WO2022250430A1

WO2022250430A1 - Method for preparing mrna for expressing protein, and use of mrna prepared thereby

Info

Publication number: WO2022250430A1
Application number: PCT/KR2022/007377
Authority: WO
Inventors: 김태돈; 강희영
Original assignee: 한국생명공학연구원
Priority date: 2021-05-25
Filing date: 2022-05-24
Publication date: 2022-12-01
Also published as: KR20220159909A

Abstract

The present invention relates to an mRNA structure comprising a nucleic acid sequence, which encodes a target protein or peptide, and a poly A nucleic acid sequence, which has a length of 20nt to 500nt and is connected downstream of the nucleic acid sequence encoding a target protein or peptide. It is expected that the mRNA structure is structurally stable in the cytoplasm after introduced into cells and enables a target protein fully performing the functions thereof to be expressed for a long time, and thus contributes to robust utilization of a transient transformation technology.

Description

Method for producing mRNA for protein expression and use of the mRNA produced thereby

The present invention relates to a technology for improving mRNA stability and protein translation in a host cell with respect to mRNA for transformation for protein expression.

mRNA is an intermediate link between the translation of DNA encoding protein information and the protein production process by cytoplasmic ribosomes. Optimal in vitro transcription mRNA preparations for therapeutic purposes are produced from linear DNA templates using T7, T3 or Sp6 phage RNA polymerase. The RNA thus prepared must have an open reading frame (ORF) encoding the protein of interest, an untranslated region, a 5'-Cap and a poly (A) tail sequence. . The engineered mRNA is similar to the fully mature natural mRNA molecule and is identical to that naturally present in the cytoplasm of eukaryotic cells, thereby avoiding the activation of the host cell's innate immune system.

Since poly(A) tail plays an important regulatory role in mRNA translation and stability, RNA transcripts are prepared from DNA templates and then poly(A) polymerase is used. Tailing, which extends the adenosine sequence at the 3' end of the mRNA, is essential. On the other hand, the length of the poly (A) tail affects mRNA stability and protein expression efficiency, and the optimal poly (A) tail length may vary depending on the type of cell and the protein to be expressed.

On the other hand, recently, as an immune cell therapy for cancer treatment, a cell therapy method in which immune cells in the body are taken out and strengthened or genetically modified and reinserted is being developed. Representative examples include Tumor Infiltrating Lymphocytes (TIL), Chimeric Antigen Receptor (CAR), and T-Cell Receptor (TCR) technology. Research and clinical trials using phosphorus CAR are being conducted. However, cell therapy modalities or gene therapy using the genetic engineering modifications have a number of challenges, including undesirable immune responses and safety issues due to the incorporation of genes at random locations in the genome. In this regard, a transgenic CAR-NK cell (Chimeric Antigen Receptor - Natural killer cell) using DNA has a problem in that safety is not guaranteed because the CAR gene is integrated into the genome or mutated. In order to solve this problem, attempts have been made to use transiently transformed CAR-NK cells using mRNA, but in the case of transient transformation, mRNA instability, low transfection rate, and target protein expression rate act as obstacles, resulting in poor performance. No studies were shown. Accordingly, it is necessary to develop an mRNA construct capable of stably expressing CAR without being degraded in the cytoplasm of natural killer cells.

One object of the present invention is to provide an mRNA construct having a long half-life and a high expression rate of a target protein in the cytoplasm of a host cell and a method for preparing the same.

Another object of the present invention is to provide a transient transformant transformed with the mRNA construct and the transformant for use in the treatment of cancer.

However, the technical problem to be solved in the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

In order to achieve the above object, one aspect of the present invention is a nucleotide sequence encoding a target protein or peptide; and a poly(A) sequence having a length of 20 nt to 500 nt linked downstream of the mRNA encoding the target protein or peptide.

Another aspect of the present invention provides a gene construct comprising a DNA sequence corresponding to or complementary to the nucleotide sequence of the mRNA construct, and a vector comprising the gene construct.

In addition, another aspect of the present invention provides a method for preparing mRNA with improved stability, comprising performing in vitro transcription using the vector as a template.

After the in vitro transcription, poly(A) tailing may not be performed in vitro.

In addition, another aspect of the present invention provides a transformant in which the mRNA construct is introduced into a host cell, and a cell therapy composition comprising the same as an active ingredient.

In addition, the present invention provides a cancer treatment method comprising administering the transformant to a subject.

In addition, the present invention provides the use of the transformant for the preparation of anticancer drugs.

Since the mRNA construct of the present invention is stable and can express a target protein that fully functions after being injected into a cell for a long time, it is expected to contribute to the active use of transient transformation technology. For example, transiently transfected CAR-NK cells prepared by selecting a Chimeric Antigen Receptor (CAR) as a target protein and applying it to the mRNA construct of the present invention have excellent cytotoxicity against cancer cells while stably expressing the CAR for a long time. In addition to expressing CAR without gene insertion into the genome of natural killer cells, safety in vivo is guaranteed, so it can be usefully used for anti-cancer pharmaceutical compositions and anti-cancer immunotherapy targeting solid cancer.

1 shows the structure of the CAR mRNA of the present invention and the domain and motif configuration of the CAR.

Figure 2 shows the results of optimizing transfection, showing the results of establishing transformation conditions for NK92 cells using the Nepa21 system.

Figure 3 shows the results of transfection optimization, showing the results of establishing transfection conditions for primary NK cells using the Nepa21 system.

Figure 4 shows the results of the confirmation of CAR expression over time in Transient CAR NK92 cells and Stable CAR NK92 cells.

Figure 5 shows the results of confirming the cancer cell killing ability over time for Transient CAR NK92 cells and Stable CAR NK92 cells.

Figure 6 shows the domains and motifs constituting the vector construction or CAR for the confirmation experiment on the expression rate and cancer cell killing ability of the chimeric antigen receptor including DAP10,

FIG. 7 shows the confirmation of the CAR expression rate according to the presence or absence of DAP10 during CAR mRNA transfection using FACS, in relation to FIG. 6 above.

8 shows the difference in CAR expression rate and cytotoxicity according to the type of 3rd generation CAR having 2 co-activators (CD28, DAP10) and 2nd generation CAR having 1 co-activator (DAP10) in the CAR structure.

9 shows the results of confirming the difference in CAR expression rate and cytotoxicity according to the co-activators DAP10 and 4-1BB in the CAR structure.

10 shows the result of confirming the difference in CAR expression rate and cytotoxicity according to the co-activators DAP10 and 2B4 in the CAR structure.

