WO2022256642A2 - Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof - Google Patents
Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof Download PDFInfo
- Publication number
- WO2022256642A2 WO2022256642A2 PCT/US2022/032144 US2022032144W WO2022256642A2 WO 2022256642 A2 WO2022256642 A2 WO 2022256642A2 US 2022032144 W US2022032144 W US 2022032144W WO 2022256642 A2 WO2022256642 A2 WO 2022256642A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleotide
- seq
- sequence
- nos
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/34—Allele or polymorphism specific uses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03015—(S)-2-Hydroxy-acid oxidase (1.1.3.15)
Definitions
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- Cas CRISPR-associated genes
- the present disclosure is based, at least in part, on the development of a system for genetic editing of a hydroxyacid oxidase 1 (HAO1) gene.
- the system involves a Cas12i CRISPR nuclease polypeptide (e.g., a Cas12i2 polypeptide) and an RNA guide mediating cleavage at a genetic site within the HAO1 gene by the CRISPR nuclease polypeptide.
- the gene editing system disclosed herein has achieved successful editing of HAO1 gene with high editing efficiency and accuracy.
- the gene editing system disclosed herein may further exhibit one or more of the following advantageous features.
- Cas12i effectors are smaller (1033 to 1093aa), which, in conjunction with their short mature crRNA (40-43 nt), is preferable in terms of delivery and cost of synthesis.
- Cas12i cleavage results in larger deletions compared to the small deletions and +1 insertions induced by Cas9 cleavage.
- Cas12i PAM sequences also differ from those of Cas9. Therefore, larger and different portions of genetic sites of interest can be disrupted with a Cas12i polypeptide and RNA guide compared to Cas9.
- Cas12i such as Cas12i2 may be more specific than Cas9.
- gene editing systems for editing HAO1 gene for editing HAO1 gene, pharmaceutical compositions or kits comprising such, methods of using the gene editing systems to produce genetically modified cells, and the resultant cells thus produced. Also provided herein are uses of the gene editing systems disclosed herein, the pharmaceutical compositions and kits comprising such, and/or the genetically modified cells thus produced for treating primary hyperoxaluria (PH) in a subject.
- PH primary hyperoxaluria
- the present disclosure features system for genetic editing of a hydroxyacid oxidase 1 (HAO1) gene, comprising (i) a Cas12i polypeptide or a first nucleic acid encoding the Cas12i polypeptide, and (ii) an RNA guide or a second nucleic acid encoding the RNA guide.
- the RNA guide comprises a spacer sequence specific to a target sequence within an HAO1 gene, the target sequence being adjacent to a protospacer adjacent motif (PAM) comprising the motif of 5’-TTN-3', which is located 5’ to the target sequence.
- PAM protospacer adjacent motif
- the Cas12i polypeptide can be a Cas12i2 polypeptide. In other embodiments, the Cas12i polypeptide can be a Cas12i4 polypeptide.
- the Cas12i polypeptide is a Cas12i2 polypeptide, which comprises an amino acid sequence at least 95% identical to SEQ ID NO: 922 and comprises one or more mutations relative to SEQ ID NO: 922.
- the one or more mutations in the Cas12i2 polypeptide are at positions D581, G624, F626, P868, 1926, V1030, E1035, and/or S1046 of SEQ ID NO: 922.
- the one or more mutations are amino acid substitutions, which optionally is D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, S1046G, or a combination thereof.
- the Cas12i2 polypeptide comprises mutations at positions D581, D911, 1926, and V1030 (e.g., amino acid substitutions of D581R, D911R, I926R, and V1030G).
- the Cas12i2 polypeptide comprises mutations at positions D581, 1926, and V1030 (e.g., amino acid substitutions of D581R, I926R, and V1030G).
- the Cas12i2 polypeptide comprises mutations at positions D581, 1926, V1030, and S1046 (e.g., amino acid substitutions of D581R, I926R, V1030G, and S1046G).
- the Cas12i2 polypeptide comprises mutations at positions D581, G624, F626, 1926, V1030, E1035, and S1046 (e.g ., amino acid substitutions of D581R, G624R, F626R, I926R, V1030G, E1035R, and S1046G).
- the Cas12i2 polypeptide comprises mutations at positions D581, G624, F626, P868, 1926, V1030, E1035, and S1046 (e.g., amino acid substitutions of D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G).
- Exemplary Cas12i2 polypeptides for use in any of the gene editing systems disclosed herein may comprise the amino acid sequence of any one of SEQ ID NOs: 923-927.
- the exemplary Cas12i2 polypeptide for use in any of the gene editing systems disclosed herein comprises the amino acid sequence of SEQ ID NO: 924.
- the exemplary Cas12i2 polypeptide for use in any of the gene editing systems disclosed herein comprises the amino acid sequence of SEQ ID NO: 927.
- the gene editing system may comprise the first nucleic acid encoding the Cas12i polypeptide (e.g., the Cas12i2 polypeptide as disclosed herein).
- the first nucleic acid is located in a first vector (e.g., a viral vector such as an adeno- associated viral vector or AAV vector).
- the first nucleic acid is a messenger RNA (mRNA).
- mRNA messenger RNA
- the nucleic acid encoding the Cas12i polypeptide (e.g., the Cas12i2 polypeptide as disclosed herein) is codon-optimized.
- the target sequence may be within exon 1 or exon 2 of the HAO1 gene.
- the target sequence comprises 5’-CAAAGTCTATATATGACTAT-3’ (SEQ ID NO: 1025), 5 ’ - GG A AGT ACT G ATTT AGC ATG- 3 ’ (SEQ ID NO: 1026), 5’- TAGATGGAAGCTGTATCCAA-3’ (SEQ ID NO: 1046), 5’-CGGAGCATCCTTGGATACAG- 3’ (SEQ ID NO: 1047), or 5 ’ -AGGACAGAGGGTCAGC ATGC-3 ’ (SEQ ID NO: 1052).
- the target sequence can be the nucleotide sequence of SEQ ID NO: 1047.
- the spacer sequence may be 20-30-nucleotide in length. In some examples, the spacer sequence is 20-nucleotide in length. In some examples, the spacer sequence comprises 5’-CAAAGUCUAUAUAUGACUAU-3’ (SEQ ID NO: 1093); 5’- GG A AGU ACUG AUUU AGC AU G- 3 ’ (SEQ ID NO: 1094); 5’- UAGAU GGAAGCUGU AUCC AA-3 ’ (SEQ ID NO: 1095); 5’- CGGAGCAUCCUUGGAUACAG-3’ (SEQ ID NO: 1096); or 5’-
- the spacer sequence may comprise SEQ ID NO: 1096.
- the RNA guide comprises the spacer and a direct repeat sequence.
- the direct repeat sequence is 23 -36-nucleotide in length. In one example, the direct repeat sequence is at least 90% identical to any one of SEQ ID NOs: 1-10 or a fragment thereof that is at least 23-nucleotide in length. In some specific examples, the direct repeat sequence is any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23-nucleotide in length. By way of non-limiting example, the direct repeat sequence is 5’- AG A A AU CC GU CUUUC AUU G ACGG- 3 ’ (SEQ ID NO: 10).
- the RNA guide may comprise the nucleotide sequence of 5’- AG A A AU CC GU CUUUC AUU G ACGGC A A AGU CU AU AU G ACU AU-3 ’ (SEQ ID NO: 967), 5’-AGAAAUCCGUCUUUCAUUGACGGGGAAGUACUGAUUUAGCAUG-3’ (SEQ ID NO: 968), 5 ’ - AG A A AU CC GUCUUU C AUU G AC GGU AG AU GG A AGCUGU AU CC A A-3 ’ (SEQ ID NO: 988), 5’-AGAAAUCCGUCUUUCAUUGACGGCGGAGCAUCCUUGGAUACAG-3’ (SEQ ID NO: 989), or 5’-AGAAAUCCGUCUUUCAUUGACGGAGGACAGAGGGUCAGCAUGC-3’ (SEQ ID NO: 994).
- the RNA guide may comprise SEQ ID NO: 989.
- the system may comprise the second nucleic acid encoding the RNA guide.
- the nucleic acid encoding the RNA guide may be located in a viral vector.
- the viral vector comprises the both the first nucleic acid encoding the Cas12i2 polypeptide and the second nucleic acid encoding the RNA guide.
- any of the systems described herein may comprise the first nucleic acid encoding the Cas12i2 polypeptide, which is located in a first vector, and the second nucleic acid encoding the RNA guide, which is located on a second vector.
- the first and/or second vector is a viral vector.
- the first and second vectors are the same vector. In other examples, the first and second vectors are different vectors.
- any of the systems described herein may comprise one or more lipid nanoparticles (LNPs), which encompass the Cas12i2 polypeptide or the first nucleic acid encoding the Cas12i2 polypeptide, the RNA guide or the second nucleic acid encoding the RNA guide, or both.
- LNPs lipid nanoparticles
- the system described herein may comprise a LNP, which encompass the Cas12i2 polypeptide or the first nucleic acid encoding the Cas12i2 polypeptide, and a viral vector comprising the second nucleic acid encoding the RNA guide.
- the viral vector is an AAV vector.
- the system described herein may comprise a LNP, which encompass the RNA guide or the second nucleic acid encoding the RNA guide, and a viral vector comprising the first nucleic acid encoding the Cas12i2 polypeptide.
- the viral vector is an AAV vector.
- the present disclosure also provides a pharmaceutical composition comprising any of the gene editing systems disclosed herein, or a kit comprising the components of the gene editing system.
- the present disclosure also features a method for editing a hydroxyacid oxidase 1 (HAO1) gene in a cell, the method comprising contacting a host cell with any of the systems disclosed herein to genetically edit the HAO1 gene in the host cell.
- the host cell is cultured in vitro.
- the contacting step is performed by administering the system for editing the HAO1 gene to a subject comprising the host cell.
- a cell comprising a disrupted a hydroxyacid oxidase 1 (HAO1) gene, which can be produced by contacting a host cell with the system disclosed herein genetically edit the HAO1 gene in the host cell.
- HAO1 hydroxyacid oxidase 1
- the present disclosure provides a method for treating primary hyperoxaluria (PH) in a subject.
- the method may comprise administering to a subject in need thereof any of the systems for editing a hydroxyacid oxidase 1 (HAO1) gene or any of the modified cells disclosed herein.
- the subject may be a human patient having the PH.
- the PH is PHI, PH2, or PH3.
- the PH is PHI.
- RNA guide comprising (i) a spacer sequence as disclosed herein that is specific to a target sequence in a hydroxyacid oxidase 1 (HAO1) gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) comprising the motif of 5’- TTN-3’, which is located 5’ to the target sequence; and (ii) a direct repeat sequence.
- HAO1 hydroxyacid oxidase 1
- PAM protospacer adjacent motif
- the spacer may be 20-30-nucleotide in length. In some examples, the spacer is 20-nucleotide in length.
- the direct repeat sequence may be 23 -36-nucleotide in length. In some examples, the direct repeat sequence is 23-nucleotide in length.
- the target sequence may be within exon 1 or exon 2 of the HAO1 gene.
- the target sequence comprises 5’-CAAAGTCTATATATGACTAT-3’ (SEQ ID NO: 1025), 5 ’ - GG A AGT ACT G ATTT AGC ATG- 3 ’ (SEQ ID NO: 1026), 5’- TAGATGGAAGCTGTATCCAA-3’ (SEQ ID NO: 1046), 5’-CGGAGCATCCTTGGATACAG- 3’ (SEQ ID NO: 1047), or 5 ’ -AGGACAGAGGGTCAGC ATGC-3 ’ (SEQ ID NO: 1052).
- the target sequence may comprise SEQ ID NO: 1047.
- the spacer sequence may be set forth as 5’- C A A AGU CUAUAUAUGACUAU-3’ (SEQ ID NO: 1093); 5 ’ - GG A AGU ACU G AUUU AGC AUG- 3’ (SEQ ID NO: 1094); 5’-UAGAUGGAAGCUGUAUCCAA-3’ (SEQ ID NO: 1095); 5’- CGGAGCAUCCUUGGAUACAG-3’ (SEQ ID NO: 1096); or 5’-
- the spacer sequence may comprise SEQ ID NO: 1096.
- the direct repeat sequence may be at least 90% identical to any one of SEQ ID NOs: 1-10 or a fragment thereof that is at least 23-nucleotide in length. In some examples, the direct repeat sequence is any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23-nucleotide in length. By way of non-limiting example, the direct repeat sequence is 5’-AGAAAUCCGUCUUUCAUUGACGG-3’ (SEQ ID NO: 10).
- the RNA guide may comprise the nucleotide sequence of 5’- AG A A AU CC GU CUUUC AUU G ACGGC A A AGU CU AU AU G ACU AU-3 ’ (SEQ ID NO: 967), 5’-AGAAAUCCGUCUUUCAUUGACGGGGAAGUACUGAUUUAGCAUG-3’ (SEQ ID NO: 968), 5 ’ - AG A A AU CC GUCUUU C AUU G AC GGU AG AU GG A AGCUGU AU CC A A-3 ’ (SEQ ID NO: 988), 5’-AGAAAUCCGUCUUUCAUUGACGGCGGAGCAUCCUUGGAUACAG-3’ (SEQ ID NO: 989), or 5’-AGAAAUCCGUCUUUCAUUGACGGAGGACAGAGGGUCAGCAUGC-3’ (SEQ ID NO: 994).
- the RNA guide may comprise SEQ ID NO: 989.
- compositions or kits comprising such, or genetically modified cells generated by the gene editing system for use in treating PH in a subject, as well as uses of the gene editing systems disclosed herein, pharmaceutical compositions or kits comprising such, or genetically modified cells generated by the gene editing system for manufacturing a medicament for treatment of PH in a subject.
- FIG. 1 is a graph showing the ability of RNPs prepared with a Cas12i2 polypeptide and a crRNA to edit the HAO1 gene in HEK293 cells.
- the darker grey bars represent target sequences with perfect homology to both rhesus macaque (. Macaca mulatto) and crab-eating macaque ( Macaco fascicularis ) sequences .
- FIG. 2 is a graph showing the ability of RNPs prepared with a Cas12i2 polypeptide and a crRNA to edit the HAO1 gene in HepG2 cells.
- FIG. 3 is a graph showing the ability of RNPs prepared with a Cas12i2 polypeptide and a crRNA to edit the HAO1 gene in primary hepatocytes.
- FIG. 4 is a graph showing knockdown of HAO1 mRNA in primary human hepatocytes with a Cas12i2 polypeptide and an HAO1 -targeting crRNA.
- FIG. 5A is a graph showing % indels induced by an HAO1 -targeting crRNA and the variant Cas12i2 polypeptide of SEQ ID NO: 924 or SEQ ID NO: 927 in HepG2 cells.
- FIG. 5B shows the size (left) and start position (right) of indels induced in HepG2 cells by the variant Cas12i2 of SEQ ID NO: 924 and the HAO1 -targeting RNA guide of E1T3 (SEQ ID NO: 968).
- FIG. 6 is a graph showing % indels induced by chemically modified HAO1 -targeting crRNAs of SEQ ID NO: 1091 and SEQ ID NO: 1092 and the variant Cas12i2 mRNA of SEQ ID NO: 1089 or SEQ ID NO: 1090.
- FIG. 7A shows plots depicting tagmentation-based tag integration site sequencing (TTISS) reads for variant Cas12i2 of SEQ ID NO: 924 and HAO1 -targeting RNA guides E2T5 (SEQ ID NO: 989), E1T2 (SEQ ID NO: 967), E1T3 (SEQ ID NO: 968), and E2T10 (SEQ ID NO: 994).
- the black wedge and centered number represent the fraction of on-target TTISS reads.
- Each gray wedge represents a unique off-target site identified by TTISS.
- the size of each gray wedge represents the fraction of TTISS reads mapping to a given off-target.
- FIG. 7B shows plots depicting two replicates of TTISS reads for variant Cas12i2 of SEQ ID NO: 927 and HAO1- targeting RNA guides E2T5 (SEQ ID NO: 989), E1T2 (SEQ ID NO: 967), and E1T3 (SEQ ID NO: 968).
- the black wedge and centered number represent the fraction of on-target TTISS reads.
- Each gray wedge represents a unique off-target site identified by TTISS.
- the size of each gray wedge represents the fraction of TTISS reads mapping to a given off-target.
- FIG. 8 is a Western Blot showing knockdown of HAO1 protein following electroporation of primary human hepatocytes with variant Cas12i2 of SEQ ID NO: 924 and RNA guide E2T5 (SEQ ID NO: 989).
- the present disclosure relates to a system for genetic editing of a hydroxyacid oxidase 1 (HAO1) gene ( a.k.a ., glycolate oxidase gene), which comprises (i) a Cas12i polypeptide or a first nucleic acid encoding the Cas12i polypeptide, and (ii) an RNA guide or a second nucleic acid encoding the RNA guide, wherein the RNA guide comprises a spacer sequence specific to a target sequence within an HAO1 gene, the target sequence being adjacent to a protospacer adjacent motif (PAM) comprising the motif of 5’-TTN-3', which is located 5’ to the target sequence.
- PAM protospacer adjacent motif
- a pharmaceutical composition or a kit comprising such system as well as uses thereof.
- a method for editing a HAO1 gene in a cell a cell so produced that comprises a disrupted a HAO1 gene, a method of treating primary hyperoxaluria (PH) in a subject, and an RNA guide that comprises (i) a spacer that is specific to a target sequence in a HAO1 gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) comprising the motif of 5’-TTN-3', which is located 5’ to the target sequence; and (ii) a direct repeat sequence as well as uses thereof.
- PAM protospacer adjacent motif
- the Cas12i polypeptide for use in the gene editing system disclosed herein may be a Cas12i2 polypeptide, e.g., a wild-type Cas12i polypeptide or a variant thereof as those disclosed herein.
- the Cas12i2 polypeptide comprises an amino acid sequence at least 95% identical to SEQ ID NO: 922 and comprises one or more mutations relative to SEQ ID NO: 922.
- the Cas12i polypeptide may be a Cas12i4 polypeptide, which is also disclosed herein.
- activity refers to a biological activity.
- activity includes enzymatic activity, e.g., catalytic ability of a Cas12i polypeptide.
- activity can include nuclease activity.
- HAO1 refers to “glycolate oxidase 1,” which is also known as “hydroxyacid oxidase.” HAO1 is a peroxisome protein expressed primarily in the liver and pancreas, and its activities include oxidation of glycolate and 2-hydroxy fatty acids. SEQ ID NO: 928 as set forth herein provides an example of an HAO1 gene sequence.
