "Surfactants and polymers in drug delivery", 2002, INFORMA HEALTH CARE |
| MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309 |
| MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 |
| MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053 |
| MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770 |
| MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060 |
| MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973 |
| MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654 |
| MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504 |
| MCNAMARA, JO. ET AL., NAT. BIOTECHNOL., vol. 24, 2006, pages 1005 - 1015 |
| MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237 |
| MITCHELL ET AL., CIRC RES., vol. 122, no. 4, 16 February 2018 (2018-02-16), pages 555 - 9 |
| MIYAO ET AL., DSRNA RES. DEV., vol. 5, 1995, pages 115 - 121 |
| MOOK, OR. ET AL., MOL CANE THER, vol. 6, no. 3, 2007, pages 833 - 843 |
| MURANISHI, CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, vol. 7, 1990, pages 1 - 33 |
| NAUWELAERTS ET AL., J. AM. CHEM. SOC., vol. 129, no. 30, 2007, pages 9340 - 9348 |
| NAUWELAERTS ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 8, 2005, pages 2452 - 2463 |
| NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500 |
| NUC. ACIDS SYMP. SERIES, vol. 52, 2008, pages 133 - 134 |
| NYKANEN ET AL., CELL, vol. 107, 2001, pages 309 |
| OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538 |
| PAL, A. ET AL., INT J. ONCOL., vol. 26, 2005, pages 1087 - 1091 |
| PEARLE ET AL., J UROL., vol. 192, no. 2, August 2014 (2014-08-01), pages 316 - 24 |
| PILLE, J. ET AL., MOL. THER., vol. 11, 2005, pages 267 - 274 |
| PROCHASKA ET AL., J UROL., vol. 199, no. 5, May 2018 (2018-05-01), pages 1262 - 6 |
| REICH, SJ. ET AL., MOL. VIS., vol. 9, 2003, pages 210 - 216 |
| RITSCHEL, METH. FIND. EXP. CLIN. PHARMACOL., vol. 13, 1993, pages 205 |
| ROBEYNS ET AL., ACTA CRYSTALLOGRAPHICA, SECTION F: STRUCTURAL BIOLOGY AND CRYSTALLIZATION COMMUNICATIONS, vol. F61, no. 6, 2005, pages 585 - 586 |
| ROBEYNS ET AL., J. AM. CHEM. SOC., vol. 130, no. 6, 2008, pages 1979 - 1984 |
| RUL ET AL., CLIN J AM SOC NEPHROL., vol. 4, no. 4, April 2009 (2009-04-01), pages 804 - 11 |
| SAISON-BEHMOARAS ET AL., EMBO J, vol. 10, 1991, pages 1111 - 1118 |
| SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111 |
| SALIDO ET AL., PROC NATL ACAD SCI USA, vol. 103, 2006, pages 18249 |
| SCALES ET AL., EUR UROL., vol. 62, no. l, July 2012 (2012-07-01), pages 160 - 5 |
| SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783 |
| SHIN ET AL., WORLD J NEPHROL., vol. 7, no. 7, 24 November 2018 (2018-11-24), pages 129 - 42 |
| SHISHKINA, GT. ET AL., NEUROSCIENCE, vol. 129, 2004, pages 521 - 528 |
| SIMEONI ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages 2717 - 2724 |
| SORENSEN, DR. ET AL., J. MOL. BIOL, vol. 327, 2003, pages 761 - 766 |
| SOUTSCHEK, J. ET AL., NATURE, vol. 432, 2004, pages 173 - 178 |
| SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54 |
| TAKAHASHI ET AL., J. PHARM. PHARMACOL., vol. 40, 1988, pages 252 |
| TAKAKURA ET AL., DSRNA & NUCL. ACID DRUG DEV., vol. 6, 1996, pages 177 - 183 |
| TAN, PH ET AL., GENE THER., vol. 12, 2005, pages 59 - 66 |
| THAKKER, ER. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17270 - 17275 |
| TOLENTINO, MJ. ET AL., RETINA, vol. 24, 2004, pages 132 - 138 |
| TOMALIA, DA. ET AL., BIOCHEM. SOC. TRANS., vol. 35, 2007, pages 61 - 67 |
| TURK ET AL., EAU GUIDELINES ON UROLITHIASIS. EAU ANNUAL CONGRESS, 2021 |
| VERBEURE ET AL., NUCLEIC ACIDS RESEARCH, vol. 29, no. 24, 2001, pages 4941 - 4947 |
| VERMA, UN. ET AL., CLIN. CANCER RES., vol. 9, 2003, pages 1291 - 1300 |
| WANG ET AL., J. AM. CHEM., vol. 122, 2000, pages 8595 - 8602 |
| WANG ET AL., J. ORG. CHEM., vol. 66, 2001, pages 8478 - 82 |
| WANG ET AL., J. ORG. CHEM., vol. 68, 2003, pages 4499 - 4505 |
| WANG ET AL., NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 20, no. 4-7, 2001, pages 785 - 788 |
| WORCESTER EMCOE FL, N ENGL J MED., vol. 363, no. 10, 2 September 2010 (2010-09-02), pages 954 - 63 |
| WORCESTER EMCOE FL, NEPHROLITHIASIS. PRIM CARE., vol. 35, no. 2, June 2008 (2008-06-01), pages 369 - 91 |
| YAMAMOTO ET AL., J. PHARM. EXP. THER., vol. 263, 1992, pages 25 |
| YAMASHITA ET AL., J. PHARM. PHARMACOL., vol. 39, 1987, pages 621 - 626 |
| YAMASHITA ET AL., J. PHARM. SCI., vol. 79, 1990, pages 579 - 583 |
| YOO, H. ET AL., PHARM. RES., vol. 16, 1999, pages 1799 - 1804 |
| ZHANG, X. ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 10677 - 10684 |
| ZIMMERMANN, TS. ET AL., NATURE, vol. 441, 2006, pages 111 - 114 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2026011785A1 (zh) * | 2024-07-10 | 2026-01-15 | 凯莱英医药集团(天津)股份有限公司 | 一种Nedosiran的制备方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4373934A1 (en) | 2024-05-29 |
| US20240344070A1 (en) | 2024-10-17 |
| JP2024528659A (ja) | 2024-07-30 |
| TW202333748A (zh) | 2023-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12492401B2 (en) | Angiopoietin-like 3 (ANGPTL3) iRNA compositions and methods of use thereof | |
| JP7775254B2 (ja) | 乳酸脱水素酵素A(LDHA)iRNA組成物及びその使用方法 | |
| EP3853364A1 (en) | Ketohexokinase (khk) irna compositions and methods of use thereof | |
| EP4073251A1 (en) | Human chromosome 9 open reading frame 72 (c9orf72) irna agent compositions and methods of use thereof | |
| US20250188456A1 (en) | High mobility group box-1 (hmgb1) irna compositions and methods of use thereof | |
| WO2022212231A2 (en) | Huntingtin (htt) irna agent compositions and methods of use thereof | |
| US20240344070A1 (en) | Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder | |
| US20230183706A1 (en) | Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant | |
| WO2023076450A2 (en) | HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF | |
| EP4347822A2 (en) | Human chromosome 9 open reading frame 72 (c9orf72) irna agent compositions and methods of use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22754232 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2024503387 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022754232 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022754232 Country of ref document: EP Effective date: 20240219 |