WO2022265130A1 - Nouveau promoteur et son utilisation - Google Patents

Nouveau promoteur et son utilisation Download PDF

Info

Publication number
WO2022265130A1
WO2022265130A1 PCT/KR2021/007511 KR2021007511W WO2022265130A1 WO 2022265130 A1 WO2022265130 A1 WO 2022265130A1 KR 2021007511 W KR2021007511 W KR 2021007511W WO 2022265130 A1 WO2022265130 A1 WO 2022265130A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
seq
present application
nucleotide
promoter
Prior art date
Application number
PCT/KR2021/007511
Other languages
English (en)
Korean (ko)
Inventor
권나라
이한형
김혜미
박소정
김병수
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to PCT/KR2021/007511 priority Critical patent/WO2022265130A1/fr
Publication of WO2022265130A1 publication Critical patent/WO2022265130A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine

Definitions

  • the present application relates to a novel promoter and a method for producing a target substance using the same, and more particularly, to a novel polynucleotide having promoter activity, a gene expression cassette and host cell containing the same, and a method for producing a target substance using the microorganism It is about.
  • L-amino acid is a basic structural unit of protein and is used as an important raw material for pharmaceutical raw materials, food additives, animal feeds, nutrients, insecticides, and bactericides.
  • L-lysine is an essential amino acid that is not biosynthesized at all in vivo, and is known to be necessary for growth promotion, calcium metabolism, gastric juice secretion promotion, and increased resistance to disease.
  • the L-lysine is used in various ways such as feed, medicine, food, etc.
  • L-tryptophan is also one of the essential amino acids, and is used as a feed additive, infusion solution, pharmaceutical raw material, and health food material.
  • Common methods for producing the amino acid include Brevibacterium or Corynebacterium ( Corynebacterium; Amino Acid Fermentation, Gakkai Shuppan Center: 195-215, 1986), other Escherichia coli , Bacillus subtilis ( Bacillus ), actinomyces ( Streptomyces ), Penicillium ( Penicillum ), Klebsiella ( Klebsiella ), Erwinia ( Erwinia ), Pantoea ( Pantoea )
  • There is a fermentation method using microorganisms such as 3,220,929, 6,682,912), and also industrially produced through synthetic methods such as monochloroacetic acid method and Strecker method.
  • the present inventors have developed a polynucleotide having a novel promoter activity capable of producing a target substance with high productivity in a microorganism of the genus Corynebacterium, and introducing it into a microorganism can increase the productivity of the target substance.
  • This application was completed by confirming that it exists.
  • the present inventors completed the present application by developing a polynucleotide having a novel promoter activity, a host cell containing the polynucleotide, and a method for producing a target substance using the host cell.
  • One object of the present application is to provide a host cell comprising one or more polynucleotides of the present application.
  • Another object of the present application is to provide a host cell comprising one or more gene expression cassettes of the present application.
  • Another object of the present application is to provide a method for producing a target substance, including culturing the host cells in a medium and recovering the target substance from the medium.
  • Another object of the present application is to provide use as a promoter of one or more polynucleotides of the present application.
  • novel promoter of the present application can be introduced into a microorganism that produces amino acids to increase the amount of amino acids produced by the microorganism.
  • L-lysine which has been previously produced synthetically, can be produced by fermentation, so it can be usefully used for amino acid production.
  • a host cell comprising at least one polynucleotide selected from the group consisting of (a) and (b) below is provided.
  • One or more in the present application may be one or more or two or more, but is not limited thereto.
  • the host cell of the present application may contain one or more polynucleotides selected from the group consisting of (a) and (b), but is not limited thereto.
  • the host cell of the present application includes (a) a polynucleotide having promoter activity; and (b) a host cell containing a polynucleotide having promoter activity, but is not limited thereto.
  • nucleotide sequence represented by SEQ ID NO: 1 may mean a part of the promoter sequence of the NCgl0859 gene.
  • NCgl0859 gene refers to a gene inherently present in microorganisms of the genus Corynebacterium, or a gene encoding a hypothetical protein whose function is unknown.
  • nucleotide sequence represented by SEQ ID NO: 3 may mean a part of the promoter sequence of the NCgl1416 gene.
  • NCgl1416 gene refers to a gene inherently present in a microorganism of the genus Corynebacterium, or a gene encoding a hypothetical protein whose function is unknown.
  • sequence corresponding to SEQ ID NO: 1 or SEQ ID NO: 3 may be derived from Corynebacterium sp., specifically, may be a sequence from Corynebacterium glutamicum , but the polynucleotide Sequences having activity equal to or higher than may be included without limitation in the promoter of the present application.
  • polynucleotide is a DNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds.
