WO2022270695A1 - Aptamer specifically binding to at least one among nickel ions and cobalt ions - Google Patents

Aptamer specifically binding to at least one among nickel ions and cobalt ions Download PDF

Info

Publication number
WO2022270695A1
WO2022270695A1 PCT/KR2021/017354 KR2021017354W WO2022270695A1 WO 2022270695 A1 WO2022270695 A1 WO 2022270695A1 KR 2021017354 W KR2021017354 W KR 2021017354W WO 2022270695 A1 WO2022270695 A1 WO 2022270695A1
Authority
WO
WIPO (PCT)
Prior art keywords
aptamer
ions
cobalt
nickel
nickel ions
Prior art date
Application number
PCT/KR2021/017354
Other languages
French (fr)
Korean (ko)
Inventor
윤미용
장대혁
이선영
박창제
차균호
Original Assignee
세종대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 세종대학교산학협력단 filed Critical 세종대학교산학협력단
Publication of WO2022270695A1 publication Critical patent/WO2022270695A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/71—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light thermally excited
    • G01N21/73—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light thermally excited using plasma burners or torches
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/62—Detectors specially adapted therefor
    • G01N30/74—Optical detectors

Definitions

  • the present invention relates to an aptamer that specifically binds to at least one of nickel ions and cobalt ions.
  • the radiation decontamination method that is, the method of removing radioactive materials from waste liquid containing radioactive materials, includes filtration treatment (separating suspended solids, insoluble substances and solid particles with a permeable medium), evaporation treatment (removing volatile and non-volatile substances through an evaporator). Separation method), separation treatment method (method of separating radiation particles and ions), and the like.
  • filtration treatment separating suspended solids, insoluble substances and solid particles with a permeable medium
  • evaporation treatment removing volatile and non-volatile substances through an evaporator
  • Separation method separation treatment method (method of separating radiation particles and ions), and the like.
  • the above processes are mixed and used, and various facilities and processing costs are incurred for each process.
  • various wastes inseparably generated in each process are generated, and additional costs are incurred to treat them. Therefore, the current radiation decontamination process requires various treatment processes,
  • an aptamer is a molecule having a single-stranded oligonucleotide sequence, may have a specific three-dimensional structure by intramolecular hydrogen bonding, and can specifically bind to a target through this three-dimensional spatial structure. Because aptamers are target-specific, some aptamers can inhibit the function of target substances and block intracellular signal transduction pathways by binding to targets, so they have attracted attention as nucleic acid agents for target-specific inhibition. .
  • Aptamers can be selected through systematic evolution of ligands by exponential enrichment (SELEX). Aptamers can be bound to a target by forming a specific three-dimensional structure, have high affinity, high specificity, and ease of synthesis, as well as being an eco-friendly biomaterial. Since aptamers have a nanomolar (nM) level of binding force, aptamers can be used to capture even low-concentration targets.
  • SELEX nanomolar
  • An object of the present invention is to provide an aptamer that specifically binds to at least one of nickel ions and cobalt ions.
  • An object of the present invention is to provide a composition for separating or detecting at least one of nickel ions and cobalt ions.
  • An object of the present invention is to provide a microarray for separating or detecting at least one of nickel ions and cobalt ions.
  • An object of the present invention is to provide a column for separating or detecting at least one of nickel ions and cobalt ions.
  • An object of the present invention is to provide a method for separating or detecting at least one of nickel ions and cobalt ions.
  • An aptamer that specifically binds to at least one of nickel ion and cobalt ion consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  • a microarray for separating or detecting at least one of nickel ions and cobalt ions including a substrate on which the aptamer of any one of 1 and 2 above is immobilized.
  • the substrate is one selected from the group consisting of a bead, a membrane, a microtiter plate, and a chip.
  • a method for separating or detecting at least one of nickel ions and cobalt ions comprising the step of contacting the aptamer of any one of the above 1 and 2 with a sample.
  • At least one of nickel ions and cobalt ions can be separated or detected by using the aptamer of the present invention.
  • FIG. 2 confirms the binding force of the N1 2174 aptamer to nickel ions by measuring the concentration of Ni 2+ remaining in the waste liquid that passed through the column filled with the N1 2174 aptamer.
  • FIG. 3 confirms the binding ability of the N1 2174 aptamer to cobalt ions by measuring the concentration of Co 2+ remaining in the waste liquid that has passed through the column filled with the N1 2174 aptamer.
  • the present invention provides an aptamer that specifically binds to at least one of nickel ions and cobalt ions.
  • the aptamer of the present invention may consist of the nucleotide sequence represented by SEQ ID NO: 1.
  • An aptamer refers to an oligonucleotide or peptide molecule that selectively binds to a specific target material, and aptamers have a characteristic of recognizing and binding to a target's three-dimensional structure.
  • An aptamer may have binding ability to a target substance according to its unique structure.
  • the aptamer of the present invention may be prepared by a method well known in the art, or may be prepared by an appropriately modified method as needed.
  • the aptamer of the present invention can specifically bind to at least one of nickel ions and cobalt ions, it can be used to detect or separate at least one of nickel ions and cobalt ions from a sample containing at least one of nickel ions and cobalt ions.
  • detection may include all actions (eg, fluorescence change, absorption change, etc.) of confirming the existence of a specific substance through a selective reaction to the specific substance.
  • separation means to separate only a specific substance from an object containing or suspected of containing a specific substance, and includes “removing” the specific substance from the object or “recovering” and reusing the specific substance. do.
  • the aptamer of the present invention may specifically bind to nickel ions and cobalt ions.
  • the aptamer may be modified with a sugar residue of each nucleotide, specifically ribose or deoxyribose, to increase binding and stability to a target substance.
  • a sugar residue of each nucleotide specifically ribose or deoxyribose
  • one or more oxygen atoms selected from the group consisting of the 2', 3' and 4' positions of the sugar residue may be substituted with other atoms. Examples of modifications may include fluorination, O-alkylation, O-allylation, S-alkylation, S-allylation, amination, and the like. Modification of the sugar moiety as described above can be performed in a conventional manner.
  • Nucleobase of the aptamer may be modified to increase binding to the target substance. Modifications of the nucleic acid base include pyrimidine modification at position 5, purine modification at position 6, purine modification at position 8, modification at exocyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo. or substitution with 5-iodo-urisyl; and the like.
  • An aptamer may have a phosphate group modified to be resistant to nucleases and hydrolases.
  • the phosphoric acid group may be substituted with thioate, dithioate, amidate, formacetal, 3'-amine, and the like.
  • the DNA aptamer may include modification of the 3' end or the 5' end, and the modification may include capping, biotinyl, polyethylglycol, amino acid, peptide, nucleic acid, nucleoside, myristoyl , lithocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl , lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer drugs, toxins, enzymes, radioactive substances, biotin, etc. may be added.
  • the present invention provides a composition for separating or detecting at least one of nickel ions and cobalt ions.
  • the composition may include an aptamer that specifically binds to at least one of a nickel ion and a cobalt ion consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  • the composition may include an aptamer that specifically binds to nickel ions and cobalt ions consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  • the aptamer may be within the aforementioned range, but is not limited thereto.
  • the aptamer may be a conjugate labeled with a detector such as a color-developing enzyme, a fluorescent substance, a radioactive isotope, or a colloid.
  • a detector such as a color-developing enzyme, a fluorescent substance, a radioactive isotope, or a colloid.
  • the chromogenic enzyme may be peroxidase, alkaline phosphatase or acid phosphatase
  • the fluorescent substance may be thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6-yl , 2',7'-dichlorofluorescein-5-yl, 2',7'-dichlorofluorescein-6-yl, dihydrotetramethylrosamine-4-yl, tetramethylrhodamine-5-yl , tetramethylrhodamine-6-yl, 4,4-difluoro-5,
  • an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1, it can be used to detect or separate at least one of nickel ions and cobalt ions from a sample containing at least one of nickel ions and cobalt ions.
  • the present invention provides a microarray for separating or detecting at least one of nickel ions and cobalt ions.
  • the microarray may include a substrate on which an aptamer comprising the nucleotide sequence represented by SEQ ID NO: 1 and specifically binding to at least one of nickel ions and cobalt ions is immobilized.
  • the microarray may include a substrate immobilized with an aptamer comprising the nucleotide sequence represented by SEQ ID NO: 1 and specifically binding to nickel ions and cobalt ions.
  • Substrate means any substrate that has binding properties and to which an aptamer can be attached.
  • the substrate may be one selected from the group consisting of a bead, a membrane, a microtiter plate, and a chip.
  • the aptamer Before immobilizing or applying the aptamer to the substrate, the aptamer may be modified to facilitate immobilization or improve binding efficiency.
  • the modifications include homopolymer tailing; Coupling with different reactive functional groups such as aliphatic groups, NH 2 groups, SH groups or carboxyl groups; or coupling with biotin, hapten or protein.
  • the fixation may be performed by a chemical bonding method or a covalent bonding method such as UV.
  • an aptamer can be bound to a glass surface modified to include an epoxy compound or an aldehyde group, and can be bound by UV on a polylysine coated surface.
  • the aptamer may be fixed to the substrate through a linker such as ethylene glycol oligomer or diamine.
  • a microarray means that a group of oligonucleotides is immobilized in a certain area on a substrate at a high density.
  • the microarray may be prepared by a method well known in the art, or may be prepared by an appropriately modified method as needed.
  • the microarray of the present invention includes a substrate immobilized with an aptamer that specifically binds to at least one of nickel ions and cobalt ions, it can be used to separate or detect at least one of nickel ions and cobalt ions.
  • the present invention provides a column for separating or detecting at least one of nickel ions and cobalt ions.
  • the column may be filled with an aptamer that specifically binds to at least one of nickel ions and cobalt ions composed of the nucleotide sequence represented by SEQ ID NO: 1.
  • the column may be filled with an aptamer that specifically binds to nickel ions and cobalt ions consisting of the base sequence represented by SEQ ID NO: 1.
  • a column well known in the art may be used, but it is not limited as long as it can be filled with an aptamer.
  • the column may be filled with an aptamer immobilized on a substrate, and the substrate may be within the above range, but is not limited thereto.
  • the column of the present invention is filled with an aptamer that specifically binds to at least one of nickel ions and cobalt ions, it can be used to separate or detect at least one of nickel ions and cobalt ions.
  • the present invention provides a method for separating or detecting at least one of nickel ions and cobalt ions.
  • the method may include contacting a sample with an aptamer that specifically binds to at least one of nickel ions and cobalt ions composed of the nucleotide sequence represented by SEQ ID NO: 1.
  • the method may include contacting a sample with an aptamer that specifically binds to nickel ions and cobalt ions consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  • the sample is not limited as long as it contains or is suspected of containing nickel ions or cobalt ions, and may be, for example, collected from any one or more of water, soil, and waste.
  • the aptamer Since the aptamer has excellent binding force to at least one of nickel ions and cobalt ions, when the aptamer is brought into contact with a sample, at least one of the nickel ions and cobalt ions contained in the sample binds to the aptamer to remove the nickel from the sample. ions or cobalt ions can be detected or separated.
  • Contacting the aptamer with the sample may be performed by a method well known in the art, for example, by passing the sample through a column filled with the aptamer, but is not limited thereto.
  • the column may be within the aforementioned range, but is not limited thereto.
  • the present inventors discovered an aptamer (N1 2174) that specifically binds to nickel ions (Ni 2+ ) and cobalt ions (Co 2+ ). Through the mfold and NUPACK programs, it was confirmed whether the aptamer forms a stable secondary structure.
  • N1 aptamer sequence known to specifically bind to nickel ions and cobalt ions was used as a positive control.
  • Table 1 below shows the sequences of N1 (positive control), N1 NEGATIVE (negative control) and N1 2174 aptamer.
  • the N1 2174 aptamer forms a secondary structure similar to that of the N1 aptamer.
  • the N1 NEGATIVE aptamer only the 20th and 75th nucleotide sequences differ from the N1 2174, and the other sequences are the same, but it was confirmed that it forms a completely different secondary structure from the N1 aptamer or the N1 2174 aptamer (Fig. 1a to 1c).
  • the ⁇ G value of the aptamer was confirmed.
  • N1 2174 forms a more stable structure by having a lower ⁇ G value than N1.
  • N1 NEGATIVE although the ⁇ G value is smaller than that of N1, since the secondary structure is different, it can be seen that the binding force of the aptamer is different as will be described later.
  • the concentrations of Ni 2+ and Co 2+ in the waste liquid were measured after passing through a column filled with aptamer-coupled beads (Aptamer-bead).
  • concentration of ions in the waste liquid before passing through the column was set to 10 ⁇ M for both ions, and then the experiment was conducted.
  • concentration of ions included in the waste liquid (Bead only) after passing through the column filled with only beads without the aptamer of FIGS. 2 and 3 means an initial concentration of 10 ⁇ M.
  • the N1 2174 aptamer binds to Ni 2+ and Co 2+ more effectively than the N1 aptamer. This suggests that the N1 2174 aptamer can be used more effectively for Ni 2+ and Co 2+ removal than the N1 aptamer.
  • the N1 NEGATIVE aptamer did not specifically bind to Ni 2+ and Co 2+ by forming a completely different secondary structure, although it differed from N1 2174 by only two bases (FIGS. 2 and 3).
  • the present inventors confirmed the secondary structure and thermodynamic stability of aptamers having sequences different from the N1 2174 aptamer by 2 to 7 bases as a comparative example.
  • the table below shows sequences of the N1 2174 aptamer of the present invention and aptamers used as comparative examples.
  • the table below shows the ⁇ G values of the N1 2174 aptamer of the present invention and the aptamers used as comparative examples.
  • N1 MUT1 and N1 MUT2 aptamers form completely different secondary structures even though only 5 and 4 sequences differ from the N1 2174 aptamer sequence (FIGS. 4a to 4c).
  • the present inventors confirmed the secondary structure and thermodynamic stability of other aptamers including the common sequence of the N1 aptamer and the N1 2174 aptamer.
  • the table below shows the sequences of the N1 and N1 2174 aptamers of the present invention and aptamers used as comparative examples.
  • the N1 aptamer and the N1 2174 aptamer have a common sequence (AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU; SEQ ID NO: 10), but their secondary structures are completely different (FIGS. 5A to 5D). . That is, since not only the sequence common to the N1 aptamer but also other sequences among the sequences of the N1 2174 aptamer are essential for the formation of a unique secondary structure, even the aptamer comprising the sequence of SEQ ID NO: 10 Ni 2+ , Co 2+ suggests that there may be no bonding force for .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plasma & Fusion (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to an aptamer comprising a base sequence represented by SEQ ID NO: 1, wherein the aptamer can specifically bind to at least one among nickel ions and cobalt ions and thereby assist in the separation or detection of nickel ions or cobalt ions. The present invention provides a composition, a microarray, and a column, which contain the aptamer, for separating or detecting at least one among nickel ions and cobalt ions.

