WO2023000555A1

WO2023000555A1 - Use of pzp and pharmaceutical composition that comprises pzp and that is used to fight obesity

Info

Publication number: WO2023000555A1
Application number: PCT/CN2021/130319
Authority: WO
Inventors: 金万洙; 林骏; 蒋笑笑
Original assignee: 中国科学院动物研究所
Priority date: 2021-07-23
Filing date: 2021-11-12
Publication date: 2023-01-26
Also published as: CN113876937B; CN113876937A

Abstract

The present invention relates to a use of PZP and a pharmaceutical composition that comprises PZP and that is used to fight obesity, and discloses a weight loss effect of PZP in an intermittent fasting (IF) cycle and a related molecular mechanism. Clinical data proves that a negative correlation exists between human body BMI and the PZP content in the blood. Experiments on mice prove that PZP is significantly highly expressed in the liver in an IF re-feeding stage, and GRP78 proteins in brown adipose tissue are transferred to a cell membrane. The liver delivers PZP targeted binding to GRP78 transferred to brown adipose cell membrane, and p38 MAPK-ATF2 signal paths in brown adipose and brown adipose formed by induction are activated jointly, promoting the expression of UCP1, achieving resistance to increased obesity, promoting weight loss in people who suffer from obesity, and improving overall metabolic disorders caused by obesity. Exogenous subcutaneous injection of a PZP carbon terminal part can enhance the effect of IF in fighting weight gain caused by high-fat food, and accelerates weight loss in obese mice caused by IF. Therefore, a PZP preparation and stimulation to promote GRP78 membrane transfer have become a new means of intervention in fighting obesity, and have broad application prospects.

Description

Use of PZP and pharmaceutical composition comprising PZP for combating obesity

technical field

The application relates to the technical field of biology and new medicine, and specifically relates to the use of PZP and a pharmaceutical composition including PZP for resisting obesity.

Background technique

Obesity is not only an independent disease, but also a predisposing factor for type II diabetes, cardiovascular disease, hypertension, hyperlipidemia, sleep disturbance, stroke, osteoarthritis and various cancers. In addition, studies have shown that parental obesity leads to increased incidence of obesity and related metabolic diseases in offspring. Therefore, obesity will not only affect the appearance of beauty, but also seriously affect the health of the human body.

Obesity is the result of the body absorbing more energy than it expends. Excess absorbed energy substances are converted into fat and stored in white adipose tissue. Preventing obesity requires strengthening exercise, a reasonable diet, and maintaining a good mental state. However, due to the accelerated pace of life and increased life pressure, it is difficult to ensure the implementation of these basic preventive measures. Currently, the treatment of obesity is mainly through the intervention of bariatric drugs and bariatric surgery. Although drugs and bariatric surgery have been effective in treating severely obese patients, their use has been greatly criticized due to their severe side effects (increased heart rate, headaches, insomnia, bowel disturbances, death, etc.) Restrictions are far from being able to solve the current growing global obesity problem. Therefore, it is imminent to explore new and more effective approaches to obesity prevention and treatment.

Different from white adipocytes that store energy, brown adipocytes are smaller in size and contain lipid droplets in a multi-cavity form, which can convert stored chemical energy into heat energy and emit it through the uncoupling protein UCP1. In addition, recent studies have identified a third type of adipose tissue, beige adipose tissue, in humans and rodents. The shape and function of beige adipose tissue are similar to classic brown fat, but it mainly exists in subcutaneous white adipose tissue. Afterwards, its morphology changed significantly to brown fat-like cells, and the protein content of UCP1 was also significantly up-regulated, so that white adipose tissue also had the function of heat production. Therefore, the promotion of brown fat and beige fat thermogenesis by external stimuli has become an important research direction for obesity resistance.

Existing clinical data prove that intermittent fasting (IF) can effectively inhibit the aggravation of obesity and even reduce the weight of obese people. Appropriately prolonging the starvation time, the body changes from the metabolic mode of sugar-driven oxidative phosphorylation to the metabolic mode dependent on the utilization of ketone bodies and free fatty acids, which can effectively promote the consumption of energy substances and produce many beneficial metabolic intermediates. Long-term IF increased cognition, increased insulin sensitivity, decreased blood pressure and heart rate, and decreased visceral fat and blood pressure in mice. Basic research on the molecular mechanism of IF inhibiting obesity can play an important role in the development of new weight loss drugs. Recent studies have shown that IF can significantly increase the thermogenic activity of brown adipose tissue in mice, while promoting the browning of white adipose tissue. However, the specific molecular mechanism by which IF promotes body weight loss is not clear, but it is certain that this is the result of information exchange and cooperative regulation among multiple tissues and organs in the body.

The liver is a well-known endocrine gland that occupies a central position in metabolic processes and plays a key role in maintaining nutritional balance in the body. Most regulatory responses to diet occur initially in the liver, which then regulates the activity of other organs to deal with changes in metabolic state. Considering the thermogenic function of brown adipose tissue (BAT) in diet-induced thermogenesis, and the high sensitivity of the liver to metabolic changes during fasting and refeeding, we speculated that there may be factors secreted by the liver that affect the thermogenic function of BAT and thus participate in IF resists the process of obesity.

application content

In order to screen new hepatic secreted factors that affect the function of brown adipose tissue, we conducted bioinformatics analysis based on the existing database of ncbi, and finally screened out a protein, pregnancy zone protein (PZP), which is involved in Regulatory signaling molecule of IF. PZP, a member of the α-macroglobulin family, was originally proposed as a protease inhibitor because of its unique domain—a decoy region containing multiple protease cleavage sites. Currently, the physiological functions of PZPs in energy metabolism are unclear. The present application reveals the weight loss efficacy of PZP in the intermittent light fasting (IF) cycle and its related molecular mechanism.

The concrete technical scheme of this application is as follows:

1. The use of the pregnancy zone protein in the preparation of a pharmaceutical composition for resisting obesity or losing weight.

2. Use of the pregnancy zone protein in preparing a pharmaceutical composition for promoting energy consumption of brown adipocytes or in promoting energy consumption of brown adipocytes.

3. The use of the pregnancy zone protein in the preparation of a pharmaceutical composition for improving the glucose tolerance of a subject or in improving the glucose tolerance of a subject.

4. Use of the pregnancy zone protein in preparing a pharmaceutical composition for activating the p38 MAPK-ATF2 signaling pathway or in activating the p38 MAPK-ATF2 signaling pathway.

5. The use of the pregnancy zone protein in preparing a pharmaceutical composition for promoting the expression of UCP1 or in promoting the expression of UCP1.

6. Use of gestational zone protein in the preparation of a pharmaceutical composition for treating and/or preventing fatty liver.

7. The use according to any one of items 1-6, wherein the amino acid sequence of the gestational zone protein is as shown in SEQ ID NO: 4; or

is an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4; or

It is a sequence consisting of 150-550 amino acids at the C-terminal of SEQ ID NO:4.

8. The use of a substance that promotes the translocation of GRP78 to the cell membrane in the preparation of a pharmaceutical composition for fighting obesity or losing weight; preferably, the substance is thapsigargin.

9. A method for promoting energy consumption of brown fat cells in the subject, or improving the glucose tolerance of the subject, or activating the p38 MAPK-ATF2 signaling pathway in the subject, or promoting the expression of UCP1 in the subject, It is characterized in that it includes the following steps: administering the pregnancy zone protein to the subject or overexpressing the pregnancy zone protein in the subject through genetic manipulation means or enhancing the activity of the pregnancy zone protein in the subject through manipulation means;

Preferably, in the refeeding state of the intermittent light fasting cycle, administer the gestational zone protein to the subject or realize the overexpression of the gestational zone protein in the subject through genetic manipulation means or enhance the gestational zone protein in the subject through manipulation means. gestational zone protein activity; or

Preferably, at the same time as or after administering a substance that promotes the translocation of GRP78 to the cell membrane, the pregnancy zone protein is administered to the subject or the pregnancy zone protein is overexpressed in the subject by genetic manipulation means or by The manipulation means enhances the activity of the pregnancy zone protein in the subject.

