WO2022252097A1

WO2022252097A1 - Method for adjusting polarization state of macrophages

Info

Publication number: WO2022252097A1
Application number: PCT/CN2021/097555
Authority: WO
Inventors: 钱政江; 李燕娇; 李翔; 李洪超; 杨海洋
Original assignee: 中国科学院深圳先进技术研究院
Priority date: 2021-05-31
Filing date: 2021-05-31
Publication date: 2022-12-08

Abstract

The present application relates to the technical field of biomedicines, and specifically discloses a method for adjusting a polarization state of macrophages. The method comprises the step of infecting macrophages by using an overexpressed HIMF gene, or knocking down or overall knocking out HIMF genes in macrophages by using a specific siRNA. In this way, in the present application, the macrophages are infected by using the overexpressed HIMF gene, or the HIMF genes in the macrophages are knocked down or overall knocked out by using the specific siRNA, such that functions of macrophages of different polarization types are affected, thereby inhibiting the development of inflammation and delaying the occurrence of myocardial infarction.

Description

A method of modulating the polarization state of macrophages

【Technical field】

The present application relates to the field of biomedicine, in particular to a method for regulating the polarization state of macrophages.

【Background technique】

Macrophages are formed by polarizing myeloid progenitor cells into monocytes, entering the blood, migrating to tissues and polarizing. According to the difference in activation mode and function, macrophages are divided into classical type (M1 type) and replacement type (M2 type). Under the stimulation of bacterial toxin LPS or Th1 cytokines (TNFα, IFNγ), macrophages are activated and polarized into M1 type, express and release related marker genes and reactive oxygen species, and have the functions of killing pathogens, clearing necrotic tissue and promoting inflammation Correspondingly, under the induction of Th2 cytokines (IL-4, IL-13), macrophages are activated into M2 type, express anti-inflammatory factors (such as TGFβ, IL-10), and have Reduce inflammation, promote tissue growth and repair.

The study found that two different polarized macrophages play an important regulatory role in the occurrence of inflammatory diseases, and they can switch functionally to each other when responding to different stimuli in different microenvironments; while blocking M1 macrophages The function of maintaining the anti-inflammatory and repairing properties of M2 polarized cells plays an important role in inhibiting the occurrence and development of inflammation. Therefore, finding an effective way to regulate the polarization state of macrophages is of great significance in the prevention and treatment of inflammation-related diseases. However, there are currently fewer effective methods for modulating macrophage polarization.

【Content of invention】

In view of the deficiencies in the prior art and actual needs, this application provides a method for regulating the polarization state of macrophages, using overexpression of HIMF gene to infect macrophages or specific siRNA knockdown or overall knockout of HIMF in macrophages Genes that affect the function of different polarized macrophages, thereby inhibiting the development of inflammation and delaying the occurrence of myocardial infarction.

For this purpose, the application adopts the following technical solutions:

In the first aspect, the present application provides a method for regulating the polarization state of macrophages, the method comprising infecting macrophages with overexpressed HIMF gene, or using specific siRNA to knock down or knock out HIMF in macrophages as a whole Gene steps.

Wherein, the step of using the overexpressed HIMF gene to infect macrophages includes: constructing an adenovirus vector overexpressing the HIMF gene; inoculating the macrophages in a multi-well plate; waiting for the cell density of the macrophages to reach At a preset value, the macrophage is infected with the adenoviral vector overexpressing the HIMF gene.

Wherein, before the step of inoculating the macrophages in the multi-well plate, the method also includes: isolating and culturing the bone marrow-derived macrophages: killing the mice by decapitation, and soaking them in two 75% alcohol beakers in turn; Cut the thigh with scissors, separate the femur and tibia, remove the skin and put it in the culture medium; cut off the articular surface of the femur and tibia, expose the bone marrow cavity, rinse the bone marrow cavity with a syringe, and blow off the cells with a pipette; the cells are filtered through a cell sieve , collect the cell suspension into a centrifuge tube; centrifuge, discard the supernatant, resuspend the cells with a medium containing macrophage colony-stimulating factor (MCSF), inoculate in a multi-well plate for culture; add the medium containing MCSF after 3 days , the mature bone marrow-derived macrophages obtained after further culturing for 3 days. Wherein, the macrophages include RAW264.7 and/or bone marrow-derived macrophages.