Figure 11a is a schematic diagram of mRNA constructs designed differently with 5'-β-globin UTR, 3'-BGH, EMCV-IRES structure, forward/reverse direction or 5'/3' position of EMCV-IRES, Figure 11b is a schematic view of the mRNA construct manufacturing process.

12 is a diagram comparing the reduction ratios of mRNA constructs 1 to 7 injected into cells over time.

13 is a diagram confirming comparison of CAR protein expression levels in transient NK92 cells injected with mRNA constructs 1 to 7.

14 is a view comparing and confirming the toxicity of transient NK92 cells injected with mRNA constructs 1 to 7 in lung cancer cell lines and breast cancer cell lines.

15A is a view confirming, through electrophoresis, a transcript obtained from a vector containing a DNA sequence corresponding to or complementary to the nucleotide sequence of mRNA in which the order of BGH and IRES is different at the 3' end.

15B is a view confirming the efficiency of target protein expression and the performance of the target protein in cells of the mRNA construct in which the order of BGH and IRES is different at the 3' end.

16a and 16b are views confirming the efficiency of expression of the target protein and the performance of the target protein in cells of the mRNA construct according to the presence or absence of the poly(A) sequence at the 3' end.

Hereinafter, the present invention will be described in detail.

One aspect of the present invention provides an mRNA construct that is structurally stable and capable of actively inducing the expression of a target protein having intact functions by being injected into a cell for a long time.

The mRNA construct of the present invention includes a nucleotide sequence encoding a target protein or peptide and a poly(A) nucleotide sequence.

The target protein or peptide is a target protein or peptide to be produced in a recombinant transformant, and refers to any protein or peptide that can be expressed using the transformant's own transcription or translation system. For example, the target protein or peptide includes hormones, hormone analogues, enzymes, enzyme inhibitors, receptors and receptor fragments, antigens and fragments or analogs of antigens, antibodies and antibody fragments, monoclonal antibodies, structural proteins, toxin proteins, etc., It may be a protein in which some or some or all of them are fused. In a specific embodiment of the present invention, a chimeric antigen receptor (CAR) was used as the target protein or peptide.

The nucleotide sequence encoding the target protein or peptide may be an RNA sequence, and in particular, an mRNA sequence.

The poly(A) nucleotide sequence refers to a nucleotide sequence in which a plurality of adenosine monophosphates are linked through phosphodiester bonds. The poly(A) sequence may have a length of 20 nt to 500 nt, for example, 30 nt to 450 nt, 50 nt to 400 nt, 100 nt to 350 nt, or 150 nt to 310 nt.

The poly(A) nucleotide sequence may be arranged downstream of the nucleotide sequence encoding the target protein or peptide. The downstream means the next part of the 3'-end of the nucleotide sequence encoding the target protein or peptide. Therefore, the poly(A) nucleotide sequence may be placed after the 3'-end of the nucleotide sequence encoding the target protein or peptide. At this time, the poly(A) nucleotide sequence may be connected immediately after the 3'-end of the nucleotide sequence encoding the target protein or peptide, and the 3'-end of the nucleotide sequence encoding the target protein or peptide and the An arbitrary base sequence may be interposed between the poly(A) base sequences.

As described above, in the case of an mRNA construct in which the poly(A) base sequence is arranged downstream of the base sequence encoding the target protein or peptide, structurally high stability even in the cytoplasm of the fraudulent cell after being introduced into the cell. , and can actively induce the expression of a target protein or peptide with intact functions for a long time.

In addition, the mRNA construct of the present invention may further include a 5'-β-globin untranslated region (UTR) region upstream of the nucleotide sequence encoding the target protein or peptide. The upstream refers to the front part of the 5'-end of the nucleotide sequence encoding the target protein or peptide. Therefore, the 5'-β-globin UTR region may be placed in front of the 5'-end of the nucleotide sequence encoding the target protein or peptide. At this time, the 5'-end of the nucleotide sequence encoding the target protein or peptide may be connected immediately after the 5'-β-globin UTR region, and the 5'-β-globin UTR region and the target protein or peptide Any nucleotide sequence may be interposed between the 5'-end of the nucleotide sequence encoding . On the other hand, the 5'-β-globin UTR region is an untranslated portion present in the front part of the 5'-end of the nucleotide sequence of the gene encoding β-globin, that is, upstream of the gene encoding β-globin. means In particular, the 5'-β-globin UTR region may include or consist of the nucleotide sequence of SEQ ID NO: 1.

In addition, the mRNA construct of the present invention may further include BGH between the nucleotide sequence encoding the target protein or peptide and the poly(A) nucleotide sequence. Therefore, the BGH may be placed between the 3'-end of the nucleotide sequence encoding the target protein or peptide and the 5'-end of the poly(A) nucleotide sequence, and similarly, the target protein or peptide encoding the target protein or peptide Any base sequence may be interposed between the 3'-end of the base sequence and the BGH, and between the BGH and the 3'-end of the poly(A) base sequence. Meanwhile, the BGH refers to a polyadenylation signal of bovine growth hormone (bGH). In particular, the BGH may include or consist of the nucleotide sequence of SEQ ID NO: 2.

Furthermore, the mRNA construct of the present invention may further include an IRES between the nucleotide sequence encoding the target protein or peptide and the poly(A) nucleotide sequence. Therefore, the IRES may be placed between the 3'-end of the nucleotide sequence encoding the target protein or peptide and the 5'-end of the poly(A) nucleotide sequence, and similarly, the target protein or peptide encoding the target protein or peptide Any base sequence may be interposed between the 3'-end of the base sequence and the IRES, and between the IRES and the 3'-end of the poly(A) base sequence. In particular, when both BGH and IRES are included between the nucleotide sequence encoding the target protein or peptide and the poly(A) nucleotide sequence, the IRES is i) between the nucleotide sequence encoding the target protein or peptide and the BGH and ii) between the BGH and the poly(A) sequence. On the other hand, the IRES is an internal ribosome entry site or a ribosome binding site, and forms a loop structure on mRNA to initiate translation of mRNA. In particular, the IRES may be an IRES region of encephalomyocarditis virus (EMCV), and may specifically include or consist of the nucleotide sequence of SEQ ID NO: 3.