10. A pharmaceutical composition for preventing and/or treating fatty liver, resisting obesity or losing weight, characterized in that it includes gestational zone proteins and/or substances that promote GRP78 translocation to cell membranes;

Preferably, the substance that promotes the translocation of GRP78 to the cell membrane is thapsigargin;

Preferably, the amino acid sequence of the pregnancy zone protein is as shown in SEQ ID NO: 4; or

11. A core functional fragment of pregnancy zone protein for preventing and/or treating fatty liver, resisting obesity or losing weight, characterized in that its sequence is a sequence consisting of 150-550 amino acids;

Preferably, the sequence of the core functional fragment of the gestational zone protein is a sequence consisting of 150-550 amino acids at the C-terminal of the gestational zone protein;

Preferably, the sequence of the core functional fragment of the gestational zone protein is a sequence consisting of 250-300 amino acids at the C-terminal of the gestational zone protein;

Preferably, the sequence of the pregnancy zone protein is shown in SEQ ID NO:4;

Preferably, the sequence of the core functional fragment of the pregnancy zone protein is shown in SEQ ID NO:5.

12. A nucleic acid molecule encoding the core functional fragment of the gestational zone protein described in item 11, the sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

13. An expression vector comprising the nucleic acid molecule described in item 12.

14. A core functional fragment of the gestational zone protein as described in item 11, or a core functional fragment of the gestational zone protein encoded by the nucleic acid molecule described in item 12, or expressed by the expression vector described in item 13 Use of the core functional fragment of the pregnancy zone protein in the preparation of a pharmaceutical composition for preventing and/or treating fatty liver, resisting obesity or losing weight.

The effect of the invention

The smooth signal transduction of liver PZP/brown fat GRP78 across tissues of the present application can amplify the effect of intermittent light fasting for weight loss, and at the same time reduce the accumulation of fat in liver tissue. The specific mechanism is that refeeding promotes the transport of PZP secreted by the liver to brown adipose tissue through the blood, and refeeding promotes the membrane localization of GRP78 in brown adipocytes. UCP1 protein levels. The UCP1 protein uncouples energy transfer in the mitochondrial inner membrane of brown adipocytes, promoting the conversion of chemical energy into heat energy release. Subsequent experiments proved that the stimuli that can promote the increase of PZP protein and the occurrence of GRP78 membrane translocation may increase energy consumption by promoting heat production, thereby achieving the effect of weight control.

Description of drawings

Figure 1A is the expression level of genes in the liver during the intermittent light fasting cycle, and the red dots are genes with abundant expression in the liver, which is at least 10 times the highest expression level in all 21 non-hepatic tissues.

Figure 1B is a comparison result of gene expression levels in the liver during feeding and fasting in the intermittent light fasting cycle. The red dots are genes whose expression levels in the liver are significantly higher during feeding than during fasting;

Figure 1C is the comparison of liver gene expression levels of mice fed with high-fat diet and mice fed with low-fat diet during the intermittent light fasting cycle; the red dots indicate that the liver expression of mice fed with high-fat diet was significantly lower than that of mice fed with low-fat diet mouse genes.

Figure 1D is a diagram of the screening process and results of 35 potential proteins meeting the criteria.

Figure 1E shows the changes in gene expression levels in Ob/Ob mice relative to wild-type mice among the 17 secreted proteins.

Figure 1F shows the changes in gene expression levels in re-fed mice compared to fasted mice among the 17 secreted proteins.

Figure 1G shows the changes in gene expression levels of 17 secreted proteins in high-fat-induced obese mice compared with normal diet mice.

Figure 1H is the comparison result of the expression level of PZP gene in various tissues.

Fig. 2A shows the changes of PZP content in liver and serum of mice under feeding, fasting and re-feeding states.

Fig. 2B is the change of the content of PZP in serum with the amount of food in the case of fasting and then feeding of mice.

Figure 2C is the relationship between PZP content in human serum and BMI.

Figure 2D is the change of PZP content in human serum with refeeding time in oral glucose tolerance test.

Fig. 3A is a schematic diagram of the intermittent light fasting scheme adopted in the present application.

Fig. 3B is the result of body weight comparison between mice in PZP KO group and mice in WT group under the same diet and IF cycle.

Figure 3C is the comparison of fat accumulation between mice in PZP KO group and mice in WT group under the same diet and IF cycle.

Figure 3D shows the changes in glucose content in the blood of mice in the PZP KO group and mice in the WT group over time in the glucose tolerance test.

Figure 3E shows the comparison results of oxygen consumption between the mice in the PZP KO group and the mice in the WT group during fasting and refeeding.

Figure 3F is the comparison of the core body temperature of the mice in the PZP KO group and the mice in the WT group during fasting and refeeding.

Figure 3G is the comparison of the body temperature of the scapula between the mice in the PZP KO group and the mice in the WT group during fasting and refeeding.

Fig. 3H is a thermal image showing the body surface temperature of mice at different eating times.

Figure 3I is the UCP1 protein content in the brown fat of mice in the PZP KO group and WT group during the refeeding process.

Fig. 4A is a schematic flow chart of screening for PZP protein receptors.

Figure 4B is the result of Orbitrap protein profile.

Figure 4C is a graph showing the results of reverse co-immunoprecipitation analysis of PZP and GRP78.

Figure 4D is the detection result of the membrane mass separation experiment.

Figure 4E is the statistical results of each tissue in the membrane-mass separation experiment.

Figure 4F shows the results of whole-tissue staining of brown adipose tissue from fasted and re-fed mice.

Figure 5A is a schematic diagram of the treatment of mouse brown adipocytes.

Fig. 5B is an electrophoresis image of prokaryotic expression and purification of MBP-PZP fusion protein.

Fig. 5C shows the change of UCP1 protein level in brown adipocytes with the concentration of PZP in the re-feeding simulated state, using DMEM containing high glucose and insulin and PZP as the complete medium.

Figure 5D shows the protein of UCP1 in brown adipocytes under the re-feeding simulated state, when PZP and DMEM containing only high glucose were used as complete medium, and when PZP and DMEM containing only insulin were used as complete medium level changes.

Figure 5E shows the protein level changes of UCP1 in brown adipocytes under fasting and re-feeding simulated states when PZP was used in the IF cycle.

Figure 5F shows the protein levels of UCP1 in brown adipocytes when the insulin concentrations were 100 nM and 1 μM, respectively, under the condition of refeeding simulation, using DMEM containing high glucose and insulin and PZP as the complete medium.

Fig. 5G shows the change of UCP1 protein level in brown adipocytes with refeeding time under refeeding simulated state, using DMEM containing high glucose and insulin and PZP as complete medium.

Figure 5H shows the oxygen consumption rate of brown adipocytes as a function of refeeding time. After detecting the basic energy consumption, add the ATP synthase inhibitor oligomycin (Oligomycin) to measure the oxygen consumption of ATP synthesis; then add the uncoupler FCCP of the electron transport chain to determine the maximum oxygen consumption capacity of the mitochondria; finally The electron transport chain inhibitor rotenone (Retenone) was added to detect the maximum oxygen consumption.

Fig. 5I is a diagram of staining results of immunofluorescence detection after brown adipocyte differentiation and maturation, starvation treatment, re-feeding or thapsigargin treatment for 1 hour.