In a second aspect, the present application provides a pharmaceutical composition for regulating the polarization state of macrophages, the pharmaceutical composition comprising an adenovirus vector overexpressing the HIMF gene.

Wherein, the pharmaceutical composition further includes any one or a combination of at least two of pharmaceutically acceptable carriers, excipients or diluents.

Wherein, the nucleotide sequence of the adenoviral vector overexpressing the HIMF gene is shown in SEQ.ID.NO.1.

SEQ.ID.NO.1:

In a third aspect, the present application provides the application of the aforementioned pharmaceutical composition in the preparation of medicines for treating inflammation-related diseases.

Wherein, the diseases include any one or a combination of at least two of cardiovascular diseases, sepsis, rheumatoid arthritis, inflammatory gastrointestinal diseases, nervous system diseases or tumors.

Wherein, the diseases include cardiovascular diseases leading to myocardial infarction.

Compared with the prior art, the present application has the following beneficial effects:

(1) This application uses the overexpression of HIMF gene to infect macrophages, promotes the polarization of M1 macrophages, and inhibits the polarization of M2 macrophages, realizing the specific regulation of the function of polarized macrophages and the induction the effects of the disease;

(2) This application suppresses the function of M1 type pro-inflammatory macrophages and promotes the function of M2 type macrophages through specific siRNA knockdown or overall knockout of the HIMF gene in macrophages, and achieves specific regulation of polarization Effects on macrophage function and disease.

【Description of drawings】

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings that need to be used in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application. For those skilled in the art, other drawings can also be obtained based on these drawings without creative effort. in:

Fig. 1 is the schematic flow chart of the step of infecting macrophages with overexpressed HIMF gene in the present application;

Fig. 2 is the roadmap of the technical solution in the embodiment of the present application;

Figure 3a is the result of overexpression of HIMF gene promoting the expression of M1 type RAW264.7 cell-related marker genes (TNFα, IL-1β, IL-6);

Figure 3b is the result of overexpression of HIMF gene promoting the expression of M1 type BMDM cell-related marker genes (TNFα, IL-1β, IL-6);

Figure 4a is the result of overexpressing the HIMF gene to inhibit the expression of M2 type RAW264.7 cell-related marker genes (Arg1, TGF and IL-10);

Figure 4b is the result of overexpressing the HIMF gene to inhibit the expression of M2 type BMDM cell-related marker genes (Arg1, TGF and IL-10);

Figure 5a is the result of flow cytometric screening of the control group (mice without knockout of the HIMF gene in macrophages);

Figure 5b is the flow cytometric screening results of the experimental group (specific siRNA knockdown or mice after the overall knockout of the HIMF gene in macrophages);

Figure 6a shows the results of knocking out the HIMF gene in macrophages to suppress the expression of M1-type macrophage-related marker genes (CD45 ⁺ CD11B ⁺ Ly6G ^- Ly6C ⁺ );

Figure 6b is the result of overexpression of HIMF gene promoting the expression of M2 macrophage-related marker genes (CD45 ⁺ CD11B ⁺ Ly6G ^- Ly6C ^- );

Figure 7 is a photograph of mouse heart section staining;

Fig. 8 is the statistical data of the infarction area of operation group and control group;

Fig. 9 is the statistical data of the survival rate of the operation group and the control group.

【Detailed ways】

The following will clearly and completely describe the technical solutions in the embodiments of the present application with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all of them. Based on the embodiments in this application, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the scope of protection of this application.

From the perspective of regulating the polarization function of macrophages and then specifically intervening in the functions of macrophages, this application proposes a method for regulating the polarization state of macrophages by using technical means such as primary cell culture and histopathological observation. The method comprises the steps of infecting macrophages with overexpressed HIMF gene, or specifically knocking out HIMF gene in macrophages, or delivering siRNA to macrophages to inhibit the expression of HIMF genes.

In the above examples, hypoxia-induced mitogenic factor (hypoxia-induced mitogenic factor, HIMF), also known as resistin-like molecule α (resistin-like molecμLe α, RELMα), or found in inflammatory zone 1 (found in inflammatory zone 1, FIZZ1), which belongs to one of the highly conserved RELM family genes, the known RELM family includes four mouse subtypes (HIMF/RELMα/FIZZ1, RELM/FIZZ2, Resistin/FIZZ3 and RELM/FIZZ4) and two human isoforms (RELM/FIZZ2 and Resistin/FIZZ3), each of which has a unique expression pattern, exerts different biological functions, and exerts different biological functions.