The mRNA construct of the present invention constructed as described above may be intended to be transformed into cells. The transformation means introducing a foreign nucleotide sequence into a cell, and the cell into which the foreign gene is introduced by transformation is called a transformant. On the other hand, when the foreign base sequence introduced into the cell as described above is inserted into the chromosome of the cell or exists in an independently replicable form, this is referred to as stable transformation or permanent transformation, otherwise it is called transient (transient) is called transformation. In particular, the mRNA construct of the present invention may be transformed into cells as mRNA itself, and in this case, the mRNA itself is not in a form capable of independently replicating in cells, and is degraded in cells over time. It is extinguished. The mRNA construct of the present invention may be for temporary transformation, or may be for maintaining the expression of the target protein or peptide by being stably maintained for a long time in the cytoplasm of the transformed cell.

In a specific embodiment of the present invention, an mRNA construct was designed in which poly(A) sequences of 40 nt, 150 nt and 310 nt lengths were linked downstream of the mRNA encoding the target protein, the chimeric antigen receptor. It was confirmed that the expression rate of the protein from the mRNA construct and the activity (cytotoxicity to cancer cells) by the protein were remarkably improved and sustained in the transient CAR-NK cells prepared by direct transformation of cells and primary NK cells.

Another aspect of the present invention provides a gene construct comprising a DNA sequence corresponding to or complementary to the nucleotide sequence of the mRNA construct of the present invention, and a vector comprising the gene construct.

The DNA nucleotide sequence corresponding to the nucleotide sequence of the mRNA construct means that only uracil (U) is changed to thymine (T) in the nucleotide sequence of the mRNA construct, and all other nucleotide sequences are the same DNA sequence. do. In addition, the DNA nucleotide sequence complementary to the mRNA construct means a DNA sequence having an antisense nucleotide sequence to a DNA nucleotide sequence corresponding to the nucleotide sequence of the mRNA construct.

A gene construct comprising a DNA sequence corresponding to or complementary to the nucleotide sequence of the mRNA construct of the present invention may be used in a form included in a vector for storage or utilization.

For example, in one embodiment, the vector itself can be transformed into cells. In this case, the gene construct is stably or permanently transformed, and the target protein or peptide can be expressed by transcribing and translating the target protein or peptide from the vector using the transcription and translation system of the transformant.

Meanwhile, in another embodiment, mRNA may be prepared using the vector as a template by in vitro transcription and transformed into cells. In this case, the mRNA may be transiently transformed, and the target protein or peptide may be translated using the transformant's translation system to express the target protein or peptide. In the case of mRNA obtained by in vitro transcription using the vector as a template, since the poly(A) nucleotide sequence is included downstream of the nucleotide sequence encoding the target protein or peptide, even when introduced into the cell, it exists very stably in the cytoplasm of the cell It is possible to express the target protein or peptide for a long time. Accordingly, another aspect of the present invention provides a method for producing mRNA with improved stability, comprising performing in vitro transcription using the vector as a template.

The in vitro transcription refers to a process of synthesizing RNA in vitro using RNA polymerase, its cofactor, NTP substrate, and template DNA, and is well known to those skilled in the art to which the present invention pertains. Therefore, those skilled in the art to which the present invention pertains can perform the above process in an appropriate manner.

In particular, in the case of the mRNA production method of the present invention, since a nucleotide sequence corresponding to or complementary to the poly(A) nucleotide sequence is included in the gene construct included in the vector, only in vitro transcription as described above is performed. and poly(A) tailing may not be performed separately or additionally in vitro after in vitro transcription.

In general, when mRNA is obtained through in vitro transcription, an additional poly(A) tailing process of polyadenylating the mRNA using poly(A) polymerase or the like for the obtained mRNA. should be performed. However, when poly(A) tailing is performed using poly(A) polymerase, the length of poly(A) connected to the downstream of mRNA cannot be constantly adjusted, and even several lengths of poly(A) There is a problem that it is not known exactly whether is connected. However, when the poly(A) sequence is included in the mRNA construct as in the present invention, it is possible to produce stable mRNA having a single length simply by in vitro transcription without the need to perform poly(A) tailing. will be.

In addition, another aspect of the present invention provides a transformant in which an mRNA construct in which the target protein or peptide is a chimeric antigen receptor (CAR) in the mRNA construct of the present invention is introduced into a cell.

The cells may be immune cells, and the immune cells may be used without limitation as long as they are cells capable of inducing immunity to induce a desired therapeutic effect, and peripheral blood, umbilical cord blood, bone marrow, tumor-infiltrating lymphocytes, lymph node tissue or thymus tissue may be used. It can be obtained from, and can be obtained by differentiating from placental cells, embryonic stem cells, induced pluripotent stem cells or hematopoietic stem cells. In addition, the immune cells can be obtained from human, monkey, chimpanzee, dog, cat, mouse, rat and transgenic species thereof as well as established cell lines.

The method for obtaining immune cells can use any means known in the art, and can be obtained from autologous, allogeneic or heterologous sources. "autologous" means any cell derived from the same individual that is subsequently reintroduced into the individual, "allogeneic" means any cell derived from another animal of the same species as the individual into which the cell is being introduced, and "xenogeneic" means a cell derived from another species of animal.

In particular, the immune cells are natural killer cells (NK cells), T cells, natural killer T cells (NKT cells), cytokine induced killer cells (CIK), macrophages , It may be any one selected from dendritic cells, etc., but is not limited thereto. Therefore, immune cells expressing the chimeric antigen receptor according to the present invention on the cell surface include CAR-NK cells (Chimeric Antigen Receptor Natural Killer Cell), CAR-T cells (Chimeric Antigen Receptor T Cell), and CAR-NKT cells (Chimeric Antigen Receptor Cell). Receptor Natural killer T Cell), CAR-macrophage (Chimeric Antigen Receptor Macrophage), and the like.

Since the immune cells provided in the present invention can control the onset (on) / stop (off) of a conventional chimeric antigen receptor response to target cells, subsequent cell therapy, the need to increase or decrease the activity of therapeutic cells It includes a safety switch that can be very beneficial in situations. For example, when immune cells expressing a chimeric antigen receptor are provided to a patient, in some circumstances there may be side effects, such as off-target toxicity. Or, for example, the therapeutic cells may act to reduce the number of tumor cells or tumor size, and may no longer be needed. In this situation, the treatment cells can be controlled so that they are no longer activated. In particular, the CAR-NK cells into which the chimeric antigen receptor was introduced into natural killer cells have problems due to the persistent toxicity of cancer immunotherapy when using conventional T cell-based CAR-T therapeutics, and autologous Not only can the risk of immune disease, the problem of graft-versus-host disease (GVHD) for xenogeneic cell transplantation, and the problem of off-target toxicity be solved through the on/off switch, but also various cancer cells It has the advantage of being able to be used as a general-purpose therapeutic agent by allowing it to be targeted.