  • promoter refers to a non-translated nucleotide sequence upstream of a coding region that includes a binding site for polymerase and has an activity to initiate transcription of a promoter target gene into mRNA, that is, a polymerase A region of DNA that binds and initiates transcription of a gene.
  • the promoter may be located at the 5' site of the mRNA transcription initiation site.
  • polynucleotide having promoter activity refers to a gene operably linked thereto, that is, near a transcription site of a target gene including a site to which RNA polymerase or an enhancer binds for the expression of the target gene. refers to a region of DNA that is present.
  • the polynucleotide can be used as a universal promoter, and the polynucleotide can be compared with an existing promoter or a cell endogenous promoter in a cell, expression of a target gene operably linked thereto,
  • the production and/or activity of a protein encoded by a gene may be regulated (eg, increased or decreased), and the target product involved in the production of the protein (as a biologically active substance, for example, amino acids, nucleic acids, vitamins, It may be to regulate (eg, increase or decrease) production and/or activity of at least one selected from the group consisting of protein, fatty acid, and organic acid, but is not limited thereto.
  • polynucleotide of the present application may be included without limitation as long as it is a polynucleotide sequence having promoter activity.
  • the polynucleotide having promoter activity of the present application may include a polynucleotide having promoter activity in which one or more nucleotides of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3 are substituted with other nucleotides.
  • it may be composed of a polynucleotide having promoter activity in which one or more nucleotides of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3 are substituted with other nucleotides.
  • the polynucleotide having the promoter activity may be used interchangeably with "mutant promoter" herein, and all of the above-described terms may be used herein.
  • the polynucleotide having promoter activity may have promoter activity weakened or enhanced by substituting a nucleotide at a specific position in an existing polynucleotide sequence having promoter activity.
  • the mutant promoter may be one in which the 178th nucleotide of the nucleotide sequence represented by SEQ ID NO: 1 is replaced with another nucleotide or the 268th nucleotide of the nucleotide sequence represented by SEQ ID NO: 3 is replaced with another nucleotide. there is.
  • the "other nucleotide” is not limited as long as it is different from the nucleotide before substitution.
  • the nucleotide at position 178 in SEQ ID NO: 1 is substituted with another nucleotide
  • nucleotide 268 in SEQ ID NO: 3 it means that thymine (T), cytosine (C), and guanine (G) are substituted except for adenine (A) do.
  • a nucleotide is described as "substituted” in this application, it means that it is substituted with a nucleotide different from the nucleotide before substitution.
  • nucleotide at the position corresponding to nucleotide 178 of SEQ ID NO: 1 or nucleotide 268 of SEQ ID NO: 3 of the present application in any polynucleotide sequence through sequence alignment known in the art Even if it is not separately described in the present application, if "a nucleotide at a specific position in a specific sequence number" is described, it is clear that it means including "a nucleotide at a corresponding position" in any polynucleotide sequence.
  • any polynucleotide sequence having promoter activity selected from the group consisting of the nucleotide at position corresponding to position 178 of the polynucleotide sequence of SEQ ID NO: 1 and the nucleotide at position corresponding to position 268 of the polynucleotide sequence of SEQ ID NO: 3
  • Polynucleotide sequences in which any one or more nucleotides are substituted with other nucleotides are also included in the scope of the present application.
  • the polynucleotide is a mutation in the nucleotide sequence represented by SEQ ID NO: 1, that is, the promoter sequence of the NCgl0859 gene, specifically, the mutation is a polynucleotide in which the 178th nucleotide of the sequence is substituted with another nucleotide, More specifically, a polynucleotide in which the 178th nucleotide of the nucleotide sequence represented by SEQ ID NO: 1 is substituted with C; And the nucleotide sequence represented by SEQ ID NO: 3, that is, the promoter sequence of the NCgl1416 gene is mutated, specifically, the mutation is a polynucleotide in which the 268th nucleotide of the sequence is substituted with another nucleotide, more specifically, SEQ ID NO: 3 It may be any one or more selected from the group consisting of polynucleotides in which the 268th nucleotide of the displayed
  • the polynucleotide may have a promoter activity that is mutated (increased or decreased) compared to a polynucleotide that does not contain the mutation. Accordingly, the expression of a target gene operably linked to the polynucleotide and the activity of a protein encoded by the target gene may be regulated (increased or decreased), and furthermore, the expression of other genes other than the target gene may be regulated.
  • a promoter having a weakened or enhanced activity than that of the unsubstituted (unmodified) promoter sequence can be provided.
  • a promoter having a weakened or enhanced activity than the unsubstituted (unmodified) promoter sequence can be provided.
  • polynucleotide may be a polynucleotide involved in increasing the production or production of a target substance, specifically, L-amino acid, more specifically, L-lysine.