HIMF was originally found in macrophages in the inflammatory area, and has an important regulatory function on the occurrence and development of inflammation and angiogenesis. Studies have shown that HIMF can regulate cell functions (such as cell proliferation, intracellular calcium flow, etc.) and different diseases (such as pulmonary hypertension, inflammatory outbreaks and fibrosis) ) plays an important role in the occurrence and development of the pathological process.

In one embodiment, as shown in Figure 1, the above steps of infecting macrophages by overexpressing the HIMF gene specifically include:

S10: Construction of an adenovirus vector overexpressing the HIMF gene.

S20: Seeding macrophages in a multi-well plate.

S30: When the cell density of the macrophage reaches a preset value, the macrophage is infected with the adenovirus vector overexpressing the HIMF gene.

In one embodiment, before step S20, the method further includes: isolating and culturing bone marrow-derived macrophages: killing the mice by decapitation, soaking them in two 75% alcohol beakers in turn; cutting the thighs with scissors, separating the femur and Tibia, remove the skin and put it in the culture medium; cut off the articular surface of the femur and tibia, expose the bone marrow cavity, flush the bone marrow cavity with a syringe, blow off the cells with a pipette gun; after the cells are filtered through a cell sieve, collect the cell suspension into a centrifuge tube Medium; centrifuge, discard the supernatant, resuspend the cells with a medium containing macrophage colony-stimulating factor (MCSF), inoculate in a multi-well plate for culture; add the medium containing MCSF after 3 days, and cultivate the mature cells obtained after 3 days bone marrow-derived macrophages. Wherein, macrophages include RAW264.7 and/or bone marrow-derived macrophages.

The application also provides a pharmaceutical composition for regulating the polarization state of macrophages, the pharmaceutical composition includes an adenovirus vector overexpressing the HIMF gene.

SEQ.ID.NO.1:

The present application also proposes the application of the aforementioned pharmaceutical composition in the preparation of medicines for treating inflammation-related diseases.

Among them, diseases include cardiovascular diseases leading to myocardial infarction.

In order to better understand the present application, the examples are mainly listed from the following aspects: (1) Infect macrophages with overexpressed HIMF gene, and verify in vitro cell and animal experiments to promote the polarization of M1 type macrophages and inhibit the M2 type Macrophage polarization; (2) Using a mouse model of myocardial infarction to verify the inhibitory effect of macrophage-specific knockout of the HIMF gene on the process of inflammation and cardiac necrosis, the roadmap of the technical solution is shown in Figure 2. These examples are for illustrative purposes only and should not be construed as limiting the scope of the application in any way.

Example 1 Isolation and cultivation of bone marrow derived macrophages (bone marrow derived macrophage, BMDM)

The mice were killed by neck dislocation, and soaked in two 75% alcohol beakers in turn; the thighs were cut with scissors, the femur and tibia were separated, and the skin and flesh were removed and placed in 10 mL RPMI1640 medium (containing 10% FBS); the femur and tibia were cut On the articular surface, expose the bone marrow cavity, flush the bone marrow cavity with a 10mL syringe (1mL needle), and blow off the cells with a 1mL pipette gun;

After the cells were filtered through a cell sieve, collect the cell suspension into a 50 mL centrifuge tube; centrifuge at 1000 g for 8 minutes, discard the supernatant, resuspend the cells in 1640 medium containing 10 ng/mL macrophage colony-stimulating factor (MCSF), and inoculate in Cultured in a 6-well plate; 3 days later, the medium containing 10ng/mL MCSF was added, and the mature bone marrow-derived macrophages obtained after another 3 days were cultured.

Example 2 Effect of Overexpression of HIMF Gene on M1 Macrophages

RAW264.7 cells were inoculated in 6-well plates, and when the cell density reached about 70%, the RAW264.7 cells were infected with adenovirus vectors with viral titers MO1-30 overexpressing the HIMF gene. Lipopolysaccharide (LPS) was used to stimulate and induce M1 macrophages, and the cells were collected 48 hours later to analyze the expression of related marker genes TNFα, IL-1β, and IL-6.

The BMDM cells were inoculated in a 6-well plate, and when the cell density reached about 70%, the BMDM cells were infected with adenovirus vectors overexpressing the HIMF gene with a virus titer of MO1-30. M1 macrophages were induced by IFN-γ stimulation, and the cells were collected 48 hours later to analyze the expression of related marker genes TNFα, IL-1β, and IL-6.