Description

니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머Aptamers that specifically bind to at least one of nickel ions and cobalt ions
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머에 관한 것이다.The present invention relates to an aptamer that specifically binds to at least one of nickel ions and cobalt ions.
국내 원전에서 발생하는 방사성 폐액은 방사선 제염 처리를 거쳐 방사성 물질을 제거한다. 방사선 제염 방법, 즉 방사성 물질이 포함된 폐액에서 방사성 물질을 제거하는 방법은 여과 처리법(투과성 매질로 부유물, 불용성 물질 및 고체 입자를 분리하는 방법), 증발처리법(증발기를 통해 휘발성 및 비휘발성 물질을 분리하는 방법), 분리처리법(방사선 입자 및 이온을 분리하는 방법) 등이 있다. 방사선 제염 순도를 높이기 위해 위 공정들이 혼합하여 사용되며, 각 공정에 필요한 다양한 설비들 및 처리 비용이 발생하게 됨. 또한, 각 공정에서 불가분하게 발생하는 여러 폐기물이 나오게 되며 이를 처리하기 위한 추가적인 비용이 발생하게 된다. 따라서, 현재의 방사선 제염 과정은 다양한 처리 과정과 다양한 폐기물 발생, 그에 대한 처리 비용이 요구된다.Radioactive waste fluid generated from domestic nuclear power plants undergoes radiation decontamination to remove radioactive substances. The radiation decontamination method, that is, the method of removing radioactive materials from waste liquid containing radioactive materials, includes filtration treatment (separating suspended solids, insoluble substances and solid particles with a permeable medium), evaporation treatment (removing volatile and non-volatile substances through an evaporator). Separation method), separation treatment method (method of separating radiation particles and ions), and the like. In order to increase the purity of radiation decontamination, the above processes are mixed and used, and various facilities and processing costs are incurred for each process. In addition, various wastes inseparably generated in each process are generated, and additional costs are incurred to treat them. Therefore, the current radiation decontamination process requires various treatment processes, various waste generation, and corresponding treatment costs.
한편, 앱타머는 단일 가닥 올리고뉴클레오티드 서열을 갖는 분자이고, 분자 내 수소결합에 의해 특정 3차원 구조를 갖을 수 있으며, 이러한 3차원의 공간적 구조를 통해 표적에 특이적으로 결합할 수 있다. 앱타머는 표적에 특이적이기 때문에, 일부 앱타머는 표적 물질의 기능을 억제할 수 있고, 표적에 결합함으로써 세포 내 신호 전달 경로를 차단할 수 있기 때문에 표적을 특이적으로 억제하기 위한 핵산 약제로서 주목을 받아왔다. On the other hand, an aptamer is a molecule having a single-stranded oligonucleotide sequence, may have a specific three-dimensional structure by intramolecular hydrogen bonding, and can specifically bind to a target through this three-dimensional spatial structure. Because aptamers are target-specific, some aptamers can inhibit the function of target substances and block intracellular signal transduction pathways by binding to targets, so they have attracted attention as nucleic acid agents for target-specific inhibition. .
앱타머는 SELEX (systematic evolution of ligands by exponential enrichment)를 통해 선별될 수 있다. 앱타머는 특정 3차원 구조를 형성하여 표적에 결합될 수 있으며, 높은 친화성, 높은 특이성, 합성의 용이성을 가지고 있을 뿐 아니라 친환경 바이오 소재라는 장점을 갖는다. 앱타머는 나노몰(nM) 수준의 결합력을 갖는바 앱타머를 활용하여 낮은 농도의 표적까지도 포집할 수 있다.Aptamers can be selected through systematic evolution of ligands by exponential enrichment (SELEX). Aptamers can be bound to a target by forming a specific three-dimensional structure, have high affinity, high specificity, and ease of synthesis, as well as being an eco-friendly biomaterial. Since aptamers have a nanomolar (nM) level of binding force, aptamers can be used to capture even low-concentration targets.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머를 제공하는 것을 목적으로 한다.An object of the present invention is to provide an aptamer that specifically binds to at least one of nickel ions and cobalt ions.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 조성물을 제공하는 것을 목적으로 한다.An object of the present invention is to provide a composition for separating or detecting at least one of nickel ions and cobalt ions.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 마이크로어레이를 제공하는 것을 목적으로 한다.An object of the present invention is to provide a microarray for separating or detecting at least one of nickel ions and cobalt ions.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 컬럼을 제공하는 것을 목적으로 한다.An object of the present invention is to provide a column for separating or detecting at least one of nickel ions and cobalt ions.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출 방법을 제공하는 것을 목적으로 한다.An object of the present invention is to provide a method for separating or detecting at least one of nickel ions and cobalt ions.
1. 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머.1. An aptamer that specifically binds to at least one of nickel ion and cobalt ion consisting of the nucleotide sequence represented by SEQ ID NO: 1.
2. 위 1에 있어서, 상기 앱타머는 니켈 이온 및 코발트 이온에 특이적으로 결합하는 앱타머.2. The aptamer according to 1 above, wherein the aptamer specifically binds to nickel ions and cobalt ions.
3. 위 1 및 2 중 어느 한 항의 앱타머를 포함하는 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 조성물.3. A composition for separating or detecting at least one of nickel ions and cobalt ions containing the aptamer of any one of 1 and 2 above.
4. 위 1 및 2 중 어느 한 항의 앱타머가 고정화된 기판을 포함하는 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 마이크로어레이.4. A microarray for separating or detecting at least one of nickel ions and cobalt ions, including a substrate on which the aptamer of any one of 1 and 2 above is immobilized.
5. 위 4에 있어서, 상기 기판은 비드(bead), 막(membrane), 마이크로 타이터 플레이트(microtiter plate) 및 칩(chip)으로 이루어진 군에서 선택된 하나인 마이크로어레이.5. The microarray according to 4 above, wherein the substrate is one selected from the group consisting of a bead, a membrane, a microtiter plate, and a chip.
6. 위 1 및 2 중 어느 한 항의 앱타머가 충진된 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 컬럼.6. A column for separation or detection of at least one of nickel ions and cobalt ions filled with the aptamer of any one of 1 and 2 above.
7. 위 1 및 2 중 어느 한 항의 앱타머를 시료와 접촉시키는 단계를 포함하는 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출 방법.7. A method for separating or detecting at least one of nickel ions and cobalt ions, comprising the step of contacting the aptamer of any one of the above 1 and 2 with a sample.
8. 위 7에 있어서, 상기 시료는 물, 토양 및 폐기물 중 어느 하나 이상에서 채취된 시료인 방법.8. The method of 7 above, wherein the sample is a sample taken from any one or more of water, soil, and waste.
본 발명의 앱타머를 이용하면 니켈 이온 및 코발트 이온 중 적어도 하나를 분리 또는 검출할 수 있다.At least one of nickel ions and cobalt ions can be separated or detected by using the aptamer of the present invention.
도 1a 내지 도 1c는 N1 2174 앱타머와 2개의 염기가 상이한 서열을 갖는 앱타머(N1 NEGATIVE)가 N1 2174 앱타머와 상이한 2차 구조를 형성하는 것을 확인한 것이다.1a to 1c confirm that the aptamer (N1 NEGATIVE) having a sequence different from the N1 2174 aptamer by two bases forms a secondary structure different from that of the N1 2174 aptamer.