  • the present inventors first identified the effect of increasing the amount of L-amino acid, more specifically, L-lysine, by the promoter mutation of the NCgl0859 gene or the NCgl1416 gene as described above.
  • L-lysine is one of the basic ⁇ -amino acids and is an essential amino acid that is not synthesized in the body.
  • the L- lysine is not limited thereto, but may be applied to various products such as feed or feed additives, or foods, food additives, and pharmaceuticals.
  • the polynucleotide having promoter activity in the present application may include at least one or at least two of the polynucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 4.
  • the polynucleotide may consist essentially of, or consist of, one or more of the polynucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 4, but is not limited thereto.
  • nucleotide sequence of the present application may be modified by conventionally known mutagenesis methods, such as directed evolution and site-directed mutagenesis.
  • mutation means a genetic or non-genetically stable phenotypic change, and may be named interchangeably with “variation” or “mutation” in the present specification.
  • a polynucleotide having promoter activity is SEQ ID NO: 1, to SEQ ID NO: 4, or at least 70%, 80%, 85%, 90%, 95%, 96% of SEQ ID NO: 1 to SEQ ID NO: 4 , polynucleotide sequences having 97%, 98%, or 99% or more homology or identity.
  • a nucleotide sequence having homology or identity may be a sequence having less than 100% identity or excluding sequences having 100% identity among the above categories.
  • a meaningless sequence is added to the inside or end of the nucleotide sequence of the corresponding sequence number, or a polynucleotide in which some sequence inside or at the end of the nucleotide sequence of the corresponding sequence number is deleted It is obvious that also falls within the scope of the present application.
  • Homology and identity mean the extent to which two given base sequences are related and can be expressed as a percentage.
  • Sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Hybridization is also contemplated for polynucleotides that contain degenerate codons in lieu of codons in the polynucleotide.
  • Whether any two polynucleotide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the “FASTA” program using default parameters as in 2444. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol.
  • GAP program defines the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp.
  • a probe that can be prepared from a known gene sequence for example, a polynucleotide sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the above-described polynucleotide sequence and has the same activity, may be included without limitation.
  • the "stringent condition” means a condition that allows specific hybridization between polynucleotides. These conditions are described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York).
  • genes with high homology or identity 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, More specifically, genes having homology or identity of 97% or more, particularly specifically, 99% or more hybridize, and genes having lower homology or identity than that do not hybridize, or normal Southern hybridization (southern hybridization) hybridization) washing conditions of 60 ° C, 1XSSC, 0.1% SDS, specifically 60 ° C, 0.1XSSC, 0.1% SDS, more specifically 68 ° C, 0.1XSSC, 0.1% SDS At a salt concentration and temperature corresponding to, Conditions for washing once, specifically two to three times, can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated nucleic acid fragments complementary to substantially similar nucleic acid sequences as well as the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotide and the degree of complementarity, parameters well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • Polynucleotides having promoter activity of the present application can be isolated or prepared using standard molecular biology techniques. For example, it may be prepared using standard synthesis techniques using an automated DNA synthesizer, but is not limited thereto.
  • a polynucleotide having promoter activity of the present application can be used as a promoter.
  • the promoter may be located at the 5' site of the initiation site of transcription into mRNA.
  • the promoter may have increased or decreased promoter activity compared to conventional promoters. That is, it is possible to increase or decrease the expression and/or activity of a protein encoded by the gene of interest as well as the expression of the gene of interest in the host cell.
  • the gene of interest for enhancing or attenuating expression may be changed depending on the product to be produced, and the promoter may be used as a universal promoter for enhancing or attenuating the gene of interest.
  • Another aspect of the present application provides a host cell comprising one or more gene expression cassettes selected from the group consisting of the following (a') and (b').
  • a gene expression cassette comprising a polynucleotide having promoter activity in which the 178th nucleotide of the nucleotide sequence represented by SEQ ID NO: 1 is substituted with C and a first target gene;
  • a gene expression cassette comprising a polynucleotide having promoter activity in which the 268th nucleotide of the nucleotide sequence represented by SEQ ID NO: 3 is substituted with G, and a second target gene.
  • the polynucleotide and the like are as described above.