Therefore, the transformant of the present invention can be used as an active ingredient in a pharmaceutical composition for preventing or treating cancer, and another aspect of the present invention is for preventing or treating cancer comprising the transformant as an active ingredient. A pharmaceutical composition is provided.

In the present invention, the term "cancer" is used synonymously with "tumor" and refers to or refers to a physiological condition in mammals that is typically characterized by unregulated cell growth/proliferation.

Cancer or carcinoma that can be treated with the pharmaceutical composition of the present invention is not particularly limited, and includes both solid cancer and hematological cancer. In particular, it may be a blood cancer such as the leukemia or lymphoma, specifically thymic carcinoma, non-Hodgkin lymphoma, diffuse large cell lymphoma, small lymphocytic cell lymphoma ( small lymphocytic lymphoma, T-cell neoplasma, peripheral T-cell lymphoma, mantle cell lymphoma, T-cell acute lymphocytic leukemia lymphobalstic lymphoma), chronic lymphoblastic leukemia, and the like.

In addition, the pharmaceutical composition of the present invention may include 1 to 10 times, 2 to 10 times, or 5 to 8 times the number of immune cells compared to the number of tumor cells of the subject to be treated, but is limited thereto. it is not going to be

Meanwhile, in the treatment of cancer, it is common to combine chemotherapy and radiation therapy. Anticancer agents used in chemotherapy induce apoptosis of proliferating cells, and radiation to enhance the therapeutic effect of anticancer agents increases such apoptosis. At this time, cells whose apoptosis is induced by anticancer agents and radiation are not limited to cancer cells, and may also affect immune cell therapy agents administered to individuals for immunotherapy.

Chemotherapy includes, but is not limited to, CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone), EPOCH (etoposide, vincristine, doxorubicin, cyclophosphamide, prednisone) or any other multi-drug regimen.

In the present invention, "cell therapy product" refers to cells and tissues manufactured through isolation, culture, and special manipulation from a subject, and is a drug (US FDA regulation) used for the purpose of treatment, diagnosis, and prevention, and is used to restore the function of cells or tissues. It refers to drugs used for the purpose of treatment, diagnosis, and prevention through a series of actions such as proliferation and selection of living autologous, allogeneic, or heterogeneous cells in vitro or changing the biological characteristics of cells in other ways.

Meanwhile, the pharmaceutical composition of the present invention may additionally include a pharmaceutical or pharmaceutically acceptable carrier. The meaning of 'pharmaceutically acceptable' is that it does not inhibit the activity of the active ingredient and does not have toxicity more than is adaptable to the subject of application (prescription), and the 'carrier' facilitates the addition of the compound into cells or tissues. defined as a compound that

The pharmaceutical composition of the present invention may be formulated in various forms for administration to a subject, and a representative formulation for parenteral administration is an injectable formulation, preferably an isotonic aqueous solution or suspension. Formulations for injection may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, it may be formulated for injection by dissolving each component in saline or a buffer solution. In addition, dosage forms for oral administration include, for example, ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. , sucrose, mannitol, sorbitol, cellulose and/or glycine) and lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). The tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid or Disintegrants such as sodium salts, absorbents, colorants, flavors and/or sweeteners may further be included. The formulation may be prepared by conventional mixing, granulating or coating methods.

In addition, the pharmaceutical composition of the present invention may further include adjuvants such as preservatives, hydrating agents, emulsification accelerators, salts or buffers for osmotic pressure control, and other therapeutically useful substances, and may be formulated according to conventional methods. .

The pharmaceutical composition according to the present invention can be administered through various routes including oral, transdermal, subcutaneous, intravenous or intramuscular, and the dosage of the active ingredient depends on the route of administration, age, sex, weight and severity of the patient. It can be appropriately selected according to several factors. In addition, the composition of the present invention can be administered in parallel with a known compound capable of enhancing the desired effect.

The route of administration of the pharmaceutical composition according to the present invention may be administered to humans and animals orally or parenterally, such as intravenously, subcutaneously, intranasally or intraperitoneally.

In the pharmaceutical composition of the present invention, the total effective amount of the transformant according to the present invention can be administered to the patient in a single dose, and a split treatment method in which multiple doses are administered for a long period of time ( fractionated treatment protocol). The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease, but is typically administered repeatedly several times a day at an effective dose of 100 μg to 3,000 mg per administration based on adults. . However, the concentration of the transformant can be determined by considering various factors such as the patient's age, weight, health condition, sex, disease severity, diet and excretion rate, as well as the drug administration route and number of treatments. can Therefore, considering this point, those skilled in the art can determine an appropriate effective dosage according to the specific use of the transformant as an anticancer agent, and the pharmaceutical composition according to the present invention exhibits the effect of the present invention. As long as the dosage form, route of administration and method of administration are not particularly limited.

In addition, the pharmaceutical composition of the present invention may further include a known anticancer agent in addition to the above-described transformant as an active ingredient, and may be used in combination with other known therapies for the treatment of these diseases.

In addition, another aspect of the present invention provides a method for preventing or treating cancer, comprising administering the transformant of the present invention to a subject in need of treatment.

The transformant of the present invention may be in the form of the above-described pharmaceutical composition, and a person skilled in the art to which the present invention belongs can determine an appropriate administration route and dosage of the pharmaceutical composition.

In addition, another aspect of the present invention provides the use of the transformant for the preparation of a drug for preventing or treating cancer.

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments will be illustrated in the drawings and described in detail in the detailed description. However, it should be understood that this is not intended to limit the present invention to specific embodiments, and includes all transformations, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of related known technologies may obscure the gist of the present invention, the detailed description will be omitted.

[실시예 1] [Example 1]

목적 단백질의 설계Design of target protein

A chimeric antigen receptor (CAR) configured as shown in FIG. 1 was designed as a target protein to be applied to the mRNA construct of the present invention and temporarily expressed in cells. Specifically, the chimeric antigen receptor includes an ectodomain that recognizes a target, a spacer (Myc-Hinge) that provides connection and flexibility of the ectodomain, a transmembrane domain that penetrates cell membranes, and It is constructed by sequentially connecting endodomains that induce cell signaling. In the present invention, the ScFv of an anti-CEACAM6 antibody recognizing CEACAM6 as an antigen with the ectodomain, the ScFv of an anti-cotinine antibody recognizing cotinine as an antigen, or an anti-EGFR affibody recognizing EGFR as an antigen On the other hand, by adopting CD28 and DAP10 as co-activators along with CD3ξ responsible for cytotoxic signaling as an endodomain, a chimeric antigen receptor having an anti-CEACAM6 scFv ( Anti-CEACAM6-CAR), a chimeric antigen receptor (anti-cotinine-CAR) having an anti-cotinine scFv, and a chimeric antigen receptor (ZEGFR-CAR) having an anti-EGFR Affibody were respectively designed. And the nucleotide sequence of the gene construct encoding it was inserted into the pBluescript SK(-) vector (Addgene) and the lenti-virus vector (Clontech, 632155), respectively.