도 2는 N1 2174 앱타머가 충진된 컬럼을 통과한 폐액 속에 남아있는 Ni2+의 농도를 측정하여 N1 2174 앱타머의 니켈 이온에 대한 결합력을 확인한 것이다.FIG. 2 confirms the binding force of the N1 2174 aptamer to nickel ions by measuring the concentration of Ni 2+ remaining in the waste liquid that passed through the column filled with the N1 2174 aptamer.
도 3은 N1 2174 앱타머가 충진된 컬럼을 통과한 폐액 속에 남아있는 Co2+의 농도를 측정하여 N1 2174 앱타머의 코발트 이온에 대한 결합력을 확인한 것이다.FIG. 3 confirms the binding ability of the N1 2174 aptamer to cobalt ions by measuring the concentration of Co 2+ remaining in the waste liquid that has passed through the column filled with the N1 2174 aptamer.
도 4a 내지 도 4e는 N1 2174 앱타머와 2개 내지 7개의 염기가 상이한 서열을 갖는 앱타머들(N1 MUT1, N1 MUT2, N1 MUT3, N1 MUT4)이 N1 2174 앱타머와 상이한 2차 구조를 형성하는 것을 확인한 것이다.4a to 4e show that aptamers (N1 MUT1, N1 MUT2, N1 MUT3, N1 MUT4) having sequences different from the N1 2174 aptamer by 2 to 7 bases form a secondary structure different from that of the N1 2174 aptamer. that confirmed that
도 5a 내지 도 5d는 N1 앱타머와 N1 2174 앱타머의 공통 서열을 포함하는 다른 앱타머들(N1 74, N1 21)이 N1 2174 앱타머와 상이한 2차 구조를 형성하는 것을 확인한 것이다.5a to 5d confirm that other aptamers (N1 74, N1 21) including a common sequence of the N1 aptamer and the N1 2174 aptamer form a secondary structure different from that of the N1 2174 aptamer.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머를 제공한다.The present invention provides an aptamer that specifically binds to at least one of nickel ions and cobalt ions.
본 발명의 앱타머는 서열번호 1로 표시되는 염기 서열로 이루어진 것일 수 있다.The aptamer of the present invention may consist of the nucleotide sequence represented by SEQ ID NO: 1.
(서열번호 1: (SEQ ID NO: 1:
GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG)GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG)
앱타머(aptamer)란 특정 표적 물질에 선택적으로 결합하는 올리고뉴클레오타이드(oligonucleotide) 또는 펩타이드(peptide) 분자를 의미하며, 앱타머는 표적의 3차원적인 구조를 인식해 결합하는 특징을 가지고 있다. 앱타머는 고유의 구조에 따라 표적 물질에 대한 결합능을 가질 수 있다. 또한 생물학적 생산이 아닌 화학적 합성법으로 생산하기 때문에 배치 재현성이 높고 물질 안정성도 우수하며 제조 가격도 저렴하다는 장점을 갖는다. 본 발명의 앱타머는 통상의 기술 분야에 잘 알려진 방법으로 제조된 것일 수 있고, 필요에 따라 적절히 변형된 방법에 의해 제조된 것일 수 있다.An aptamer refers to an oligonucleotide or peptide molecule that selectively binds to a specific target material, and aptamers have a characteristic of recognizing and binding to a target's three-dimensional structure. An aptamer may have binding ability to a target substance according to its unique structure. In addition, since it is produced by chemical synthesis rather than biological production, it has the advantage of high batch reproducibility, excellent material stability, and low manufacturing cost. The aptamer of the present invention may be prepared by a method well known in the art, or may be prepared by an appropriately modified method as needed.
본 발명의 앱타머는 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합할 수 있어 니켈 이온 및 코발트 이온 중 적어도 하나를 포함하는 시료로부터 니켈 이온 및 코발트 이온 중 적어도 하나를 검출 또는 분리하는 데에 이용할 수 있다.Since the aptamer of the present invention can specifically bind to at least one of nickel ions and cobalt ions, it can be used to detect or separate at least one of nickel ions and cobalt ions from a sample containing at least one of nickel ions and cobalt ions. can
용어 “검출”은 특정 물질에 대한 선택적 반응을 통해 상기 특정 물질의 존재를 확인하는 모든 행위(예를 들면, 형광 변화, 흡광 변화 등)를 포함하는 것일 수 있다.The term "detection" may include all actions (eg, fluorescence change, absorption change, etc.) of confirming the existence of a specific substance through a selective reaction to the specific substance.
용어 “분리”는 특정 물질을 함유하고 있거나 함유하는 것으로 의심되는 대상으로부터 상기 특정 물질만을 별도로 구분하는 것을 의미하며, 상기 특정 물질을 대상으로부터 “제거”하거나 특정 물질을 “회수”하여 재사용하는 것을 포함한다.The term "separation" means to separate only a specific substance from an object containing or suspected of containing a specific substance, and includes "removing" the specific substance from the object or "recovering" and reusing the specific substance. do.
일 예에 따르면, 본 발명의 앱타머는 니켈 이온 및 코발트 이온에 특이적으로 결합하는 것일 수 있다.According to one example, the aptamer of the present invention may specifically bind to nickel ions and cobalt ions.
앱타머는 표적 물질에 대한 결합성 및 안정성을 높이기 위해, 각 뉴클레오티드의 당 잔기, 구체적으로 리보오스 또는 디옥시리보스가 수식될 수 있다. 상기 수식은 당 잔기의 2'위치, 3'위치 및 4'위치로 구성된 군으로부터 선택되는 어느 하나 이상의 산소 원자를 다른 원자로 치환한 것일 수 있다. 수식의 예로는 플루오로화, O-알킬화, O-알릴화, S-알킬화, S-알릴화, 아미노화 등이 포함될 수 있다. 상기와 같은 당 잔기의 변형은 통상적인 방법으로 수행될 수 있다.The aptamer may be modified with a sugar residue of each nucleotide, specifically ribose or deoxyribose, to increase binding and stability to a target substance. In the above formula, one or more oxygen atoms selected from the group consisting of the 2', 3' and 4' positions of the sugar residue may be substituted with other atoms. Examples of modifications may include fluorination, O-alkylation, O-allylation, S-alkylation, S-allylation, amination, and the like. Modification of the sugar moiety as described above can be performed in a conventional manner.
앱타머는 표적 물질에 대한 결합성을 높이기 위해, 핵산염기가 변형될 수 있다. 상기 핵산염기의 변형은 5위치의 피리미딘 변형, 6위치의 푸린 변형, 8위치의 푸린 변형, 환외(環外) 아민에서의 변형, 4-티오우리딘으로의 치환, 5-브로모로의 치환 또는 5-요오드-우리실로의 치환 등을 포함할 수 있다.Nucleobase of the aptamer may be modified to increase binding to the target substance. Modifications of the nucleic acid base include pyrimidine modification at position 5, purine modification at position 6, purine modification at position 8, modification at exocyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo. or substitution with 5-iodo-urisyl; and the like.
앱타머는 뉴클레아제 및 가수분해효소 등에 대해 내성을 갖도록 인산기가 변형될 수 있다. 예를 들면, 상기 인산기는 티오에이트, 디티오에이트, 아미데이트, 포름아세탈, 3'-아민 등으로 치환될 수 있다. 나아가, 상기 DNA 앱타머는 3' 말단 또는 5' 말단의 변형을 포함할 수 있고, 상기 변형은 캡핑이나, 바이오티닐, 폴리에틸글리콜, 아미노산, 펩티드, 핵산, 뉴클레오시드, 미리스토일(myristoyl), 리소콜릭-올레일(lithocolic-oleyl), 도코사닐(docosanyl), 라우로일(lauroyl), 스테아로일(stearoyl), 팔미토일(palmitoyl), 올레오일(oleoyl), 리놀레오일(linoleoyl), 지질, 스테로이드, 콜레스테롤, 카페인, 비타민, 색소, 형광물질, 항암제, 독소, 효소, 방사성 물질, 비오틴 등이 부가된 것일 수 있다.An aptamer may have a phosphate group modified to be resistant to nucleases and hydrolases. For example, the phosphoric acid group may be substituted with thioate, dithioate, amidate, formacetal, 3'-amine, and the like. Furthermore, the DNA aptamer may include modification of the 3' end or the 5' end, and the modification may include capping, biotinyl, polyethylglycol, amino acid, peptide, nucleic acid, nucleoside, myristoyl , lithocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl , lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer drugs, toxins, enzymes, radioactive substances, biotin, etc. may be added.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 조성물을 제공한다.The present invention provides a composition for separating or detecting at least one of nickel ions and cobalt ions.