  • One or more in the present application may be one or more or two or more, but is not limited thereto.
  • the host cell of the present application may include one or more gene expression cassettes selected from the group consisting of (a') and (b'), but is not limited thereto.
  • the host cells of the present application may also include host cells containing the gene expression cassettes of (a') and (b'), but are not limited thereto.
  • the term "gene expression cassette” means a unit cassette capable of expressing a target gene operably linked to a downstream side of a promoter, including a promoter and a target gene. Various factors that can help the efficient expression of the target gene may be included inside or outside such a gene expression cassette.
  • the gene expression cassette may include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the gene of interest.
  • target gene for the purpose of the present application, means a gene whose expression is to be controlled by the promoter sequence of the present application.
  • a protein encoded by the target gene may be referred to as “target protein”, and a gene encoding the "target protein” may be referred to as “target gene”.
  • a polynucleotide encoding a protein of interest can be varied in the coding region within a range that does not change the polypeptide sequence due to codon degeneracy or in consideration of codons preferred in organisms in which the polynucleotide is to be expressed. Transformations can be made. Description of the polynucleotide sequence is as described above.
  • the expression consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 above refers to the number of nucleotides that may occur during the process of linking to the target gene, such as using a restriction enzyme, when using the polynucleotide linked to the target gene as a promoter. Additions, and/or deletions, and/or mutations are not excluded.
  • a polynucleotide having promoter activity consisting of the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 is hybridized with a complementary sequence to all or part of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 under stringent conditions, Any nucleotide sequence having promoter activity of the present application may be included without limitation.
  • vector is an artificial DNA molecule having genetic material so as to express a target gene in a suitable host, specifically, a DNA comprising a nucleotide sequence of a gene encoding a target protein operably linked thereto. means product.
  • operably linked means that a polynucleotide having promoter activity of the present application is functionally linked to the gene sequence to initiate and mediate transcription of a target gene.
  • Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cleavage and linkage can be prepared using cutting and linking enzymes in the art, but are not limited thereto.
  • Vectors used in the present application are not particularly limited as long as they can be expressed in host cells, and host cells can be transformed using any vector known in the art. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors , pBluescriptII-based, pGEM-based, pTZ-based, pCL-based and pET-based, etc. may be used, but is not limited thereto.
  • pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. may be used, but are not limited thereto.
  • insertion of the polynucleotide into a chromosome is not known in the art. This can be done by any known method, for example homologous recombination.
  • a selection marker may be additionally included to determine whether the vector is inserted into the chromosome.
  • Selectable markers are used to select cells transformed with a vector, that is, to determine whether a polynucleotide is inserted, and to impart selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins. Markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, so transformed cells can be selected.
  • the term "transformation” means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide can be expressed in the host cell, it may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and RNA encoding a target protein, and may be introduced in any form as long as it can be introduced into a host cell and expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression, or a vector containing the polynucleotide.
  • the transformation method includes all methods of introducing a gene encoding the target protein into a cell, and can be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method, etc., but is not limited thereto.
  • the host cell of the present application may include one or more polynucleotides of the present application, one or more gene expression cassettes including the polynucleotide and the target gene, or a combination thereof.
  • the host cell may be a microorganism of the genus Corynebacterium, but is not limited thereto.
  • microorganism includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and specific mechanisms are weakened due to causes such as insertion of external genes or enhancement or weakening of the activity of endogenous genes. It is a concept that includes all microorganisms that have been enhanced or enhanced.
  • the microorganism may be included without limitation as long as it is a microorganism into which the polynucleotide of the present application is introduced or included.
  • the microorganism may include the polynucleotide, may specifically include the polynucleotide and/or a vector containing the polynucleotide, and more specifically, a vector containing a gene encoding a target protein. It may include, but is not limited thereto.