- Cas12i polypeptide refers to a polypeptide that binds to a target sequence on a target nucleic acid specified by an RNA guide, wherein the polypeptide has at least some amino acid sequence homology to a wild-type Cas12i polypeptide.
- the Cas12i polypeptide comprises at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with any one of SEQ ID NOs: 1-5 and 11-18 of U.S. Patent No. 10,808,245, which is incorporated by reference for the subject matter and purpose referenced herein.
- a Cas12i polypeptide comprises at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with any one of SEQ ID NOs: 8, 2, 11, and 9 of the present application.
- a Cas12i polypeptide of the disclosure is a Cas12i2 polypeptide as described in WO/2021/202800, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
- the Cas12i polypeptide cleaves a target nucleic acid (e.g., as a nick or a double strand break).
- a nucleotide sequence is adjacent to another nucleotide sequence if no nucleotides separate the two sequences (i.e., immediately adjacent). In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if a small number of nucleotides separate the two sequences (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides).
- a first sequence is adjacent to a second sequence if the two sequences are separated by about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by up to 2 nucleotides, up to 5 nucleotides, up to 8 nucleotides, up to 10 nucleotides, up to 12 nucleotides, or up to 15 nucleotides.
- a first sequence is adjacent to a second sequence if the two sequences are separated by 2-5 nucleotides, 4-6 nucleotides, 4-8 nucleotides, 4-10 nucleotides, 6-8 nucleotides, 6-10 nucleotides, 6-12 nucleotides, 8-10 nucleotides, 8-12 nucleotides, 10-12 nucleotides, 10-15 nucleotides, or 12-15 nucleotides.
- the term “complex” refers to a grouping of two or more molecules.
- the complex comprises a polypeptide and a nucleic acid molecule interacting with (e.g ., binding to, coming into contact with, adhering to) one another.
- the term “complex” can refer to a grouping of an RNA guide and a polypeptide (e.g., a Cas12i polypeptide).
- the term “complex” can refer to a grouping of an RNA guide, a polypeptide, and the complementary region of a target sequence.
- the term “complex” can refer to a grouping of an HAO1 -targeting RNA guide and a Cas12i polypeptide.
- the term “protospacer adjacent motif’ or “PAM” refers to a DNA sequence adjacent to a target sequence (e.g., an HAO1 target sequence) to which a complex comprising an RNA guide (e.g., an HAO1 -targeting RNA guide) and a Cas12i polypeptide binds.
- a target sequence e.g., an HAO1 target sequence
- RNA guide e.g., an HAO1 -targeting RNA guide
- Cas12i polypeptide binds.
- the strand containing the PAM motif is called the “PAM-strand” and the complementary strand is called the “non-PAM strand.”
- the RNA guide binds to a site in the non-PAM strand that is complementary to a target sequence disclosed herein.
- the PAM strand is a coding (e.g., sense) strand.
- the PAM strand is a non-coding (e.g., antisense strand). Since an RNA guide binds the non-PAM strand via base-pairing, the non-PAM strand is also known as the target strand, while the PAM strand is also known as the non-target strand.
- target sequence refers to a DNA fragment adjacent to a PAM motif (on the PAM strand).
- the complementary region of the target sequence is on the non- PAM strand.
- a target sequence may be immediately adjacent to the PAM motif.
- the target sequence and the PAM may be separately by a small sequence segment (e.g., up to 5 nucleotides, for example, up to 4, 3, 2, or 1 nucleotide).
- a target sequence may be located at the 3’ end of the PAM motif or at the 5’ end of the PAM motif, depending upon the CRISPR nuclease that recognizes the PAM motif, which is known in the art.
- a target sequence is located at the 3’ end of a PAM motif for a Cas12i polypeptide (e.g., a Cas12i2 polypeptide such as those disclosed herein).
- the target sequence is a sequence within an HAO1 gene sequence, including, but not limited, to the sequence set forth in SEQ ID NO: 928.
- a nucleotide sequence is adjacent to another nucleotide sequence if no nucleotides separate the two sequences (i.e., immediately adjacent). In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if a small number of nucleotides separate the two sequences (e.g ., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides).
- a first sequence is adjacent to a second sequence if the two sequences are separated by about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by up to 2 nucleotides, up to 5 nucleotides, up to 8 nucleotides, up to 10 nucleotides, up to 12 nucleotides, or up to 15 nucleotides.
- a first sequence is adjacent to a second sequence if the two sequences are separated by 2-5 nucleotides, 4-6 nucleotides, 4-8 nucleotides, 4-10 nucleotides, 6-8 nucleotides, 6-10 nucleotides, 6-12 nucleotides, 8-10 nucleotides, 8-12 nucleotides, 10-12 nucleotides, 10-15 nucleotides, or 12-15 nucleotides.
- the term “spacer” or “spacer sequence” is a portion in an RNA guide that is the RNA equivalent of the target sequence (a DNA sequence).
- the spacer contains a sequence capable of binding to the non-PAM strand via base-pairing at the site complementary to the target sequence (in the PAM strand).
- Such a spacer is also known as specific to the target sequence.
- the spacer may be at least 75% identical to the target sequence (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%), except for the RNA-DNA sequence difference.
- the spacer may be 100% identical to the target sequence except for the RNA-DNA sequence difference.
- RNA guide refers to any RNA molecule or a modified RNA molecule that facilitates the targeting of a polypeptide (e.g., a Cas12i polypeptide) described herein to a target sequence (e.g., a sequence of an HAO1 gene).
- a target sequence e.g., a sequence of an HAO1 gene.
- an RNA guide can be a molecule that is designed to be complementary to a specific nucleic acid sequence (a target sequence such as a target sequence with an HAO1 gene).
- An RNA guide may comprise a spacer sequence and a direct repeat (DR) sequence.
- DR direct repeat
- the RNA guide can be a modified RNA molecule comprising one or more deoxyribonucleotides, for example, in a DNA-binding sequence contained in the RNA guide, which binds a sequence complementary to the target sequence.
- the DNA- binding sequence may contain a DNA sequence or a DNA/RNA hybrid sequence.
- CRISPR RNA (crRNA), pre-crRNA and mature crRNA are also used herein to refer to an RNA guide.
- the term “complementary” refers to a first polynucleotide (e.g ., a spacer sequence of an RNA guide) that has a certain level of complementarity to a second polynucleotide (e.g., the complementary sequence of a target sequence) such that the first and second polynucleotides can form a double- stranded complex via base-pairing to permit an effector polypeptide that is complexed with the first polynucleotide to act on (e.g., cleave) the second polynucleotide.
- first polynucleotide e.g a spacer sequence of an RNA guide
- a second polynucleotide e.g., the complementary sequence of a target sequence
- the first polynucleotide may be substantially complementary to the second polynucleotide, i.e., having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the second polynucleotide.
- the first polynucleotide is completely complementary to the second polynucleotide, i.e., having 100% complementarity to the second polynucleotide.
- the term “edit” refers to one or more modifications introduced into a target nucleic acid, e.g., within the HAO1 gene.
- the edit can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof.
- substitution refers to a replacement of a nucleotide or nucleotides with a different nucleotide or nucleotides, relative to a reference sequence.
- the term “insertion” refers to a gain of a nucleotide or nucleotides in a nucleic acid sequence, relative to a reference sequence.
- the term “deletion” refers to a loss of a nucleotide or nucleotides in a nucleic acid sequence, relative to a reference sequence.
- a sequence comprising a deletion can be synthesized directly from individual nucleotides.
- a deletion is made by providing and then altering a reference sequence.
- the nucleic acid sequence can be in a genome of an organism.
- the nucleic acid sequence can be in a cell.
- the nucleic acid sequence can be a DNA sequence.
- the deletion can be a frameshift mutation or a non-frameshift mutation.
- a deletion described herein refers to a deletion of up to several kilobases .
- upstream and downstream refer to relative positions within a single nucleic acid (e.g., DNA) sequence in a nucleic acid molecule. “Upstream” and “downstream” relate to the 5’ to 3’ direction, respectively, in which RNA transcription occurs. A first sequence is upstream of a second sequence when the 3’ end of the first sequence occurs before the 5’ end of the second sequence. A first sequence is downstream of a second sequence when the 5’ end of the first sequence occurs after the 3’ end of the second sequence.
- the 5’-NTTN-3’ or 5’-TTN-3’ sequence is upstream of an indel described herein, and a Cas12i-induced indel is downstream of the 5’-NTTN-3’ or 5’-TTN-3’ sequence.
- the present disclosure provides gene editing systems comprising an RNA guide targeting an HAO1 gene.
- a gene editing system can be used to edit the HAO1 target gene, e.g., to disrupt the HAO1 gene.
- HAO1 Hydroxy acid oxidase 1
- GOX glycolate oxidase
- GOX glycolate oxidase
- the RNA guide is comprised of a direct repeat component and a spacer component.
- the RNA guide binds a Cas12i polypeptide.
- the spacer component is specific to an HAO1 target sequence, wherein the HAO1 target sequence is adjacent to a 5’-NTTN-3’ or 5’-TTN-3’ PAM sequence as described herein.
- the RNA guide binds to a first strand of the target (i.e., the non-PAM strand) and a PAM sequence as described herein is present in the second, complementary strand (i.e., the PAM strand).
- the present disclosure provides compositions comprising a complex, wherein the complex comprises an RNA guide targeting HAO1.
- the present disclosure comprises a complex comprising an RNA guide and a Cas12i polypeptide.
- the RNA guide and the Cas12i polypeptide bind to each other in a molar ratio of about 1:1.
- a complex comprising an RNA guide and a Cas12i polypeptide binds to the complementary region of a target sequence within an HAO1 gene.
- a complex comprising an RNA guide targeting HAO1 and a Cas12i polypeptide binds to the complementary region of a target sequence within an HAO1 gene at a molar ratio of about 1:1.
- the complex comprises enzymatic activity, such as nuclease activity, that can cleave the HAO1 target sequence and/or the complementary sequence.
- the RNA guide in the complex comprises a direct repeat and/or a spacer sequence described herein.
- the sequence of the RNA guide has at least 90% identity (e.g ., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence of any one of SEQ ID NOs: 967-1023. In some embodiments, the RNA guide has a sequence of any one of SEQ ID NOs: 967-1023.
- the present disclosure described herein comprises compositions comprising an RNA guide as described herein and/or an RNA encoding a Cas12i polypeptide as described herein.
- the RNA guide and the RNA encoding a Cas12i polypeptide are comprised together within the same composition.
- the RNA guide and the RNA encoding a Cas12i polypeptide are comprised within separate compositions.
- the RNA guide comprises a direct repeat and/or a spacer sequence described herein.
- the sequence of the RNA guide has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence of any one of SEQ ID NOs: 967-1023. In some embodiments, the RNA guide has a sequence of any one of SEQ ID NOs: 967-1023.
- Cas12i polypeptides are smaller than other nucleases.
- Cas12i2 is 1,054 amino acids in length
- S. pyogenes Cas9 (SpCas9) is 1,368 amino acids in length
- S. thermophilus Cas9 (StCas9) is 1,128 amino acids in length
- FnCpfl is 1,300 amino acids in length
- AsCpfl is 1,307 amino acids in length
- LbCpfl is 1,246 amino acids in length.
- Cas12i RNA guides which do not require a trans-activating CRISPR RNA (tracrRNA), are also smaller than Cas9 RNA guides.
- compositions comprising a Cas12i polypeptide also demonstrate decreased off-target activity compared to compositions comprising an SpCas9 polypeptide. See PCT/US2021/025257, which is incorporated by reference in its entirety.
- indels induced by compositions comprising a Cas12i polypeptide differ from indels induced by compositions comprising an SpCas9 polypeptide.
- SpCas9 polypeptides primarily induce insertions and deletions of 1 nucleotide in length.
- Cas12i polypeptides induce larger deletions, which can be beneficial in disrupting a larger portion of a gene such as HAO1.
- a system for genetic editing of a hydroxyacid oxidase 1 (HAO1) gene which comprises (i) a Cas12i polypeptide (e.g., a Cas12i2 polypeptide) or a first nucleic acid encoding the Cas12i polypeptide(e.g., a Cas12i2 polypeptide comprises an amino acid sequence at least 95% identical to SEQ ID NO: 922, which may and comprises one or more mutations relative to SEQ ID NO: 922); and (ii) an RNA guide or a second nucleic acid encoding the RNA guide, wherein the RNA guide comprises a spacer sequence specific to a target sequence within an HAO1 gene (e.g., within exon 1 or exon 2 of the HAO1 gene), the target sequence being adjacent to a protospacer adjacent motif (PAM) comprising the motif of 5’-TTN- 3’ (5’-NTTN-3’), which is located 5’ to the target sequence.
- PAM protospacer adjacent
- the gene editing system described herein comprises an RNA guide targeting a HAO1 gene, for example, targeting exon 1 or exon 2 of the HAO1 gene.
- the gene editing system described herein may comprise two or more (e.g ., 2, 3, 4, 5, 6, 7, 8, 9, or more) RNA guides targeting HAO1.
- the RNA guide may direct the Cas12i polypeptide contained in the gene editing system as described herein to an HAO1 target sequence.
- Two or more RNA guides may direct two or more separate Cas12i polypeptides (e.g., Cas12i polypeptides having the same or different sequence) as described herein to two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or more) HAO1 target sequences.
- an RNA guide is HAO1 target-specific. That is, in some embodiments, an RNA guide binds specifically to one or more HAO1 target sequences (e.g., within a cell) and not to non-targeted sequences (e.g., non-specific DNA or random sequences within the same cell).
- the RNA guide comprises a spacer sequence followed by a direct repeat sequence, referring to the sequences in the 5’ to 3’ direction. In some embodiments, the RNA guide comprises a first direct repeat sequence followed by a spacer sequence and a second direct repeat sequence, referring to the sequences in the 5’ to 3’ direction. In some embodiments, the first and second direct repeats of such an RNA guide are identical. In some embodiments, the first and second direct repeats of such an RNA guide are different.
- the spacer sequence and the direct repeat sequence(s) of the RNA guide are present within the same RNA molecule.
- the spacer and direct repeat sequences are linked directly to one another.
- a short linker is present between the spacer and direct repeat sequences, e.g., an RNA linker of 1, 2, or 3 nucleotides in length.
- the spacer sequence and the direct repeat sequence(s) of the RNA guide are present in separate molecules, which are joined to one another by base pairing interactions.
- RNA guides Additional information regarding exemplary direct repeat and spacer components of RNA guides is provided as follows.
- the RNA guide comprises a direct repeat sequence.
- the direct repeat sequence of the RNA guide has a length of between 12-100, 13- 75, 14-50, or 15-40 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides).
- the direct repeat sequence is a sequence of Table 1 or a portion of a sequence of Table 1.
- the direct repeat sequence can comprise nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 9 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 10 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 11 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 12 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 13 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 14 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can comprise nucleotide 1 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 2 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 3 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 4 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 5 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 6 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 7 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 8 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 9 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 10 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 11 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can comprise nucleotide 12 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence is set forth in SEQ ID NO: 10.
- the direct repeat sequence comprises a portion of the sequence set forth in SEQ ID NO: 10.
- the direct repeat sequence has at least 90% identity (e.g ., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 1 or a portion of a sequence of Table 1.
- the direct repeat sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 2 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 3 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 4 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 5 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 6 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 7 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 8 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 9 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 10 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3,
- the direct repeat sequence can have at least 90% identity to a sequence comprising 11 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 12 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 13 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 14 through nucleotide 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 1 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 2 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 3 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 4 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 5 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 6 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 7 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 8 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 9 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 10 through nucleotide 34 of SEQ ID NO: 9.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 11 through nucleotide
- the direct repeat sequence can have at least 90% identity to a sequence comprising 12 through nucleotide 34 of SEQ ID NO: 9. In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to SEQ ID NO: 10. In some embodiments, the direct repeat sequence has at least 90% identity to a portion of the sequence set forth in SEQ ID NO: 10.
- compositions comprising a Cas12i2 polypeptide and an RNA guide comprising the direct repeat of SEQ ID NO: 10 and a spacer length of 20 nucleotides are capable of introducing indels into an HAO1 target sequence.
- Example 1 where indels were measured at forty-four HAO1 target sequences following delivery of an RNA guide and a Cas12i2 polypeptide of SEQ ID NO: 924 to HEK293T cells by RNP;
- Example 2 where indels were measured at eleven HAO1 target sequences following delivery of an RNA guide and a Cas12i2 polypeptide of SEQ ID NO: 924 to HepG2 cells by RNP;
- Example 3 where indels were measured at five HAO1 target sequences following delivery of an RNA guide and a Cas12i2 polypeptide of SEQ ID NO: 924 to primary hepatocytes by RNP.
- the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 1-10 (see, Table 1). In some embodiments, the direct repeat sequence is the reverse complement of any one of SEQ ID NOs: 1-10. Table 1.
- the direct repeat sequence is a sequence of Table 2 or a portion of a sequence of Table 2.
- the direct repeat sequence can comprise nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948,
- the direct repeat sequence can comprise nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 9 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 10 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 11 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948,
- the direct repeat sequence can comprise nucleotide 12 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 13 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can comprise nucleotide 14 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence has at least 95% identity (e.g ., at least 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 2 or a portion of a sequence of Table 2.
- the direct repeat sequence can have at least 95% identity to a sequence comprising nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 2 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 3 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 4 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 5 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948,
- the direct repeat sequence can have at least 95% identity to a sequence comprising 6 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 7 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 8 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 9 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 10 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 11 through nucleotide 36 of any one of SEQ ID NOs: 936,
- the direct repeat sequence can have at least 95% identity to a sequence comprising 12 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 95% identity to a sequence comprising 13 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938,
- the direct repeat sequence has at least 90% identity (e.g ., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 2 or a portion of a sequence of Table 2.
- the direct repeat sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936, 937,
- the direct repeat sequence can have at least 90% identity to a sequence comprising 2 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 2 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948,
- the direct repeat sequence can have at least 90% identity to a sequence comprising 3 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939,
- the direct repeat sequence can have at least 90% identity to a sequence comprising 4 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 5 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 6 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 7 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 8 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 9 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948,
- the direct repeat sequence can have at least 90% identity to a sequence comprising 10 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 11 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949,
- the direct repeat sequence can have at least 90% identity to a sequence comprising 12 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence can have at least 90% identity to a sequence comprising 13 through nucleotide 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. In some embodiments, the direct repeat sequence is at least 95% identical to the reverse complement of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence is the reverse complement of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
- the direct repeat sequence is at least 90% identical to SEQ ID NO: 954 or a portion of SEQ ID NO: 954. In some embodiments, the direct repeat sequence is at least 95% identical to SEQ ID NO: 954 or a portion of SEQ ID NO: 954. In some embodiments, the direct repeat sequence is 100% identical to SEQ ID NO: 954 or a portion of SEQ ID NO: 954.