일 예에 따르면, 조성물은 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머를 포함할 수 있다.According to one example, the composition may include an aptamer that specifically binds to at least one of a nickel ion and a cobalt ion consisting of the nucleotide sequence represented by SEQ ID NO: 1.
다른 예에 따르면, 조성물은 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온에 특이적으로 결합하는 앱타머를 포함할 수 있다.According to another example, the composition may include an aptamer that specifically binds to nickel ions and cobalt ions consisting of the nucleotide sequence represented by SEQ ID NO: 1.
앱타머는 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.The aptamer may be within the aforementioned range, but is not limited thereto.
앱타머는 발색 효소, 형광물질, 방사성 동위 원소 또는 콜로이드 등의 검출체로 표지된 접합체일 수 있다. 발색 효소는 퍼록시다제, 알칼라인 포스파타제 또는 산성 포스파타제일 수 있고, 형광물질은 티오우레아(FTH), 7-아세톡시쿠마린-3-일, 플루오레신-5-일, 플루오레신-6-일, 2',7'-디클로로플루오레신-5-일, 2',7'-디클로로플루오레신-6-일, 디하이드로 테트라메틸로사민-4-일, 테트라메틸로다민-5-일, 테트라메틸로다민-6-일, 4,4-디플루오로-5,7-디메틸-4-보라-3a,4a-디아자-s-인다센-3-에틸 또는 4,4-디플루오로-5,7-디페닐-4-보라-3a,4a-디아자-s-인다센-3-에틸, Cy3, Cy5, 폴리 L-라이신-플루오레세인 이소티오시아네이트(FITC), 로다민-B-이소티오시아네이트(RITC), PE(Phycoerythrin) 또는 로다민일 수 있다.The aptamer may be a conjugate labeled with a detector such as a color-developing enzyme, a fluorescent substance, a radioactive isotope, or a colloid. The chromogenic enzyme may be peroxidase, alkaline phosphatase or acid phosphatase, and the fluorescent substance may be thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6-yl , 2',7'-dichlorofluorescein-5-yl, 2',7'-dichlorofluorescein-6-yl, dihydrotetramethylrosamine-4-yl, tetramethylrhodamine-5-yl , tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl or 4,4-difluoro Rho-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl, Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), Rhoda Min-B-isothiocyanate (RITC), PE (phycoerythrin) or rhodamine.
서열번호 1로 표시되는 염기 서열로 이루어진 앱타머를 포함함으로써, 니켈 이온 및 코발트 이온 중 적어도 하나를 포함하는 시료로부터 니켈 이온 및 코발트 이온 중 적어도 하나를 검출 또는 분리하는 데에 이용할 수 있다.By including an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1, it can be used to detect or separate at least one of nickel ions and cobalt ions from a sample containing at least one of nickel ions and cobalt ions.
용어 “검출” 및 “분리” 는 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.The terms "detection" and "separation" may be within the foregoing scope, but are not limited thereto.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 마이크로어레이를 제공한다.The present invention provides a microarray for separating or detecting at least one of nickel ions and cobalt ions.
일 예에 따르면, 마이크로어레이는 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머가 고정화된 기판을 포함할 수 있다.According to one example, the microarray may include a substrate on which an aptamer comprising the nucleotide sequence represented by SEQ ID NO: 1 and specifically binding to at least one of nickel ions and cobalt ions is immobilized.
다른 예에 따르면, 마이크로어레이는 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온에 특이적으로 결합하는 앱타머가 고정화된 기판을 포함할 수 있다.According to another example, the microarray may include a substrate immobilized with an aptamer comprising the nucleotide sequence represented by SEQ ID NO: 1 and specifically binding to nickel ions and cobalt ions.
앱타머, 용어 “분리” 및 용어 “검출”은 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.An aptamer, the term "separation" and the term "detection" may be within the foregoing scope, but is not limited thereto.
기판은 결합 특성을 보유하고 앱타머가 부착될 수 있는 임의의 기판을 의미한다. 통상적으로 기판은 비드(bead), 막(membrane), 마이크로 타이터 플레이트(microtiter plate) 및 칩(chip)으로 이루어진 군에서 선택된 하나일 수 있다. 앱타머를 기판에 고정 또는 적용시키기 전에 앱타머를 변형시켜 고정화를 촉진시키거나 결합 효율을 개선시킬 수 있다. 상기 변형은 단독 중합체 테일링(homopolymer tailing); 지방족기, NH2기, SH기 또는 카르복실기와 같은 상이한 반응성 작용기와의 커플링; 또는 바이오틴, 합텐 또는 단백질과의 커플링;을 포함할 수 있다. 상기 고정은 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 수행될 수 있다. 예를 들면, 앱타머는 에폭시 화합물 또는 알데하이드기를 포함하도록 변형된 유리 표면에 결합될 수 있고, 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 앱타머는 에틸렌글리콜 올리고머나 디아민과 같은 링커를 통해 기판에 고정될 수도 있다.Substrate means any substrate that has binding properties and to which an aptamer can be attached. Typically, the substrate may be one selected from the group consisting of a bead, a membrane, a microtiter plate, and a chip. Before immobilizing or applying the aptamer to the substrate, the aptamer may be modified to facilitate immobilization or improve binding efficiency. The modifications include homopolymer tailing; Coupling with different reactive functional groups such as aliphatic groups, NH 2 groups, SH groups or carboxyl groups; or coupling with biotin, hapten or protein. The fixation may be performed by a chemical bonding method or a covalent bonding method such as UV. For example, an aptamer can be bound to a glass surface modified to include an epoxy compound or an aldehyde group, and can be bound by UV on a polylysine coated surface. In addition, the aptamer may be fixed to the substrate through a linker such as ethylene glycol oligomer or diamine.
마이크로어레이란 기판 상에 올리고뉴클레오티드 그룹이 높은 밀도로 일정한 영역에 고정화되어 있는 것을 의미한다. 마이크로어레이는 통상의 기술 분야에 잘 알려진 방법으로 제조된 것일 수 있고, 필요에 따라 적절히 변형된 방법에 의해 제조된 것일 수 있다.A microarray means that a group of oligonucleotides is immobilized in a certain area on a substrate at a high density. The microarray may be prepared by a method well known in the art, or may be prepared by an appropriately modified method as needed.
본 발명의 마이크로어레이는 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머가 고정화된 기판을 포함하므로 니켈 이온 및 코발트 이온 중 적어도 하나를 분리 또는 검출하는 데에 사용될 수 있다.Since the microarray of the present invention includes a substrate immobilized with an aptamer that specifically binds to at least one of nickel ions and cobalt ions, it can be used to separate or detect at least one of nickel ions and cobalt ions.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 컬럼을 제공한다.The present invention provides a column for separating or detecting at least one of nickel ions and cobalt ions.
일 예에 따르면, 컬럼은 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머가 충진된 것일 수 있다.According to one example, the column may be filled with an aptamer that specifically binds to at least one of nickel ions and cobalt ions composed of the nucleotide sequence represented by SEQ ID NO: 1.
다른 예에 따르면, 컬럼은 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온에 특이적으로 결합하는 앱타머가 충진된 것일 수 있다.According to another example, the column may be filled with an aptamer that specifically binds to nickel ions and cobalt ions consisting of the base sequence represented by SEQ ID NO: 1.
