WO2022247936A1 - Animal non humain génétiquement modifié avec cd36 humaine ou chimérique - Google Patents

Animal non humain génétiquement modifié avec cd36 humaine ou chimérique Download PDF

Info

Publication number
WO2022247936A1
WO2022247936A1 PCT/CN2022/095669 CN2022095669W WO2022247936A1 WO 2022247936 A1 WO2022247936 A1 WO 2022247936A1 CN 2022095669 W CN2022095669 W CN 2022095669W WO 2022247936 A1 WO2022247936 A1 WO 2022247936A1
Authority
WO
WIPO (PCT)
Prior art keywords
exon
animal
human
endogenous
chimeric
Prior art date
Application number
PCT/CN2022/095669
Other languages
English (en)
Inventor
Chang Liu
Chengzhang SHANG
Huilin LI
Original Assignee
Biocytogen Pharmaceuticals (Beijing) Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biocytogen Pharmaceuticals (Beijing) Co., Ltd. filed Critical Biocytogen Pharmaceuticals (Beijing) Co., Ltd.
Publication of WO2022247936A1 publication Critical patent/WO2022247936A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A01K2267/0325—Animal model for autoimmune diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/60—Vectors containing traps for, e.g. exons, promoters
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/24—Immunology or allergic disorders
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/70—Mechanisms involved in disease identification
    • G01N2800/7023—(Hyper)proliferation
    • G01N2800/7028—Cancer
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) CD36, and methods of use thereof.
  • the immune system has developed multiple mechanisms to prevent deleterious activation of immune cells.
  • One such mechanism is the intricate balance between positive and negative costimulatory signals delivered to immune cells.
  • Targeting the stimulatory or inhibitory pathways for the immune system is considered to be a potential approach for the treatment of various diseases, e.g., cancers and autoimmune diseases.
  • This disclosure is related to an animal model with human CD36 or chimeric CD36.
  • the animal model can express human CD36 or chimeric CD36 (e.g., humanized CD36) protein in its body. It can be used in the studies on the function of CD36 gene, and can be used in the screening and evaluation of anti-human CD36 antibodies.
  • the animal models prepared by the methods described herein can be used in drug screening, pharmacodynamics studies, treatments for immune-related diseases, and cancer therapy for human CD36 target sites; they can also be used to facilitate the development and design of new drugs, and save time and cost.
  • this disclosure provides a powerful tool for studying the function of CD36 protein and a platform for screening cancer drugs.
  • the disclosure provides a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric CD36 (cluster of differentiation 36) .
  • the sequence encoding the human or chimeric CD36 is operably linked to an endogenous regulatory element at the endogenous CD36 gene locus in the at least one chromosome.
  • the sequence encoding a human or chimeric CD36 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human CD36 (NP_000063.2 (SEQ ID NO: 2) ) .
  • the sequence encoding a human or chimeric CD36 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 10.
  • the sequence encoding a human or chimeric CD36 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 30-439 of SEQ ID NO: 2.
  • the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse.
  • the animal does not express endogenous CD36 or expresses a decreased level of endogenous CD36. In some embodiments, the animal has one or more cells expressing human or chimeric CD36.
  • the animal has one or more cells expressing human or chimeric CD36, and the expressed human or chimeric CD36 can interact with human collagen types I and IV, thrombospondin, erythrocytes parasitized with Plasmodium falciparum, platelet-agglutinating protein p37, and/or oxidized low density lipoprotein and long-chain fatty acids.
  • the animal has one or more cells expressing human or chimeric CD36, and the expressed human or chimeric CD36 can interact with endogenous collagen types I and IV, thrombospondin, erythrocytes parasitized with Plasmodium falciparum, platelet-agglutinating protein p37, and/or oxidized low density lipoprotein and long-chain fatty acids.
  • the disclosure provides a genetically-modified, non-human animal.
  • the genome of the animal comprises a replacement of a sequence encoding a region of endogenous CD36 with a sequence encoding a corresponding region of human CD36 at an endogenous CD36 gene locus.