  • the polynucleotide and vector may be introduced into the microorganism by transformation, but is not limited thereto.
  • the microorganism is, for example, a cell or microorganism that is transformed with a vector containing the polynucleotide of the present application and a gene encoding a target protein, and expresses the target protein, and for the purpose of the present application, the host cell or microorganism is the above Any microorganism capable of producing a target product including a target protein is possible.
  • microorganism producing a target protein or target product includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and in which foreign genes are inserted or the activity of endogenous genes is enhanced or inactivated. It may be a microorganism whose specific mechanism is weakened or enhanced due to causes such as, etc., and which includes genetic modification (modification) for the production of a desired protein or product.
  • the microorganism producing the target protein or the target product may be a microorganism characterized by an increased ability to produce the target protein or the target product, including the polynucleotide of the present application.
  • a microorganism producing a target protein or a target product, or a microorganism capable of producing a target protein or a target product has a part of a gene in the target protein or target product biosynthesis pathway that is enhanced or weakened, or a target protein or target product. It may be a microorganism in which some of the genes in the degradation pathway are enhanced or weakened.
  • the microorganism containing the polynucleotide may be one with increased production of L-amino acids, specifically, L-lysine.
  • the microorganism may be included without limitation as long as it is a microorganism capable of operating as a promoter by introducing a polynucleotide having a promoter activity of the present application.
  • the microorganism may be a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum ) or Corynebacterium flavum ( Corynebacterium flavum ) It may be, most specifically Corynebacterium It may be Nebacterium glutamicum, but is not limited thereto.
  • Another aspect of the present application provides a method for producing a target substance, including culturing the host cells in a medium and recovering the target substance from the medium.
  • the polynucleotide, gene expression cassette, host cell, target substance, etc. are as described above.
  • the target substance may be an amino acid.
  • the amino acids may be L-type amino acids, unless otherwise specified, and include glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, and lysine.
  • arginine, histidine, phenylalanine, tyrosine, tryptophan, proline and may be selected from the group consisting of combinations thereof, but is not limited thereto.
  • amino acid may be L-lysine, but is not limited thereto.
  • the term "cultivation” means to grow microorganisms under appropriately artificially controlled environmental conditions.
  • the method for producing a target substance using a microorganism containing the polynucleotide may be performed using a method widely known in the art. Specifically, the culture may be cultured continuously in a batch process, injection batch or repeated injection batch process (fed batch or repeated fed batch process), but is not limited thereto. The medium used for culture must meet the requirements of the particular strain in an appropriate manner. Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
  • Sugar sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, and stearic acid. , fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
  • Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto.
  • Persons that may be used may include salts containing potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium.
  • the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth.
  • essential growth substances such as amino acids and vitamins may be used in addition to the above substances.
  • precursors suitable for the culture medium may be used. The above raw materials may be added in a batchwise or continuous manner by a method suitable for the culture during the cultivation process.
  • the pH of the culture may be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide, or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner.
  • a basic compound such as sodium hydroxide, potassium hydroxide, or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner.
  • antifoaming agents such as fatty acid polyglycol esters may be used to suppress foam formation.
  • Oxygen or an oxygen-containing gas eg, air
  • air oxygen-containing gas
  • the temperature of the culture may be usually 20 ° C to 45 ° C, specifically 25 ° C to 40 ° C.
  • the culturing time may be continued until a desired production amount of the target substance is obtained, but may be specifically 10 to 160 hours.
  • Recovery of the target substance from the culture (medium) can be separated and recovered by a conventional method known in the art. Methods such as centrifugation, filtration, chromatography and crystallization may be used for such a separation method.
  • the culture may be centrifuged at low speed to remove biomass, and the obtained supernatant may be separated through ion exchange chromatography, but is not limited thereto.
  • the recovery step may further include a purification process.
  • Another aspect of the present application provides the use of one or more polynucleotides of the present application as promoters.