앱타머, 용어 “분리” 및 용어 “검출”은 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.An aptamer, the term "separation" and the term "detection" may be within the foregoing scope, but is not limited thereto.
컬럼은 통상의 기술 분야에 잘 알려진 것을 사용할 수 있으나 앱타머가 충진될 수 있는 것이라면 제한되지 않는다. 컬럼은 기판에 고정화된 앱타머가 충진된 것일 수 있고, 기판은 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.A column well known in the art may be used, but it is not limited as long as it can be filled with an aptamer. The column may be filled with an aptamer immobilized on a substrate, and the substrate may be within the above range, but is not limited thereto.
본 발명의 컬럼은 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머가 충진되어 있으므로 니켈 이온 및 코발트 이온 중 적어도 하나를 분리 또는 검출하는 데에 사용될 수 있다.Since the column of the present invention is filled with an aptamer that specifically binds to at least one of nickel ions and cobalt ions, it can be used to separate or detect at least one of nickel ions and cobalt ions.
본 발명은 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출 방법을 제공한다.The present invention provides a method for separating or detecting at least one of nickel ions and cobalt ions.
일 예에 따르면, 방법은 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머를 시료와 접촉시키는 단계를 포함하는 것일 수 있다.According to one example, the method may include contacting a sample with an aptamer that specifically binds to at least one of nickel ions and cobalt ions composed of the nucleotide sequence represented by SEQ ID NO: 1.
다른 예에 따르면, 방법은 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온에 특이적으로 결합하는 앱타머를 시료와 접촉시키는 단계를 포함하는 것일 수 있다.According to another example, the method may include contacting a sample with an aptamer that specifically binds to nickel ions and cobalt ions consisting of the nucleotide sequence represented by SEQ ID NO: 1.
앱타머, 용어 “분리” 및 용어 “검출”은 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.An aptamer, the term "separation" and the term "detection" may be within the foregoing scope, but is not limited thereto.
시료는 니켈 이온 또는 코발트 이온을 함유하고 있거나 함유하고 있는 것으로 의심 되는 것이라면 제한되지 않고, 예를 들면 물, 토양 및 폐기물 중 어느 하나 이상에서 채취된 것일 수 있다.The sample is not limited as long as it contains or is suspected of containing nickel ions or cobalt ions, and may be, for example, collected from any one or more of water, soil, and waste.
상기 앱타머는 니켈 이온 및 코발트 이온 중 적어도 하나에 대해 결합력이 우수하므로, 앱타머를 시료와 접촉시키면 시료 내에 포함된 니켈 이온 및 코발트 이온 중 적어도 하나의 이온이 앱타머와 결합하여 해당 시료로부터 상기 니켈 이온 또는 코발트 이온을 검출 또는 분리할 수 있다.Since the aptamer has excellent binding force to at least one of nickel ions and cobalt ions, when the aptamer is brought into contact with a sample, at least one of the nickel ions and cobalt ions contained in the sample binds to the aptamer to remove the nickel from the sample. ions or cobalt ions can be detected or separated.
앱타머를 시료와 접촉시키는 단계는 통상의 기술 분야에 잘 알려진 방법에 의해 수행되는 것일 수 있고, 예를 들면 앱타머가 충진된 컬럼에 시료를 통과시켜 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.Contacting the aptamer with the sample may be performed by a method well known in the art, for example, by passing the sample through a column filled with the aptamer, but is not limited thereto.
컬럼은 전술한 범위 내의 것일 수 있으나, 이에 제한되는 것은 아니다.The column may be within the aforementioned range, but is not limited thereto.
이하, 본 발명을 구체적으로 설명하기 위해 실시예를 들어 상세하게 설명하기로 한다.Hereinafter, examples will be described in detail to explain the present invention in detail.
실시예Example
본 발명자들은 니켈 이온(Ni2+) 및 코발트 이온(Co2+)에 특이적으로 결합하는 앱타머(N1 2174)를 발굴하였다. mfold 및 NUPACK 프로그램을 통해 앱타머가 안정적인 2차 구조를 형성하는지 여부를 확인하였다.The present inventors discovered an aptamer (N1 2174) that specifically binds to nickel ions (Ni 2+ ) and cobalt ions (Co 2+ ). Through the mfold and NUPACK programs, it was confirmed whether the aptamer forms a stable secondary structure.
1. N1 2174 앱타머의 2차 구조 및 열역학적 안정성 확인1. Confirmation of secondary structure and thermodynamic stability of N1 2174 aptamer
양성 대조군으로 니켈 이온 및 코발트 이온에 특이적으로 결합할 수 있다고 알려진 N1 앱타머의 서열을 사용하였다. 하기 표 1은 N1(Positive control), N1 NEGATIVE(Negative control) 및 N1 2174 앱타머의 서열을 나타낸 것이다.As a positive control, an N1 aptamer sequence known to specifically bind to nickel ions and cobalt ions was used. Table 1 below shows the sequences of N1 (positive control), N1 NEGATIVE (negative control) and N1 2174 aptamer.
AptamerAptamer 서열번호sequence number SequenceSequence
N1 2174N1 2174 1One GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG GCUGCAAAACGUCGGCAGGG AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU CCCAGCCGAGGGACCGCAGCG
N1(Positive control)N1 (Positive control) 22 GGGAGAGGAUACUACACGUGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUUGCAUGUAGCAGAAGCUUCCG GGGAGAGGAUACUACACGUG AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU UGCAUGUAGCAGAAGCUUCCG
N1 NEGATIVE(Negative control)N1 NEGATIVE (Negative control) 33 GCUGCAAAACGUCGGCAGGUAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUUCCAGCCGAGGGACCGCAGCGGCUGCAAAACGUCGGCAGG U AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU U CCAGCCGAGGGACCGCAGCG
도 1a 내지 도 1c에 나타난 바와 같이, N1 2174 앱타머의 경우 N1 앱타머와 유사한 2차 구조를 형성함을 확인할 수 있다. N1 NEGATIVE 앱타머의 경우, N1 2174와 20번째 및 75번째 염기 서열만이 상이하고 그 외의 서열은 동일하나 N1 앱타머 또는 N1 2174 앱타머와는 전혀 다른 2차 구조를 형성하는 것을 확인하였다(도 1a 내지 도 1c).As shown in FIGS. 1a to 1c, it can be confirmed that the N1 2174 aptamer forms a secondary structure similar to that of the N1 aptamer. In the case of the N1 NEGATIVE aptamer, only the 20th and 75th nucleotide sequences differ from the N1 2174, and the other sequences are the same, but it was confirmed that it forms a completely different secondary structure from the N1 aptamer or the N1 2174 aptamer (Fig. 1a to 1c).
다음으로 앱타머의 △G값을 확인하였다. △G값이 더 작을수록 열역학적으로 안정한 구조를 갖게 된다. 하기 표 2에 나타난 바와 같이, N1 2174는 N1보다 더 낮은 △G값을 가져 보다 안정적인 구조를 형성함을 확인할 수 있다. 한편, N1 NEGATIVE의 경우, N1 보다 △G값이 작으나, 2차 구조가 상이하므로 후술할 바와 같이 앱타머의 결합력이 달라짐을 알 수 있다.Next, the ΔG value of the aptamer was confirmed. The smaller the ΔG value, the more thermodynamically stable the structure. As shown in Table 2 below, it can be confirmed that N1 2174 forms a more stable structure by having a lower ΔG value than N1. On the other hand, in the case of N1 NEGATIVE, although the ΔG value is smaller than that of N1, since the secondary structure is different, it can be seen that the binding force of the aptamer is different as will be described later.
AptamerAptamer △G값△G value
N1 2174N1 2174 -30.33-30.33
N1(Positive control)N1 (Positive control) -20.43-20.43
N1 NEGATIVE(Negative control)N1 NEGATIVE (Negative control) -24.79-24.79
2. N1 2174 앱타머의 Ni2. Ni of the N1 2174 aptamer 2+2+ , Co, Co 2+2+ 에 대한 결합력 확인Check binding force for