  • the sequence encoding the corresponding region of human CD36 is operably linked to an endogenous regulatory element at the endogenous CD36 locus, and one or more cells of the animal expresses a human or chimeric CD36.
  • the animal does not express endogenous CD36 or expresses a decreased level of endogenous CD36.
  • the replaced locus is the extracellular region of CD36.
  • the animal has one or more cells expressing a chimeric CD36 having a first cytoplasmic region, a first transmembrane region, an extracellular region, a second transmembrane region, and a second cytoplasmic region, optionally from N-terminus to C-terminus.
  • the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the extracellular region of human CD36.
  • the extracellular region of the chimeric CD36 has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 405, 406, 407, 408, 409, or 410 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human CD36.
  • the sequence encoding a region of endogenous CD36 comprises exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and/or exon 15, or a part thereof, of the endogenous CD36 gene.
  • the animal is a mouse.
  • the animal is heterozygous with respect to the replacement at the endogenous CD36 gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous CD36 gene locus.
  • the disclosure provides a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous CD36 gene locus, a sequence encoding a region of endogenous CD36 with a sequence encoding a corresponding region of human CD36.
  • the sequence encoding the corresponding region of human CD36 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and/or exon 14, or a part thereof, of a human CD36 gene.
  • the sequence encoding the corresponding region of human CD36 comprises a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and a portion of exon 14, of a human CD36 gene.
  • sequence encoding the corresponding region of human CD36 encodes amino acids 30-439 of SEQ ID NO: 2.
  • the region is located within the extracellular region of CD36.
  • the sequence encoding a region of endogenous CD36 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and/or exon 16, or a part thereof, of the endogenous CD36 gene.
  • the animal is a mouse, and the sequence encoding a region of endogenous CD36 comprises a portion of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and a portion of exon 15 of the endogenous CD36 gene.
  • the disclosure provides a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a chimeric CD36 polypeptide.
  • the chimeric CD36 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CD36.
  • the animal expresses the chimeric CD36 polypeptide.
  • the chimeric CD36 polypeptide has at least 50, at least 80, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, or at least 400 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CD36 extracellular region.
  • the chimeric CD36 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 30-439 of SEQ ID NO: 2.
  • the nucleotide sequence is operably linked to an endogenous CD36 regulatory element of the animal.
  • the chimeric CD36 polypeptide comprises one or more of the following: an endogenous CD36 first cytoplasmic region, an endogenous CD36 first transmembrane region, an endogenous CD36 second transmembrane region, and an endogenous CD36 second cytoplasmic region.
  • the nucleotide sequence is integrated to an endogenous CD36 gene locus of the animal.
  • the chimeric CD36 polypeptide has at least one mouse CD36 activity and/or at least one human CD36 activity.
  • the disclosure provides a method of making a genetically-modified animal cell that expresses a chimeric CD36, the method comprising: replacing at an endogenous CD36 gene locus, a nucleotide sequence encoding a region of endogenous CD36 with a nucleotide sequence encoding a corresponding region of human CD36, thereby generating a genetically-modified animal cell that includes a nucleotide sequence that encodes the chimeric CD36.
  • the animal cell expresses the chimeric CD36.
  • the animal is a mouse.
  • the chimeric CD36 comprises an extracellular region of human CD36; and a first cytoplasmic region, a first transmembrane region, a second transmembrane region, and a second cytoplasmic region of mouse CD36.
  • the nucleotide sequence encoding the chimeric CD36 is operably linked to an endogenous CD36 regulatory region, e.g., promoter.
  • the animal further comprises a sequence encoding an additional human or chimeric protein.
  • the additional human or chimeric protein is programmed cell death protein 1 (PD-1) , programmed cell death ligand 1 (PD-L1) , T-Cell immunoreceptor with Ig and ITIM Domains (TIGIT) , or CD226.
  • PD-1 programmed cell death protein 1
  • PD-L1 programmed cell death ligand 1
  • TAGIT T-Cell immunoreceptor with Ig and ITIM Domains
  • CD226 CD226.
  • the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.
  • the additional human or chimeric protein is PD-1, PD-L1, TIGIT, or CD226.