The results are shown in Figure 3a and Figure 3b. The results showed that compared with the control group, in LPS-induced RAW264.7 cells, overexpression of the HIMF gene can significantly promote the polarization of M1 macrophages, and promote related marker genes such as The expression of TNFα, IL-1β, and IL-6; similarly, compared with the control group, in IFNγ-induced BMDM cells, the overexpression of HIMF gene can significantly promote the polarization of M1 macrophages and promote the expression of related marker genes. Such as the expression of TNFα, IL-1β, IL-6.

Example 3 Effect of Overexpression of HIMF Gene on M2 Macrophages

The RAW264.7 cells were inoculated in a 6-well plate, and when the cell density reached about 70%, the RAW264.7 cells were infected with adenovirus vectors overexpressing the HIMF gene with a viral titer of MO1-30. M2 macrophages were induced by stimulation with IL-4, and the cells were collected 48 hours later to analyze the expression of related marker genes Arg1, TGF and IL-10.

The BMDM cells were inoculated in a 6-well plate, and when the cell density reached about 70%, the BMDM cells were infected with adenovirus vectors overexpressing the HIMF gene with a virus titer of MO1-30. M2 macrophages were induced by stimulation with IL-4, and the cells were collected 48 hours later to analyze the expression of related marker genes Arg1, TGF and IL-10.

The results are shown in Figure 4a and Figure 4b. The results showed that: in IL-4-induced RAW264.7 cells, overexpression of the HIMF gene can significantly inhibit the polarization of M2 macrophages, and the related marker genes induced by IL-4 (Arg1, TGF and IL-10) can be inhibited by overexpression of HIMF gene in a concentration-dependent manner. Similarly, in IL-4-induced BMDM cells, the overexpression of HIMF gene can significantly inhibit the polarization of M2 macrophages, and the related marker genes (Arg1, TGF and IL-10) induced by IL-4 can be suppressed. Overexpression of HIMF gene inhibited in a concentration-dependent manner.

Example 4 Constructing a Mouse Model of Myocardial Infarction

Myocardial infarction is myocardial necrosis caused by persistent ischemia and hypoxia, which may be complicated by arrhythmia, shock or heart failure, and is often life-threatening. Myocardial infarction leads to ischemic necrosis of myocardial cells and a severe inflammatory response. At this time, a large number of macrophages are recruited to the heart to remove dead myocardial tissue, and at the same time secrete a variety of cytokines and chemokines to assist in the phagocytosis of necrotic cell debris and promote tissue repair. This process is regulated by multiple factors and is mainly related to the tissue microenvironment. In some cases, imbalances in macrophage regulation can cause irreversible damage and accelerate the process of heart failure.

Mice (6-8 weeks old, body weight 20-24 g) after specific siRNA knockdown or overall knockout of HIMF gene in macrophages were randomly divided into operation group and sham operation group.

Dissolve pentobarbital sodium at a ratio of 3g pentobarbital sodium per 100mL of normal saline, prepare 3% pentobarbital sodium solution, and use a clean 1mL syringe to draw an appropriate amount of anesthetic (inject 0.05mL 3% per 10g body weight) Pentobarbital sodium solution meter), grasp the skin on the back of the neck of the mouse, turn the mouse upside down obliquely, and shift the abdominal organs to the chest cavity as much as possible. After exposing the abdomen, insert the syringe into the skin at an angle of 45° to the abdominal skin, shake the needle of the syringe and feel that the needle moves freely in the abdominal cavity, which proves that the needle penetrates into the abdominal cavity, and push the push handle of the syringe with the thumb to inject the anesthetic.

Clamp the tail of the mouse with tweezers. If the mouse does not respond, it means that the mouse is anesthetized successfully. Then the mouse is fixed on the operating table, and the tongue is clipped to prevent intubation into the esophagus. The prepared tube was inserted into the trachea along the mandible, and mechanical ventilation was performed (100 times/min, stroke volume 250 μL). Observe that the frequency of mechanical ventilation is consistent with the frequency of mouse chest rise and fall, which means that the tracheal intubation is successful.