ICP-OES PlasmaQuant®PQ 9000를 이용하여, 앱타머가 결합된 비드(Aptamer-bead)가 충진된 컬럼 통과 후 폐액 내 Ni2+, Co2+의 농도를 측정하였다. 컬럼 통과 전 폐액 내 이온의 농도는 두 이온 모두 10 μM로 설정 후 실험을 진행하였다. 도 2 및 도 3의 앱타머 없이 비드만이 충진된 컬럼 통과 후의 폐액(Bead only)에 포함된 이온의 농도는 초기 농도인 10 μM을 의미한다.Using ICP-OES PlasmaQuant®PQ 9000, the concentrations of Ni 2+ and Co 2+ in the waste liquid were measured after passing through a column filled with aptamer-coupled beads (Aptamer-bead). The concentration of ions in the waste liquid before passing through the column was set to 10 μM for both ions, and then the experiment was conducted. The concentration of ions included in the waste liquid (Bead only) after passing through the column filled with only beads without the aptamer of FIGS. 2 and 3 means an initial concentration of 10 μM.
도 2 및 도 3에 나타난 바와 같이, N1 2174 앱타머는 N1 앱타머에 비해 더 효과적으로 Ni2+ 및 Co2+에 결합하는 것을 확인하였다. 이는 N1 2174 앱타머가 N1 앱타머에 비해 Ni2+, Co2+ 제거에 더 효과적으로 이용될 수 있음을 시사한다. 한편, N1 NEGATIVE 앱타머는 N1 2174와 2개의 염기만 상이하나 전혀 다른 2차 구조를 형성하여 Ni2+, Co2+에 대해 특이적으로 결합하지 못한다는 것을 확인하였다(도 2 및 도 3).As shown in FIGS. 2 and 3 , it was confirmed that the N1 2174 aptamer binds to Ni 2+ and Co 2+ more effectively than the N1 aptamer. This suggests that the N1 2174 aptamer can be used more effectively for Ni 2+ and Co 2+ removal than the N1 aptamer. On the other hand, it was confirmed that the N1 NEGATIVE aptamer did not specifically bind to Ni 2+ and Co 2+ by forming a completely different secondary structure, although it differed from N1 2174 by only two bases (FIGS. 2 and 3).
3. 비교예 (1)3. Comparative Example (1)
본 발명자들은 비교예로 N1 2174 앱타머와 2 내지 7개의 염기가 상이한 서열을 갖는 앱타머들의 2차 구조와 열역학적 안정성을 확인하였다.The present inventors confirmed the secondary structure and thermodynamic stability of aptamers having sequences different from the N1 2174 aptamer by 2 to 7 bases as a comparative example.
3-1. 비교 앱타머의 염기 서열3-1. Base sequences of comparative aptamers
하기 표는 본 발명 N1 2174 앱타머와 비교예로 사용된 앱타머들의 서열을 나타낸 것이다.The table below shows sequences of the N1 2174 aptamer of the present invention and aptamers used as comparative examples.
AptamerAptamer 서열번호sequence number SequenceSequence
N1 2174N1 2174 1One GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCGGCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG
N1 MUT1N1 MUT1 44 GCUACAAAACGUCGGCAGCCAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCGGAGGGACCGCAGCA GCU A CAAAACGUCGGCAG CC AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGC G GAGGGACCGCAGC A
N1 MUT2N1 MUT2 55 GCUGCAAAACGUCGGCAGAUAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUGGCAGCCGAGGGACCGCAGCGGCUGCAAAACGUCGGCAG AU AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU GG CAGCCGAGGGACCGCAGCG
N1 MUT3N1 MUT3 66 GCUGCAAAACGUCGGCAGGAAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUACCAGCCGAGGGACCGCAGCGGCUGCAAAACGUCGGCAGG A AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU A CCAGCCGAGGGACCGCAGCG
N1 MUT4N1 MUT4 77 GCUGCGGCCCGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUAACAGCCGAGGGGCCGCAGCGGCUGC GGCC CGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU AA CAGCCGAGGG GCCGCAGCG
하기 표는 본 발명 N1 2174 앱타머와 비교예로 사용된 앱타머들의 △G값을 나타낸 것이다.The table below shows the ΔG values of the N1 2174 aptamer of the present invention and the aptamers used as comparative examples.
AptamerAptamer △G값△G value
N1 2174N1 2174 -30.33-30.33
N1 MUT1N1 MUT1 -18.03-18.03
N1 MUT2N1 MUT2 -22.74-22.74
N1 MUT3N1 MUT3 -21.69-21.69
N1 MUT4N1 MUT4 -40.21-40.21
도 4d의 N1 MUT3 앱타머의 2차 구조에서 확인할 수 있듯이, N1 2174 앱타머 서열과 단 2개의 염기만 달라져도 전혀 상이한 2차 구조를 형성하였다(도 4a 및 도 4d). 또한, 상기 표 4에 나타난 바와 같이, N1 MUT4 앱타머의 △G값은 -40.21로 N1 앱타머에 비해 열역학적으로 안정하나, 도 4e에서 확인할 수 있듯이 그 2차 구조는 전혀 상이한 것을 확인하였다(도 4a 및 도 4e).As can be seen from the secondary structure of the N1 MUT3 aptamer in FIG. 4d, a completely different secondary structure was formed even when only two bases were different from the sequence of the N1 2174 aptamer (FIGS. 4a and 4d). In addition, as shown in Table 4, the ΔG value of the N1 MUT4 aptamer is -40.21, which is thermodynamically stable compared to the N1 aptamer, but as can be seen in FIG. 4e, it was confirmed that the secondary structure is completely different (Fig. 4a and 4e).
뿐만 아니라, N1 MUT1, N1 MUT2 앱타머도 N1 2174 앱타머 서열과 각 5개, 4개의 서열만이 상이함에도 전혀 다른 2차 구조를 형성하는 것을 확인할 수 있다(도 4a 내지 도 4c).In addition, it can be confirmed that the N1 MUT1 and N1 MUT2 aptamers form completely different secondary structures even though only 5 and 4 sequences differ from the N1 2174 aptamer sequence (FIGS. 4a to 4c).
4. 비교예 (2)4. Comparative Example (2)
추가적으로 본 발명자들은 N1 앱타머와 N1 2174 앱타머의 공통 서열을 포함하는 다른 앱타머들의 2차 구조와 열역학적 안정성을 확인하였다.Additionally, the present inventors confirmed the secondary structure and thermodynamic stability of other aptamers including the common sequence of the N1 aptamer and the N1 2174 aptamer.
하기 표는 본 발명 N1, N1 2174 앱타머와 비교예로 사용된 앱타머들의 서열을 나타낸 것이다.The table below shows the sequences of the N1 and N1 2174 aptamers of the present invention and aptamers used as comparative examples.
AptamerAptamer 서열번호sequence number SequenceSequence
N1 2174N1 2174 1One GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCGGCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG
N1N1 22 GGGAGAGGAUACUACACGUGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUUGCAUGUAGCAGAAGCUUCCG GGGAGAGGAUACUACACGUG AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU UGCAUGUAGCAGAAGCUUCCG
N1 74N1 74 88 GGGAGAGGAUACUACACGUGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG GGGAGAGGAUACUACACGUG AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUCCCAGCCGAGGGACCGCAGCG
N1 21N1 21 99 GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAUUGCAUGUAGCAGAAGCUUCCG GCUGCAAAACGUCGGCAGGGAUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU UGCAUGUAGCAGAAGCUUCCG
N1 74 및 N1 21 앱타머의 경우, N1 앱타머 및 N1 2174 앱타머의 공통된 서열(AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU; 서열번호 10)을 포함하나, 그 2차 구조는 전혀 다른 것을 확인할 수 있다(도 5a 내지 도 5d). 즉, N1 2174 앱타머의 서열 중 N1 앱타머와 공통된 서열뿐만 아니라 그 외의 서열도 특유의 2차 구조 형성에 필수적이기 때문에, 서열번호 10의 서열을 포함하는 앱타머라고 하더라도 Ni2+, Co2+에 대한 결합력이 존재하지 않을 수도 있음을 시사한다.In the case of the N1 74 and N1 21 aptamers, the N1 aptamer and the N1 2174 aptamer have a common sequence (AUAGUCAGGGAACAUGACAAACACAGGGACUUGCGAAAAUCAGUGUUUUGCCAU; SEQ ID NO: 10), but their secondary structures are completely different (FIGS. 5A to 5D). . That is, since not only the sequence common to the N1 aptamer but also other sequences among the sequences of the N1 2174 aptamer are essential for the formation of a unique secondary structure, even the aptamer comprising the sequence of SEQ ID NO: 10 Ni 2+ , Co 2+ suggests that there may be no bonding force for .