  • the disclosure provides a method of determining effectiveness of an anti-CD36 antibody for the treatment of cancer, comprising: a) administering the anti-CD36 antibody to the animal as described herein; and b) determining inhibitory effects of the anti-CD36 antibody to the tumor.
  • the animal has a tumor.
  • the tumor comprises one or more cells that express CD36.
  • the tumor comprises one or more cancer cells that are injected into the animal.
  • determining inhibitory effects of the anti-CD36 antibody to the tumor involves measuring the tumor volume in the animal.
  • the cancer is ovarian cancer, gastric cancer, glioblastoma, oral squamous cell carcinoma, lung cancer, cervical cancer, bladder cancer, prostate cancer, or breast cancer.
  • the disclosure provides a method of determining effectiveness of an anti-CD36 antibody and an additional therapeutic agent for the treatment of cancer, comprising a) administering the anti-CD36 antibody and the additional therapeutic agent to the animal as described herein; and b) determining inhibitory effects on the tumor.
  • the animal has a tumor.
  • the animal further comprises a sequence encoding a human or chimeric programmed cell death protein 1 (PD-1) . In some embodiments, the animal further comprises a sequence encoding a human or chimeric programmed death-ligand 1 (PD-L1) . In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody or an anti-PD-L1 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD36 or PD-L1.
  • the tumor is caused by injection of one or more cancer cells into the animal.
  • determining inhibitory effects of the treatment involves measuring the tumor volume in the animal.
  • the animal has ovarian cancer, gastric cancer, glioblastoma, oral squamous cell carcinoma, lung cancer, cervical cancer, bladder cancer, prostate cancer, or breast cancer.
  • the disclosure provides a method of determining effectiveness of an anti-CD36 antibody for treating an autoimmune disorder, comprising: a) administering the anti-CD36 antibody to the animal as described herein, wherein the animal has the autoimmune disorder; and b) determining effects of the anti-CD36 antibody for treating the auto-immune disease.
  • the autoimmune disorder is rheumatoid arthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, and/or scleroderma.
  • the disclosure provides a method of determining effectiveness of an anti-CD36 antibody for treating an immune disorder, comprising: a) administering the anti-CD36 antibody to the animal as described herein, wherein the animal has the immune disorder; and b) determining effects of the anti-CD36 antibody for treating the immune disorder.
  • the immune disorder is allergy, asthma, and/or atopic dermatitis.
  • the disclosure provides a protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:
  • amino acid sequence that comprises a substitution, a deletion and /or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 11.
  • the disclosure provides a nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:
  • the disclosure is related to a cell comprising the protein and/or the nucleic acid as described herein.
  • the disclosure is related to an animal comprising the protein and/or the nucleic acid as described herein.
  • the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous CD36 gene, wherein the disruption of the endogenous CD36 gene comprises deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and/or exon 16, or part thereof of the endogenous CD36 gene.
  • the disruption of the endogenous CD36 gene comprises deletion of one or more exons or part of exons selected from the group consisting of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and exon 15 of the endogenous CD36 gene.
  • the disruption of the endogenous CD36 gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, and intron 14 of the endogenous CD36 gene.
  • deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, or more nucleotides.
  • the disruption of the endogenous CD36 gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 260, 270, 280, 290, or 300 nucleotides of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and/or exon 16 (e.g., deletion of at least 200 nucleotides from exon 4, exons 5-14, and at least 150 nucleotides from exon 15) .
  • the disclosure further relates to a CD36 genomic DNA sequence of a humanized mouse, a DNA sequence obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence; a construct expressing the amino acid sequence thereof; a cell comprising the construct thereof; a tissue comprising the cell thereof.
  • the disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the development of a product related to an immunization processes of human cells, the manufacture of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
  • the disclosure also relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and /or a therapeutic strategy.
  • the disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the methods as described herein, in the screening, verifying, evaluating or studying the CD36 gene function, human CD36 antibodies, the drugs or efficacies for human CD36 targeting sites, and the drugs for immune-related diseases and antitumor drugs.