- the direct repeat sequence is a sequence of Table 3 or a portion of a sequence of Table 3. In some embodiments, the direct repeat sequence has at least 95% identity (e.g., at least 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 3 or a portion of a sequence of Table 3. In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 3 or a portion of a sequence of Table 3. In some embodiments, the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 959-961. In some embodiments, the direct repeat sequence is at least 95% identical to the reverse complement of any one of SEQ ID NOs: 959-961. In some embodiments, the direct repeat sequence is the reverse complement of any one of SEQ ID NOs: 959-961.
- the direct repeat sequence is a sequence of Table 4 or a portion of a sequence of Table 4.
- the direct repeat sequence has at least 95% identity (e.g ., at least 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 4 or a portion of a sequence of Table 4.
- the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 4 or a portion of a sequence of Table 4.
- the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 962-964. In some embodiments, the direct repeat sequence is at least 95% identical to the reverse complement of any one of SEQ ID NOs: 962-964. In some embodiments, the direct repeat sequence is the reverse complement of any one of SEQ ID NOs: 962-964. Table 4. Cas12i3 Direct Repeat Sequences
- a direct repeat sequence described herein comprises an uracil (U). In some embodiments, a direct repeat sequence described herein comprises a thymine (T). In some embodiments, a direct repeat sequence according to Tables 1-4 comprises a sequence comprising a thymine in one or more places indicated as uracil in Tables 1-4.
- the RNA guide comprises a DNA targeting or spacer sequence.
- the spacer sequence of the RNA guide has a length of between 12-100, 13- 75, 14-50, or 15-30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and is complementary to a non-PAM strand sequence.
- the spacer sequence is designed to be complementary to a specific DNA strand, e.g., of a genomic locus.
- the RNA guide spacer sequence is substantially identical to a complementary strand of a target sequence.
- the RNA guide comprises a sequence (e.g., a spacer sequence) having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a complementary strand of a reference nucleic acid sequence, e.g., a target sequence.
- the percent identity between two such nucleic acids can be determined manually by inspection of the two optimally aligned nucleic acid sequences or by using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL) using standard parameters.
- the RNA guide comprises a spacer sequence that has a length of between 12-100, 13-75, 14-50, or 15-30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a region on the non-PAM strand that is complementary to the target sequence.
- the RNA guide comprises a sequence at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a target DNA sequence.
- the RNA guide comprises a sequence at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a target genomic sequence.
- the RNA guide comprises a sequence, e.g., RNA sequence, that is a length of up to 50 and at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a region on the non-PAM strand that is complementary to the target sequence.
- the RNA guide comprises a sequence at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a target DNA sequence. In some embodiments, the RNA guide comprises a sequence at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to a target genomic sequence.
- the spacer sequence is a sequence of Table 5 or a portion of a sequence of Table 5. It should be understood that an indication of SEQ ID NOs: 466-920 should be considered as equivalent to a listing of SEQ ID NOs: 466-920, with each of the intervening numbers present in the listing, i.e., 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496,
- the spacer sequence can comprise nucleotide 1 through nucleotide 16 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 17 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 18 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 19 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 20 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 21 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 22 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 23 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 24 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 25 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 26 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 27 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 28 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 29 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can comprise nucleotide 1 through nucleotide 30 of any one of SEQ ID NOs: 466-920.
- the spacer sequence has at least 90% identity (e.g ., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to a sequence of Table 5 or a portion of a sequence of Table 5.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 16 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 17 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 18 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 19 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 20 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 21 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 22 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 23 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 24 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 25 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 26 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 27 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 28 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 29 of any one of SEQ ID NOs: 466-920.
- the spacer sequence can have at least 90% identity to a sequence comprising nucleotide 1 through nucleotide 30 of any one of 466-920.
- the present disclosure includes all combinations of the direct repeats and spacers listed above, consistent with the disclosure herein.
- a spacer sequence described herein comprises an uracil (U). In some embodiments, a spacer sequence described herein comprises a thymine (T). In some embodiments, a spacer sequence according to Table 5 comprises a sequence comprising a thymine in one or more places indicated as uracil in Table 5.
- RNA guides that comprise any and all combinations of the direct repeats and spacers described herein (e.g ., as set forth in Table 5, above).
- the sequence of an RNA guide has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence of any one of SEQ ID NOs: 967-1023.
- an RNA guide has a sequence of any one of SEQ ID NOs: 967-1023.
- exemplary RNA guides provided herein may comprise a spacer sequence of any one of SEQ ID NOs: 1093-1097.
- the RNA guide may comprise a spacer of SEQ ID NO: 1096.
- any of the exemplary RNA guides disclosed herein may comprise a direct sequence of any one of SEQ ID NOs: 1-10 or a fragment thereof that is at least 23-nucleotide in length.
- the direct sequence may comprise SEQ ID NO: 10.
- RNA guides provided herein may comprise the nucleotide sequence of SEQ ID NOs: 967, 968, 988, 989, or 994. In one example, the RNA guide provided herein comprise the nucleotide sequence of SEQ ID NO: 989.
- the RNA guide may include one or more covalent modifications with respect to a reference sequence, in particular the parent polyribonucleotide, which are included within the scope of the present disclosure.
- Exemplary modifications can include any modification to the sugar, the nucleobase, the intemucleoside linkage (e.g., to a linking phosphate/to a phosphodiester linkage/to the phosphodiester backbone), and any combination thereof.
- Some of the exemplary modifications provided herein are described in detail below.
- the RNA guide may include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g., to a linking phosphate/to a phosphodiester linkage/to the phosphodiester backbone).
- One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro).
- modifications e.g., one or more modifications
- RNAs ribonucleic acids
- DNAs deoxyribonucleic acids
- TAAs threose nucleic acids
- GNAs glycol nucleic acids
- PNAs peptide nucleic acids
- LNAs locked nucleic acids
- the modification may include a chemical or cellular induced modification.
- RNA modifications are described by Lewis and Pan in “RNA modifications and structures cooperate to RNA guide- protein interactions” from Nat Reviews Mol Cell Biol, 2017, 18:202-210.
- nucleotide modifications may exist at various positions in the sequence.
- nucleotide analogs or other modification(s) may be located at any position(s) of the sequence, such that the function of the sequence is not substantially decreased.
- the sequence may include from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%>, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 50% to 50% to 50% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%,
- sugar modifications e.g ., at the 2’ position or 4’ position
- replacement of the sugar at one or more ribonucleotides of the sequence may, as well as backbone modifications, include modification or replacement of the phosphodiester linkages.
- Specific examples of a sequence include, but are not limited to, sequences including modified backbones or no natural internucleoside linkages such as internucleoside modifications, including modification or replacement of the phosphodiester linkages.
- Sequences having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
- modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
- a sequence will include ribonucleotides with a phosphorus atom in its intemucleoside backbone.
- Modified sequence backbones may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’.
- Various salts, mixed salts and free acid forms are also included.
- the sequence may be negatively or positively charged.
- the modified nucleotides which may be incorporated into the sequence, can be modified on the intemucleoside linkage (e.g., phosphate backbone).
- the phrases “phosphate” and “phosphodiester” are used interchangeably.
- Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent.
- the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another intemucleoside linkage as described herein.
- modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters.
- Phosphorodithioates have both non-linking oxygens replaced by sulfur.
- the phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).
- a-thio substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment.
- a modified nucleoside includes an alpha-thio-nucleoside (e.g., 5’-O-(1-thiophosphate)-adenosine, 5’-O-(1-thiophosphate)-cytidine (a-thio-cytidine), 5’-O-(1- thiophosphate)-guanosine, 5’-O-(1-thiophosphate)-uridine, or 5’-O-(1-thiophosphate)- pseudouridine).
- alpha-thio-nucleoside e.g., 5’-O-(1-thiophosphate)-adenosine, 5’-O-(1-thiophosphate)-cytidine (a-thio-cytidine), 5’-O-(1- thiophosphate)-guanosine, 5’-O-(1-thiophosphate)-uridine, or 5’-O-(1-thiophosphate)- pseudouridine
- intemucleoside linkages that may be employed according to the present disclosure, including intemucleoside linkages which do not contain a phosphorous atom, are described herein.
- the sequence may include one or more cytotoxic nucleosides.
- cytotoxic nucleosides may be incorporated into sequence, such as bifunctional modification.
- Cytotoxic nucleoside may include, but are not limited to, adenosine arabinoside, 5- azacytidine, 4’-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro- l-(tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione), t
- Additional examples include fludarabine phosphate, N4-behenoyl-l-beta-D- arabinofuranosylcytosine, N4-octadecyl-l-beta-D-arabinofuranosylcytosine, N4-palmitoyl-l-(2- C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5’-elaidic acid ester).
- the sequence includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc).
- the one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999).
- the first isolated nucleic acid comprises messenger RNA (mRNA).
- the mRNA comprises at least one nucleoside selected from the group consisting of pyridin-4-one ribonucleoside, 5 -aza- uridine, 2-thio-5-aza-uridine, 2- thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5- carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl- pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, l-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1 -methyl-pseudo uridine, 4-thi
- the mRNA comprises at least one nucleoside selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine,
- 6-diaminopurine 7-deaza- adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8- aza-2-aminopurine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1- methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio
- mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7- deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza- guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy- guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo- guanosine, 7-methyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.
- nucleoside selected from the group
- the sequence may or may not be uniformly modified along the entire length of the molecule.
- nucleotides e.g ., naturally-occurring nucleotides, purine or pyrimidine, or any one or more or all of A, G, U, C, I, pU
- the sequence includes a pseudouridine.
- the sequence includes an inosine, which may aid in the immune system characterizing the sequence as endogenous versus viral RNAs. The incorporation of inosine may also mediate improved RNA stability /reduced degradation. See for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self’. Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety.
- one or more of the nucleotides of an RNA guide comprises a 2’-O- methyl phosphorothioate modification.
- each of the first three nucleotides of the RNA guide comprises a 2’-O-methyl phosphorothioate modification.
- each of the last four nucleotides of the RNA guide comprises a 2’-O-methyl phosphorothioate modification.
- each of the first to last, second to last, and third to last nucleotides of the RNA guide comprises a 2’ -O- methyl phosphorothioate modification, and wherein the last nucleotide of the RNA guide is unmodified.
- each of the first three nucleotides of the RNA guide comprises a 2’-O-methyl phosphorothioate modification
- each of the first to last, second to last, and third to last nucleotides of the RNA guide comprises a 2’-O-methyl phosphorothioate modification
- nucleic acid molecules may contain any of the modifications disclosed herein, where applicable.
- composition or system of the present disclosure includes a Cas12i polypeptide as described in WO/2019/178427, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
- the genetic editing system disclosed herein includes a Cas12i2 polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 922 and/or encoded by SEQ ID NO: 921).
- the Cas12i2 polypeptide comprises at least one RuvC domain.
- a nucleic acid sequence encoding the Cas12i2 polypeptide described herein may be substantially identical to a reference nucleic acid sequence, e.g., SEQ ID NO: 921.
- the Cas12i2 polypeptide is encoded by a nucleic acid comprising a sequence having least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to the reference nucleic acid sequence, e.g., SEQ ID NO: 921.
- the percent identity between two such nucleic acids can be determined manually by inspection of the two optimally aligned nucleic acid sequences or by using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL) using standard parameters.
- One indication that two nucleic acid sequences are substantially identical is that the nucleic acid molecules hybridize to the complementary sequence of the other under stringent conditions of temperature and ionic strength (e.g., within a range of medium to high stringency). See, e.g., Tijssen, “Hybridization with Nucleic Acid Probes. Part I. Theory and Nucleic Acid Preparation” (Laboratory Techniques in Biochemistry and Molecular Biology, Vol 24).
- the Cas12i2 polypeptide is encoded by a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity, but not 100% sequence identity, to a reference nucleic acid sequence, e.g., SEQ ID NO: 921.
- the Cas12i2 polypeptide of the present disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 922.
- the present disclosure describes a Cas12i2 polypeptide having a specified degree of amino acid sequence identity to one or more reference polypeptides, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity to the amino acid sequence of SEQ ID NO: 922.
- Homology or identity can be determined by amino acid sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL, as described herein.
- Cas12i2 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, and comprising an amino acid sequence which differs from the amino acid sequences of SEQ ID NO: 922 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residue(s), when aligned using any of the previously described alignment methods.
- the Cas12i2 polypeptide may contain one or more mutations relative to SEQ ID NO: 922, for example, at position D581, G624, F626, P868, 1926, V1030, E1035, S1046, or any combination thereof.
- the one or more mutations are amino acid substitutions, for example, D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, S1046G, or a combination thereof.
- the Cas12i2 polypeptide contains mutations at positions D581, D911, 1926, and V1030. Such a Cas12i2 polypeptide may contain amino acid substitutions of D581R, D911R, I926R, and V1030G (e.g., SEQ ID NO: 923). In some examples, the Cas12i2 polypeptide contains mutations at positions D581, 1926, and V1030. Such a Cas12i2 polypeptide may contain amino acid substitutions of D581R, I926R, and V1030G (e.g., SEQ ID NO: 924).
- the Cas12i2 polypeptide may contain mutations at positions D581, 1926, V1030, and S1046. Such a Cas12i2 polypeptide may contain amino acid substitutions of D581R, I926R, V1030G, and S1046G (e.g., SEQ ID NO: 925). In some examples, the Cas12i2 polypeptide may contain mutations at positions D581, G624, F626, 1926, V1030, E1035, and S1046.
- Such a Cas12i2 polypeptide may contain amino acid substitutions of D581R, G624R, F626R, I926R, V1030G, E1035R, and S1046G (e.g., SEQ ID NO: 926).
- the Cas12i2 polypeptide may contain mutations at positions D581, G624, F626, P868, 1926, V1030, E1035, and S1046.
- Such a Cas12i2 polypeptide may contain amino acid substitutions of D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G (e.g., SEQ ID NO: 927).
- the Cas12i2 polypeptide of the present disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927.
- the present disclosure describes a Cas12i2 polypeptide having a specified degree of amino acid sequence identity to one or more reference polypeptides, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity to the amino acid sequence of SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927.
- Homology or identity can be determined by amino acid sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL, as described herein.
- Cas12i2 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, and comprising an amino acid sequence which differs from the amino acid sequences of SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residue(s), when aligned using any of the previously described alignment methods.
- enzymatic activity e.g., nuclease or endonuclease activity
- the composition of the present disclosure includes a Cas12i4 polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 956 and/or encoded by SEQ ID NO: 955).
- the Cas12i4 polypeptide comprises at least one RuvC domain.
- a nucleic acid sequence encoding the Cas12i4 polypeptide described herein may be substantially identical to a reference nucleic acid sequence, e.g., SEQ ID NO: 955.
- the Cas12i4 polypeptide is encoded by a nucleic acid comprising a sequence having least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to the reference nucleic acid sequence, e.g., SEQ ID NO: 955.
- the percent identity between two such nucleic acids can be determined manually by inspection of the two optimally aligned nucleic acid sequences or by using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL) using standard parameters.
- One indication that two nucleic acid sequences are substantially identical is that the nucleic acid molecules hybridize to the complementary sequence of the other under stringent conditions of temperature and ionic strength (e.g ., within a range of medium to high stringency).
- the Cas12i4 polypeptide is encoded by a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity, but not 100% sequence identity, to a reference nucleic acid sequence, e.g., SEQ ID NO: 955.
- the Cas12i4 polypeptide of the present disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 956.
- the present disclosure describes a Cas12i4 polypeptide having a specified degree of amino acid sequence identity to one or more reference polypeptides, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity to the amino acid sequence of SEQ ID NO: 956.
- Homology or identity can be determined by amino acid sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL, as described herein.
- Cas12i4 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, and comprising an amino acid sequence which differs from the amino acid sequences of SEQ ID NO: 956 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residue(s), when aligned using any of the previously described alignment methods.
- the Cas12i4 polypeptide comprises a polypeptide having a sequence of SEQ ID NO: 957 or SEQ ID NO: 958.
- the Cas12i4 polypeptide of the present disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 957 or SEQ ID NO: 958.
- a Cas12i4 polypeptide having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 957 or SEQ ID NO: 958 maintains the amino acid changes (or at least 1, 2, 3 etc. of these changes) that differentiate it from its respective parent/reference sequence.
- the present disclosure describes a Cas12i4 polypeptide having a specified degree of amino acid sequence identity to one or more reference polypeptides, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity to the amino acid sequence of SEQ ID NO: 957 or SEQ ID NO: 958.
- Homology or identity can be determined by amino acid sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL, as described herein.
- Cas12i4 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, and comprising an amino acid sequence which differs from the amino acid sequences of SEQ ID NO: 957 or SEQ ID NO: 958 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residue(s), when aligned using any of the previously described alignment methods.
- composition of the present disclosure includes a Cas12il polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 965).
- the Cas12i4 polypeptide comprises at least one RuvC domain.
- the Cas12il polypeptide of the present disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 965.
- the present disclosure describes a Cas12il polypeptide having a specified degree of amino acid sequence identity to one or more reference polypeptides, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity to the amino acid sequence of SEQ ID NO: 965.
- Homology or identity can be determined by amino acid sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL, as described herein.
- Cas12il polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, and comprising an amino acid sequence which differs from the amino acid sequences of SEQ ID NO: 965 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residue(s), when aligned using any of the previously described alignment methods.
- composition of the present disclosure includes a Cas12i3 polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 966).
- the Cas12i4 polypeptide comprises at least one RuvC domain.
- the Cas12i3 polypeptide of the present disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 966.
- the present disclosure describes a Cas12i3 polypeptide having a specified degree of amino acid sequence identity to one or more reference polypeptides, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity to the amino acid sequence of SEQ ID NO: 966.
- Homology or identity can be determined by amino acid sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL, as described herein.
- Cas12i3 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, and comprising an amino acid sequence which differs from the amino acid sequences of SEQ ID NO: 966 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residue(s), when aligned using any of the previously described alignment methods.
- changes to the Cas12i polypeptide may also be of a substantive nature, such as fusion of polypeptides as amino- and/or carboxyl-terminal extensions.