[실시예 2] [Example 2]

자연살해 세포로의 일시적 형질전환(transient transfection)을 위한 최적 조건 확립Establishment of optimal conditions for transient transfection into natural killer cells

To establish optimal conditions for transient transformation of mRNA constructs into natural killer cells, GFP mRNA was injected into NK92 cells in an amount of 2 μg per 1×10 ⁶ cells while varying the voltage from 110 V to 200 V using the Nepa21 system. After transfection, expression of GFP in NK92 cells was examined.

As a result, as shown in FIG. 2, the survival rate of NK92 cells gradually decreased as the voltage increased, but it was confirmed that GFP was expressed in more than 90% of the surviving NK92 cells at a voltage of 150V or less, and in 110V conditions It was confirmed to exhibit the best cell viability and GFP expression rate. In addition, as a result of transfection with a voltage of 110 V by increasing the amount of mRNA treated per 1X10 ⁶ of NK92 cells from 2 μg to 5 μg, the expression rate was increased, and GFP expression was observed until 3 days after transfection. Based on this, 20 μg of mRNA per 1X10 ⁷ of NK92 cells was transfected at a voltage of 110 V to scale-up, and it was confirmed that the expression rate and persistence of expression were excellently maintained even in this case.

In addition, targeting primary NK cells matured by treating monocytes obtained by depleting CD3 ⁺ cells from cord blood with hydrocortisone and cytokines such as IL15 and IL21 for more than 7 days, GFP mRNA was transfected in an amount of 5 μg per cell 1X10 ⁶ while changing the voltage in the same manner as in the NK92 cells, and then the expression of GFP in primary NK cells was examined.

As a result, as shown in FIG. 3, the transformation efficiency was high in 190V and 200V conditions, and the best efficiency was shown in 200V conditions (FIG. 3).

[실시예 3] [Example 3]

자연살해 세포에서 목적 단백질의 일시적(Transient) 발현과 영구적 발현의 비교Comparison of transient and permanent expression of target protein in natural killer cells

From each of the pBluescript SK (-) vectors into which the nucleotide sequences of the gene constructs encoding anti-CEACAM6-CAR and anti-cotinine-CAR among the target proteins designed in Example 1 were inserted, in vitro transcription ( in vitro mRNAs of anti-CEACAM6-CAR and anti-cotinine-CAR were respectively obtained through transcription) and poly(A) tailing.

The mRNAs of the anti-CEACAM6-CAR and anti-cotinine-CAR obtained as above were transfected into NK92 cells with a voltage of 110 V using the Nepa 21 system used in Example 2 to obtain transient CAR-NK cells. First, the CAR expression pattern (expression rate and expression persistence) over time was confirmed through flow cytometry for the transient CAR-NK cells prepared as described above. As shown in FIG. 4, In the case of anti-CEACAM6-CAR, a high expression rate of 90% or more was maintained until 48 hours after mRNA injection, and the expression continued for 4 days, and in the case of anti-cotinine-CAR, an expression rate of 70% or more was shown until 16 hours after mRNA injection.

In addition, with respect to breast cancer cell line AU565, the cytotoxicity (or cell killing ability, cytolytic activity) of the transient CAR-NK cells prepared as described above was confirmed by Calcein AM assay. Specifically, after reacting by treating AU565 cells with Calcein-AM (life technologies; C1430) at a concentration of 5ug/ml (37°C, 5% CO2, 1 hour in the dark), AU565 cells stained with Calcein The transient CAR-NK cells were treated at a ratio of 10:1, 5:1, and 1:1 (natural killer cells:cancer cells), respectively, in 200ul of RPMI1640 (10% FBS) for 5.5 hours, 13 hours, 25 hours, After reacting for 50 hours and 82 hours (37 ° C, 5% CO ₂ ), 100 ul of the supernatant was taken to determine the amount of calcein present in the supernatant, and the cytotoxicity according to each condition was calculated in the following manner. At this time, the anti-cotinine-CAR-expressing transient CAR-NK cells were treated with the AU565 cells together with a cotinine-tagged conjugate to an antibody against EGFR.

Cytotoxicity (%) = (Calcein release value-spontaneous value according to conditions) / (maximum value-spontaneous value) x 100

As a result, as shown in FIG. 5, when the protein expression of the CARs is high after transfection of the mRNA of the anti-cotinine-CAR, the cytotoxicity to cancer cells is also high, and then the protein expression of the CARs decreases. Cytotoxicity was also found to be reduced.

On the other hand, each lenti-viral vector into which the nucleotide sequences of the gene constructs encoding the two target proteins, anti-CEACAM6-CAR and anti-cotinine-CAR, designed in Example 1 were inserted, were converted into viral packaging vectors (viral packaging vectors). vector; PMDLg/RRE, RSV/REV, VSVG) were transfected into HEK293T cells, and anti-CEACAM6-CAR and anti-cotinine-CAR-expressing lentiviruses were obtained therefrom. After concentrating the lentivirus using an ultra-high-speed centrifugal separator, infecting HEK293T cells with the concentrated lentivirus, the amount of the Myc epitope of CD5-CAR was confirmed by flow cytometry to determine the infection unit was calculated. Calculate the number of natural killer cells and the amount of lentivirus so that the multiplicity of infection (MOI) is 30, and spinoculate lentiviruses expressing anti-CEACAM6-CAR and anti-cotinine-CAR in NK92 cells, respectively (360g, 90min, RT) to construct stable CAR-NK cells.

For the permanent CAR-NK cells prepared as described above, the CAR expression pattern (expression rate and expression persistence) and cytotoxicity over time were confirmed in the same manner as in the transient CAR-NK cells.

As a result, as shown in Figure 4, in the case of anti-CEACAM6-CAR, like transient CAR-NK cells, a high expression rate of 90% or more was maintained until 48 hours, and the expression continued for 4 days, and anti-cotinine-CAR In the case of , it was confirmed that the expression rate of less than 40% lasted for 2 days. In addition, as shown in FIG. 5 , cytotoxicity was confirmed to exhibit the same pattern as protein expression of CARs as in transient CAR-NK cells.