  • the polynucleotide is as described above.
  • Example 1 Evaluation of L-lysine production ability of microorganisms containing novel promoter sequences
  • Example 1-1 Construction of a recombinant vector containing a novel promoter sequence
  • a base sequence (SEQ ID NO: 1) including the promoter region of NCgl0859 of wild type Corynebacterium glutamicum ATCC13032 was obtained based on the NIH GenBank of the US National Institutes of Health.
  • Vector for constructing an expression strain to confirm the effect of a promoter variant (PNCgl0859 (t178c); SEQ ID NO: 2) in which the nucleotide corresponding to position 178 of the polynucleotide of SEQ ID NO: 1 is substituted from T to C on L-lysine production was constructed using plasmid pDCM2 (Korean Publication No. 10-2020-0136813) for insertion and replacement of genes in the Corynebacterium chromosome.
  • PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template and the primer pairs of SEQ ID NOs: 5 and 6 and the primer pairs of SEQ ID NOs: 7 and 8, respectively. .
  • gDNA genomic DNA
  • overlapping PCR was performed again to obtain fragments.
  • PCR was denatured at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute 30 seconds, followed by 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with SmaI, and the PCR product obtained above was subjected to fusion cloning.
  • In-Fusion® HD cloning kit (Clontech) was used.
  • the resulting vector was named pDCM2-PNCgl0859 (t178c). Primer sequence information used for constructing the vector is shown in Table 1 below.
  • sequence number primer name 5' sequence 3' 5 PNCgl0859_1F TGAATTCGAGCTCGGTACCCCCACCGCCTTCACACCG 6 PNCgl0859_2R GATCGAAAAGAATCAGgGCTTGTGACGATTATC 7 PNCgl0859_3F GATAATCGTCACAAGCcCTGATTCTTTTCGATC 8 PNCgl0859_4R GTCGACTCTAGAGGATCCCCCGCAGTACATAGATCGGGG
  • Example 1-2 Evaluation of L-lysine production ability of microorganisms containing novel promoter sequences
  • Example 1-1 The gene replacement vector prepared in Example 1-1 was introduced into the Corynebacterium glutamicum CJ3P (US 9556463 B2) strain to produce L-lysine producing strain "CJ3P_PNCgl0859 (t178c)" into which the mutation was introduced. .
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of the strain prepared in Example 1-2-1 and the parent strain of the control group.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured at 30° C. for 20 hours with shaking at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and incubated at 30° C. for 72 hours with shaking at 200 rpm.
  • the composition of the seed medium and production medium is as follows.
  • the concentration of L-lysine produced by the mutant-introduced Corynebacterium glutamicum CJ3P_PNCgl0859 (t178c) strain was higher than that produced by the non-mutated Corynebacterium glutamicum CJ3P strain. It was confirmed that the L- lysine concentration increased by 22.5%.
  • Example 2 Evaluation of L-lysine production ability of microorganisms containing novel promoter sequences
  • Example 2-1 Construction of a recombinant vector containing a novel promoter sequence
  • a base sequence (SEQ ID NO: 3) including the promoter region of NCgl1416 of wild type Corynebacterium glutamicum ATCC13032 was obtained based on the NIH GenBank of the US National Institutes of Health.
  • SEQ ID NO: 4 the promoter variant in which the nucleotide corresponding to position 268 of the polynucleotide of SEQ ID NO: 3 is substituted from A to G (PNCgl1416 (a268g); SEQ ID NO: 4) on L-lysine production, for the construction of an expression strain
  • the vector was constructed using the plasmid pDCM2 (Korean Publication No. 10-2020-0136813) for insertion and replacement of genes in the Corynebacterium chromosome.
  • PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template and the primer pairs of SEQ ID NOs: 11 and 12 and the primer pairs of SEQ ID NOs: 13 and 14, respectively. .
  • gDNA genomic DNA
  • overlapping PCR was performed again to obtain fragments.
  • PCR was denatured at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute 30 seconds, followed by 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with SmaI, and the PCR product obtained above was subjected to fusion cloning.
  • In-Fusion® HD cloning kit (Clontech) was used.
  • the resulting vector was named pDCM2-PNCgl1416(a268g). Primer sequence information used for constructing the vector is shown in Table 4 below.
  • Example 2-2 Evaluation of L-lysine production ability of microorganisms containing novel promoter sequences
  • Example 2-1 The gene replacement vector prepared in Example 2-1 was introduced into the Corynebacterium glutamicum CJ3P (US 9556463 B2) strain to produce L-lysine producing strain "CJ3P_PNCgl1416 (a268g)" into which the mutation was introduced. .
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of the strain prepared in Example 2-2-1 and the parent strain of the control group.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured at 30° C. for 20 hours with shaking at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and incubated at 30° C. for 72 hours with shaking at 200 rpm.
  • the composition of the seed medium and production medium is as follows.
  • the concentration of L-lysine produced by the mutated Corynebacterium glutamicum CJ3P_PNCgl1416 (a268g) strain was higher than that produced by the non-mutated Corynebacterium glutamicum CJ3P strain. It was confirmed that the L- lysine concentration increased by 19.8%. That is, it was confirmed that the mutation remarkably increases the ability of the microorganism to produce L-lysine.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