- the Cas12i polypeptide may contain additional peptides, e.g., one or more peptides. Examples of additional peptides may include epitope peptides for labelling, such as a polyhistidine tag (His-tag), Myc, and FLAG.
- the Cas12i polypeptide described herein can be fused to a detectable moiety such as a fluorescent protein (e.g., green fluorescent protein (GFP) or yellow fluorescent protein (YFP)).
- GFP green fluorescent protein
- YFP yellow fluorescent protein
- the Cas12i polypeptide comprises at least one (e.g., two, three, four, five, six, or more) nuclear localization signal (NLS). In some embodiments, the Cas12i polypeptide comprises at least one (e.g., two, three, four, five, six, or more) nuclear export signal (NES). In some embodiments, the Cas12i polypeptide comprises at least one (e.g., two, three, four, five, six, or more) NLS and at least one (e.g., two, three, four, five, six, or more) NES.
- NLS nuclear localization signal
- NES nuclear export signal
- the Cas12i polypeptide comprises at least one (e.g., two, three, four, five, six, or more) NLS and at least one (e.g., two, three, four, five, six, or more) NES.
- the Cas12i polypeptide described herein can be self-inactivating. See, Epstein et al., “Engineering a Self-Inactivating CRISPR System for AAV Vectors,” Mol. Ther., 24 (2016): S50, which is incorporated by reference in its entirety.
- the nucleotide sequence encoding the Cas12i polypeptide described herein can be codon-optimized for use in a particular host cell or organism.
- the nucleic acid can be codon-optimized for any non-human eukaryote including mice, rats, rabbits, dogs, livestock, or non-human primates. Codon usage tables are readily available, for example, at the “Codon Usage Database” available at www.kazusa.orjp/codon/ and these tables can be adapted in a number of ways. See Nakamura et al. Nucl. Acids Res. 28:292 (2000), which is incorporated herein by reference in its entirety.
- nucleic acid encoding the Cas12i polypeptides such as Cas12i2 polypeptides as disclosed herein can be an mRNA molecule, which can be codon optimized.
- Cas12i polypeptide sequences and corresponding nucleotide sequences are listed in Table 6. Table 6. Cas12i and HAO1 Sequences
- the gene editing system disclosed herein may comprise a Cas12i polypeptide as disclosed herein.
- the gene editing system may comprise a nucleic acid encoding the Cas12i polypeptide.
- the gene editing system may comprise a vector (e.g ., a viral vector such as an AAV vector, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAV11 and AAV 12) encoding the Cas12i polypeptide.
- the gene editing system may comprise a mRNA molecule encoding the Cas12i polypeptide. In some instances, the mRNA molecule may be codon- optimized.
- the present disclosure provides methods for production of components of the gene editing systems disclosed herein, e.g., the RNA guide, methods for production of the Cas12i polypeptide, and methods for complexing the RNA guide and Cas12i polypeptide.
- the RNA guide is made by in vitro transcription of a DNA template.
- the RNA guide is generated by in vitro transcription of a DNA template encoding the RNA guide using an upstream promoter sequence (e.g ⁇ , a T7 polymerase promoter sequence).
- the DNA template encodes multiple RNA guides or the in vitro transcription reaction includes multiple different DNA templates, each encoding a different RNA guide.
- the RNA guide is made using chemical synthetic methods.
- the RNA guide is made by expressing the RNA guide sequence in cells transfected with a plasmid including sequences that encode the RNA guide.
- the plasmid encodes multiple different RNA guides.
- RNA guide is expressed from a plasmid that encodes the RNA guide and also encodes a Cas12i polypeptide.
- the RNA guide is expressed from a plasmid that expresses the RNA guide but not a Cas12i polypeptide.
- the RNA guide is purchased from a commercial vendor.
- the RNA guide is synthesized using one or more modified nucleotide, e.g., as described above.
- the Cas12i polypeptide of the present disclosure can be prepared by (a) culturing bacteria which produce the Cas12i polypeptide of the present disclosure, isolating the Cas12i polypeptide, optionally, purifying the Cas12i polypeptide, and complexing the Cas12i polypeptide with an RNA guide.
- the Cas12i polypeptide can be also prepared by (b) a known genetic engineering technique, specifically, by isolating a gene encoding the Cas12i polypeptide of the present disclosure from bacteria, constructing a recombinant expression vector, and then transferring the vector into an appropriate host cell that expresses the RNA guide for expression of a recombinant protein that complexes with the RNA guide in the host cell.
- the Cas12i polypeptide can be prepared by (c) an in vitro coupled transcription-translation system and then complexing with an RNA guide.
- a host cell is used to express the Cas12i polypeptide.
- the host cell is not particularly limited, and various known cells can be preferably used. Specific examples of the host cell include bacteria such as E. coli, yeasts (budding yeast, Saccharomyces cerevisiae, and fission yeast, Schizosaccharomyces pombe), nematodes ( Caenorhabditis elegans ), Xenopus laevis oocytes, and animal cells (for example, CHO cells, COS cells and HEK293 cells).
- the method for transferring the expression vector described above into host cells i.e., the transformation method, is not particularly limited, and known methods such as electroporation, the calcium phosphate method, the liposome method and the DEAE dextran method can be used.
- the host cells After a host is transformed with the expression vector, the host cells may be cultured, cultivated or bred, for production of the Cas12i polypeptide. After expression of the Cas12i polypeptide, the host cells can be collected and Cas12i polypeptide purified from the cultures etc. according to conventional methods (for example, filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.).
- the methods for Cas12i polypeptide expression comprises translation of at least 5 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, at least 250 amino acids, at least 300 amino acids, at least 400 amino acids, at least 500 amino acids, at least 600 amino acids, at least 700 amino acids, at least 800 amino acids, at least 900 amino acids, or at least 1000 amino acids of the Cas12i polypeptide.
- the methods for protein expression comprises translation of about 5 amino acids, about 10 amino acids, about 15 amino acids, about 20 amino acids, about 50 amino acids, about 100 amino acids, about 150 amino acids, about 200 amino acids, about 250 amino acids, about 300 amino acids, about 400 amino acids, about 500 amino acids, about 600 amino acids, about 700 amino acids, about 800 amino acids, about 900 amino acids, about 1000 amino acids or more of the Cas12i polypeptide.
- a variety of methods can be used to determine the level of production of a Cas12i polypeptide in a host cell. Such methods include, but are not limited to, for example, methods that utilize either polyclonal or monoclonal antibodies specific for the Cas12i polypeptide or a labeling tag as described elsewhere herein. Exemplary methods include, but are not limited to, enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (MA), fluorescent immunoassays (FIA), and fluorescent activated cell sorting (FACS). These and other assays are well known in the art (See, e.g., Maddox et ak, J. Exp. Med. 158:1211 [1983]).
- the present disclosure provides methods of in vivo expression of the Cas12i polypeptide in a cell, comprising providing a polyribonucleotide encoding the Cas12i polypeptide to a host cell wherein the polyribonucleotide encodes the Cas12i polypeptide, expressing the Cas12i polypeptide in the cell, and obtaining the Cas12i polypeptide from the cell.
- the present disclosure further provides methods of in vivo expression of a Cas12i polypeptide in a cell, comprising providing a polyribonucleotide encoding the Cas12i polypeptide to a host cell wherein the polyribonucleotide encodes the Cas12i polypeptide and expressing the Cas12i polypeptide in the cell.
- the polyribonucleotide encoding the Cas12i polypeptide is delivered to the cell with an RNA guide and, once expressed in the cell, the Cas12i polypeptide and the RNA guide form a complex.
- the polyribonucleotide encoding the Cas12i polypeptide and the RNA guide are delivered to the cell within a single composition. In some embodiments, the polyribonucleotide encoding the Cas12i polypeptide and the RNA guide are comprised within separate compositions. In some embodiments, the host cell is present in a subject, e.g., a human patient.
- an RNA guide targeting HAO1 is complexed with a Cas12i polypeptide to form a ribonucleoprotein.
- complexation of the RNA guide and Cas12i polypeptide occurs at a temperature lower than about any one of 20°C, 21°C, 22 °C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 50°C, or 55°C.
- the RNA guide does not dissociate from the Cas12i polypeptide at about 37°C over an incubation period of at least about any one of lOmins, 15mins, 20mins, 25mins, 30mins, 35mins, 40mins, 45mins, 50mins, 55mins, lhr, 2hr, 3hr, 4hr, or more hours.
- the RNA guide and Cas12i polypeptide are complexed in a complexation buffer.
- the Cas12i polypeptide is stored in a buffer that is replaced with a complexation buffer to form a complex with the RNA guide.
- the Cas12i polypeptide is stored in a complexation buffer.
- the complexation buffer has a pH in a range of about 7.3 to 8.6. In one embodiment, the pH of the complexation buffer is about 7.3. In one embodiment, the pH of the complexation buffer is about 7.4. In one embodiment, the pH of the complexation buffer is about 7.5. In one embodiment, the pH of the complexation buffer is about 7.6. In one embodiment, the pH of the complexation buffer is about 7.7. In one embodiment, the pH of the complexation buffer is about 7.8. In one embodiment, the pH of the complexation buffer is about 7.9. In one embodiment, the pH of the complexation buffer is about 8.0. In one embodiment, the pH of the complexation buffer is about 8.1. In one embodiment, the pH of the complexation buffer is about 8.2. In one embodiment, the pH of the complexation buffer is about 8.3. In one embodiment, the pH of the complexation buffer is about 8.4. In one embodiment, the pH of the complexation buffer is about 8.5. In one embodiment, the pH of the complexation buffer is about 8.6.
- the Cas12i polypeptide can be overexpressed and complexed with the RNA guide in a host cell prior to purification as described herein.
- mRNA or DNA encoding the Cas12i polypeptide is introduced into a cell so that the Cas12i polypeptide is expressed in the cell.
- the RNA guide is also introduced into the cell, whether simultaneously, separately, or sequentially from a single mRNA or DNA construct, such that the ribonucleoprotein complex is formed in the cell.
- the disclosure also provides methods of modifying a target site within the HAO1 gene.
- the methods comprise introducing an HAO1 -targeting RNA guide and a Cas12i polypeptide into a cell.
- the HAO1 -targeting RNA guide and Cas12i polypeptide can be introduced as a ribonucleoprotein complex into a cell.
- the HAO1 -targeting RNA guide and Cas12i polypeptide can be introduced on a nucleic acid vector.
- the Cas12i polypeptide can be introduced as an mRNA.
- the RNA guide can be introduced directly into the cell.
- the composition described herein is delivered to a cell/tis sue/liver/person to reduce HAO1 in the cell/tissue/liver/person.
- the composition described herein is delivered to a cell/tissue/liver/person to reduce oxalate production in the cell/tissue/liver/person. In some embodiments, the composition described herein is delivered to a cell/tissue/liver/person to correct calcium oxalate crystal deposition in the cell/tissue/liver/person. In some embodiments, the composition described herein is delivered to a person with primary hyperoxaluria.
- the gene editing system may comprise an RNA guide and a Cas12i2 polypeptide.
- the RNA guide comprises a spacer sequence specific to a target sequence in the HAO1 gene, e.g., specific to a region in exonl or exon 2 of the HAO1 gene.
- an RNA guide as disclosed herein is designed to be complementary to a target sequence that is adjacent to a 5’-TTN-3’ PAM sequence or 5’-NTTN- 3’ PAM sequence.
- the target sequence is within an HAO1 gene or a locus of an HAO1 gene (e.g., in exonl or exon 2), to which the RNA guide can bind via base pairing.
- a cell has only one copy of the target sequence.
- a cell has more than one copy, such as at least about any one of 2, 3, 4, 5, 10, 100, or more copies of the target sequence.
- the HAO1 gene is a mammalian gene. In some embodiments, the HAO1 gene is a human gene.
- the target sequence is within the sequence of SEQ ID NO: 928 (or the reverse complement thereof). In some embodiments, the target sequence is within an exon of the HAO1 gene set forth in SEQ ID NO: 928, e.g., within a sequence of SEQ ID NO: 929, 930, 931, 932, 933, 934, or 935 (or a reverse complement thereof).
- Target sequences within an exon region of the HAO1 gene of SEQ ID NO: 928 are set forth in Table 5.
- the target sequence is within an intron of the HAO1 gene set forth in SEQ ID NO: 928 (or the reverse complement thereof). In some embodiments, the target sequence is within a variant (e.g., a polymorphic variant) of the HAO1 gene sequence set forth in SEQ ID NO: 928 (or the reverse complement thereof). In some embodiments, the HAO1 gene sequence is a homolog of the sequence set forth in SEQ ID NO: 928 (or the reverse complement thereof). For examples, in some embodiments, the HAO1 gene sequence is a nonhuman HAO1 sequence. In some embodiments, the HAO1 gene sequence is a coding sequence set forth in SEQ ID NO: 1024 (or the reverse complement thereof). In some embodiments, the HAO1 gene sequence is a homolog of a coding sequence set forth in SEQ ID NO: 1024 (or the reverse complement thereof).
- the target sequence is adjacent to a 5’-TTN-3’ PAM sequence or a 5’-NTTN-3’ PAM sequence, wherein N is any nucleotide.
- the 5’-NTTN-3’ sequence may be immediately adjacent to the target sequence or, for example, within a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides of the target sequence.
- the 5’-NTTN-3’ sequence is 5’-NTTY-3’, 5’-NTTC-3', 5’-NTTT-3', 5’-NTTA-3', 5’-NTTB-3', 5’-NTTG-3', 5’-CTTY-3', 5’-DTTR-3’, 5’-CTTR-3’, 5’-DTTT-3’, 5’-ATTN-3’, or 5’-GTTN-3’, wherein Y is C or T, B is any nucleotide except for A, D is any nucleotide except for C, and R is A or G.
- the 5’-NTTN-3’ sequence is 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC- 3’, 5’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3', 5’-CTTT-3', 5’-CTTG-3’, or 5’-CTTC-3’.
- the PAM sequence may be 5’ to the target sequence.
- the 5’-NTTN-3’ sequence may be immediately adjacent to the target sequence or, for example, within a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides of the target sequence.
- the 5’-NTTN-3’ sequence is 5’-NTTY-3', 5’-NTTC-3', 5’-NTTT-3’, 5’- NTTA-3’, 5’-NTTB-3', 5’-NTTG-3', 5’-CTTY-3’, 5’-DTTR-3’, 5’-CTTR-3', 5’-DTTT-3’, 5’- ATTN-3’, or 5’-GTTN-3’, wherein Y is C or T, B is any nucleotide except for A, D is any nucleotide except for C, and R is A or G.
- the 5’-NTTN-3’ sequence is 5’- ATTA-3’, 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3', 5’-TTTG-3’, 5’- TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3', 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’- CTTG-3’, or 5’-CTTC-3’.
- the RNA guide is designed to bind to a first strand of a double- stranded target nucleic acid (i.e., the non-PAM strand), and the 5’-NTTN-3’ PAM sequence is present in the second, complementary strand (i.e., the PAM strand).
- the RNA guide binds to a region on the non-PAM strand that is complementary to a target sequence on the PAM strand, which is adjacent to a 5’-NAAN-3’ sequence.
- the target sequence is present in a cell. In some embodiments, the target sequence is present in the nucleus of the cell. In some embodiments, the target sequence is endogenous to the cell. In some embodiments, the target sequence is a genomic DNA. In some embodiments, the target sequence is a chromosomal DNA. In some embodiments, the target sequence is a protein-coding gene or a functional region thereof, such as a coding region, or a regulatory element, such as a promoter, enhancer, a 5' or 3' untranslated region, etc.
- the target sequence is present in a readily accessible region of the target sequence. In some embodiments, the target sequence is in an exon of a target gene. In some embodiments, the target sequence is across an exon-intron junction of a target gene. In some embodiments, the target sequence is present in a non-coding region, such as a regulatory region of a gene.
- the Cas12i polypeptide has enzymatic activity (e.g., nuclease activity). In some embodiments, the Cas12i polypeptide induces one or more DNA double- stranded breaks in the cell. In some embodiments, the Cas12i polypeptide induces one or more DNA single-stranded breaks in the cell. In some embodiments, the Cas12i polypeptide induces one or more DNA nicks in the cell. In some embodiments, DNA breaks and/or nicks result in formation of one or more indels (e.g., one or more deletions).
- an RNA guide disclosed herein forms a complex with the Cas12i polypeptide and directs the Cas12i polypeptide to a target sequence adjacent to a 5’-NTTN-3’ sequence.
- the complex induces a deletion (e.g., a nucleotide deletion or DNA deletion) adjacent to the 5’-NTTN-3’ sequence.
- the complex induces a deletion adjacent to a 5’-ATTA-3', 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3', 5’-TTTA- 3’, 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3', 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- the complex induces a deletion adjacent to a T/C-rich sequence.
- the deletion is downstream of a 5’-NTTN-3’ sequence. In some embodiments, the deletion is downstream of a 5’-ATTA-3’, 5’-ATTT-3’, 5’-ATTG-3’, 5’- ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3’, 5’- GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion is downstream of a T/C-rich sequence.
- the deletion alters expression of the HAO1 gene. In some embodiments, the deletion alters function of the HAO1 gene. In some embodiments, the deletion inactivates the HAO1 gene. In some embodiments, the deletion is a frameshifting deletion. In some embodiments, the deletion is a non-frameshifting deletion. In some embodiments, the deletion leads to cell toxicity or cell death ( e.g ., apoptosis).
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5’-NTTN-3’ sequence. In some embodiments, the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of a 5’-ATTA-3’, 5’-ATTT- 3’, 5’-ATTG-3', 5’-ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3', 5’-TTTC-3’, 5’-GTTA-3', 5’-GTTT-3', 5’-GTTG-3', 5’-GTTC-3', 5’-CTTA-3', 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion starts within about 5 to about 15 nucleot
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’- NTTN-3’ sequence. In some embodiments, the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT- 3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA- 3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence. In some embodiments, the deletion starts within about 5 to about 10 nucleotides ( e.g ., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3’, 5’- TTTA-3’, 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’-GTTT-3', 5’-GTTG-3’, 5’- GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of a T/C-rich sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5’-NTTN-3’ sequence. In some embodiments, the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a 5’-ATTA-3', 5’-ATTT-3', 5’-ATTG-3', 5’- ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3', 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3’, 5’-GTTT-3’, 5’- GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion starts within about 5 to about 10 nucleotides (e.g., about 3,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5’-NTTN-3’ sequence. In some embodiments, the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3’, 5’ -TTTA-3’, 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’-GTTT-3', 5’-GTTG-3', 5’- GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3', 5’-CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’-NTTN-3’ sequence. In some embodiments, the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a 5’-ATTA-3’, 5’-ATTT- 3’, 5’-ATTG-3', 5’-ATTC-3’, 5 ’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence. In some embodiments, the deletion ends within about 20 to about 30 nucleotides ( e.g ., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’- NTTN-3’ sequence.