[실시예 4] [Example 4]

공-활성자(co-activator)를 포함하는 키메릭 항원 수용체의 발현율 및 암세포에 대한 세포독성(cytotoxicity) 확인Confirmation of expression rate of chimeric antigen receptor containing co-activator and cytotoxicity against cancer cells

In order to evaluate the function of each part constituting the endodomain of the chimeric antigen receptor designed in Example 1 and the effect on mRNA expression, as shown in FIG. 6, the ZEGFR- Based on CAR, ΔEcto-TM-10z, a modified ZEGFR-CAR without an ectodomain, and three types of modified ZEGFR-CARs (ZEGFR-TM, ZEGFR-TM-10 and ZEGFR- TM-z) were designed, and the nucleotide sequences of gene constructs encoding them were inserted into a lenti-viral vector (Clontech, 632155).

From a lenti-viral vector containing the nucleotide sequence of the gene construct encoding the ZEGFR-CAR and the four modified ZEFGR-CARs, through in vitro transcription and poly (A) tailing, the mRNAs of 5 CARs were obtained. In addition, the mRNAs were transfected into NK92 cells with a voltage of 110V using the Nepa 21 system used in Example 2 to prepare transient CAR-NK cells. CAR expression and cytotoxicity of the transient CAR-NK cells were measured in the same manner as in Example 3 for the 5 types of transient CAR-NK cells prepared as described above.

As a result, as shown in FIG. 7, compared to ZEGFR-TM and ZEGFR-TM-z without DAP10, ZEGFR-TM-10 with DAP10 and ZEGFR-CAR designed in Example 1 (ZEGFR-TM-z) 10z), it was confirmed that the CAR expression rate was improved (FIG. 7(A)), and the apoptosis rate of NK cells caused by the CAR protein was also reduced (FIG. 7(D)). In addition, in the case of the ZEGFR-CAR (ZEGFR-TM-10z) designed in Example 1 having both DAP10 and CD3ξ, not only enhances the expression of CD107a in NK92 cells (FIG. 7(B)), but actually breast cancer cell line It was confirmed that the cytotoxicity of transient CAR-NK cells to AU565 was also greatly improved (FIG. 7(C)).

In addition, based on the ZEGFR-CAR designed in Example 1, a modified ZEGFR-CAR (ZEGFR-MH-TM-10z-B) in which the ITAM motif of CD28 was removed was designed, respectively, and obtained by the method described above. The mRNA of the modified ZEGFR-CAR was transformed into NK92 cells as described above to prepare transient CAR-NK cells, and CAR expression and cytotoxicity of the transient CAR-NK cells were measured as described above. measured.

As a result, as shown in FIG. 8, in the case of the modified ZEGFR-CAR (ZEGFR-MH-TM-10z-B) in which the ITAM motif of CD28 is removed, the ZEGFR-CAR designed in Example 1 (in FIG. 8) Example containing the ITAM motif of CD28 as well as the cytotoxicity of transient CAR-NK cells against the breast cancer cell line AU565, as well as the lowered CAR expression rate compared to 'ZEGFR-MH-TM-28-10z-B') It was confirmed that it fell short of the ZEGFR-CAR designed in 1.

Finally, based on the ZEGFR-CAR designed in Example 1, modified ZEGFR-CARs having a 4-1BB motif or a 2B4 motif instead of the DAP10 motif ('ZEGFR-MH-BBz' and 'ZEGFR-MH-2B4z, respectively) ') was designed, respectively, and the above obtained by the method described above

The mRNA of the modified ZEGFR-CARs was transformed into NK92 cells as described above to prepare transient CAR-NK cells, and CAR expression and cytotoxicity of the transient CAR-NK cells were measured as described above. .

As a result, as shown in FIGS. 9 and 10, in the case of the modified ZEGFR-CARs having the 4-1BB motif or the 2B4 motif, the expression rate of the CAR was higher than that of the ZEGFR-CAR designed in Example 1 having the DAP10 motif. In addition, it was confirmed that the cytotoxicity of transient CAR-NK cells against breast cancer cell line AU565 was also inferior to that of ZEGFR-CAR designed in Example 1.

From the above results, it can be seen that the ZEGFR-CAR designed in Example 1 having both CD28 and DAP10 together with CD3ξ as the endodomain is the most effective in terms of both the CAR expression rate and the cytotoxicity of transient CAR-NK cells. can

[실시예 5] [Example 5]

mRNA의 구조적 안정성 및 목적 단백질의 발현 향상을 위한 구성 확인Confirmation of the structure for improving the structural stability of mRNA and the expression of the target protein

[5-1] [5-1] 목적 단백질에 대한 mRNA 구조체 설계 및 제작Design and manufacture of mRNA constructs for target proteins

In order to confirm the role of 5'-UTR and 3'-UTR in the structural stability of mRNA for the target protein and the expression of the protein, 5'-UTR and 5'-UTR were tested for the ZEGFR-CAR designed in Example 1 above. The 3'-UTR was variously modified to design mRNA constructs 1 to 7 as described in Table 1 below. Figure 11a is a schematic diagram of the constructs arranged next to the T7 promoter in the template vector for synthesizing the 7 types of mRNA constructs listed in Table 1 below, and Table 2 below is introduced into the 5'-UTR and 3'-UTR of ZEGFR-CAR. It shows the DNA sequence of one component.

구조체 No.Structure No.	명명denomination	mRNA SizemRNA Size
1One	CAR(실시예 1에서 설계한 ZEGFR-CAR)CAR (ZEGFR-CAR designed in Example 1)	1286 bp1286 bp
22	CAR-BGHCAR-BGH	1519 bp1519 bp
33	5U-CAR5U-CAR	1345 bp1345 bp
44	5U-CAR-BGH5U-CAR-BGH	1578 bp1578 bp
55	5U-CAR-IRES-BGH5U-CAR-IRES-BGH	2164 bp2164 bp
66	5U-CAR-reIRES-BGH5U-CAR-reIRES-BGH	2164 bp2164 bp
77	5U-IRES-CAR-BGH5U-IRES-CAR-BGH	2164 bp2164 bp

ee	유전자gene	염기서열base sequence
1One	5U(β-globin UTR)5U (β-globin UTR)	ACATTTGCTTCTGACATAGTTGTGTTGACTCACAACCCCAGAAACAGACATCC ACATTTGCTTCTGACATAGTTGTGTTGACTCACAACCCCAGAAACAGACATCC
22	BGH BGH	GCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGA	TTGGGAAGACAATAGCAGGCATGCTGGGGAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGA
33	EMCV-IRESEMCV-IRES	TCCCCCTCTCCCTCCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGTTGATAATTTGTCCCCCTCTCCCTCCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGTTGATAATTTG

The base sequences of the gene constructs encoding the 7 types of mRNA constructs designed as described above were inserted into the pBluescript SK(-) vector (Addgene), and in vitro transcription and mRNA constructs 1 to 7 were prepared by poly(A) tailing.