Claims (8)

  1. 서열번호 1로 표시되는 염기 서열로 이루어진 니켈 이온 및 코발트 이온 중 적어도 하나에 특이적으로 결합하는 앱타머.An aptamer that specifically binds to at least one of a nickel ion and a cobalt ion consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  2. 청구항 1에 있어서, 상기 앱타머는 니켈 이온 및 코발트 이온에 특이적으로 결합하는 앱타머.The aptamer of claim 1, wherein the aptamer specifically binds to nickel ions and cobalt ions.
  3. 청구항 1 및 2 중 어느 한 항의 앱타머를 포함하는 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 조성물.A composition for separating or detecting at least one of nickel ions and cobalt ions, comprising the aptamer of any one of claims 1 and 2.
  4. 청구항 1 및 2 중 어느 한 항의 앱타머가 고정화된 기판을 포함하는 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 마이크로어레이.A microarray for separating or detecting at least one of nickel ions and cobalt ions, comprising a substrate on which the aptamer of any one of claims 1 and 2 is immobilized.
  5. 청구항 4에 있어서, 상기 기판은 비드(bead), 막(membrane), 마이크로 타이터 플레이트(microtiter plate) 및 칩(chip)으로 이루어진 군에서 선택된 하나인 마이크로어레이.The microarray of claim 4, wherein the substrate is one selected from the group consisting of a bead, a membrane, a microtiter plate, and a chip.
  6. 청구항 1 및 2 중 어느 한 항의 앱타머가 충진된 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출용 컬럼.A column for separating or detecting at least one of nickel ions and cobalt ions filled with the aptamer of any one of claims 1 and 2.
  7. 청구항 1 및 2 중 어느 한 항의 앱타머를 시료와 접촉시키는 단계를 포함하는 니켈 이온 및 코발트 이온 중 적어도 하나의 분리 또는 검출 방법.A method for separating or detecting at least one of nickel ions and cobalt ions, comprising the step of contacting the aptamer of any one of claims 1 and 2 with a sample.
  8. 청구항 7에 있어서, 상기 시료는 물, 토양 및 폐기물 중 어느 하나 이상에서 채취된 시료인 방법.The method according to claim 7, wherein the sample is a sample collected from any one or more of water, soil, and waste.
PCT/KR2021/017354 2021-06-24 2021-11-24 Aptamer specifically binding to at least one among nickel ions and cobalt ions WO2022270695A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210082301A KR102328488B1 (en) 2021-06-24 2021-06-24 Aptamer specifically binding to at least one of a nickel ion and a cobalt ion
KR10-2021-0082301 2021-06-24