- the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3', 5’-TTTA-3', 5’-TTTT- 3’, 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3', 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA- 3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a T/C-rich sequence.
- the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN-3’ sequence. In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA- 3’, 5’-TTTT-3', 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3', 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion ends within about
- the deletion ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5’-NTTN-3’ sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3’, 5’- ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’- GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3', 5’-CTTT-3’, 5’-CTTG-3', or 5’-CTTC-3’ sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (
- the deletion ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5’-NTTN- 3’ sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of a 5’- ATTA-3’, 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’- TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3', 5’-GTTG-3', 5’-GTTC-3', 5’-CTTA-3’, 5’-CTTT-3', 5’- CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (e
- the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’-NTTN-3’ sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3’, 5’- ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’- GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3', 5’-CTTT-3', 5 ’-CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleo
- the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN- 3’ sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of a 5’- ATTA-3’, 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3’, 5’- TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’- CTTG-3’, or 5’-CTTC-3’ sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’-NTTN-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a 5’-ATTA-3’, 5’-ATTT-3’, 5’- ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3’, 5’- GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5 ’-CTTG-3’, or 5’-CTTC-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nu
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g ., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a T/C-rich sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’- NTTN-3’ sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a 5’-ATTA- 3’, 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3', 5’-GTTG-3’, 5’-GTTC-3', 5’-CTTA-3', 5’-CTTT-3', 5’-CTTG-3’, or 5’-CTTC-3’ sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-ATTA- 3’, 5’-ATTT-3’, 5’-ATTG-3’,
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence and ends within about 20 to about 30 nucleotides (e.g., about
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3', 5’-TTTA-3’, 5’- TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’- CTTA-3’, 5’-CTTT-3', 5’-CTTG-3', or 5’-CTTC-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17,
- the deletion starts within about 5 to about 15 nucleotides (e.g ., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’- NTTN-3’ sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’- NTTN-3’ sequence.
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7,
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3', 5’-TTTA-3’, 5’- TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’- CTTA-3’, 5’-CTTT-3', 5’-CTTG-3', or 5’-CTTC-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a T/C-rich sequence.
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’- NTTN-3’ sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN-3’ sequence. In some embodiments, the deletion starts within about 5 to about 15 nucleotides (e.g ., about 3, 4, 5, 6, 7,
- the deletion starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’-NTTN-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3', 5’-TTTA- 3’, 5’-TTTT-3', 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3', 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a T/C-rich sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5’-NTTN-3’ sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7,
- nucleotides downstream of a 5’-ATTA-3', 5’-ATTT-3', 5’-ATTG-3', 5’- ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3’, 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3’, 5’-GTTT-3’, 5’- GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence and ends within about 20 to about 30 nucleotides ( e.g ., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
- nucleotides downstream of the 5’-ATTA-3’, 5’-ATTT-3’, 5’- ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’- GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a T/C-rich sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T/C-rich sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5’- NTTN-3’ sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3', 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3',
- the deletion starts within about 5 to about 10 nucleotides and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of a T/C-rich sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5’-NTTN-3’ sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA- 3’, 5’-TTTT-3', 5’-TTTG-3’, 5 ’-TTTC-3’, 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3', 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5’-ATTA-3', 5’-ATTT-3
- the deletion starts within about 5 to about 10 nucleotides (e.g ., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a T/C-rich sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the T/C-rich sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’- NTTN-3’ sequence. In some embodiments, the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a T/C-rich sequence.
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5’-NTTN-3’ sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a 5’-ATTA-3’, 5’-ATTT-3', 5’-ATTG-3’, 5’-ATTC-3’, 5’-TTTA- 3’, 5’-TTTT-3', 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3', 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-ATTA-3', 5’-ATTT
- the deletion starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a T/C-rich sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T/C-rich sequence.
- nucleotides e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’-NTTN-3’ sequence.
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides ( e.g ., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a T/C- rich sequence.
- nucleotides e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’-NTTN-3’ sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN-3’ sequence.
- nucleotides e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a 5’-ATTA-3’, 5’-ATTT-3’, 5’- ATTG-3’, 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’- GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3', 5’-CTTT-3', 5’-CTTG-3', or 5’-CTTC-3’ sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-ATTA-3’, 5’-ATTT- 3’, 5’-ATTG-3', 5’-ATTC
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5’- NTTN-3’ sequence.
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3', 5’-TTTA-3’, 5’-TTTT- 3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3', 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA- 3’, 5’-CTTT-3', 5’-CTTG-3', or 5’-CTTC-3’ sequence.
- nucleotides e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 10 to about 15 nucleotides (e.g ., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’-NTTN-3’ sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a 5’-ATTA-3', 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3’, 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’- GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 26,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the T/C-rich sequence.
- nucleotides e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5’- NTTN-3’ sequence.
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of a 5’-ATTA-3', 5’-ATTT-3’, 5’-ATTG-3’, 5’-ATTC-3', 5 ’-TTTA-3’, 5’-TTTT- 3’, 5’-TTTG-3’, 5’-TTTC-3’, 5’-GTTA-3’, 5’-GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA- 3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence.
- nucleotides e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27,
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5’-NTTN-3’ sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a 5’-ATTA-3', 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3’, 5’-TTTA-3’, 5’-TTTT-3', 5’-TTTG-3’, 5’-TTTC-3', 5’-GTTA-3', 5’-GTTT-3’, 5’- GTTG-3’, 5 ’-GTTC-3’, 5’-CTTA-3’, 5’-CTTT-3’, 5’-CTTG-3’, or 5’-CTTC-3’ sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
- the deletion starts within about 10 to about 15 nucleotides (e.g ., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of a T/C-rich sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T/C-rich sequence.
- the deletion is up to about 40 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
- the deletion is between about 4 nucleotides and about 40 nucleotides in length (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides).
- the deletion is between about 4 nucleotides and about 25 nucleotides in length (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides). In some embodiments, the deletion is between about 10 nucleotides and about 25 nucleotides in length (e.g., about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides). In some embodiments, the deletion is between about 10 nucleotides and about 15 nucleotides in length (e.g., about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides).
- the methods described herein are used to engineer a cell comprising a deletion as described herein in an HAO1 gene.
- the methods are carried out using a complex comprising a Cas12i enzyme as described herein and an RNA guide comprising a direct repeat and a spacer as described herein.
- the sequence of the RNA guide has at least 90% identity (e.g ., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence of any one of SEQ ID NOs: 967-1023.
- an RNA guide has a sequence of any one of SEQ ID NOs: 967-1023.
- the RNA guide targeting HAO1 is encoded in a plasmid. In some embodiments, the RNA guide targeting HAO1 is synthetic or purified RNA. In some embodiments, the Cas12i polypeptide is encoded in a plasmid. In some embodiments, the Cas12i polypeptide is encoded by an RNA that is synthetic or purified.
- Components of any of the gene editing systems disclosed herein may be formulated, for example, including a carrier, such as a carrier and/or a polymeric carrier, e.g., a liposome, and delivered by known methods to a cell (e.g., a prokaryotic, eukaryotic, plant, mammalian, etc.).
- a carrier such as a carrier and/or a polymeric carrier, e.g., a liposome
- transfection e.g., lipid-mediated, cationic polymers, calcium phosphate, dendrimers
- electroporation or other methods of membrane disruption e.g., nucleofection
- viral delivery e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)
- microinjection e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)
- microinjection e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)
- microinjection e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)
- microinjection e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)
- microinjection e.g., lentivirus, retrovirus, adenovirus,
- the method comprises delivering one or more nucleic acids (e.g., nucleic acids encoding the Cas12i polypeptide, RNA guide, donor DNA, etc.), one or more transcripts thereof, and/or a pre-formed RNA guide/Cas12i polypeptide complex to a cell, where a ternary complex is formed.
- nucleic acids e.g., nucleic acids encoding the Cas12i polypeptide, RNA guide, donor DNA, etc.
- a pre-formed RNA guide/Cas12i polypeptide complex to a cell, where a ternary complex is formed.
- an RNA guide and an RNA encoding a Cas12i polypeptide are delivered together in a single composition.
- an RNA guide and an RNA encoding a Cas12i polypeptide are delivered in separate compositions.
- an RNA guide and an RNA encoding a Cas12i polypeptide delivered in separate compositions are delivered using the same delivery technology. In some embodiments, an RNA guide and an RNA encoding a Cas12i polypeptide delivered in separate compositions are delivered using different delivery technologies.
- Exemplary intracellular delivery methods include, but are not limited to: viruses, such as AAV, or virus-like agents; chemical-based transfection methods, such as those using calcium phosphate, dendrimers, liposomes, lipid nanoparticles, or cationic polymers (e.g., DEAE-dextran or polyethylenimine); non-chemical methods, such as microinjection, electroporation, cell squeezing, sonoporation, optical transfection, impalefection, protoplast fusion, bacterial conjugation, delivery of plasmids or transposons; particle-based methods, such as using a gene gun, magnectofection or magnet assisted transfection, particle bombardment; and hybrid methods, such as nucleofection.
- viruses such as AAV, or virus-like agents
- chemical-based transfection methods such as those using calcium phosphate, dendrimers, liposomes, lipid nanoparticles, or cationic polymers (e.g., DEAE-dextran or polyethyleni
- a lipid nanoparticle comprises an mRNA encoding a Cas12i polypeptide, an RNA guide, or an mRNA encoding a Cas12i polypeptide and an RNA guide.
- the mRNA encoding the Cas12i polypeptide is a transcript of the nucleotide sequence set forth in SEQ ID NO: 921 or SEQ ID NO: 955 or a variant thereof.
- the present application further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells.
- the cell is an isolated cell.
- the cell is in cell culture or a co-culture of two or more cell types.
- the cell is ex vivo.
- the cell is obtained from a living organism and maintained in a cell culture.
- the cell is a single-cellular organism.
- the cell is a prokaryotic cell. In some embodiments, the cell is a bacterial cell or derived from a bacterial cell. In some embodiments, the cell is an archaeal cell or derived from an archaeal cell.
- the cell is a eukaryotic cell. In some embodiments, the cell is a plant cell or derived from a plant cell. In some embodiments, the cell is a fungal cell or derived from a fungal cell. In some embodiments, the cell is an animal cell or derived from an animal cell. In some embodiments, the cell is an invertebrate cell or derived from an invertebrate cell. In some embodiments, the cell is a vertebrate cell or derived from a vertebrate cell. In some embodiments, the cell is a mammalian cell or derived from a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a zebra fish cell. In some embodiments, the cell is a rodent cell. In some embodiments, the cell is synthetically made, sometimes termed an artificial cell.
- the cell is derived from a cell line.
- a wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, 293T, MF7, K562, HeLa, CHO, and transgenic varieties thereof. Cell lines are available from a variety of sources known to those with skill in the art (see, e.g., the American Type Culture Collection (ATCC) (Manassas, Va.)).
- the cell is an immortal or immortalized cell.
- the cell is a primary cell.
- the cell is a stem cell such as a totipotent stem cell (e.g., omnipotent), a pluripotent stem cell, a multipotent stem cell, an oligopotent stem cell, or an unipotent stem cell.
- the cell is an induced pluripotent stem cell (iPSC) or derived from an iPSC.
- the cell is a differentiated cell.
- the differentiated cell is a liver cell (e.g., a hepatocyte), a biliary cell (e.g., a cholangiocyte), a stellate cell, a Kupffer cell, a liver sinusoidal endothelial cell, a muscle cell (e.g., a myocyte), a fat cell (e.g., an adipocyte), a bone cell (e.g., an osteoblast, osteocyte, osteoclast), a blood cell (e.g., a monocyte, a lymphocyte, a neutrophil, an eosinophil, a basophil, a macrophage, a erythrocyte, or a platelet), a nerve cell (e.g., a neuron), an epithelial cell, an immune cell (e.g., a lymphocyte, a neutrophil, a monocyte, or a macrophage), a fibroblast, or a sex
- the cell is a terminally differentiated cell.
- the terminally differentiated cell is a neuronal cell, an adipocyte, a cardiomyocyte, a skeletal muscle cell, an epidermal cell, or a gut cell.
- the cell is an immune cell.
- the immune cell is a T cell.
- the immune cell is a B cell.
- the immune cell is a Natural Killer (NK) cell.
- the immune cell is a Tumor Infiltrating Lymphocyte (TIL).
- the cell is a mammalian cell, e.g., a human cell or a murine cell.
- the murine cell is derived from a wild-type mouse, an immunosuppressed mouse, or a disease-specific mouse model.
- the cell is a cell within a living tissue, organ, or organism.
- modified cells produced using any of the gene editing system disclosed herein is also within the scope of the present disclosure.
- modified cells may comprise a disrupted HAO1 gene.
- compositions, vectors, nucleic acids, RNA guides and cells disclosed herein may be used in therapy.
- Compositions, vectors, nucleic acids, RNA guides and cells disclosed herein may be used in methods of treating a disease or condition in a subject.
- the disease or condition is Any suitable delivery or administration method known in the art may be used to deliver compositions, vectors, nucleic acids, RNA guides and cells disclosed herein. Such methods may involve contacting a target sequence with a composition, vector, nucleic acid, or RNA guide disclosed herein. Such methods may involve a method of editing an HAO1 sequence as disclosed herein.
- a cell engineered using an RNA guide disclosed herein is used for ex vivo gene therapy.
- any of the gene editing systems or modified cells generated using such a gene editing system as disclosed herein may be used for treating a disease that is associated with the HAO1 gene, for example, primary hyperoxaluria (PH).
- PH primary hyperoxaluria
- the PH is PHI, PH2, or PH3.
- the target disease is PHI.
- PH primary hyperoxaluria
- PH is a rare genetic disorder effecting subjects of all ages from infants to elderly.
- PH includes three subtypes involving genetic defects that alter the expression of three distinct proteins.
- PHI involves alanine-glyoxylate aminotransferase, or AGT/AGT1.
- PH2 involves glyoxylate/hydroxypyruvate reductase, or GR/HPR, and
- PH3 involves 4-hydroxy-2-oxoglutarate aldolase, or HOGA.
- excess oxalate can also combine with calcium to form calcium oxalate in the kidney and other organs.
- Deposits of calcium oxalate can produce widespread deposition of calcium oxalate (nephrocalcinosis) or formation of kidney and bladder stones (urolithiasis) and lead to kidney damage.
- Common kidney complications in PHI include blood in the urine (hematuria), urinary tract infections, kidney damage, and end-stage renal disease (ESRD). Over time, kidneys in patients with PHI may begin to fail, and levels of oxalate may rise in the blood.
- oxalate in tissues throughout the body may occur due to high blood levels of oxalate and can lead to complications in bone, skin, and eye.
- Patients with PHI normally have kidney failure at an early age, with renal dialysis or dual kidney /liver organ transplant as the only treatment options.
- a method for treating a target disease as disclosed herein comprising administering to a subject (e.g., a human patient) in need of the treatment any of the gene editing systems disclosed herein.
- the gene editing system may be delivered to a specific tissue or specific type of cells where the gene edit is needed.
- the gene editing system may comprise LNPs encompassing one or more of the components, one or more vectors (e.g., viral vectors) encoding one or more of the components, or a combination thereof.
- Components of the gene editing system may be formulated to form a pharmaceutical composition, which may further comprise one or more pharmaceutically acceptable carriers.
- modified cells produced using any of the gene editing systems disclosed herein may be administered to a subject (e.g., a human patient) in need of the treatment.
- the modified cells may comprise a substitution, insertion, and/or deletion described herein.
- the modified cells may include a cell line modified by a CRISPR nuclease, reverse transcriptase polypeptide, and editing template RNA (e.g., RNA guide and RT donor RNA).
- the modified cells may be a heterogenous population comprising cells with different types of gene edits.
- the modified cells may comprise a substantially homogenous cell population (e.g., at least 80% of the cells in the whole population) comprising one particular gene edit in the HAO1 gene.
- the cells can be suspended in a suitable media.
- compositions comprising the gene editing system or components thereof.
- a composition can be a pharmaceutical composition.
- a pharmaceutical composition that is useful may be prepared, packaged, or sold in a formulation suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, intra-lesional, buccal, ophthalmic, intravenous, intra-organ or another route of administration.
- a pharmaceutical composition of the disclosure may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses.
- a “unit dose” is discrete amount of the pharmaceutical composition (e.g., the gene editing system or components thereof ), which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one- half or one-third of such a dosage.
- a pharmaceutical composition comprising the gene editing system or components thereof as described herein may be administered to a subject in need thereof, e.g., one who suffers from a liver disease associated with the HAO1 gene.
- the gene editing system or components thereof may be delivered to specific cells or tissue (e.g., to liver cells), where the gene editing system could function to genetically modify the HAO1 gene in such cells.
- a formulation of a pharmaceutical composition suitable for parenteral administration may comprise the active agent (e.g., the gene editing system or components thereof or the modified cells) combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline.
- a pharmaceutically acceptable carrier such as sterile water or sterile isotonic saline.
- Such a formulation may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration.
- Some injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative.
- Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations.
- Some formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
- the pharmaceutical composition may be in the form of a sterile injectable aqueous or oily suspension or solution.
- This suspension or solution may be formulated according to the known art, and may comprise, in addition to the cells, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
- Such sterile injectable formulation may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or saline.
- Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
- compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
- kits that can be used, for example, to carry out a method described herein for genetical modification of the HAO1 gene.
- the kits include an RNA guide and a Cas12i polypeptide.
- the kits include a polynucleotide that encodes such a Cas12i polypeptide, and optionally the polynucleotide is comprised within a vector, e.g., as described herein.
- the Cas12i polypeptide and the RNA guide e.g., as a ribonucleoprotein
- the kits can additionally include, optionally, a buffer and/or instructions for use of the RNA guide and Cas12i polypeptide.
- the kit may be useful for research purposes.
- the kit may be useful to study gene function.
- Embodiment 1 A composition comprising an RNA guide, wherein the RNA guide comprises (i) a spacer sequence that is substantially complementary or completely complementary to a region on a non-PAM strand (the complementary sequence of a target sequence) within an HAO1 gene and (ii) a direct repeat sequence; wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) comprising the sequence 5’-NTTN-3 ⁇
- PAM protospacer adjacent motif
- the target sequence may be within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the HAO1 gene.