As shown in FIG. 11b, 5'-Cap and 3'-Poly (A) tails are bound to the 7 types of mRNAs obtained as described above.

[5-2] [5-2] mRNA 구조체의 구조적 안정성(structural stability) 평가Evaluation of structural stability of mRNA constructs

The 7 types of mRNAs obtained in Example [5-1] were transfected into NK92 cells with a voltage of 110 V using the Nepa 21 system used in Example 2 to prepare transient CAR-NK cells. . For the transient CAR-NK cells prepared as described above, the amount of mRNA remaining in the cytoplasm after being injected into NK92 cells over time was confirmed by RT-PCR.

First, the remaining amount of mRNA at the time point 4 hours after the mRNA was injected into NK92 cells as described above, as confirmed in (A) of FIG. 12, CAR > 5U-CAR > CAR-BGH > 5U- In the order of CAR-BGH > 5U-CAR-IRES-BGH, it can be seen that the amount of mRNA remaining in NK92 cells is high (Fig. 12 (A) and Table 1). Next, mRNA was injected into NK92 cells. As a result of evaluating the residual amount of mRNA at the time point of 8 hours after setting the residual amount of mRNA at the time of 4 hours to 1, as shown in FIG. 12 (B) and (C), mRNA By the presence of 5'-β-globin in the 5'-UTR part of the construct, it was confirmed that 5U-CAR showed 36.9% better stability than CAR and 5U-CAR-BGH showed 35.9% better stability than CAR-BGH. By the presence of 3'-BGH in the '-UTR part, it was confirmed that the stability of CAR-BGH was 20.2% higher than that of CAR, and the stability of 5U-CAR-BGH was improved by 19.1% than that of 5U-CAR. In addition, 5U-CAR-BGH containing both 5'-β-globin and 3'-BGH in the 5'-UTR and 3'-UTR portions of the mRNA structure was confirmed to exhibit 56.1% improved stability than CAR.

From the above results, it can be seen that 5'-β-globin and 3'-BGH present in the 5'-UTR and 3'-UTR portions of the mRAN structure, respectively, increase the structural stability of mRNA.

[5-3] [5-3] 번역 안정성(translational stability) 평가Evaluation of translational stability

Furthermore, for the 7 types of transient CAR-NK cells prepared in Example [5-2], the expression level of the CAR protein expressed at 8 hours after the mRNA was injected into NK92 cells was measured. As criterion (1), the translational stability of the mRNA construct over time was evaluated.

As a result, in the case of the protein expression level at 18 hours after the mRNA was injected into NK92 cells, as shown in FIG. 13, CAR -BGH showed a 28.4% higher protein expression rate than CAR, and 5U-CAR-BGH showed a 24.3% higher protein expression rate than 5U-CAR due to the presence of 5'-β-globin in the 5'-UTR part of the mRNA structure, mRNA It was confirmed that 5U-CAR-IRES-BGH exhibited a 33.3% higher protein expression rate than 5U-CAR-BGH due to the additional presence of EMCV-IRES in the 3'-UTR portion of the construct. On the other hand, it was confirmed that the protein expression rate rapidly decreased when the shape of the loop structure for translation was modified by inserting EMCV-IRES in the reverse direction and when EMCV-IRES was placed in the 5'-UTR part.

Considering the above results comprehensively, it is judged that EMCV-IRES present in the forward direction in the 3'-UTR portion of the mRNA construct greatly contributes to the translational stability of mRNA.

[5-4] [5-4] 세포용해 활성(cytolytic activity) 평가Evaluation of cytolytic activity

Subsequently, 7 types of transient CAR-NK cells prepared in Example [5-2] were injected into NK92 cells, and 18 hours later, the same method as in Example 3 was performed. The transient CAR-NK cells were treated with breast cancer cell line AU565 and lung cancer cell line A549, respectively, and cytotoxicity to cancer cells was evaluated.

As a result, as shown in FIG. 14, with respect to both the breast cancer cell line AU565 and the lung cancer cell line A549, the transient CAR-NK cells had a level and pattern corresponding to the protein expression rate confirmed in Example 5-3. The cytotoxicity of was confirmed, and the secretion of IFNγ and TNFα, which are a series of reactions occurring during the cell lysis process, was also confirmed to appear at the level and pattern corresponding to the protein expression rate confirmed in Example 5-3.

[5-5] [5-5] IRES-BGH와 BGH-IRES의 비교Comparison of IRES-BGH and BGH-IRES

On the other hand, in order to confirm the effect of the IRES and BGH sequences located in the 3'-UTR of the mRNA structure on the structural stability, translational stability and cytotoxicity of mRNA, the anti-cotinine-CAR designed in Example 1 was targeted. 5'-UTR and 3'-UTR were designed as shown in Table 3 below, and mRNA was obtained in the same manner as in Example [5-1], followed by electrophoresis. The mRNA obtained as described above has a 5'-Cap and a 3'-Poly(A) tail bound thereto, similarly to the mRNA obtained in Example [5-1].

mRNA 구조체mRNA structure	구조rescue
UTR-COT-MH-10Z-IRES-BGHUTR-COT-MH-10Z-IRES-BGH
UTR-COT-MH-10Z-BGH-IRESUTR-COT-MH-10Z-BGH-IRES

As a result, as shown in FIG. 15a, in the case of the 'UTR-CAR-BGH-IRES' structure in which the IRES forming a complex secondary structure is located behind BGH, the IRES is included during mRNA synthesis during in vitro transcription. Two bands of the transcript and the IRES-deleted transcript were identified, whereas in the case of the 'UTR-CAR-IRES-BGH' construct in which the IRES is located in front of the BGH, a single band of the transcript containing the IRES was identified. only confirmed

In addition, the mRNA obtained as described above was transformed into NK92 cells in the same manner as in Examples [5-2] to [5-4], and structural stability, translational stability, and cytotoxicity of the mRNA construct were evaluated.