Fig. 6A shows the changes of GRP78-mediated mTOR, PI3K, ERK1/2 and AMPK pathways in brown adipocytes after PZP treatment in the re-feeding state.

Fig. 6B shows the changes of the whole p38 MAPK-ATF2 signaling axis in brown adipose tissue of PZP KO and WT mice after starvation and refeeding.

Figure 6C shows the expression level of UCP1 and the phosphorylation levels of p38 MAPK and ATF2 after PZP treatment after down-regulation of GRP78 expression.

Figure 6D shows the effect of adding p38 MAPK inhibitors on PZP-induced UCP1 expression level in the re-feeding state.

Fig. 7A is a flowchart of UCP1 wild-type and UCP1 knockout mice after subcutaneous injection of PZP.

Figure 7B shows the effect of subcutaneous injection of PZP on the body weight of wild-type and UCP1 knockout mice.

Fig. 7C is the result of weight comparison of various tissues in mice after subcutaneous injection of PZP.

Figure 7D is the H&E staining results of the internal structure of each mouse tissue after subcutaneous injection of PZP.

Figure 7E is the comparison of glucose tolerance between wild-type mice and UCP1 KO mice after subcutaneous injection of PZP.

Figure 7F is the comparison of oxygen consumption and energy consumption between wild-type mice and UCP1 KO mice after subcutaneous injection of PZP.

Figure 7G shows the protein levels of thermogenic genes in brown adipose tissue of wild-type mice after subcutaneous injection of PZP.

Fig. 8A is a schematic diagram of the sgRNA sequence and vector skeleton for specifically knocking out liver PZP by the AAV/Crisper/cas9 system.

Fig. 8B is the level of PZP protein in mouse liver and blood measured by western blotting (WB).

Fig. 8C is the effect of control protein and PZP protein treatment on UCP1 protein level in brown adipose tissue under re-feeding state measured by Western blot experiment.

Figure 8D shows the effects of control protein and PZP protein treatment on the body weight of wild-type and liver-specific knockout mice.

Fig. 8E is the effect of control protein and PZP protein treatment on glucose tolerance of wild-type and liver-specific knockout mice.

Fig. 8F is the effect of control protein and PZP protein treatment on oxygen consumption and energy consumption of wild-type and liver-specific knockout mice.

Figure 9A shows that PZP KO mice were induced with a high-fat diet for 10 weeks. When the average body weight of the mice exceeded 45 g, the mice were subjected to the IF diet program, and the mice were subjected to MBP at the exchange time point of starvation and refeeding -PZPC protein and MBP protein treatment, the percentage of body weight loss of PZP KO mice during the process changes with feeding time.

Fig. 9B is the comparison result of the tissue weights of PZP KO mice treated with MBP-PZPC protein and MBP protein.

Figure 9C is the H&E staining results of the internal structures of the tissues of PZP KO mice treated with MBP-PZPC protein and MBP protein.

Fig. 9D is a comparison result of glucose tolerance of PZP KO mice treated with MBP-PZPC protein and MBP protein.

Figure 9E shows the activation of the P38/ATF2 signaling axis in the brown adipose tissue of PZP KO mice treated with MBP-PZPC protein and MBP protein.

detailed description

The implementation of the present application will be described and described in detail below through specific examples, but the following should not be construed as limiting the present application.

Unless otherwise defined, technical and scientific terms in this specification have the same meaning as commonly understood by a person skilled in the art. Although methods and materials similar or identical to those described herein can be employed in experiments or practical applications, the materials and methods are described herein below. In case of conflict, the present specification, including definitions, will control and the materials, methods, and examples are presented for purposes of illustration only and not limitation. The present application will be further described below in conjunction with specific examples, but they are not used to limit the scope of the present application.

In one aspect, the present application provides a pharmaceutical composition for preventing and/or treating fatty liver, resisting obesity or losing weight, which includes gestational zone protein and/or a substance that promotes GRP78 translocation to cell membrane.

The gestational zone protein of the present application is "PZP protein", including PZP protein and any functional equivalent of PZP protein. The functional equivalents include PZP protein conservative variant proteins, or active fragments thereof, or active derivatives thereof, allelic variants, natural mutants, induced mutants, DNA capable of binding to PZP under high or low stringent conditions The protein encoded by the hybridized DNA.

In a specific embodiment, the gene sequence of the PZP protein is shown in SEQ ID NO:3.

In a specific embodiment, the amino acid sequence of the pregnancy zone protein described in the present application may be the sequence shown in SEQ ID NO:4.

In a specific embodiment, the amino acid sequence of the gestational zone protein described herein may comprise at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, Amino acid sequences that are 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.

In a specific embodiment, the amino acid sequence of the gestational zone protein described in the present application may have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% of SEQ ID NO:4 %, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity amino acid sequence composition.

In a specific embodiment, the amino acid sequence of the pregnancy zone protein described in the present application is a sequence consisting of 150-550 amino acids at the C-terminal of SEQ ID NO:4.

As used herein, the term "GRP78" refers to glucose regulated protein 78 (glucose regulated protein 78kD), also known as immunoglobulin heavy chain binding protein (immunoglobulin heavy chain binding protein, Bip), which belongs to heat shock protein 70 (heat shock protein A member of the shock protein 70) family. GRP78 is mainly located in the cavity of the endoplasmic reticulum in normal tissue cells and exists as a chaperone molecule and maintains a low level of expression. Aggregation of newly synthesized proteins, regulation of calcium ion balance in the endoplasmic reticulum, etc. However, the expression of GRP78 can be up-regulated under the conditions of protein misfolding, glucose deficiency, expression of glycosylated proteins, and other changes in the cellular microenvironment. In a specific embodiment, the pharmaceutical composition for preventing and/or treating fatty liver and resisting obesity of the present application includes a substance that promotes the translocation of GRP78 to the cell membrane and a gestational zone protein or a core functional fragment of a gestational zone protein.

In a specific embodiment, the substance that promotes the translocation of GRP78 to the cell membrane is thapsigargin.

As used herein, the terms "polypeptide", "peptide", "protein", "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, descriptions for polypeptides apply equally to descriptions of peptides and descriptions of proteins, and vice versa. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length.

In a specific embodiment, the pharmaceutical composition for anti-obesity comprises an effective dose of gestational zone protein or a core functional fragment of gestational zone protein and a pharmaceutically acceptable carrier.

As used herein, the term "pharmaceutical composition" refers to a preparation that is in such a form that the biological activity of the active ingredients contained therein is effective and which does not contain the subject to which the formulation is administered. Additional components with unacceptable toxicity.

As used herein, the term "effective dose" refers to the dose corresponding to the desired function. The effective dose is a dose that can be obtained by those skilled in the art according to actual needs and under limited experiments.

Further, the pharmaceutical composition of the present application also includes one or more pharmaceutically acceptable carriers, such carriers include (but not limited to): diluents or fillers such as lactose, glucose, sucrose, mannitol, sorbitol , cellulose (such as ethyl cellulose, microcrystalline cellulose), sugar gum, pectin, polyacrylate and/or calcium hydrogen phosphate, calcium sulfate, lubricants such as silica, talc, stearic acid, magnesium stearate or calcium stearate, metallic stearates, colloidal silicon dioxide, hydrogenated vegetable oils, corn starch, sodium benzoate and/or polyethylene glycol, binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, Methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone and/or hydroxypropylcellulose, disintegrants such as starch (such as potato starch or sodium starch), glycolate (ester), agar, alginic acid or Its sodium salt, or effervescent mixture, humectant such as sodium lauryl sulfate and/or absorbent, colouring, flavoring and sweetening agents. The pharmaceutical composition of the present application and their physiologically acceptable salts and solvates can be formulated for administration by any suitable route, including inhalation administration, topical administration, nasal administration, oral administration , parenteral or rectal administration.