- the HAO1 gene comprises the sequence of SEQ ID NO: 928, the reverse complement of SEQ ID NO: 928, a variant of SEQ ID NO: 928, or the reverse complement of a variant of SEQ ID NO: 928.
- the spacer sequence may comprise: (a) nucleotide 1 through nucleotide 16 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466- 920; (b) nucleotide 1 through nucleotide 17 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466-920; (c) nucleotide 1 through nucleotide 18 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466-920; (d) nucleotide 1 through nucleotide 19 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466-920; (e) nucleotide 1 through nucleotide 20 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466-920; (f) nucleotide 1 through nucleotide 21
- the spacer sequence may comprise: (a) nucleotide 1 through nucleotide 16 of any one of SEQ ID NOs: 466-920; (b) nucleotide 1 through nucleotide 17 of any one of SEQ ID NOs: 466-920; (c) nucleotide 1 through nucleotide 18 of any one of SEQ ID NOs: 466-920; (d) nucleotide 1 through nucleotide 19 of any one of SEQ ID NOs: 466-920; (e) nucleotide 1 through nucleotide 20 of any one of SEQ ID NOs: 466- 920; (f) nucleotide 1 through nucleotide 21 of any one of SEQ ID NOs: 466-920; (g) nucleotide 1 through nucleotide 22 of any one of SEQ ID NOs: 466-920; (h) nucleotide 1 through nucleotide 23 of any one
- the direct repeat sequence may comprises:
- nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8;
- nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8;
- nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8;
- nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8;
- nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8;
- nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs:
- nucleotide 9 (s) nucleotide 5 through nucleotide 34 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 9; (t) nucleotide 6 through nucleotide 34 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 9; (u) nucleotide 7 through nucleotide 34 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 9; (v) nucleotide 8 through nucleotide 34 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 9; (w) nucleotide 9 through nucleotide 34 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 9; (x) nucleotide 10 through nucleotide 34 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 9; (y) nucleotide 11 through nucleotide 34 of a sequence
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (i) nucleotide 9 through nucleo
- nucleotide 12 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (m) nucleotide 13 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (n) nucleotide 14 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (o) nucleotide 1 through nucleotide 34 of SEQ ID NO: 9; (p) nucleotide 2 through nucleotide 34 of SEQ ID NO: 9; (q) nucleotide 3 through nucleotide 34 of SEQ ID NO: 9; (r) nucleotide 4 through nucleotide 34 of SEQ ID NO: 9; (s) nucleotide 5 through nucleotide 34 of SEQ ID NO: 9; (t) nucleotide 6 through nucleotide 34 of SEQ ID NO: 9; (u) nucleotide 7 through nucleotide 34 of SEQ ID NO: 9; (v
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of a sequence
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 936
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959;
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 959; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 959; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 959; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 9
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO:
- nucleotide 962 or SEQ ID NO: 963 (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotide
- the spacer sequence is substantially complementary or completely complementary to the complement of a sequence of any one of SEQ ID NOs: 11-465.
- the PAM may comprise the sequence 5’- ATTA-3’, 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3', 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’- TTTC-3’, 5’-GTTA-3', 5’-GTTT-3', 5’-GTTG-3', 5’-GTTC-3', 5’-CTTA-3’, 5’-CTTT-3', 5’- CTTG-3’, or 5’-CTTC-3’.
- the target sequence is immediately adjacent to the PAM sequence.
- the RNA guide has a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 967-1023.
- the RNA guide has the sequence of any one of SEQ ID NOs: 967-
- Embodiment 2 The composition of Embodiment 1 may further comprise a Cas12i polypeptide or a polyribonucleotide encoding a Cas12i polypeptide, which can be one of the following: (a) a Cas12i2 polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 922, SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927; (b) a Cas12i4 polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 956, SEQ ID NO: 957, or SEQ ID NO: 958; (c) a Cas12il polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 965; or (d) a Cas12i3 polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO
- the Cas12i polypeptide is: (a) a Cas12i2 polypeptide comprising a sequence of SEQ ID NO: 922, SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927; (b) a Cas12i4 polypeptide comprising a sequence of SEQ ID NO: 956, SEQ ID NO: 957, or SEQ ID NO: 958; (c) a Cas12il polypeptide comprising a sequence of SEQ ID NO: 965; or (d) a Cas12i3 polypeptide comprising a sequence of SEQ ID NO: 966.
- the RNA guide and the Cas12i polypeptide may form a ribonucleoprotein complex.
- the ribonucleoprotein complex binds a target nucleic acid.
- the composition is present within a cell.
- the RNA guide and the Cas12i polypeptide may be encoded in a vector, e.g., expression vector.
- the RNA guide and the Cas12i polypeptide are encoded in a single vector.
- the RNA guide is encoded in a first vector and the Cas12i polypeptide is encoded in a second vector.
- Embodiment 3 A vector system comprising one or more vectors encoding an RNA guide disclosed herein and a Cas12i polypeptide.
- the vector system comprises a first vector encoding an RNA guide disclosed herein and a second vector encoding a Cas12i polypeptide.
- the vectors may be expression vectors.
- Embodiment 4 A composition comprising an RNA guide and a Cas12i polypeptide, wherein the RNA guide comprises (i) a spacer sequence that is substantially complementary or completely complementary to a region on a non-PAM strand (the complementary sequence of a target sequence) within an HAO1 gene; and (ii) a direct repeat sequence.
- the target sequence is within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the HAO1 gene, which may comprise the sequence of SEQ ID NO: 928, the reverse complement of SEQ ID NO: 928, a variant of the sequence of SEQ ID NO: 928, or the reverse complement of a variant of SEQ ID NO: 928.
- the spacer sequence comprises: (a) nucleotide 1 through nucleotide 16 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466-920;
- the spacer sequence comprises: (a) nucleotide 1 through nucleotide 16 of any one of SEQ ID NOs: 466-920; (b) nucleotide 1 through nucleotide 17 of any one of SEQ ID NOs: 466-920; (c) nucleotide 1 through nucleotide 18 of any one of SEQ ID NOs: 466-920; (d) nucleotide 1 through nucleotide 19 of any one of SEQ ID NOs: 466-920; (e) nucleotide 1 through nucleotide 20 of any one of SEQ ID NOs: 466-920; (f) nucleotide 1 through nucleotide 21 of any one of SEQ ID NOs: 466-920; (g) nucleotide 1 through nucleotide 22 of any one of SEQ ID NOs: 466-920; (h) nucleotide 1 through nucleotide 23 of any one of SEQ ID NOs: 466
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to a sequence that is at
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (i) nucleotide 9 through nucleo
- nucleotide 12 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (m) nucleotide 13 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (n) nucleotide 14 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (o) nucleotide 1 through nucleotide 34 of SEQ ID NO: 9; (p) nucleotide 2 through nucleotide 34 of SEQ ID NO: 9; (q) nucleotide 3 through nucleotide 34 of SEQ ID NO: 9; (r) nucleotide 4 through nucleotide 34 of SEQ ID NO: 9; (s) nucleotide 5 through nucleotide 34 of SEQ ID NO: 9; (t) nucleotide 6 through nucleotide 34 of SEQ ID NO: 9; (u) nucleotide 7 through nucleotide 34 of SEQ ID NO: 9; (v
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of a sequence
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 936
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959;
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 959; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 959; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 959; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 9
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO:
- nucleotide 962 or SEQ ID NO: 963 (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotide
- nucleotide 12 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963;
- nucleotide 13 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963;
- nucleotide 14 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963;
- nucleotide 15 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; or (p) SEQ ID NO: 964 or a portion thereof.
- the spacer sequence may be substantially complementary or completely complementary to the complement of a sequence of any one of SEQ ID NOs: 11-465.
- the target sequence is adjacent to a protospacer adjacent motif (PAM) comprising the sequence 5’-NTTN-3 ⁇
- PAM protospacer adjacent motif
- the PAM comprises the sequence 5’- ATTA-3’, 5’-ATTT-3', 5’-ATTG-3', 5’-ATTC-3', 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’- TTTC-3’, 5’-GTTA-3', 5’-GTTT-3', 5’-GTTG-3', 5’-GTTC-3', 5’-CTTA-3’, 5’-CTTT-3', 5’- CTTG-3’, or 5’-CTTC-3’.
- the target sequence is immediately adjacent to the PAM sequence. In some examples, the target sequence is within 1, 2, 3, 4, or 5 nucleotides of the PAM sequence.
- the Cas12i polypeptide is: (a) a Cas12i2 polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 922, SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927; (b) a Cas12i4 polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 956, SEQ ID NO: 957, or SEQ ID NO: 958; (c) a Cas12il polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 965;(or (d) a Cas12i3 polypeptide comprising a sequence that is at least 90% identical to the sequence of SEQ ID NO: 966.
- the Cas12i polypeptide is: (a) a Cas12i2 polypeptide comprising a sequence of SEQ ID NO: 922, SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927; (b) a Cas12i4 polypeptide comprising a sequence of SEQ ID NO: 956, SEQ ID NO: 957, or SEQ ID NO: 958; (c) a Cas12il polypeptide comprising a sequence of SEQ ID NO: 965; or (d) a Cas12i3 polypeptide comprising a sequence of SEQ ID NO: 966.
- the RNA guide and the Cas12i polypeptide may form a ribonucleoprotein complex.
- the ribonucleoprotein complex binds a target nucleic acid.
- the composition may be present within a cell.
- the RNA guide and the Cas12i polypeptide may be encoded in a vector, e.g., expression vector.
- the RNA guide and the Cas12i polypeptide are encoded in a single vector.
- the RNA guide is encoded in a first vector and the Cas12i polypeptide is encoded in a second vector.
- Embodiment 5 A vector system comprising one or more vectors encoding an RNA guide disclosed herein and a Cas12i polypeptide.
- the vector system comprises a first vector encoding an RNA guide disclosed herein and a second vector encoding a Cas12i polypeptide.
- the vectors are expression vectors.
- Embodiment 6 An RNA guide comprising (i) a spacer sequence that is substantially complementary or completely complementary to a region on a non-PAM strand (the complementary sequence of a target sequence) within an HAO1 gene, and (ii) a direct repeat sequence.
- the target sequence is within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the HAO1 gene, which may comprise the sequence of SEQ ID NO: 928, the reverse complement of SEQ ID NO: 928, a variant of the sequence of SEQ ID NO: 928, or the reverse complement of a variant of SEQ ID NO: 928.
- the spacer sequence comprises: (a) nucleotide 1 through nucleotide 16 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 466-920;
- the spacer sequence comprises: (a) nucleotide 1 through nucleotide 16 of any one of SEQ ID NOs: 466-920; (b) nucleotide 1 through nucleotide 17 of any one of SEQ ID NOs: 466-920; (c) nucleotide 1 through nucleotide 18 of any one of SEQ ID NOs: 466-920; (d) nucleotide 1 through nucleotide 19 of any one of SEQ ID NOs: 466-920; (e) nucleotide 1 through nucleotide 20 of any one of SEQ ID NOs: 466-920; (f) nucleotide 1 through nucleotide 21 of any one of SEQ ID NOs: 466-920; (g) nucleotide 1 through nucleotide 22 of any one of SEQ ID NOs: 466-920; (h) nucleotide 1 through nucleotide 23 of any one of SEQ ID NOs: 466
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to a sequence that is at
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (i) nucleotide 9 through nucleo
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of a sequence
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 936
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959;
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 959; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 959; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 959; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 9
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO:
- nucleotide 962 or SEQ ID NO: 963 (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotide
- the spacer sequence may be substantially complementary or completely complementary to the complement of a sequence of any one of SEQ ID NOs: 11-465.
- the target sequence may be adjacent to a protospacer adjacent motif (PAM) comprising the sequence 5’-NTTN-3', wherein N is any nucleotide.
- PAM comprises the sequence 5’-ATTA-3', 5’-ATTT-3’, 5’- ATTG-3’, 5’-ATTC-3 ', 5’-TTTA-3', 5’-TTTT-3', 5’-TTTG-3', 5’-TTTC-3', 5’-GTTA-3’, 5’- GTTT-3’, 5’-GTTG-3’, 5’-GTTC-3’, 5’-CTTA-3', 5’-CTTT-3', 5’-CTTG-3', or 5’-CTTC-3’.
- the target sequence is immediately adjacent to the PAM sequence. In other examples, the target sequence is within 1, 2, 3, 4, or 5 nucleotides of the PAM sequence.
- the RNA guide has a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 967-1023. In some specific examples, the RNA guide has the sequence of any one of SEQ ID NOs: 967-1023.
- Embodiment 7 A nucleic acid encoding an RNA guide as described herein.
- Embodiment 8 A vector comprising an RNA guide as described herein.
- Embodiment 9 A cell comprising a composition, an RNA guide, a nucleic acid, or a vector as described herein.
- the cell is a eukaryotic cell, an animal cell, a mammalian cell, a human cell, a primary cell, a cell line, a stem cell, or a hepatocyte.
- Embodiment 10 A kit comprising a composition, an RNA guide, a nucleic acid, or a vector as described herein.
- Embodiment 11 A method of editing an HAO1 sequence, the method comprising contacting an HAO1 sequence with a composition or an RNA guide as described herein. In some examples, the method is carried out in vitro. In other examples, the method is carried out ex vivo.
- the HAO1 sequence is in a cell.
- the composition or the RNA guide induces a deletion in the HAO1 sequence.
- the deletion is adjacent to a 5’-NTTN-3’ sequence, wherein N is any nucleotide.
- the deletion is downstream of the 5’-NTTN-3’ sequence.
- the deletion is up to about 40 nucleotides in length. In some instances, the deletion is from about 4 nucleotides to 40 nucleotides, about 4 nucleotides to 25 nucleotides, about 10 nucleotides to 25 nucleotides, or about 10 nucleotides to 15 nucleotides in length.
- the deletion starts within about 5 nucleotides to about 15 nucleotides, about 5 nucleotides to about 10 nucleotides, or about 10 nucleotides to about 15 nucleotides of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 15 nucleotides, about 5 nucleotides to about 10 nucleotides, or about 10 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion ends within about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 25 nucleotides, or about 25 nucleotides to about 30 nucleotides of the 5’-NTTN-3’ sequence. In some examples, the deletion ends within about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 25 nucleotides, about 25 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 nucleotides to about 25 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 25 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 10 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 10 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 nucleotides to about 25 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 5 nucleotides to about 10 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 25 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 10 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 10 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 20 nucleotides to about 25 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the deletion starts within about 10 nucleotides to about 15 nucleotides downstream of the 5’-NTTN-3’ sequence and ends within about 25 nucleotides to about 30 nucleotides downstream of the 5’-NTTN-3’ sequence.
- the 5’-NTTN-3’ sequence is 5’-CTTT-3', 5’-CTTC-3', 5’-GTTT-3', 5’-GTTC-3', 5’-TTTC-3', 5’-GTTA-3', or 5’-GTTG-3 ⁇
- the deletion overlaps with a mutation in the HAO1 sequence. In some instances, the deletion overlaps with an insertion in the HAO1 sequence. In some instances, the deletion removes a repeat expansion of the HAO1 sequence or a portion thereof. In some instances, the deletion disrupts one or both alleles of the HAO1 sequence.
- the RNA guide may comprise the sequence of any one of SEQ ID NOs: 967-1023.
- Embodiment 12 A method of treating primary hyperoxaluria (PH), which optionally is PHI, PH2, or PH3, in a subject, the method comprising administering any of the compositions, RNAs, or cells as described herein to the subject.
- PH primary hyperoxaluria
- the RNA guide and/or the polyribonucleotide encoding the Cas12i polypeptide may be comprised within a lipid nanoparticle. In some examples, the RNA guide and the polyribonucleotide encoding the Cas12i polypeptide are comprised within the same lipid nanoparticle. In other examples, the RNA guide and the polyribonucleotide encoding the Cas12i polypeptide are comprised within separate lipid nanoparticles.
- Embodiment 13 An RNA guide comprising (i) a spacer sequence that is complementary to a target site within an HAO1 gene (the target site being on the non-PAM strand and complementary to a target sequence), and (ii) a direct repeat sequence, wherein the target sequence is any one of SEQ ID NOs: 1047, 1026, or 1025 or the reverse complement thereof.
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to a sequence that is at
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (i) nucleotide 9 through nucleo
- nucleotide 12 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (m) nucleotide 13 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (n) nucleotide 14 through nucleotide 36 of any one of SEQ ID NOs: 1-8; (o) nucleotide 1 through nucleotide 34 of SEQ ID NO: 9; (p) nucleotide 2 through nucleotide 34 of SEQ ID NO: 9; (q) nucleotide 3 through nucleotide 34 of SEQ ID NO: 9; (r) nucleotide 4 through nucleotide 34 of SEQ ID NO: 9; (s) nucleotide 5 through nucleotide 34 of SEQ ID NO: 9; (t) nucleotide 6 through nucleotide 34 of SEQ ID NO: 9; (u) nucleotide 7 through nucleotide 34 of SEQ ID NO: 9; (v
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of a sequence
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 through nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) nucleotide 8 through nucleotide 36 of any one of SEQ ID NOs: 936
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of a sequence that is at least 90% identical to SEQ ID NO: 959;
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 959; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 959; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO: 959; (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 959; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 959; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 959; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 959; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 959; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 959; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 9
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (d) nucleotide 4 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of a sequence that is at least 90% identical to a sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through
- the direct repeat sequence comprises: (a) nucleotide 1 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (b) nucleotide 2 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (c) nucleotide 3 through nucleotide 36 of SEQ ID NO:
- nucleotide 962 or SEQ ID NO: 963 (d) nucleotide 4 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (e) nucleotide 5 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (f) nucleotide 6 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (g) nucleotide 7 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (h) nucleotide 8 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (i) nucleotide 9 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotide 10 through nucleotide 36 of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotide
- the RNA guide has a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 989, 968, or 967. In some specific examples, the RNA guide has the sequence of any one of SEQ ID NOs: 989, 968, or 967.
- each of the first three nucleotides of the RNA guide comprises a T-O- methyl phosphorothioate modification.
- each of the last four nucleotides of the RNA guide comprises a ⁇ -O- methyl phosphorothioate modification.
- each of the first to last, second to last, and third to last nucleotides of the RNA guide comprises a 2’-O-methyl phosphorothioate modification, and wherein the last nucleotide of the RNA guide is unmodified.