As a result, as shown in FIG. 15B, it was confirmed that the 'UTR-CAR-IRES-BGH' construct exhibited higher protein expression levels and higher cytotoxicity than the 'UTR-CAR-BGH-IRES' construct. .

[실시예 6] [Example 6]

Poly (A) tail이 목적 단백질의 발현에 미치는 영향 확인Confirmation of the effect of Poly (A) tail on the expression of the target protein

First, based on structure 5 (5U-CAR-IRES-BGH) designed in Example [5-1], as shown in Table 4 below, 40 bp, 150 bp or 310 bp poly (A) Design mRNA constructs with added sequences (

structures

2, 3, and 4 in Table 4 below), and insert the base sequences of the gene constructs encoding them into the pBluescript SK(-) vector (Addgene), respectively. did From each of the pBluescript SK(-) vectors prepared as described above,

mRNAs having structures

2, 3 and 4 in Table 4 below were obtained through only in vitro transcription without poly(A) tailing.

On the other hand, from the pBluescript SK(-) vector into which the nucleotide sequence of the gene construct encoding the 5th construct designed in Example [5-1] was inserted, only through in vitro transcription without poly(A) tailing, respectively. mRNA having structure No. 1 of Table 4 below and mRNA having structure No. 5 in Table 4 below were obtained through both in vitro transcription and poly(A) tailing.

mRNA 구조체 mRNA structure		구조rescue
1. 5U-CAR-IRES-BGH1. 5U-CAR-IRES-BGH
2. 5U-CAR-IRES-BGH-PA402. 5U-CAR-IRES-BGH-PA40
3. 5U-CAR-IRES-BGH-PA1503. 5U-CAR-IRES-BGH-PA150
4. 5U-CAR-IRES-BGH-PA3104. 5U-CAR-IRES-BGH-PA310
5. 5U-CAR-IRES-BGH-PolyA5. 5U-CAR-IRES-BGH-PolyA

As a result, structures No. 2, 3, and 4 in Table 4 are designed so that poly(A) tails exist in the structures themselves, so poly(A) tailing does not proceed separately after in vitro transfer, and structure No. 5 in Table 4 is Although the poly(A) tail does not exist in the structure itself, the poly(A) tail is attached by additional poly(A) tailing after in vitro transcription.

The 5 types of mRNs designed and obtained as described above were transformed into NK92 cells and primary NK cells under optimal conditions in the same manner as in Example 2 above to construct transient CAR-NK cells. In the same manner as in [5-3] and Example [5-4], the protein expression level of CAR and its cytotoxicity to cancer cells were confirmed.

First, as a result of comparing structure 1 and structure 5, as shown in FIGS. 16A and 16B, compared to structure 5 including a poly (A) tail, structure 1 without a poly (A) tail In this case, despite the presence of BGH, which increases stability, and IRES, which increases translational stability, in the 3'-UTR of the mRNA construct, it was confirmed that the CAR protein expression or cytotoxicity against breast cancer cell line AU565 was significantly low (FIG. 16a, Figure 16b).

On the other hand, in the case of constructs No. 2 to 4 having a poly(A) tail in the construct itself, in NK92 cells, construct No. 2 is more effective in protein expression or breast cancer cell line AU65 than construct No. 1 without the poly(A) tail. Although the cytotoxicity was high, it was confirmed that the protein expression or cytotoxicity to the breast cancer cell line AU565 was lower than that of

constructs

3 and 4, respectively. In addition, constructs 3 and 4 of Nos. 3 and 4 were confirmed to stably express the protein and exhibit cytotoxicity at a level or aspect corresponding to the expression rate (FIG. 16a). On the other hand, in primary NK cells, construct 5 showed the highest level of protein expression, but the cytotoxicity against breast cancer cell line AU565 was found to be highest in construct 3 containing 150 bp of adenosine (A) (FIG. 16b ).

From the above results, compared to the poly (A) tail that is additionally synthesized in the mRNA structure depending on the enzyme activity and reaction time, when the poly (A) tail itself is designed to be included in the mRNA structure, the gene construct encoding it Since an mRNA construct containing a poly(A) tail can be generated through in vitro transcription only without a separate poly(A) tailing process from a template recombinant vector containing the nucleotide sequence of the nucleotide sequence, a single-sized mRNA construct is produced when the mRNA construct is produced. In addition to production, there are advantages in that the mRNA construct synthesis process itself is reduced and the quality control of the mRNA construct is facilitated.

As above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims

A nucleotide sequence encoding a target protein or peptide; and a poly(A) sequence having a length of 20 nt to 500 nt linked downstream of the nucleotide sequence encoding the target protein or peptide.
The method of claim 1,

The mRNA construct further comprising a 5'-β-globin UTR region upstream of the nucleotide sequence encoding the target protein or peptide.
The method of claim 2,

The mRNA construct further comprising BGH between the nucleotide sequence encoding the target protein or peptide and the poly (A) nucleotide sequence.
The method of claim 3,

The mRNA construct further comprising an IRES between the nucleotide sequence encoding the target protein or peptide and the poly (A) nucleotide sequence.
The method of claim 4,

The IRES is an mRNA construct that is included in at least one of i) between the nucleotide sequence encoding the target protein or peptide and the BGH, and ii) between the BGH and the poly (A) nucleotide sequence.
The method of claim 1,

The poly (A) nucleotide sequence has a length of 100nt to 350nt mRNA construct.
The method according to any one of claims 1 to 6,

Wherein the mRNA construct is to be transformed into a cell.
The method according to any one of claims 1 to 6,

The target protein or peptide is an mRNA construct that is a chimeric antigen receptor (Chimeric Antigen Receptor, CAR).
A gene construct comprising a DNA sequence corresponding to or complementary to the nucleotide sequence of the mRNA construct according to any one of claims 1 to 6.
A vector comprising the gene construct of claim 9.
A method for producing mRNA with improved stability, comprising performing in vitro transcription using the vector of claim 10 as a template.
The method of claim 11,

A method for producing mRNA with improved stability, wherein poly (A) tailing is not performed in vitro after the in vitro transcription.
A transformant in which the mRNA construct of claim 8 is introduced into a host cell.
The method of claim 13,

The transformant wherein the host cell is an immune cell.
A cell therapy composition comprising the transformant of claim 13 as an active ingredient.
The method of claim 15

The cell therapy agent is a cell therapy composition that is an anti-cancer agent.
The method of claim 16

The cell therapy composition of which the cancer is a solid cancer.