  • FIG. 1 is a schematic diagram showing mouse and human CD36 gene loci.
  • FIG. 2 is a schematic diagram showing humanized CD36 gene locus.
  • FIG. 3 is a schematic diagram showing a CD36 gene targeting strategy.
  • FIG. 4 shows Southern Blot results of cells after recombination using the 5’ Probe and 3’ Probe.
  • WT is a wild-type control.
  • FIG. 5 is a schematic diagram showing the Flp recombination process in CD36 gene humanized mice.
  • FIGS. 6A-6D show mouse tail PCR identification results of F1 generation mice by primer pairs WT-F/WT-R, WT-F/Mut-R, Frt-F/Frt-R, and Flp-F/Flp-R, respectively.
  • M is a marker.
  • PC is a positive control.
  • WT is a wild-type control.
  • H 2 O is a water control.
  • FIGS. 7A-7C show RT-PCR detection results of mouse CD36 mRNA, humanized CD36 mRNA, and GAPDH mRNA, respectively, in lung tissues of wild-type C57BL/6 mice (+/+) and CD36 gene humanized homozygous mice (H/H) .
  • M is a marker.
  • H 2 O is a water control.
  • GAPDH is an internal reference.
  • FIG. 8 shows the percentages of leukocyte subtypes in the spleen of C57BL/6 wild-type mice and CD36 gene humanized homozygous mice (H/H) .
  • FIG. 9 shows the percentages of T cell subtypes in the spleen of C57BL/6 wild-type mice and CD36 gene humanized homozygous mice (H/H) .
  • FIG. 10 shows the percentages of leukocyte subtypes in the peripheral blood of C57BL/6 wild-type mice and CD36 gene humanized homozygous mice (H/H) .
  • FIG. 11 shows the percentages of T cell subtypes in the peripheral blood of C57BL/6 wild-type mice and CD36 gene humanized homozygous mice (H/H) .
  • FIG. 12 shows the percentages of leukocyte subtypes in the lymph nodes of C57BL/6 wild-type mice and CD36 gene humanized homozygous mice (H/H) .
  • FIG. 13 shows the percentages of T cell subtypes in the lymph nodes of C57BL/6 wild-type mice and CD36 gene humanized homozygous mice (H/H) .
  • FIG. 14 shows the body weight of CD36 gene humanized homozygous mice that were xenografted with mouse colon cancer cells (MC38) , and then treated with anti-human CD36 antibody 1G04 at 3 mg/kg (G2) or 10 mg/kg (G3) .
  • G1 group mice were injected with PBS (G1) as a control.
  • FIG. 15 shows the body weight change of CD36 gene humanized homozygous mice that were xenografted with mouse colon cancer cells (MC38) , and then treated with anti-human CD36 antibody 1G04 at 3 mg/kg (G2) or 10 mg/kg (G3) .
  • G1 group mice were injected with PBS (G1) as a control.
  • FIG. 16 shows the tumor volume of CD36 gene humanized homozygous mice that were xenografted with mouse colon cancer cells (MC38) , and then treated with anti-human CD36 antibody 1G04 at 3 mg/kg (G2) or 10 mg/kg (G3) .
  • G1 group mice were injected with PBS (G1) as a control.
  • FIG. 17 shows the alignment between human CD36 amino acid sequence (NP_000063.2; SEQ ID NO: 2) and mouse CD36 amino acid sequence (NP_001153030.1; SEQ ID NO: 1) .
  • FIG. 18 shows the alignment between human CD36 amino acid sequence (NP_000063.2; SEQ ID NO: 2) and rat CD36 amino acid sequence (NP_113749.2; SEQ ID NO: 31) .
  • This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) CD36, and methods of use thereof.
  • Adipocytes supply adequate fatty acids (FAs) to meet the high energy requirement of tumor cells and fuel their development, and tumor cells also show increased propensity to migrate toward adipose tissues, where they can uptake sufficient lipids.
  • CD36 is expressed on the cell surface in multiple cell types, including dendritic cells (DCs) , microvascular endothelial cells (MVECs) , retinal epithelial cells, monocytes, adipocytes, platelets, enterocytes, microglial cells, and podocytes.