La présente invention concerne un nouveau promoteur et un procédé de production de substance cible l'utilisant et, plus particulièrement, un nouveau polynucléotide ayant une activité promotrice ; une cassette d'expression génique et une cellule hôte qui les comprennent ; et un procédé de production de substance cible utilisant le micro-organisme.
PCT/KR2021/007511 2021-06-15 2021-06-15 Nouveau promoteur et son utilisation WO2022265130A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/007511 WO2022265130A1 (fr) 2021-06-15 2021-06-15 Nouveau promoteur et son utilisation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/007511 WO2022265130A1 (fr) 2021-06-15 2021-06-15 Nouveau promoteur et son utilisation

Publications (1)

Publication Number Publication Date
WO2022265130A1 true WO2022265130A1 (fr) 2022-12-22

Family

ID=84526578

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007511 WO2022265130A1 (fr) 2021-06-15 2021-06-15 Nouveau promoteur et son utilisation

Country Status (1)

Country Link
WO (1) WO2022265130A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7332310B2 (en) * 1999-12-16 2008-02-19 Kyowa Hakko Kogyo Co., Ltd. Mutant of homoserine dehydrogenase from Corynebacterium and DNA encoding thereof
KR100987281B1 (ko) * 2008-01-31 2010-10-12 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
KR20150001341A (ko) * 2013-06-27 2015-01-06 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
US20180362991A1 (en) * 2015-12-07 2018-12-20 Zymergen Inc. Promoters from corynebacterium glutamicum
KR20190106815A (ko) * 2018-03-09 2019-09-18 씨제이제일제당 (주) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7332310B2 (en) * 1999-12-16 2008-02-19 Kyowa Hakko Kogyo Co., Ltd. Mutant of homoserine dehydrogenase from Corynebacterium and DNA encoding thereof
KR100987281B1 (ko) * 2008-01-31 2010-10-12 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
KR20150001341A (ko) * 2013-06-27 2015-01-06 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
US20180362991A1 (en) * 2015-12-07 2018-12-20 Zymergen Inc. Promoters from corynebacterium glutamicum
KR20190106815A (ko) * 2018-03-09 2019-09-18 씨제이제일제당 (주) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법