The pharmaceutical composition may be formulated for any type of administration, for example, intradermal injection, subcutaneous injection, intravenous injection, intraperitoneal injection, intrapleural injection, intravesical injection, intracoronary or intratumoral injection using a syringe or other device Injection, oral administration, rectal administration.

The methods of introducing the pharmaceutical composition of the present application into tissues or cells can be divided into in vitro or in vivo methods. The in vitro method includes introducing the pharmaceutical composition containing the PZP protein into the cells, and then transplanting or returning the cells into the body. The in vivo method includes directly injecting the pharmaceutical composition containing PZP protein into tissues in the body.

The pharmaceutical composition of the present application can also be used in combination with other drugs for resisting obesity, reducing weight or preventing and/or treating fatty liver.

For the dosage of the pharmaceutical composition of the present application, medical personnel will determine the dosage regimen based on various clinical factors. As is well known in the medical arts, the dosage for any one patient will depend on a variety of factors, including the patient's size, body surface area, age, the particular compound being administered, sex, frequency and route of administration, general health, and other drugs administered concomitantly .

On the one hand, the present application provides a core functional fragment of the pregnancy zone protein for preventing and/or treating fatty liver, resisting obesity or losing weight, characterized in that its sequence is a sequence consisting of 150-550 amino acids, specifically For 150, 170, 190, 210, 230, 250, 270, 290, 310, 330, 350, 370, 390, 410, 430, 450, 470 1, 490, 510, 530, 550 amino acid sequences.

In a specific embodiment, the sequence of the core functional fragment of the gestational zone protein is a sequence consisting of 150-550 amino acids at the C-terminal of the gestational zone protein.

In a specific embodiment, the sequence of the core functional fragment of the gestational zone protein is a sequence consisting of 250-300 amino acids at the C-terminal of the gestational zone protein.

In the above specific embodiment, the sequence of the pregnancy zone protein is shown in SEQ ID NO:4.

In a specific embodiment, the sequence of the core functional fragment of the pregnancy zone protein is shown in SEQ ID NO:5.

The present application also provides a nucleic acid molecule encoding a core functional fragment of any of the aforementioned pregnancy zone proteins, the sequence of which is shown in SEQ ID NO:1 or SEQ ID NO:2.

As used herein, the term "nucleic acid molecule" may include those comprising naturally and/or non-naturally occurring nucleotides and bases, for example including those with backbone modifications, which refer to nucleotide Polymers of nucleotides. Such polymers may contain natural and/or unnatural nucleotides and include, but are not limited to, DNA, RNA and PNA. Nucleotide sequence refers to the linear sequence that makes up a nucleic acid molecule.

In some cases, the nucleic acid molecule comprises cDNA, and in some cases, the nucleic acid molecule can be modified for use in the constructs described herein, such as for codon optimization. In some cases, the sequence may be designed to contain terminal restriction site sequences for the purpose of cloning into a vector.

In some cases, nucleic acid molecules can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) of encoding nucleic acids within or isolated from one or more given cells. obtained by PCR amplification.

The present application also provides an expression vector comprising the aforementioned nucleic acid molecule.

As used herein, the term "vector" is used to describe a nucleic acid molecule that can be engineered to contain a cloned polynucleotide or polynucleotides that can be amplified in a host cell. Vectors include, but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, without free ends (e.g. circular); nucleic acid molecules comprising DNA, RNA or both; and other polynucleotide species known in the art. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, for example by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (eg, bacterial vectors with a bacterial origin of replication and episomal mammalian vectors). Other vectors (eg, non-episomal mammalian vectors) integrate into the genome of the host cell upon introduction into the host cell, thereby replicating along with the host genome. Furthermore, certain vectors are capable of directing the expression of those genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." A recombinant expression vector may comprise a nucleic acid of the present application in a form suitable for expressing nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory elements, which may be based on the The host cell to which the sequence is operably linked is selected.

As used herein, the term "expression" includes any step involved in the production of a variant, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

As used herein, the term "expression vector" means a linear or circular DNA molecule comprising a polynucleotide encoding a variant operably linked to other nucleotides that provide for its expression.

The present application also provides a fusion protein, which comprises the aforementioned gestational zone protein or the core function fragment of the gestational zone protein and the immunoglobulin Fc segment.

As used herein, the term "fusion protein" refers to a protein produced by recombinant techniques, wherein DNA or RNA encoding the expressed protein is usually inserted into a suitable expression vector and used to transform host cells to produce the protein. In some exemplary embodiments, DNA or RNA encoding the expressed protein is inserted into the host chromosome by homologous recombination or other means known in the art, and thus used to transform the host cell to produce the protein.

As used herein, the term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc., of a nucleic acid construct or expression vector comprising a polynucleotide of the present application. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell mutated due to the replication process. The host cell can be any cell useful in the production of recombinant human-like collagen of the present application.

The present application also provides a core function fragment of the pregnancy zone protein as described above, or a core function fragment of the pregnancy zone protein encoded by the nucleic acid molecule as described above, or a pregnancy zone protein expressed by the expression vector as described above. Use of the core functional fragment of the zone protein in the preparation of a pharmaceutical composition for preventing and/or treating fatty liver, resisting obesity or losing weight.

The present application also provides the use of the pregnancy zone protein in the preparation of a pharmaceutical composition for resisting obesity or losing weight.

As used herein, the term "anti-obesity" refers not only to suppressing obesity from a health perspective, but also to firming and smoothing the skin by reducing fat accumulation. The present application also provides the use of the pregnancy zone protein in preparing a pharmaceutical composition for promoting energy consumption of brown adipocytes or in promoting energy consumption of brown adipocytes.

The present application also provides the use of the pregnancy zone protein in the preparation of a pharmaceutical composition for improving the glucose tolerance of a subject or in improving the glucose tolerance of a subject.

As used herein, the term "glucose tolerance" refers to the body's ability to regulate blood sugar levels. After the body eats rice and noodles as a staple food or takes glucose, almost all of it is absorbed by the intestines, which increases blood sugar, stimulates insulin secretion, increases liver glycogen synthesis, inhibits decomposition, reduces liver glycogen output, and increases glucose utilization by tissues in the body , and eat more or less blood sugar are maintained in a relatively stable range. This shows that the normal body has a strong tolerance to glucose, that is, the glucose tolerance is normal.

The present application also provides the use of the pregnancy zone protein in preparing a pharmaceutical composition for activating the p38 MAPK-ATF2 signaling pathway or in activating the p38 MAPK-ATF2 signaling pathway.

As used herein, the term "p38 MAPK-ATF2 signaling pathway" refers to the existence of three parallel MAPKs signaling pathways found in mammals, namely extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun N-terminal kinase (JNK), and p38 MAPK pathway. The role of p38 MAPK in cells includes inflammatory response, cell cycle regulation, cell development, differentiation, aging, apoptosis and tumorigenesis. The non-phosphorylated state of p38 MAPK is an inactive state. When stimulated by various extracellular factors, it is rapidly phosphorylated and activated through the classic MAP3K-MKK pathway. Phosphorylated p38 MAPK can activate many downstream substrates , activating transcription factor 2 (activating transcription factor 2, ATF2) is one of many substrates of p38 MAPK. ATF2 is a member of the activator protein-1 (activator protein-1, AP1) family of transcription factors including c-Jun and c-Fos, and is widely expressed in mammalian neurons. ATF2 plays an indispensable role in the normal growth and metabolism of nerve cells. At the same time, the loss of ATF2 expression can also stimulate a large number of cell apoptosis and neuron loss, leading to the occurrence of various diseases. The activity of ATF2 is regulated by the phosphorylation of its Thr69 and Thr71 sites. When the p38 MAPK signaling pathway is activated, its downstream substrate ATF2 is phosphorylated and activated, and the phosphorylated ATF2 interacts with and transfers to other proteins in the AP1 family It binds to the promoter sequence of the target gene in the nucleus, and then plays the role of up-regulating or down-regulating the transcription process of the target gene, leading to cell cycle disorder and mediating cell apoptosis.