- the RNA guide has a sequence that is at least 90% identical to a sequence of any one of SEQ ID NOs: 1082-1087. In some specific examples, the RNA guide has a sequence of any one of SEQ ID NOs: 1082-1087.
- an HAO1 -targeting RNA guide comprises at least 90% identity to any one of SEQ ID NOs: 1082-1087. In some embodiments, an HAO1 -targeting RNA guide comprises any one of SEQ ID NOs: 1082-1087. In some embodiments, an HAO1 -targeting RNA guide comprising at least 90% identity to SEQ ID NO: 1083 or SEQ ID NO: 1084 binds the complementary region of HAO1 target sequence of SEQ ID NO: 1047 via base-pairing. In some embodiments, the HAO1 -targeting RNA guide of SEQ ID NO: 1083 or SEQ ID NO: 1084 binds the complementary region of HAO1 target sequence of SEQ ID NO: 1047 via base-pairing.
- an HAO1 -targeting RNA guide comprising at least 90% identity to SEQ ID NO: 1085 or SEQ ID NO: 1086 binds the complementary region of HAO1 target sequence of SEQ ID NO: 1026 via base-pairing. In some embodiments, the HAO1 -targeting RNA guide of SEQ ID NO: 1085 or SEQ ID NO: 1086 binds the complementary region of HAO1 target sequence of SEQ ID NO: 1026 via base-pairing. In some embodiments, an HAO1 -targeting RNA guide comprising at least 90% identity to SEQ ID NO: 1087 or SEQ ID NO: 2293 binds the complementary region of HAO1 target sequence of SEQ ID NO: 1025 via base-pairing. In some embodiments, the HAO1 -targeting RNA guide of SEQ ID NO: 1087 or SEQ ID NO: 2293 binds the complementary region of HAO1 target sequence of SEQ ID NO: 1025 via base-pairing.
- Embodiment 14 A nucleic acid encoding the RNA guide of Embodiment 13 as described herein.
- Embodiment 15 A vector comprising the nucleic acid of Embodiment 14 as described herein.
- Embodiment 16 A vector system comprising one or more vectors encoding (i) the RNA guide of Embodiment 13 as described herein, and (ii) a Cas12i polypeptide.
- the vector system comprises a first vector encoding the RNA guide and a second vector encoding the Cas12i polypeptide.
- Embodiment 17 A cell comprising the RNA guide, the nucleic acid, the vector, or the vector system of Embodiments 13-16 as described herein.
- the cell is a eukaryotic cell, an animal cell, a mammalian cell, a human cell, a primary cell, a cell line, a stem cell, or a T cell.
- Embodiment 18 A kit comprising the RNA guide, the nucleic acid, the vector, or the vector system of Embodiments 13-16 as described herein.
- Embodiment 19 A method of editing an HAO1 sequence, the method comprising contacting an HAO1 sequence with the RNA guide of Embodiment 13 as described herein.
- the HAO1 sequence is in a cell.
- the RNA guide induces an indel (e.g ., an insertion or deletion) in the HAO1 sequence.
- Embodiment 20 A method of treating primary hyperoxaluria (PH), which optionally is PHI, PH2, or PH3, in a subject, the method comprising administering the RNA guide of Embodiment 12 as described herein to the subject.
- PH primary hyperoxaluria
- This Example describes the genomic editing of the HAO1 gene using Cas12i2 introduced into HEK293T cells.
- Cas12i2 RNA guides (crRNAs) were designed and ordered from Integrated DNA Technologies (IDT).
- IDCT Integrated DNA Technologies
- target sequences were designed by tiling the coding exons of HAO1 for 5’-NTTN-3’ PAM sequences, and then spacer sequences were designed for the 20-bp target sequences downstream of the PAM sequence.
- the HAO1 -targeting RNA guide sequences are shown in Table 7. In the figures, “E#T#” can also be represented as “exon # target #.”
- Cas12i2 RNP complexation reactions were made by mixing purified Cas12i2 polypeptide of SEQ ID NO: 924 (400 mM) with an HAO1 -targeting crRNA (1 mM in 250 mM NaCl) at a 1:1 (Cas12i2:crRNA) volume ratio (2.5:1 crRNA:Cas12i2 molar ratio). Complexations were incubated on ice for 30-60 min.
- HEK293T cells were harvested using TRYPLETM (recombinant cell-dissociation enzymes; ThermoFisher) and counted. Cells were washed once with PBS and resuspended in SF buffer + supplement (SF CELL LINE 4D-NUCLEOFECTORTM X KIT S; Lonza #V4XC-2032) at a concentration of 16,480 cells/pL. Resuspended cells were dispensed at 3 xlO 5 cells/reaction into Lonza 16-well NUCLEOCUVETTE® strips.
- 4D-NUCLEOFECTORTM 4D-NUCLEOFECTORTM.
- 80 pL of pre-warmed DMEM + 10% FBS was added to each well and mixed gently by pipetting.
- NGS Next Generation Sequencing
- the indel mapping function used a sample’s fastq file, the amplicon reference sequence, and the forward primer sequence.
- a kmer-scanning algorithm was used to calculate the edit operations (match, mismatch, insertion, deletion) between the read and the reference sequence.
- the first 30 nt of each read was required to match the reference and reads where over half of the mapping nucleotides are mismatches were filtered out as well.
- Up to 50,000 reads passing those filters were used for analysis, and reads were counted as an indel read if they contained an insertion or deletion.
- the % indels was calculated as the number of indel- containing reads divided by the number of reads analyzed (reads passing filters up to 50,000).
- the QC standard for the minimum number of reads passing filters was 10,000.
- FIG. 1 shows HAO1 indels in HEK293T cells following RNP delivery. Error bars represent the average of three technical replicates across one biological replicate. Following delivery, indels were detected within and/or adjacent to each of the HAO1 target sites with each of the RNA guides. Delivery of E1T2, E1T3, E1T6, E1T7, E1T13, T1T17, E2T4, E2T5, E2T9, E2T10, E3T6, E3T19, E3T22, and E3T28 resulted in indels in over 70% of the NGS reads. Therefore, HAO1 -targeting RNA guides induced indels in exon 1, exon 2, and exon 3 in HEK293T cells.
- HAO1 can be individually targeted by Cas12i2 RNPs in mammalian cells such as HEK293T cells.
- This Example describes the genomic editing of the HAO1 gene using Cas12i2 introduced into HepG2 cells by RNP.
- RNP complexation reactions were performed as described in Example 1 with various RNA guides of Table 7.
- HepG2 cells were harvested using TRYPLETM (recombinant cell- dissociation enzymes; ThermoFisher) and counted.
- Cells were washed once with PBS and resuspended in SF buffer + supplement (SF CEFF FINE 4D-NUCFEOFECTORTM X KIT S; Fonza #V4XC-2032) at a concentration of 13,889 cells/pF.
- Resuspended cells were dispensed at 2.5e5 cells/reaction into Fonza 16-well NUCFEOCUVETTE® strips.
- the strips were electroporated using an electroporation device (program DJ-100, Fonza 4D-NUCFEOFECTORTM). Immediately following electroporation, 80 pF of pre-warmed EMEM + 10% FBS was added to each well and mixed gently by pipetting. For each technical replicate plate, plated 10 pF (25,000 cells) of diluted nucleofected cells into pre-warmed 96-well plate with wells containing 100 pF EMEM + 10% FBS. Editing plates were incubated for 3 days at 37°C with 5% C0 2 .
- FIG. 2 shows HAO1 indels in HepG2 cells following RNP delivery. Error bars represent the average of three technical replicates across one biological replicate. Following delivery, indels were detected within and/or adjacent to each of the HAO1 target sites with each of the RNA guides. Therefore, HAO1 -targeting RNA guides induced indels in exon 1, exon 2, and exon 3 in HepG2 cells.
- HAO1 can be targeted by Cas12i2 RNPs in mammalian cells such as HepG2 cells.
- This Example describes the genomic editing of the HAO1 using Cas12i2 introduced into primary hepatocytes cells by RNP.
- RNP complexation reactions were performed as described in Example 1 with RNA guides of Table 7.
- Primary hepatocyte cells from human donors were thawed from liquid nitrogen very quickly in a 37°C water bath. The cells were added to pre-warmed hepatocyte recovery media (Thermo fisher, CM7000) and centrifuged at lOOg for 10 minutes. The cell pellet was resuspended in appropriate volume of hepatocyte plating Medium (Williams’ Medium E, Thermofisher A1217601 supplemented with Hepatocyte Plating Supplement Pack (serum- containing), Thermofisher CM3000).
- the cells were subjected to trypan blue viability count with an INCUCYTE® disposable hemocytometer (Fisher scientific, 22-600-100). The cells were then washed in PBS and resuspended in P3 buffer + supplement (P3 PRIMARY CELL 4D- NUCLEOFECTORTM X Kit;Lonza, VXP-3032) at a concentration of -7,500 cells/pL. Resuspended cells were dispensed at 150,000 cells/reaction into the 16 well Lonza NUCLEOCUVETTE strips or 500,000 cells/reaction into the single Lonza NUCLEOCUVETTES® for the mRNA readout.
- Complexed Cas12i2 RNP was added to each reaction at a final concentration of 20 mM (Cas12i2), and transfection enhancer oligos were then added at a final concentration of 4 mM.
- the final volume of each electroporated reaction was either 20 pL in the 16 well nucleocuvette strip format or 100 pL in the single nucleocuvette format. Non-targeting guides were used as negative controls.
- the strips were electroporated using DS-150 program, while the single nucleocuvettes were electroporated using CA137 program (Lonza 4D-NUCLEOFECTORTM).
- pre-warmed Hepatocyte plating medium was added to each well and mixed very gently by pipetting.
- the media was changed to hepatocyte maintenance media (Williams’ Medium E, Thermofisher A 1217601 supplemented with William’s E medium Cell Maintenance Cocktail, Thermofisher CM 4000) after the cells attached after 4 hours. Fresh hepatocyte maintenance media was replaced after 2 days.
- RNA readout For the mRNA readout, cell pellets were frozen at -80°C and subsequently resuspended in lysis buffer and DNA/RNA extracted with the RNeasy kit (Qiagen) following manufacturer’s instructions. The DNA extracted from the samples were analyzed by NGS. The RNA isolated was checked for quantity and purity using nanodrop, and subsequently used for cDNA synthesis using 5x iScript reverse transcription reaction mix (Bio-Rad laboratories), following manufacturer’s recommendations. cDNA templated was appropriately diluted to be in linear range of the subsequent analysis.
- Diluted cDNA was used to set up a 20 pL Digital Droplet PCR (ddPCR- BioRad laboratories) reaction using target- specific primer and probe for HAO1, ATTGTGCACTGTCAGATCTTGGAAACGGCCAAAGGATTTTTCCTCACCAATGTCTTG TCGATGACTTTCACATTCTGGCACCCACTCAGAGCCATGGCCAACCGGAATTCTTCC TTTAGTAT (SEQ ID NO: 1088), and 2x ddPCR Supermix for Probes No dUTP (BioRad laboratories) following manufacturer’s instructions.
- the reaction was used to generate droplets using Automated Droplet Generator (BioRad Laboratories), following manufacture’s recommendations.
- the plate was sealed using PX1 PCR Plate Sealer (BioRad Laboratories) generated droplets were subjected to PCR amplification using C1000 Touch Thermal Cycler (BioRad Laboratories) using conditions recommended by the manufacturer.
- the PCR amplified droplets were read on QX200 Droplet Reader (BioRad Laboratories) and the acquired data was analyzed using QX Manager version 1.2 (BioRad Laboratories) to determine presence of absolute copy number of mRNA present in each reaction for the appropriate targets.
- each RNA guide tested induced indels within and/or adjacent to the HAO1 target sites. Indels were not induced with the non-targeting control. Therefore, HAO1- targeting RNA guides induced indels in primary hepatocytes. Indels were then correlated with mRNA levels for each target to determine whether indels lead to mRNA knockdown and subsequent protein knockdown.
- FIG. 4 shows %mRNA knockdown of HAO1 in edited cells compared to unedited control cells.
- HAO1 E2T4 resulted in a greater knockdown of HAO1 mRNA.
- Example 4 Editing of HAO1 Target Sites in HepG2 Cells with Cas12i2 Variants
- This Example describes indel assessment on HAO1 targets using variants introduced into HepG2 cells by transient transfection.
- the Cas12i2 variants of SEQ ID NO: 924 and SEQ ID NO: 927 were individually cloned into a pcda3.1 backbone (Invitrogen). Nucleic acids encoding RNA guides E1T2 (SEQ ID NO: 967), E1T3 (SEQ ID NO: 968), E2T4 (SEQ ID NO: 988), E2T5 (SEQ ID NO: 989), E2T10 (SEQ ID NO: 994) were cloned into a pUC19 backbone (New England Biolabs). The plasmids were then maxi-prepped and diluted.
- HepG2 cells were harvested using TRYPLETM (recombinant cell-dissociation enzymes; ThermoFisher) and counted. Cells were washed once with PBS and resuspended in SF buffer + supplement (SF CELL LINE 4D-NUCLEOFECTORTM X KIT S; Lonza #V4XC-2032).
- TRYPLETM recombinant cell-dissociation enzymes
- 25,000 HepG2 cells in EMEM/10%FBS were plated into each well of a 96-well plate. On the day of transfection, the cells were 70-90% confluent.
- a mixture of LipofectamineTM 3000 and Opti-MEM® was prepared and then incubated at room temperature for 5 minutes (Solution 1). After incubation, the lipofectamineTM:OptiMEM® mixture was added to a separate mixture containing nuclease plasmid and RNA guide plasmid and P3000 reagent (Solution 2). In the case of negative controls, the crRNA was not included in Solution 2.
- the Solution 1 and Solution 2 were mixed by pipetting up and down and then incubated at room temperature for 15 minutes. Following incubation, the Solution 1 and Solution 2 mixture was added dropwise to each well of a 96 well plate containing the cells.
- FIG. 5A shows the indel size frequency (left) and indel start position relative to the PAM for E1T3 and the variant Cas12i2 of SEQ ID NO: 924.
- deletions ranged in size from 1 nucleotide to about 40 nucleotides. The majority of the deletions were about 6 nucleotides to about 27 nucleotides in length.
- the target sequence is represented as starting at position 0 and ending at position 20.
- Indels started within about 10 nucleotides and about 35 nucleotides downstream of the PAM sequence.
- the majority of indels started near the end of the target sequence, e.g., about 18 nucleotides to about 25 nucleotides downstream of the PAM sequence.
- this Example shows that HAO1 is capable of being targeted by multiple Cas12i2 polypeptides.
- Example 5 Editing of HAO1 in Primary Human Hepatocvtes Using Cas12i2 mRNA Constructs
- This Example describes indel assessment on HAO1 target sites via delivery of Cas12i2 mRNA and chemically modified HAO1 -targeting RNA guides.
- mRNA sequences corresponding to the variant Cas12i2 sequence of SEQ ID NO: 924 and the variant Cas12i2 sequence of SEQ ID NO: 927 were synthesized by Aldeveron with 1- pseudo-U modified nucleotides and using CleanCap® Reagent AG (TriLink Biotechnologies).
- the Cas12i2 mRNA sequences, shown in Table 8, further comprised a C-terminal NLS.
- Cas 12i2 RNA guides were designed and ordered from Integrated DNA Technologies (IDT) as having 3’ end modified phosphorothioated 2' O-methyl bases or 5’ end and 3’ end modified phosphorothioated 2' O-methyl bases guides, as specified in Table 9.
- IDTT Integrated DNA Technologies
- Each variant Cas12i2 mRNA was mixed with a crRNA at a 1:1 (Cas12i2:crRNA) volume ratio (1050:1 crRNA:Cas12i2 molar ratio). The mRNA and crRNA were mixed immediately before electroporation.
- the primary human hepatocyte cells were cultured and electroporated as described in Example 3.
- FIG. 6 shows editing of an HAO1 target site by a variant Cas12i2 mRNA and 3’ end modified E2T5 (SEQ ID NO: 1091) or 5’ and 3’ end modified E2T5 (SEQ ID NO: 1092).
- Indels in the HAO1 target site were introduced following electroporation of the Cas12i2 mRNA of SEQ ID NO: 1089 or SEQ ID NO: 1090 and either the RNA guide of SEQ ID NO: 1091 or SEQ ID NO: 1092.
- Approximately 50% NGS reads comprised an indel following electroporation of the Cas12i2 mRNA of SEQ ID NO: 1090 and the RNA guide of SEQ ID NO: 1091 or SEQ ID NO: 1092.
- This Example thus shows that HAO1 can be targeted by Cas12i2 mRNA constructs and chemically modified RNA guides in mammalian cells.
- This Example describes on-target versus off-target assessment of a Cas12i2 variant and an HAO1 -targeting RNA guide.
- HEK293T cells were transfected with a plasmid encoding the variant Cas12i2 of SEQ ID NO: 924 or the variant Cas12i2 of SEQ ID NO: 927 and a plasmid encoding E2T5 (SEQ ID NO: 989), E1T2 (SEQ ID NO: 967), E1T3 (SEQ ID NO: 968), and E2T10 (SEQ ID NO: 994) according to the method described in Example 16 of PCT/US21/25257.
- the tagmentation-based tag integration site sequencing (TTISS) method described in Example 16 of PCT/US21/25257 was then carried out.
- FIG. 7A and FIG. 7B show plots depicting on-target and off-target TTISS reads.
- the black wedge and centered number represent the fraction of on-target TTISS reads.
- Each grey wedge represents a unique off-target site identified by TTISS.
- the size of each grey wedge represents the fraction of TTISS reads mapping to a given off-target site.
- FIG. 7A shows TTISS reads for variant Cas12i2 of SEQ ID NO: 924
- FIG. 7B shows TTISS reads for variant Cas12i2 of SEQ ID NO: 927.
- variant Cas12i2 of SEQ ID NO: 924 paired with E2T5 demonstrated a low likelihood of off-target editing, as 100% of TTISS reads mapped to the on- target. No TTISS reads mapped to potential off-target sites. E1T2 also showed a low likelihood of off-target editing. For E1T2, 98% of TTISS reads mapped to the on-target, and two potential off-target sites represented a combined 2% of TTISS reads. For E5T10, 95% of TTISS reads mapped to the on-target, and two potential off-target sites represented a combined 5% of TTISS reads. E2T10 demonstrated a higher likelihood of off-target editing using the TTISS method.