Similar Documents

Publication Publication Date Title
WO2019160301A1 (fr) Polypeptide modifié à activité citrate synthase atténuée et méthode de production d'acides l-aminés l'utilisant
WO2019147078A1 (fr) Microorganisme de corynebacterium sp produisant un nucléotide de purine et procédé de production de nucléotide de purine à l'aide de celui-ci
WO2019117671A1 (fr) Micro-organisme producteur de 5'-inosine monophosphate et procédé de production de 5'-inosine monophosphate l'utilisant
WO2019004778A2 (fr) Nouveau mutant d'aspartokinase et procédé de production d'acide l-aminé l'utilisant
WO2019164346A1 (fr) Micro-organisme corynéforme recombinant pour production de l-tryptophane et méthode de production de l-tryptophane l'utilisant
WO2022163933A1 (fr) Nouveau variant de protéine de transport abc liant l'atp, et procédé de production d'acide l-glutamique faisant appel à celui-ci
WO2022163934A1 (fr) Nouveau variant de la d-alanine—d-alanine ligase, et procédé de production d'acide l-glutamique faisant appel à celui-ci
WO2022055094A1 (fr) Micro-organisme recombinant pour la production d'acide l-glutamique et procédé de production d'acide l-glutamique l'utilisant
WO2022163917A1 (fr) Nouveau variant de protéine et procédé de production de l-valine l'utilisant
WO2019004779A2 (fr) Nouveau mutant transférase o-succinylhomosérine et procédé de production d'o-succinylhomosérine utilisant ce dernier
WO2022163920A1 (fr) Nouveau variant de cystéine sulfinate désulfinase et procédé de production de l-valine l'utilisant
WO2022163923A1 (fr) Nouveau variant d'atp phosphoribosyltransférase, et procédé de production de l-valine l'utilisant
WO2022163922A1 (fr) Nouveau variant de l'asparagine synthase, et procédé de production de l-valine l'utilisant
WO2022163935A1 (fr) Nouveau variant de glucosamine-6-phosphate désaminase et procédé de production d'acide l-glutamique l'utilisant
WO2022154190A1 (fr) Nouveau variant d'hydrolase de phosphonoacétate et procédé de production de xmp ou de gmp l'utilisant
WO2022245176A1 (fr) Micro-organisme produisant un nucléotide de purine, et procédé de production de nucléotide de purine au moyen de celui-ci
WO2022154191A1 (fr) Nouveau variant de réductase d'acide 2,5-dicéto-d-gluconique et procédé de production de xmp ou gmp l'utilisant
WO2022149865A2 (fr) Variant de protéine glxr ou procédé de production de thréonine l'utilisant
WO2022265130A1 (fr) Nouveau promoteur et son utilisation
WO2022215796A1 (fr) Nouveau variant de régulateur transcriptionnel et procédé de production de l-valine l'utilisant
WO2022234881A1 (fr) Nouveau promoteur et son utilisation
WO2022234880A1 (fr) Nouveau promoteur et son utilisation
WO2022163919A1 (fr) Nouveau variant de protéine accessoire d'uréase et procédé de production de l-valine l'utilisant
WO2022163925A1 (fr) Nouveau variant de protéine et procédé de production de l-valine l'utilisant
WO2022163918A1 (fr) Nouveau variant de tétrahydrodipicolinate n-succinyltransférase et procédé de production de l-valine l'utilisant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21946141

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21946141

Country of ref document: EP

Kind code of ref document: A1