The present application also provides the use of the pregnancy zone protein in preparing a pharmaceutical composition for promoting the expression of UCP1 or in promoting the expression of UCP1.

As used herein, the term "UCP1" refers to the only uncoupling protein expressed in brown adipose tissue (BAT). Different from the functions of other members of the uncoupling protein family, the main function of UCP1 is to participate in the thermogenesis regulation and energy metabolism of BAT to maintain the energy metabolism balance of the body.

The present application also provides the use of the pregnancy zone protein in the preparation of a pharmaceutical composition for treating and/or preventing fatty liver.

The present application also provides the use of a substance that promotes GRP78 translocation to the cell membrane in the preparation of a pharmaceutical composition for resisting obesity or losing weight; preferably, the substance is thapsigargin.

In a specific embodiment, in any of the aforementioned uses, the amino acid sequence of the pregnancy zone protein is as shown in SEQ ID NO: 4; or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical amino acid sequence; or 150 to 550 amino acids at the C-terminal of SEQ ID NO:4 composed sequence.

The present application also provides a method for promoting the energy consumption of brown adipocytes in the subject, or improving the glucose tolerance of the subject, or activating the p38 MAPK-ATF2 signaling pathway in the subject, or promoting the expression of UCP1 in the subject. The method includes the following steps: administering the pregnancy zone protein to the subject or overexpressing the pregnancy zone protein in the subject through genetic manipulation or enhancing the activity of the pregnancy zone protein in the subject through manipulation.

In the above embodiments, the pregnancy zone protein may be administered to the subject by any of the following methods: intradermal injection using a syringe or other device, subcutaneous injection, intravenous injection, intraperitoneal injection, intrapleural injection, intravesical injection Injection, intracoronary or intratumoral injection, oral administration, rectal administration.

In a preferred embodiment, the method comprises the following steps: in the refeeding state of the intermittent light fasting cycle, administering the pregnancy zone protein to the subject or overexpressing the pregnancy zone protein in the subject by means of genetic manipulation. Zonal protein or enhance the activity of pregnancy Zonal protein in a subject by manipulation means.

In the above embodiment, the exogenous recombinant gene can be delivered into the mouse adipose tissue by means of an inactivated virus such as the AAV system lentivirus system through the overexpression system of the exogenous gene driven by the adipose tissue-specific promoter.

In a preferred embodiment, the method includes the following steps: at the same time or after or before administering a substance that promotes the translocation of GRP78 to the cell membrane to the subject, administering the pregnancy zone protein to the subject or through genetic manipulation means Overexpressing the pregnancy zone protein in the subject or enhancing the activity of the pregnancy zone protein in the subject through manipulation means.

As used herein, the term "serum-free DMEM containing glucose" refers to a DMEM medium (dulbecco's modified eagle medium, DMEM) that contains glucose and can maintain the growth and reproduction of cells in vitro for a long period of time without adding serum.

As used herein, the term "DMEM containing high glucose and insulin" refers to DMEM containing insulin and glucose, wherein the concentration of glucose is 8˜10 g/L.

In this application, by integrating and analyzing the existing expression profiles and detecting the expression levels in different states, we have identified the following characteristics of the PZP protein: the expression of the gene is abundant in the liver, at least the highest expression level in all 21 non-liver tissues 10 times; the gene expression in the liver was significantly higher when fed than when fasting; the gene expression in the liver of mice fed with high-fat diet was significantly lower than that of mice fed with low-fat diet; the MBI value of human body was negatively correlated with the protein content in blood . Under normal high-fat feeding conditions, PZP knockout could not affect the body weight and metabolic status of mice. In the process of IF, PZP knockout accelerated high-fat-induced obesity and exacerbated high-fat-induced metabolic disorders. The injection of exogenous PZP protein C-terminus can resist high fat-induced obesity and metabolic disorders. Injection of the carbon-terminal portion of PZP protein could not resist high fat-induced obesity in UCP1 gene-deficient mice, thus confirming that the function of PZP protein in resisting obesity depends on the activity of UCP1 protein and the thermogenesis of brown adipose tissue. During refeeding of the IF cycle, the GRP78 protein in brown adipocytes translocates to the cell membrane and acts as a membrane receptor for PZP. PZP proteins promote GRP78-dependent membrane translocation of UCP1 protein levels in brown fat. Inhibitors of GRP78 can block the PZP protein from increasing UCP1 protein levels. Overexpression of PZP protein in adipose tissue can effectively resist high-fat-induced obesity and promote the increase of blood vessels in adipose tissue. In vitro injection of the carbon-terminal part of PZP protein can effectively reduce the body weight of obese mice and improve metabolism.

Example

Example 1 PZP is a screened hepatic secretory protein that participates in the metabolic remodeling of the body during the intermittent light fasting cycle

According to the screening criteria we set: gene expression was abundant in the liver, at least 10 times the highest expression level in all 21 non-hepatic tissues (as shown in Figure 1A); gene expression in the liver was significantly higher when feeding During fasting (as shown in FIG. 1B ); liver gene expression of mice fed with high-fat diet was significantly lower than that of mice fed with low-fat diet (as shown in FIG. 1C ). We have selected three public Affymetrix microarray data in the NCBI public database: (GEO:GSE9954), (GEO:GSE46495), (GEO:GSE35961), merged and found 35 potential proteins that meet the criteria, and screened The process and results are shown in Figure 1D. According to NCBI and signal5.1 and other data predictions, it was found that 17 of these 35 genes expressed secretory peptide proteins, namely Mbl2, C8b, Cyp2c29, Cpb2, Pzp, Cyp2c44, Afm, Cyp2c50, Mbl1, Masp1, Lipc, Cyp2c70, Hgfac, Fgb, Saa4, Itih4, Serpina12. In order to further verify that the screened liver secreted proteins meet our screening conditions, we extracted the liver mRNA of mice fed a low-fat diet (LFD) and high-fat diet (HFD) for 9 weeks, wild-type and Ob/Ob mouse liver mRNA , 8-week-old C57 mice were intermittently fasted (intermittent fasting, IF) starved (fasted) and re-fed (refed) state mouse liver mRNA, reversed into cDNA, and real-time quantitative PCR (QPCR) was used to detect potential in the liver Gene expression, the results are shown in Figure 1G, Figure 1E and Figure 1F, respectively. Table 1 shows the expression changes of 17 secreted proteins in different physiological states. Finally, it was found that the expression level of PZP gene in obese model mice fed with high-fat diet was significantly lower than that of normal mice fed with low-fat diet, and the expression level of PZP was significantly up-regulated in the re-feeding state. At the same time, the QPCR experiment detected the expression level of PZP gene in different tissues and found that PZP gene was specifically and highly expressed in liver tissue, as shown in Figure 1H. In addition, studies have reported that the secretion level of PZP protein in the weight loss group is higher than that in the gainer group. Therefore, PZP is a hepatic secreted protein that participates in the metabolic remodeling of the body during the intermittent light fasting cycle.