Publications (1)

Publication Number Publication Date
WO2022270695A1 true WO2022270695A1 (en) 2022-12-29

Family

ID=78702671

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/017354 WO2022270695A1 (en) 2021-06-24 2021-11-24 Aptamer specifically binding to at least one among nickel ions and cobalt ions

Country Status (2)

Country Link
KR (1) KR102328488B1 (en)
WO (1) WO2022270695A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102328488B1 (en) * 2021-06-24 2021-11-17 세종대학교산학협력단 Aptamer specifically binding to at least one of a nickel ion and a cobalt ion

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080042872A (en) * 2005-08-11 2008-05-15 더 보드 오브 트러스티즈 오브 더 유니버시티 오브 일리노이 Aptamer-based colorimetric sensor systems
KR20100009031A (en) * 2008-07-17 2010-01-27 김양훈 Dna aptamer specifically binding to arsenic and uses thereof
US20140335630A1 (en) * 2012-01-31 2014-11-13 The University Of Toledo Methods and Devices for Detection and Measurement of Analytes
CN105548109A (en) * 2015-12-22 2016-05-04 北京农业质量标准与检测技术研究中心 A fluorescence detecting system for heavy metal cadmium and a fluorescence detecting method
KR102328488B1 (en) * 2021-06-24 2021-11-17 세종대학교산학협력단 Aptamer specifically binding to at least one of a nickel ion and a cobalt ion

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101238297B1 (en) 2011-02-08 2013-03-04 경희대학교 산학협력단 DNA aptamer specific for uranyl ion

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080042872A (en) * 2005-08-11 2008-05-15 더 보드 오브 트러스티즈 오브 더 유니버시티 오브 일리노이 Aptamer-based colorimetric sensor systems
KR20100009031A (en) * 2008-07-17 2010-01-27 김양훈 Dna aptamer specifically binding to arsenic and uses thereof
US20140335630A1 (en) * 2012-01-31 2014-11-13 The University Of Toledo Methods and Devices for Detection and Measurement of Analytes
CN105548109A (en) * 2015-12-22 2016-05-04 北京农业质量标准与检测技术研究中心 A fluorescence detecting system for heavy metal cadmium and a fluorescence detecting method
KR102328488B1 (en) * 2021-06-24 2021-11-17 세종대학교산학협력단 Aptamer specifically binding to at least one of a nickel ion and a cobalt ion

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HOFMANN H P, LIMMER S, HORNUNG V, SPRINZL M: "Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair", RNA, vol. 3, 1 January 1997 (1997-01-01), pages 1289 - 1300, XP093016184 *

Also Published As

Publication number Publication date
KR102328488B1 (en) 2021-11-17

Similar Documents

Publication Publication Date Title
US5932413A (en) DNA probe assay using neutrally charged probe strands
EP0506830B1 (en) Uncharged morpholino-based polymers having phosphorous-containing chiral intersubunit linkages
JP2862547B2 (en) Polycationic support for nucleic acid purification, separation and hybridization
EP0411186B1 (en) DNA probe assay using neutrally charged probe strands
EP0159719B1 (en) Hybridization method for the detection of genetic materials
JP2742905B2 (en) Method for detecting nucleic acid sequence
WO2022270695A1 (en) Aptamer specifically binding to at least one among nickel ions and cobalt ions
EP2616555B1 (en) Capture probes immobilizable via l-nucleotide tail
CA2652052A1 (en) Nucleic acid separation and purification method based on reversible charge interactions
EP0192197A2 (en) Fast and specific immobilization of nucleic acids to solid supports
WO2020130624A1 (en) Dna aptamer binding specifically to chikungunya virus e2 and use thereof
CN102066942A (en) Method for a highly sensitive detection and quantification of biomolecules using secondary ion mass spectrometry (SIMS) and related technologies
WO2020130627A1 (en) Dna aptamer specifically binding to yellow fever virus ediii, and use thereof
JPS61502889A (en) Chemically labeled cholic acid, its usage and kit for its implementation
Bartlett et al. Sample preparation for LC‐MS bioanalysis of oligonucleotides
US8314209B2 (en) Lipid-assisted synthesis of polymer compounds and methods for their use
JPH0568594A (en) Nucleic acid probe for detecting giradia lamblia
US20210247387A1 (en) Improved proteomic multiplex assays
JPH01317400A (en) Nucleic acid probe containing terminal nucleotide chemically modified at 5'(oh) positon for purpose of non-radioactive labelling
CN105821044A (en) Aptamer of L-serine and application of aptamer
WO2012108675A2 (en) Pna aptamer able to isolate a metal
CN114540961B (en) DNA coding compound library and compound screening method
WO2012137804A1 (en) Method for determining oligonucleotide sequence
KR101227962B1 (en) Efficient method for the isolation of genomic DNA of hepatitis B virus
Szostak Specific Binding of a Synthetic Oligonucleotide to the Yeast Iso-1 Cytochrome C Messenger-RNA and Gene.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21947282

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21947282

Country of ref document: EP

Kind code of ref document: A1