- variant Cas12i2 of SEQ ID NO: 927 paired with E2T5 demonstrated a low likelihood of off-target editing, as 100% of TTISS reads mapped to the on- target. No TTISS reads mapped to potential off-target sites.
- variant Cas12i2 of SEQ ID NO: 927 paired with the E1T2 or E1T3 also demonstrated a low likelihood of off-target editing.
- compositions comprising Cas12i2 and HAO1- targeting RNA guides comprise different off-target activity profiles.
- This Example describes use of a Western Blot to identify knockdown of HAO1 protein using variant Cas12i2 of SEQ ID NO: 924 and HAO1 -targeting RNA guides.
- hepatocyte cells Primary hepatocyte cells from human donors were thawed from liquid nitrogen very quickly in a 37°C water bath. The cells were added to pre-warmed hepatocyte recovery media (Thermo Fisher, CM7000) and centrifuged at 100g for 10 minutes. The cell pellet was resuspended in appropriate volume of hepatocyte plating Medium (Williams’ Medium E,
- the cells were subjected to trypan blue viability count with an Inucyte disposable hemocytometer (Fisher scientific, 22-600-100).
- the cells were then washed in PBS and resuspended in P3 buffer + supplement (Lonza, VXP-3032) at a concentration of -5000 cells/ ⁇ L. Resuspended cells were dispensed at 500,000 cells/reaction into Lonza electroporation cuvettes
- E2T5 (SEQ ID NO: 989) was used as the HAO1 -targeting RNA guides.
- RNPs were added to each reaction at a final concentration of 20 mM (Cas12i2), and transfection enhancer oligos were then added at a final concentration of 4 mM.
- Unelectroporated cells and cells electroporated without cargo were used as negative controls.
- the strips were electroporated using an electroporation device (program CA137, Lonza 4D-nucleofector). Immediately following electroporation, pre-warmed Hepatocyte plating medium was added to each well and mixed very gently by pipetting. For each technical replicate plate, 500,000 cells of diluted nucleofected cells were plated into a pre-warmed collagen-coated 24-well plate (Thermo Fisher) with wells containing Hepatocyte plating medium. The cells were then incubated at 37°C. The media was changed to hepatocyte maintenance media (Williams’ Medium E, Thermo Fisher A1217601 supplemented with William’s E medium Cell Maintenance Cocktail, Thermo Fisher CM 4000) after the cells attached after 24 hours. Fresh hepatocyte maintenance media was replaced every 48 hours.
- electroporation device program CA137, Lonza 4D-nucleofector
- Samples were run on a 4-15% TGX gel (BioRad 5671084) at 200V for 45 minutes. Samples were transferred to a 0.2um nitrocellulose membrane (BioRad 1704159) using the Trans Blot Turbo System. The membrane was blocked in Intercept TBS Blocking Buffer (Li-cor 927-60001) for 30 minutes at room temperature. The blot was then incubated in a 1:1000 dilution of primary anti-HAO1 antibody (Genetex GTX81144) and 1:2500 dilution of primary anti-vinculin antibody (Sigma V9131) in blocking buffer at 4C overnight.
- the blot was washed three times with TBST (ThermoFisher 28360) for 5 minutes each, then incubated with a 1:12500 dilution of IR680 antimouse (ThermoFisher PI35518) and IR800 anti-rabbit secondary antibodies (ThermoFisher PISA535571) in TBST for 1 hour at room temperature. The blot was then washed three times with TBST for 5 minutes each and visualized on the Li-cor Odyssey CLX.
- HAO1 knockdown was observed in primary human hepatocytes at Day 7 post editing by Cas12i2 RNPs targeting the HAO1 gene with E2T5 (lanes 1-3 of FIG. 8). HAO1 knockdown was not observed for the buffer only controls (lanes 4-7).
- inventive embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed.
- inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
- a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
- the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
- This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified.
- “at least one of A and B” can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
- the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3222159A CA3222159A1 (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof |
| KR1020247000358A KR20240034746A (ko) | 2021-06-04 | 2022-06-03 | 하이드록시산 산화효소 1(hao1)을 표적으로 하는 rna 가이드를 포함하는 유전자 편집 시스템 및 이의 용도 |
| AU2022283922A AU2022283922A1 (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof |
| MX2023014406A MX2023014406A (es) | 2021-06-04 | 2022-06-03 | Sistemas de edición de genes que comprenden un arn guía dirigido a hidroxiácido oxidasa 1 (hao1) y usos de estos. |
| IL308803A IL308803A (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising guide RNA targeting hydroxy acid oxidase 1 (HAO1) and uses thereof |
| CN202280052114.3A CN117897485A (zh) | 2021-06-04 | 2022-06-03 | 包括靶向羟基酸氧化酶1(hao1)的rna向导的基因编辑系统和其用途 |
| US18/565,575 US20240254494A1 (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof |
| EP22747156.2A EP4347833A2 (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof |
| PH1/2023/553297A PH12023553297A1 (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof |
| JP2023574534A JP2024520691A (ja) | 2021-06-04 | 2022-06-03 | ヒドロキシ酸オキシダーゼ1(hao1)を標的とするrnaガイドを含む遺伝子編集システム及びそれらの使用 |
| TW111120922A TW202317763A (zh) | 2021-06-04 | 2022-06-06 | 包含靶向羥基酸氧化酶1(hao1)的rna指導物的基因編輯系統及其用途 |
| CONC2023/0018656A CO2023018656A2 (es) | 2021-06-04 | 2023-12-29 | Sistemas de edición de genes que comprenden un arn guía dirigido a hidroxiácido oxidasa 1 (hao1) y usos de estos |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163197073P | 2021-06-04 | 2021-06-04 | |
| US63/197,073 | 2021-06-04 | ||
| US202163225046P | 2021-07-23 | 2021-07-23 | |
| US63/225,046 | 2021-07-23 | ||
| US202163292889P | 2021-12-22 | 2021-12-22 | |
| US63/292,889 | 2021-12-22 | ||
| US202263300727P | 2022-01-19 | 2022-01-19 | |
| US63/300,727 | 2022-01-19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2022256642A2 true WO2022256642A2 (en) | 2022-12-08 |
| WO2022256642A3 WO2022256642A3 (en) | 2023-01-12 |
Family
ID=82694238
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/032144 Ceased WO2022256642A2 (en) | 2021-06-04 | 2022-06-03 | Gene editing systems comprising an rna guide targeting hydroxyacid oxidase 1 (hao1) and uses thereof |
Country Status (12)
| Country | Link |
|---|---|
| US (3) | US20230032141A1 (https=) |
| EP (1) | EP4347833A2 (https=) |
| JP (1) | JP2024520691A (https=) |
| KR (1) | KR20240034746A (https=) |
| AU (1) | AU2022283922A1 (https=) |
| CA (1) | CA3222159A1 (https=) |
| CO (1) | CO2023018656A2 (https=) |
| IL (1) | IL308803A (https=) |
| MX (1) | MX2023014406A (https=) |
| PH (1) | PH12023553297A1 (https=) |
| TW (1) | TW202317763A (https=) |
| WO (1) | WO2022256642A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024230842A1 (zh) * | 2023-05-11 | 2024-11-14 | 尧唐(上海)生物科技有限公司 | 一种Cas蛋白、其相应的基因编辑系统及应用 |
| WO2025147604A1 (en) | 2024-01-05 | 2025-07-10 | Arbor Biotechnologies, Inc. | Methods for treating primary hyperoxaluria via genetic editing of hydroxyacid oxidase 1 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019178427A1 (en) | 2018-03-14 | 2019-09-19 | Arbor Biotechnologies, Inc. | Novel crispr dna targeting enzymes and systems |
| WO2021202800A1 (en) | 2020-03-31 | 2021-10-07 | Arbor Biotechnologies, Inc. | Compositions comprising a cas12i2 variant polypeptide and uses thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3581654B1 (en) * | 2013-12-27 | 2021-03-31 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of glycolate oxidase (hao1) by double-stranded rna |
| MX2021001070A (es) * | 2018-07-31 | 2021-05-27 | Intellia Therapeutics Inc | Composiciones y métodos para editar el gen hidroxiácido oxidasa 1 (hao1) para tratar la hiperoxaluria primaria tipo 1 (ph1). |
| WO2021257730A2 (en) * | 2020-06-16 | 2021-12-23 | Arbor Biotechnologies, Inc. | Cells modified by a cas12i polypeptide |
| CN113308451B (zh) * | 2020-12-07 | 2023-07-25 | 中国科学院动物研究所 | 工程化的Cas效应蛋白及其使用方法 |
-
2022
- 2022-06-03 IL IL308803A patent/IL308803A/en unknown
- 2022-06-03 MX MX2023014406A patent/MX2023014406A/es unknown
- 2022-06-03 WO PCT/US2022/032144 patent/WO2022256642A2/en not_active Ceased
- 2022-06-03 PH PH1/2023/553297A patent/PH12023553297A1/en unknown
- 2022-06-03 JP JP2023574534A patent/JP2024520691A/ja active Pending
- 2022-06-03 US US17/832,038 patent/US20230032141A1/en active Pending
- 2022-06-03 AU AU2022283922A patent/AU2022283922A1/en active Pending
- 2022-06-03 CA CA3222159A patent/CA3222159A1/en active Pending
- 2022-06-03 US US18/565,575 patent/US20240254494A1/en active Pending
- 2022-06-03 KR KR1020247000358A patent/KR20240034746A/ko active Pending
- 2022-06-03 EP EP22747156.2A patent/EP4347833A2/en active Pending
- 2022-06-06 TW TW111120922A patent/TW202317763A/zh unknown
- 2022-11-04 US US18/052,801 patent/US11821012B2/en active Active
-
2023
- 2023-12-29 CO CONC2023/0018656A patent/CO2023018656A2/es unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019178427A1 (en) | 2018-03-14 | 2019-09-19 | Arbor Biotechnologies, Inc. | Novel crispr dna targeting enzymes and systems |
| US10808245B2 (en) | 2018-03-14 | 2020-10-20 | Arbor Biotechnologies, Inc. | CRISPR DNA targeting enzymes and systems |
| WO2021202800A1 (en) | 2020-03-31 | 2021-10-07 | Arbor Biotechnologies, Inc. | Compositions comprising a cas12i2 variant polypeptide and uses thereof |
Non-Patent Citations (25)
| Title |
|---|
| "Cell and Tissue Culture: Laboratory Procedures (A. Doyle", vol. 8, 1993, J. WILEY AND SONS |
| "DNA Cloning: A practical Approach", vol. I, 1985 |
| "Immobilized Cells and Enzymes", 1986, 1RL PRESS |
| "The Antibodies", 1995, HARWOOD ACADEMIC PUBLISHERS |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 3402 |
| ANIMAL CELL CULTURE, 1987 |
| B. PERBAL ET AL.: "A practical Guide To Molecular Cloning", 1984 |
| C. A. JANEWAYP. TRAVERS: "Immunobiology", 1997 |
| D. CATTY .: "Monoclonal antibodies: a practical approach", 2000, OXFORD UNIVERSITY PRESS, pages: 1988 - 1989 |
| E. HARLOWD. LANE: "Using antibodies: a laboratory manual", 1999, COLD SPRING HARBOR LABORATORY PRESS |
| EPSTEIN ET AL.: "Engineering a Self-Inactivating CRISPR System for AAV Vectors", MOL. THER., vol. 24, 2016, pages S50, XP002777646, DOI: 10.1016/S1525-0016(16)32928-8 |
| F. M. AUSUBEL ET AL.: "Gene Transfer Vectors for Mammalian Cells", 1987, ACADEMIC PRESS, INC. |
| J. E. COLIGAN ET AL.: "Current Protocols in Immunology", 1991 |
| J. P. MATHERP. E. ROBERTS: "Introuction to Cell and Tissue Culture", 1998, PLENUM PRESS |
| KARLINALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 2264 - 68 |
| KARLINALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 77 |
| LEWISPAN: "RNA modifications and structures cooperate to RNA guide-protein interactions", NAT REVIEWS MOL CELL BIOL, 2017, pages 202 - 210, XP055451248 |
| MADDOX ET AL., J. EXP. MED., vol. 158, 1983, pages 1211 |
| MULLIS ET AL.: "PCR: The Polymerase Chain Reaction", 1994 |
| NAKAMURA ET AL.: "28", NUCL. ACIDS RES., 2000, pages 292 |
| ROZENSKI, JCRAIN, PMCCLOSKEY, J.: "The RNA Modification Database: 1999 update", NUCL ACIDS RES, vol. 27, 1999 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS |
| TIJSSEN: "Hybridization with Nucleic Acid Probes. Part I. Theory and Nucleic Acid Preparation", LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 24 |
| YU, Z. ET AL.: "RNA editing by ADAR1 marks dsRNA as ''self", CELL RES, vol. 25, 2015, pages 1283 - 1284 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024230842A1 (zh) * | 2023-05-11 | 2024-11-14 | 尧唐(上海)生物科技有限公司 | 一种Cas蛋白、其相应的基因编辑系统及应用 |
| CN119095956A (zh) * | 2023-05-11 | 2024-12-06 | 尧唐(上海)生物科技有限公司 | 一种Cas蛋白、其相应的基因编辑系统及应用 |
| CN119095956B (zh) * | 2023-05-11 | 2026-01-23 | 尧唐(上海)生物科技有限公司 | 一种Cas蛋白、其相应的基因编辑系统及应用 |
| WO2025147604A1 (en) | 2024-01-05 | 2025-07-10 | Arbor Biotechnologies, Inc. | Methods for treating primary hyperoxaluria via genetic editing of hydroxyacid oxidase 1 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2024520691A (ja) | 2024-05-24 |
| US20240254494A1 (en) | 2024-08-01 |
| AU2022283922A9 (en) | 2023-12-14 |
| CA3222159A1 (en) | 2022-12-08 |
| WO2022256642A3 (en) | 2023-01-12 |
| US20230212541A1 (en) | 2023-07-06 |
| AU2022283922A1 (en) | 2023-12-07 |
| PH12023553297A1 (en) | 2024-03-18 |
| CO2023018656A2 (es) | 2024-01-25 |
| KR20240034746A (ko) | 2024-03-14 |
| IL308803A (en) | 2024-01-01 |
| TW202317763A (zh) | 2023-05-01 |
| EP4347833A2 (en) | 2024-04-10 |
| US20230032141A1 (en) | 2023-02-02 |
| MX2023014406A (es) | 2024-02-12 |
| US11821012B2 (en) | 2023-11-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240261435A1 (en) | Gene editing systems comprising an rna guide targeting transthyretin (ttr) and uses thereof | |
| US11821012B2 (en) | Gene editing systems comprising an RNA guide targeting hydroxyacid oxidase 1 (HAO1) and uses thereof | |
| US20230203539A1 (en) | Gene editing systems comprising an rna guide targeting stathmin 2 (stmn2) and uses thereof | |
| AU2021369840A1 (en) | Compositions comprising an rna guide targeting b2m and uses thereof | |
| WO2023018856A1 (en) | Gene editing systems comprising an rna guide targeting polypyrimidine tract binding protein 1 (ptbp1) and uses thereof | |
| US11939607B2 (en) | Gene editing systems comprising an RNA guide targeting lactate dehydrogenase a (LDHA) and uses thereof | |
| WO2023122433A1 (en) | Gene editing systems targeting hydroxyacid oxidase 1 (hao1) and lactate dehydrogenase a (ldha) | |
| CN117897485A (zh) | 包括靶向羟基酸氧化酶1(hao1)的rna向导的基因编辑系统和其用途 | |
| WO2023081377A2 (en) | Compositions comprising an rna guide targeting ciita and uses thereof | |
| US20240301447A1 (en) | Gene editing method for inhibiting aberrant splicing in stathmin 2 (stmn2) transcript | |
| WO2025212120A1 (en) | Chemical modifications of guide rnas for crispr nucleases | |
| HK40109011A (zh) | 包括靶向羟基酸氧化酶1(hao1)的rna向导的基因编辑系统和其用途 | |
| WO2023137451A1 (en) | Compositions comprising an rna guide targeting cd38 and uses thereof | |
| CN117813382A (zh) | 包括靶向stathmin 2(stmn2)的rna向导的基因编辑系统和其用途 | |
| WO2025006563A1 (en) | Gene editing systems targeting pcsk9 and uses thereof | |
| WO2025049900A1 (en) | Crispr nuclease polypeptides and gene editing systems comprising such | |
| EP4627083A1 (en) | Reverse transcriptase-mediated genetic editing of transthyretin (ttr) and uses thereof | |
| WO2025171210A1 (en) | Compositions and methods for gene editing via homology-mediated end joining | |
| AU2021368740A1 (en) | Compositions comprising an rna guide targeting trac and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022283922 Country of ref document: AU Ref document number: 805860 Country of ref document: NZ Ref document number: AU2022283922 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 308803 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3222159 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12023553297 Country of ref document: PH Ref document number: 2023574534 Country of ref document: JP Ref document number: MX/A/2023/014406 Country of ref document: MX Ref document number: P6003135/2023 Country of ref document: AE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023024811 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022283922 Country of ref document: AU Date of ref document: 20220603 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451805 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202317085712 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2023/0018656 Country of ref document: CO Ref document number: 11202309224Y Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022747156 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022747156 Country of ref document: EP Effective date: 20240104 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22747156 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280052114.3 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: NC2023/0018656 Country of ref document: CO |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112023024811 Country of ref document: BR Free format text: EFETUAR, EM ATE 60 (SESSENTA) DIAS, O PAGAMENTO DE GRU CODIGO DE SERVICO 260 PARA A REGULARIZACAO DO PEDIDO, CONFORME ART. 2O 1O DA RESOLUCAO/INPI/NO 189/2017 E NOTA DE ESCLARECIMENTO PUBLICADA NA RPI 2421 DE 30/05/2017, UMA VEZ QUE A PETICAO NO 870240003822 DE 15/01/2024 APRESENTA DOCUMENTOS REFERENTES A 2 SERVICOS DIVERSOS (COMPLEMENTACAO DA TRADUCAO E MODIFICACAO DE PARTES DO PEDIDO JA ENVIADOS) TENDO SIDO PAGA SOMENTE 1 RETRIBUICAO. DEVERA SER PAGA MAIS 1 (UMA) GRU CODIGO DE SERVICO 260 E A GRU CODIGO DE SERVICO 207 REFERENTE A RESPOSTA DESTA EXIGENCIA. |
|
| ENP | Entry into the national phase |
Ref document number: 112023024811 Country of ref document: BR Kind code of ref document: A2 Effective date: 20231127 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451805 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451805 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451805 Country of ref document: SA |