Table 1 Expression changes of 17 liver secreted proteins in different physiological states

Continued Table 1 Expression changes of 17 liver secreted proteins in different physiological states

Example 2 Increased expression and secretion of PZP protein in refeeding state in intermittent diet cycle

In order to further verify the secretion level of PZP protein in the IF circulation, we took 4 8-week-old C57 mice, took 50 microliters of whole blood from the tip of the tail at 9 o'clock in the morning (blood sample in feeding state), and removed the mouse food; After taking 50 microliters of whole blood (blood sample in starvation state) from the tip of the tail at 9 o'clock the next morning, add feed to the mice, and take 50 microliters of whole blood from the tip of the tail (re-feeding state blood sample) after 6 hours. The whole blood was centrifuged at 4 degrees and 3000 rpm for 15 minutes, and the supernatant was taken for Western Blot (WB) test. It was found that the content of PZP in the serum was significantly increased in the re-feeding state, as shown in the figure 2A. After the mice were starved for 24 hours, we gave the mice different weights of food (0.4, 0.8, 1.2g/mouse), blood was collected 6 hours later, and the supernatant was obtained by centrifugation. The PZP content in the serum was detected with an ELISA kit, and it was found that under the re-feeding state, the secretion of PZP increased with the increase of the food intake, as shown in Figure 2B. In addition, under the supervision of the Ethics Committee of Huashan Hospital of Fudan University (HIRB, Ethics No. 2016395), we recruited 50 volunteers, and collected their blood samples, gender, age, body index and other information with the consent of the volunteers , the PZP content in the serum was detected by an ELISA kit, and it was found that the PZP content in the serum was negatively correlated with the BMI of the human body, as shown in Figure 2C. Next, we recruited 29 volunteers to participate in the OGTT experiment, and asked the volunteers to collect blood after fasting for 12 to 14 hours. Then 75g of glucose was taken orally, and blood was collected 2 hours later. The ELISA kit was used to detect the PZP content in the serum in the two states, and it was found that the concentration of PZP in the serum after 2 hours of OGTT was significantly higher than that on an empty stomach, as shown in Figure 2D.

Example 3 Deletion of PZP protein reduces diet-induced thermogenesis, thereby weakening the anti-obesity effect of intermittent fasting

In order to verify the effect of PZP protein on metabolism in the IF diet regimen, we commissioned the experimental animal platform of the Institute of Zoology to construct a PZP systemic deletion (PZP KO) mouse model using the CRISPR/Cas9 system. In addition, in order to eliminate the impact of food intake changes on metabolism, we adopted an IF cycle program of starving for 1 day and then feeding for 3 days (because the food intake for 1 day of starvation and then feeding for 3 days is the same as that of normal feeding for 4 days), As shown in Figure 3A. After that, we took 10 6-week-old PZPKO mice and littermate control wild (WT) mice, and fed them with high-fat diet according to the established IF diet, and weighed their body weight every 8 days. It was found that the weight gain rate of PZPKO mice was significantly higher than that of WT group, as shown in Figure 3B, indicating that PZP deletion weakened the anti-obesity effect of intermittent fasting. After monitoring for 104 days, we observed the body composition of the mice with nuclear magnetic resonance technology and found that the fat weight of the PZPKO mice was significantly higher than that of the WT group, as shown in Figure 3C, indicating that the loss of PZP mainly accelerated the storage of fat. Next, we monitored the glucose tolerance ability (GTT) of the mice. The specific operations were as follows: after the mice were fasted for 16 hours, the blood glucose concentration of the mice was measured with a blood glucose meter, and then 1.5 mg/kg of glucose was injected intraperitoneally. , 30, 60, 90, and 120 minutes to measure the blood glucose concentration of the mice, the results are shown in Figure 3D, the results show that the highest value of the blood glucose concentration of the PZP KO mice is higher than that of the WT group, and the rate of decline is slower than that of the WT group, indicating that the PZPKO mice are less The glucose tolerance of the mice was significantly lower than that of the WT group, suggesting that the metabolic ability of the PZPKO mice was impaired. In order to verify this speculation, we used the small animal respiratory metabolic behavior detection system to detect the energy consumption of experimental mice. The results are shown in Figure 3E, and the results showed that the oxygen consumption of PZPKO mice was significantly reduced. In addition, we used a mouse body temperature measuring instrument to measure the core body temperature of the mice, and the results are shown in Figure 3F. The results showed that the body temperature of the mice increased significantly in the re-feeding state, indicating that there was food-induced heat production. But compared with WT mice, PZPKO mice showed significantly lower body temperature rise. The body surface temperature of the mice was detected with an infrared thermal imager, and the results are shown in Figure 3G and Figure 3H. The results showed that the body surface temperature and the temperature near the scapula of the PZPKO mice were also significantly lower than those of the WT mice. Further, Western blot experiments showed that during the refeeding process, the UCP1 protein level in the brown fat of the mice in the PZP KO group was significantly lower than that in the WT mice.

Example 4 GRP78 is the receptor molecule that PZP protein acts on BAT

In order to screen the specific receptors of PZP in the target organ BAT, we used the BAT whole tissue cDNA library to transfect 293FT cells, then transfected the expression vector of PZP-flag, and then precipitated the protein that can bind to PZP by Flag affinity purification Finally, the differential bands of the two groups were sent to mass spectrometry to obtain the protein sequence. The flow chart of PZP protein receptor screening is shown in Figure 4A, and the Orbitrap protein spectrum results are shown in Figure 4B. Finally, through analysis, we believe that the 78kDa glucose-regulated protein (GRP78) is a potential binding target of PZP. We then showed that PZP could be co-precipitated by GRP78 by reverse co-immunoprecipitation analysis, verifying the PZP-GRP78 interaction, as shown in Figure 4C. GRP78 is a well-known endoplasmic reticulum (ER) molecular chaperone and belongs to the heat shock protein (heat shock protein, HSP) 70 protein family member. Although GRP78 is considered to be a protein on the endoplasmic reticulum, it also exists on the cell surface and can act as a receptor for various ligands. It is known that thapsigargin (TG), an endoplasmic reticulum stress inducer, can promote GRP78 on the cell membrane. reset. To determine whether refeeding could induce the relocalization of GRP78 to the cell membrane, we starved and refed 8-week-old C57 mice for 6 hours, and then euthanized different tissues. Membrane components were separated using a membrane separation kit (event, SM-005). Afterwards, the WB test found that in the re-feeding state, the specific membrane components of GRP78 protein increased in BAT, while other tissues did not change, as shown in the figure 4D and 4E are shown. To further confirm the relocalization of GRP78, we performed whole-tissue fluorescent staining of BAT in fasted and re-fed mice, and we observed the translocation of GRP78 from the cytoplasm to the cell membrane, as shown in Fig. 4F.

Example 5 PZP protein promotes brown adipocyte energy consumption

BAT is an energy-consuming tissue in the body, mainly due to the specific expression of uncoupling protein 1 (UCP1) in BAT. UCP1 protein is mainly distributed in the inner membrane of mitochondria, which can transport the proton gradient of chemical energy stored outside the inner membrane of mitochondria into the mitochondria, thereby uncoupling the process of storing chemical energy into ATP, and finally releasing the chemical energy in the form of heat energy. Calories account for 20% of total energy expenditure.