After checking that the tracheal intubation and mechanical ventilation were performed correctly, the skin was cut along the third and fourth intercostal spaces on the left side of the sternum of the mouse, the subcutaneous tissue and muscle were carefully separated, the chest cavity was opened, and the apex of the heart was exposed. Find the left anterior descending coronary artery (LAD) under a stereomicroscope, suture the LAD with 7-0 suture, and you can see that the left ventricle wall becomes white, and the pulsation of the wall decreases, indicating that the ligation is successful; while the mice in the sham operation group are The chest cavity was opened without ligation of the LAD. Finally, the muscles and skin were sutured sequentially with 7-0 sutures, and 0.2 mL of 0.9% normal saline was injected subcutaneously.

After the mice were stable and could breathe spontaneously, the endotracheal tube was gently pulled out. After the mice wake up, they can be put back into the shielded cages to continue feeding and to be used in the future.

Example 5 Separation and flow analysis of mouse cardiac macrophages

(1) Prepare digestive solution: 0.48 mg of hyaluronidase, 3.6 mg of type I collagenase and 0.3 μL of DNase are dissolved in 1 mL of serum-free DMEM medium, and about 1 mL of digestive solution is needed for each heart;

(2) Configure HBSS: add 0.2% BSA and 2% FBS to the HANKS buffer, filter with a 0.22 μm filter;

(3) Anesthesia: After weighing the mice 7 days after the model in Example 4 was constructed, write down the label, and perform abdominal anesthesia with the aforementioned anesthesia operation;

(4) Perfusion: cut the thorax of the mouse along the sternum, and be careful not to cut the heart. After the heart is exposed, find the left atrial appendage covering the surface of the heart at the upper left of the heart, cut off the left atrial appendage, fill the 20mL syringe with pre-cooled PBS, replace it with a small needle of a 1mL syringe, and start from the apex of the left ventricle. Insert and inject PBS so that PBS enters from the left ventricle and flows out from the left atrium after going around the circulatory system for a week. After observing that the liver and lungs become pale, the perfusion is successful;

(5) Digestion: Take out the perfused heart, dry it with absorbent paper, and weigh it. After weighing, put the heart in a small dish, add 1 drop of PBS to keep it moist, and cut the heart into pieces on ice. If it is muddy, transfer it to a 2mL centrifuge tube, add 1mL of digestion solution, seal it with a parafilm and place it on a shaker at 37°C at 100rpm for 1 hour;

(6) Termination of digestion: Shake the centrifuge tube vortex for 20s, and after visually observing that there is no solid, filter the cell suspension into a 50mL centrifuge tube with a 40μm filter, and add HBSS to terminate the digestion;

(7) Resuspension: Place the digested cell suspension in a centrifuge at 4°C, centrifuge at 400g at low temperature for 5 minutes, discard the supernatant, add 1mL of stain buffer, gently blow off the cells, and transfer the cell suspension to 1.5mL In a centrifuge tube, after centrifugation at 400g for 5 minutes at 4°C, add 200μL of stain buffer to resuspend again;

(8) Blocking: Add 2 μL CD16/CD32 to 200 μL cell suspension at a ratio of 1:100, and let stand at room temperature for 15 minutes under dark conditions;

(9) Staining: After measuring the amount of cells, stain the closed cell suspension as required, add CD45, CD11b and Ly6G respectively, and sort macrophages by flow cytometry.

(10) Flow cytometry: operate the flow cytometer, and use specific antibody combinations CD45, CD11b, and Ly6G to screen macrophages. The screening results are shown in Figure 5a and Figure 5b, wherein Figure 5a is the control group (not shown). The results of flow cytometric screening of mice with HIMF gene in macrophages knocked out); Figure 5b is the flow cytometric screening of experimental group (specific siRNA knockdown or mice with overall knockout of HIMF gene in macrophages) result.

(11) M1 type macrophages were labeled by antibody CD45 ⁺ CD11B ⁺ Ly6G ^- Ly6C ⁺ , the results are shown in Figure 6a, the results showed that: compared with the control group (mice without knockout of the HIMF gene in macrophages), Macrophage-specific ^knockout of ^HIMF gene inhibited the ^polarization of M1 macrophages ^; Marking M2 macrophages, the results are shown in Figure 6b. The results showed that macrophage-specific knockout of the HIMF gene promoted the polarization of M2 macrophages.

Example 5 Masson staining of mouse heart section

(1) Slicing: After the mice were killed by decapitation, the whole heart was taken out, completely soaked in 4% paraformaldehyde, placed on a shaker at room temperature and fixed for 1-3 days, dehydrated and embedded, and sliced with a microtome.