The molecular weight of the PZP protein is about 180KDa, and the sequence of the mouse PZP gene is shown in SEQ ID NO: 3. It is known that its carbon-terminal region is the functional region where the protein binds to the receptor. Therefore, we cloned the 828bp sequence of the mouse PZP gene C-terminus (as shown in SEQ ID NO: 2) into the Pmal-C5x plasmid, transformed the modified recombinant plasmid into the Transata (DE3) strain, and utilized the prokaryotic expression of the MBP-PZPC fusion protein, and MBP protein expressed in a blank was used as a control protein. Finally, the expressed protein was affinity-purified by Ni ⁺ beads to prepare the recombinant protein for subsequent laboratory use. The electropherogram of the prokaryotic expression and purification of the MBP-PZPC fusion protein is shown in Figure 5B. In order to study the function of PZP protein, in order to study whether PZP regulates the abundance of UCP1 in a cell-autonomous manner, brown adipocytes were extracted from one-day-old mouse pups, and these cells were differentiated into mature brown adipocytes, fully differentiated The primary brown adipocytes were fasted and cultured for 4 hours (serum-free DMEM containing 1 g/L glucose), then transferred to complete medium containing PZP protein, and fed for another 4 hours. The schematic diagram of mouse brown adipocyte treatment is shown in Figure 5A. Since fetal bovine serum (FBS) contains a large amount of bovine PZP protein, it will affect our experimental results, so we use DMEM containing high glucose (9g/L) and insulin (1μM) instead of complete medium containing fetal bovine serum as the re- Feeding medium. Under such conditions, the PZP protein treatment significantly increased the expression level of UCP1, and the PZP protein treatment with a concentration of 100ng/mL had the best effect, as shown in Figure 5C. In addition, PZP protein treatment could not induce UCP1 elevation under simple high glucose or insulin treatment, as shown in Figure 5D. And the increase of UCP1 protein only occurred in the refeeding period, and PZP could not induce the increase of UCP1 in the fasting period, as shown in Figure 5E. Further analysis found that 100 nM insulin was sufficient to promote PZP-induced UCP1 enhancement, as shown in Figure 5F. Notably, we observed that PZP gradually increased UCP1 protein abundance over time, as shown in Figure 5G. Next, we inoculated brown adipocytes on a cell respiration culture plate and induced differentiation and maturation. When feeding after starvation, we treated control protein and PZP protein respectively, and found that in the refeeding stage, PZP protein treatment increased the oxygen consumption of brown adipocytes , as shown in Figure 5H. At the same time, we planted the cells in a confocal dish, differentiated and matured, fed them after starvation or treated them with thapsigargin (TG) for 1 hour, and then detected them by immunofluorescence. The detection results are shown in Figure 5I, and the results showed that the two treatments Both can promote the translocation of GRP78 to the membrane. Taken together, these data suggest that PZP promotes UCP1 expression in mature brown adipocytes in a cell-autonomous manner under refeeding, a process that may require translocation of GRP78 to the membrane.

Example 6 PZP-GRP78 binding activates the downstream p38/ATF2 signaling axis to promote UCP1 protein expression

As a cell surface receptor, GRP78 may activate several downstream intracellular signaling pathways, such as phosphoinositide 3-kinase signaling pathway (PI3K), mammalian rapamycin signaling pathway (mTOR), extracellular signal-regulated kinase 1/2 ( ERK1/2), adenylate-activated protein kinase signaling pathway (AMPK) and p38 MAPK signaling pathway. In order to find the intracellular pathways that transduce PZP-GRP78 signals in the IF cycle, we detected the activities of these GRP78-mediated mTOR, PI3K, ERK1/2 and AMPK pathways in differentiated brown adipocytes treated with PZP by Western blot. Changes, the results are shown in Figure 6A, the results showed that PZP treatment significantly increased the phosphorylation of p38 MAPK under re-feeding conditions, while the phosphorylation of ribosomal protein S6 (mTOR signal), AKT473 (PI3K signal), ERK1/2 and AMPK Phosphorylation was not affected. It has been reported that the activated p38 MAPK-ATF2 axis can increase the expression of UCP1. Therefore, we took 8-week-old PZPKO and WT mice, fed them for 6 hours after starvation, and then euthanized the mice and extracted the BAT protein. WB experiments further detected the changes of the entire p38 MAPK-ATF2 signaling axis of BAT, and the results are shown in Figure 6B As shown, the results indicated downregulation of p38 MAPK and ATF2 phosphorylation in PZP KO mice. Further, we designed an interfering small RNA (GRP78 siRNA) that specifically suppressed the expression of Grp78. With the help of LipofectamineTM2000 (Invitrogen, 11668-019), GRP78 siRNA was transfected into brown adipocytes according to the instructions to down-regulate the expression of GRP78. The results of WB experiments showed that the down-regulation of GRP78 expression significantly inhibited the expression of UCP1 and p38 after PZP treatment. Phosphorylation of MAPK and ATF2, as shown in Figure 6C. In addition, during the treatment of PZP protein, we added the p38 MAPK inhibitor SB203580 to the medium, and found that SB203580 inhibited the activity of p38 MAPK-ATF2 signaling axis and also inhibited the expression of UCP1 by PZP, as shown in Figure 6D. Taken together, the p38 MAPK-ATF2 signaling pathway is critical for PZP binding to GRP78 to induce UCP1 expression.

Example 7 PZP protein injection promotes obesity in wild-type mice against high-fat diet, but has no effect on UCP1-null mice

Our experimental results of PZP gene deletion prove that PZP protein can accelerate energy metabolism in mice, thus resisting obesity induced by high-fat diet. We next explored whether exogenous supplementation of the original PZP protein can achieve a similar effect. We took 20 8-week-old C57 mice and 20 UCP1KO mice respectively. The mice of each genotype were randomly divided into two groups: the control protein group and the PZP protein group, wherein the protein in the control protein group was the MBP protein expressed without load, and the protein in the PZP protein group was the fusion protein of MBP-PZPC. After the mice were starved for one day, 1 mg/kg body weight of the protein was injected subcutaneously while the diet was resumed for 3 days. Cycle like this for 8 weeks, as shown in Figure 7A. In the same assay protocol as in PZPKO mice, we found that PZP protein significantly reduced high-fat-induced body weight gain compared with the control group, however, this weight loss effect of PZP was completely abolished in UCP1 KO mice, as shown in Figure 7B Show. After additional injection of PZP protein, lipid accumulation in the liver of WT mice was reduced, but there was no change in the two groups in UCP1 KO mice, as shown in Figure 7C. PZP protein injection also significantly improved glucose tolerance in WT mice, but not in UCP1 KO mice, as shown in Figure 7E. The results of H&E staining further proved that PZP protein treatment reduced fat storage in adipocytes and liver cells of C57 mice, but had no effect on UCP1 KO mice, as shown in Figure 7D. The energy metabolism of experimental mice was measured, and the measurement results are shown in Figure 7F. The results showed that subcutaneous injection of PZP protein significantly increased oxygen consumption and energy consumption in WT mice, but had no effect on UCP1 KO mice. More importantly, PZP protein increased UCP1 expression level in WT mice, and P38 MAPK signaling was also activated, as shown in Fig. 7G. Taken together, PZP plays a key role in energy metabolism by promoting the expression of UCP1, and PZP protein administration may be a promising approach for the treatment of obesity and related diseases.

Example 8 Liver-specific knockout of PZP can effectively weaken the weight loss effect of IF

To verify that during IF, the PZP that increases refeeding-induced thermogenesis is mainly derived from the liver. We used the AAV-Crisper/cas9 system to specifically knock down the expression of PZP protein in the liver, as shown in Figure 8A. The main principle is as follows: We designed a potential sgRNA targeting PZP gene (CACCGTAACTTCCGTCGTGTCTCCAC) from zhangfeng lab and cloned it into the single-stranded rAAV 2/8 vector (Addgene, pX602) with liver-specific TBG promoter. Next, we produced adeno-associated virus by transfecting the AAV system (3 plasmid system, ΔF6:AAV 2/8:PX602=3:1:1) into the 293FT system, and finally purified and concentrated the virus particles by gradient centrifugation. The sgRNA/cas9 system was introduced into the body according to the concentration of ^4x1011 viral particles injected into the tail vein of each mouse. It functions specifically in the liver under the catalysis of the TBG promoter to knock out the PZP gene in infected liver cells. Two weeks after the mice were injected with the virus, the mice were euthanized and the levels of PZP protein in the liver and blood of the mice were detected. The detection results are shown in Figure 8B. The results showed that the virus can indeed effectively knock down the expression of PZP in the liver of mice. Our liver The specific knockout model PZP ^△Liver was established successfully. Next, mice were injected with control or specific knockout virus for 2 weeks before IF treatment. After one day of starvation, 1 mg/kg of body weight protein (MBP or MBP-PZPC) was injected subcutaneously, while the diet was resumed for 3 days. In this cycle for 8 weeks, with the detection scheme of PZP KO mice, we found that compared with the control group, the weight of PZP ^△Liver mice was significantly higher than that of the control mice (PZP ^△scramble ), however, PZP exogenous supplementation reversed PZP ^ΔLiver mice exhibited excessive weight gain (Fig. 8D). At the same time, the glucose tolerance of PZP ^△Liver mice was significantly lower than that of PZP ^△scramble in the same period, however, PZP exogenous supplementation reversed the impaired glucose tolerance of PZP ^△Liver mice (Fig. 8E), and then After the mice were euthanized, the WB test found that the UCP1 level in brown adipose tissue of PZP ^{△ Liver} mice was significantly lower than that of PZP ^{△ scramble} in the same period. However, PZP exogenous supplementation reversed the expression of UCP1 protein in brown fat of PZP ^{△ Liver} mice (Fig. 8E). Further, the results of energy consumption monitoring of mice showed that the energy consumption of PZP ^{△ Liver} mice was reduced.

Example 9 PZP protein improves the metabolism of obesity model (DIO model) mice of PZPKO genotype

In order to verify whether PZP protein has weight loss effect. We induced PZPKO mice with a high-fat diet for 10 weeks, and when the average body weight of the mice exceeded 45 g, the mice were subjected to the established IF diet regimen. And at the exchange time point of starvation and refeeding, the mice were treated with MBP-PZPC protein or MBP protein, wherein the preparation method of MBP-PZPC protein was described in Example 5. After continuous treatment for 72 days, it was found that the body weight of DIO mice in the MBP-PZPC protein treatment group decreased by about 8g, while that in the MBP protein treatment group only decreased by about 2g, as shown in Figure 9A, indicating that the MBP-PZPC protein treatment significantly increased IF loss. heavy effect. Further tissue weighing (as shown in FIG. 9B ) and staining results of tissue sections (as shown in FIG. 9C ) showed that MBP-PZPC protein treatment reduced fat storage in tissues, thereby reducing tissue weight. At the same time, MBP-PZPC protein treatment improved the glucose tolerance of DIO mice (as shown in Figure 9D), and the following WB experiments proved that MBP-PZPC protein treatment can activate the P38/ATF2 signal of BAT and increase the UCP1 protein in BAT Abundance, as shown in Figure 9E.

The above is only a preferred embodiment of the application, and it is not intended to limit the application to other forms. Any skilled person who is familiar with this field may use the technical content disclosed above to change or modify the equivalent of the equivalent change. Example. However, any simple modifications, equivalent changes and modifications made to the above embodiments according to the technical essence of the present application without departing from the content of the technical solution of the present application still belong to the protection scope of the technical solution of the present application.

sequence listing

SEQ ID NO:1

PZPC-GS-6 His sequence (SEQ ID NO:2)

NCBI Reference Sequence: NM_007376.4 (SEQ ID NO: 3)

protein_id="NP_031402.3 (SEQ ID NO: 4)

SEQ ID NO:5

Claims

Use of the pregnancy zone protein in the preparation of a pharmaceutical composition for combating obesity or losing weight.
Use of pregnancy zone protein in preparing a pharmaceutical composition for promoting energy consumption of brown adipocytes or in promoting energy consumption of brown adipocytes.
Use of the pregnancy zone protein in the preparation of a pharmaceutical composition for improving the glucose tolerance of a subject or in improving the glucose tolerance of a subject.
Use of the pregnancy zone protein in preparing a pharmaceutical composition for activating the p38 MAPK-ATF2 signaling pathway or in activating the p38 MAPK-ATF2 signaling pathway.
Use of the pregnancy zone protein in preparing a pharmaceutical composition for promoting the expression of UCP1 or in promoting the expression of UCP1.
Use of the pregnancy zone protein in the preparation of a pharmaceutical composition for treating and/or preventing fatty liver.
The use according to any one of claims 1 to 6, wherein the amino acid sequence of the pregnancy zone protein is as shown in SEQ ID NO: 4; or

is an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4; or

It is a sequence consisting of 150-550 amino acids at the C-terminal of SEQ ID NO:4.
Use of a substance that promotes the translocation of GRP78 to the cell membrane in the preparation of a pharmaceutical composition for resisting obesity or losing weight; preferably, the substance is thapsigargin.
A method for promoting the energy consumption of brown adipocytes in the subject, or improving the glucose tolerance of the subject, or activating the p38 MAPK-ATF2 signaling pathway in the subject, or promoting the expression of UCP1 in the subject, its characteristics Herein, it includes the following steps: administering the pregnancy zone protein to the subject or overexpressing the pregnancy zone protein in the subject through genetic manipulation means or enhancing the activity of the pregnancy zone protein in the subject through manipulation means;

Preferably, in the refeeding state of the intermittent light fasting cycle, administer the gestational zone protein to the subject or realize the overexpression of the gestational zone protein in the subject through genetic manipulation means or enhance the gestational zone protein in the subject through manipulation means. gestational zone protein activity; or

Preferably, at the same time as or after administering a substance that promotes the translocation of GRP78 to the cell membrane, the pregnancy zone protein is administered to the subject or the pregnancy zone protein is overexpressed in the subject by genetic manipulation means or by The manipulation means enhances the activity of the pregnancy zone protein in the subject.
A pharmaceutical composition for preventing and/or treating fatty liver, resisting obesity or losing weight, characterized in that it includes gestational zone proteins and/or substances that promote GRP78 translocation to cell membranes;

Preferably, the substance that promotes the translocation of GRP78 to the cell membrane is thapsigargin;

Preferably, the amino acid sequence of the pregnancy zone protein is as shown in SEQ ID NO: 4; or

is an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4; or

It is a sequence consisting of 150-550 amino acids at the C-terminal of SEQ ID NO:4.
A core functional fragment of a pregnancy zone protein for preventing and/or treating fatty liver, resisting obesity or losing weight, characterized in that its sequence is a sequence consisting of 150-550 amino acids;

Preferably, the sequence of the core functional fragment of the gestational zone protein is a sequence consisting of 150-550 amino acids at the C-terminal of the gestational zone protein;

Preferably, the sequence of the core functional fragment of the gestational zone protein is a sequence consisting of 250-300 amino acids at the C-terminal of the gestational zone protein;

Preferably, the sequence of the pregnancy zone protein is shown in SEQ ID NO:4;

Preferably, the sequence of the core functional fragment of the pregnancy zone protein is shown in SEQ ID NO:5.
A nucleic acid molecule encoding the core functional fragment of the pregnancy zone protein according to claim 11, the sequence of which is shown in SEQ ID NO:1 or SEQ ID NO:2.
An expression vector, characterized in that it comprises the nucleic acid molecule of claim 12.
A core function fragment of the pregnancy zone protein as claimed in claim 11, or a core function fragment of the pregnancy zone protein encoded by the nucleic acid molecule as claimed in claim 12, or expressed by the expression vector as claimed in claim 13 Use of the expressed core functional fragment of the pregnancy zone protein in the preparation of a pharmaceutical composition for preventing and/or treating fatty liver, resisting obesity or losing weight.