(2) Baked slices: bake the slices in a constant temperature oven at 56°C for 120 minutes.

(3) Hydration: Soak the baked slices in xylene, xylene, absolute ethanol, absolute ethanol, 95% alcohol, 85% alcohol, 75% alcohol, and 50% alcohol for 5 minutes at room temperature. After gradient hydration, wash with dd H2O for 5 min and repeat twice.

(4) Staining: ① After routine gradient hydration of the slices, add Bouin’s solution according to the instructions, mordant at room temperature overnight, rinse with running water until the yellow color on the slices disappears; ② After 2-3 minutes of lapis lazuli staining, Rinse with a washing bottle for a while; ③Mayer's hematoxylin staining solution was dripped for 2-3 minutes, and the washing bottle was rinsed for a while; ④After soaking the tissue in acidic ethanol polarizing solution for a few seconds, put it under the tap and rinse with running water for 10 minutes. Be careful not to rinse with running water ⑤After 10 minutes of staining with Ponceau Red Fuchsin, rinse with running water and dry the water as much as possible; ⑥Immerse the tissue in phosphomolybdic acid solution for about 10 minutes, the collagen fibers can be seen to be dyed colorless or light and the muscle fibers were dyed bright red; ⑦Shake off the supernatant, drip directly into the aniline blue staining solution for 5 minutes without rinsing, and the colorless or light red collagen fibers will turn blue; ⑧In order to remove the original plasma Blue, treated with weak acid for 2 minutes; ⑨Immerse the slices in 50% alcohol, 75% alcohol, 85% alcohol, 95% alcohol, absolute ethanol, absolute ethanol, xylene, and xylene for 5 minutes at room temperature , Gradient dehydration; ⑩ carefully immobilize with neutral gum, pay attention not to have air bubbles on the tissue.

Stained photos of the mouse heart sections of the operation group, the sham operation group and the control group are shown in FIG. 7 .

After statistics, the infarct areas of the operation group and the control group are shown in Figure 8.

After statistics, the survival rates of the operation group and the control group are shown in Fig. 9 .

The above is only the implementation of the application, and does not limit the patent scope of the application. Any equivalent structure or equivalent process conversion made by using the specification and drawings of the application, or directly or indirectly used in other related technologies fields, are all included in the scope of patent protection of this application in the same way.

Claims

A method for regulating the polarization state of macrophages, characterized in that the method comprises the steps of infecting macrophages with overexpressed HIMF gene, or knocking down or overall knocking out HIMF gene in macrophages with specific siRNA.
The method according to claim 1, wherein the step of using the overexpressed HIMF gene to infect macrophages comprises:

Construct an adenoviral vector that overexpresses the HIMF gene;

Seeding the macrophages in a multi-well plate;

When the cell density of the macrophage reaches a preset value, the macrophage is infected with the adenovirus vector overexpressing the HIMF gene.
The method according to any one of claims 1-2, wherein the macrophages comprise RAW264.7 and/or bone marrow-derived macrophages.
The method according to claim 3, characterized in that, before the step of seeding the macrophages in the multi-well plate, the method further comprises:

Isolation and cultivation of bone marrow-derived macrophages: kill the mice by dislocation of the neck, soak them in two 75% alcohol beakers in turn; cut off the thighs with scissors, separate the femur and tibia, remove the flesh and put them in the culture medium; cut off the femur and tibia Expose the bone marrow cavity, flush the bone marrow cavity with a syringe, and blow off the cells with a pipette gun; after the cells are filtered through a cell sieve, collect the cell suspension into a centrifuge tube; centrifuge, discard the supernatant, and stimulate with a colony containing macrophages Factor (MCSF) medium to resuspend the cells, seeded in multi-well plates for culture; 3 days later, add MCSF-containing medium, and culture the mature bone marrow-derived macrophages obtained after 3 days.
A pharmaceutical composition for regulating the polarization state of macrophages, characterized in that the pharmaceutical composition includes an adenovirus vector overexpressing the HIMF gene.
The pharmaceutical composition according to claim 5, further comprising any one or a combination of at least two of pharmaceutically acceptable carriers, excipients or diluents.
The pharmaceutical composition according to claim 5, wherein the nucleotide sequence of the adenoviral vector overexpressing the HIMF gene is as shown in SEQ.ID.NO.1;

SEQ.ID.NO.1:

AAATGTGGGCGGCCAAAGTGTATTGAAAGTGTTTACTCCATTGGGATGTGCTTGTATATATTCAGGGCCCCTAGGTCAGTAATCTCATAGTGTATTAAAAAGCATCTCATCTGGCAAGGTCCTGGAAACTTTTCTGAGATTCTGGTGAGTCAGTCAGCTCTGTAGGATCCTCTCTTCCTCCTAAACATCTGGAATAATTATAGTAGCATTTCTCCTGATGTTCTCACCCTCTCCTCTACCTCACATCCATCCTAGAGCTCATTGATCTCATCTTCTCTGCTCTTCCCCTCCAGCCCCAGGACACTGACTTTCAACAGGATGAAGACTGCAACCTGTTCCCTTCTCATCTGCGTCTTCCTTCTCCAGCTGATGGTCCCAGTGAATACTGATGGAACCTTAGACATTATTGGGAAGAAAAAGGTCAAGGAACTTCTAGCCCATCAAGGTATGAGATGAGTAGGAAAAATCATAGCTTAATCCTTGCTGATGATGACTGTACATAAGACCTAAAATCTCTTGTATCCTGGTCTAAGCTCTTAGTCCCCGTTATCCCTGCCTTCCTGACCAGGGCTTCCTTCAGCACCCTACACTTTTGAACTCTTGGATAACAGCTTAATGTTGTTGATGAAGATGAAGAAAAAGGATAGAACCTGTAATTTATAAACATATCACAAAACAAACATATTAAGCATTCAGTTAGTTCATTCAATTTTCACAGGCACTTTATGAGTTAAGTACAACTATTACTTTTTCTTTACAAATGAGGAAGCTAGATCTTAAAAGTTAGCAAGGGGACTACTTATGGAACCAGTGACACCCCCAAGATAGAGGAAGACTTATAAAAGAATTGTGAGAAAGATCATGGGCTATATCACCTTTCTCTCTTACTCAGATAACTATCCCTCTGCTGTAAGGAAGACCCTCTCATGCACTAATGTCAAGTCTATGAGCAAATGGGCCTCCTGCCCTGCTGGTGAGTAATTCCTTAAGGAGATTTTGT GAATACAGTGGGTTCCTCTGTGTCCTCCCTCATCAATCTCTTAATGCCATCTTTCTCCTAAGTCAGGTTTGTACTGCAATGGAACTGAGCTACAGTTCCAGATGTGCAGACACCACTTCCTGATTTTCAGCTCTCCAATGATGCTATTGAGGGACTTTTGGTTTCTGCCTTTCATGTCACTTCTTCCTTTATGCCAGCCCTTCCTGTCCCTCAAGTGTCTGGTAATGGATATATATGGCCTTCATTTCTTCCATAACCTTTTCCCTTGTATTGTGGGCAGCAGGAGTCAGAACAGGGGTGAATTTGCTATTAATTGAAAGACAGTGAAACTCCACCTTCCAAATCCTCCAGTTTAAGTAACTTTTGCACTTGGTTTGTTTGAAAAGAACTGTGGAATTTGAATAGCTTTTTGTTTTGCAAAATAGAGCAACTCATGTGCTTTCTAAGAAGGAAGAACAGTTAGGGACCTTCCCTCCCTTACAGTCCAAGGGCTCTGACATATCTGTCTCACATAACTATGCAGG GATGACTGCTACTGGTTGTTCTTGTGGCTTTGCCTGTGGATCTTGGGAAATCCAGAATGAAAATATTTGCAACTGCCTGTGCTTAATCGTTGACTGGGCCTATGCCCGCTGCTGCCAACTGTCCTAAGAATGGAGAGGCACAGAACTCAGCTTTGATATGATGAGTCTAACAAAACTGCAATCTCAACTTGGAAATCTGACTCATGCGCATTTGATGTATTCATATTGCCCATTAACCCCGCTTCTTGAAAAAATAAAGACAAATTTACATCTTTCTA
Application of the pharmaceutical composition described in any one of claims 5-7 in the preparation of medicines for treating inflammation-related diseases.
The application according to claim 8, characterized in that the diseases include any one or at least two of cardiovascular diseases, sepsis, rheumatoid arthritis, inflammatory gastrointestinal diseases, nervous system diseases or tumors. combination of species.
The use according to claim 8, characterized in that the diseases include cardiovascular diseases leading to myocardial infarction.