  • DCs dendritic cells
  • MVECs microvascular endothelial cells
  • monocytes adipocytes
  • adipocytes platelets
  • enterocytes microglial cells
  • podocytes podocytes.
  • CD36 is expressed in tumor cells and in stromal and immune cells, but the expression level varies in distinct cell types and tumor stages. CD36 expression is invariably low in the in situ stage but increases during metastasis, and CD36 plays essential roles in lipid homeostasis, angiogenesis, immune response, adhesion, and metastasis in cancer. Therefore, CD36 is regarded as a potential biomarker and therapeutic target for cancer.
  • Experimental animal models are an indispensable research tool for studying the effects of these antibodies (e.g., anti-CD36 antibodies) .
  • Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on.
  • human and animal genes and protein sequences there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal’s homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments.
  • a large number of clinical studies are in urgent need of better animal models.
  • the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means.
  • the genetically engineered animal model that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems.
  • the humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels.
  • Human CD36 a transmembrane glycoprotein (GP) that is also known as FA translocase (FAT) , platelet GPIV, GP88, and scavenger receptor class B type 2 (SR-B2) , contains 472 amino acids and its estimated molecular weight is 53 kDa.
  • the protein harbors two transmembrane domains, a large extracellular region containing ligand-binding sites, and a single short cytoplasmic tail at each terminal (N and C) .
  • the extracellular domain of CD36 forms two hydrophobic cavities that mediate the uptake of hydrophobic molecules such as FAs, phospholipids, and cholesterol.
  • CD36 the CD36, LIMP-2, Emp sequence homologous (CLESH) domain residues are negatively charged and can interact with TSP-1 repeat domain 2 (TSR) to regulate tumor angiogenesis, platelet aggregation, and other reactions, and CD36 also harbors a lysine-cluster region that can bind to negatively charged ligands.
  • TSR TSP-1 repeat domain 2
  • CD36 also harbors a lysine-cluster region that can bind to negatively charged ligands.
  • Almost all end-stage oxidative products are negatively charged, including ox-LDL, apoptotic cells, and advanced oxidation protein products (AOPPs) , which might be present at adequate levels in areas that exhibit heightened metabolism, such as in tumor tissues.
  • AOPPs advanced oxidation protein products
  • transmembrane form of CD36 a soluble form of the protein, sCD36, is also generated, and this form was shown to be composed of the exposed extracellular domain of transmembrane CD36 that is shed by plasma proteases or a specific subset of circulating micro-particles.
  • CD36 is regulated by various factors, including environmental stimuli and transcriptional factors.
  • Numerous biomolecules including fatty acids and oxidized LDL (ox-LDL) , could transcriptionally upregulate CD36 expression to further activate downstream oncogenic signaling and increase the capabilities for trafficking.
  • ox-LDL can increase CD36-mediated phosphorylation of JAK2 and STAT3 activation to enhance stemness phenotypes of bladder cancer.
  • a series of transcriptional factors can bind to the promoter of CD36 to increase its expression. In hepatocyte, environmental fatty acid stimulation could drive SOX2 overexpression, thus transcriptional upregulating CD36 to drive hepatic steatosis and even hepatocellular carcinoma (HCC) .
  • HCC hepatocellular carcinoma
  • a positive loop has been found between STAT3 and CD36 in breast cancer cells to mediate tumor progression.
  • STAT3 could directly bind to the promoter of CD36 to upregulate its expression.
  • CD36 could also activate STAT3/NF- ⁇ B signaling axis to promote tumor angiogenesis and stemness.
  • Post-translational modification is also critical the transcriptional upregulation of CD36 expression. For instance, O-GlcNAcylation increases CD36 protein level by modifying CD36 at S468 and T470. Hydrophobicity of CD36 protein was impaired due to the lack of palmitoylation by decreasing its distribution on the plasma membrane, thus reducing fatty acid uptake in hepatoma cells.
  • DHHC Asp–His–His–Cys (DHHC) motif-containing palmitoyl acyltransferases, DHHC4 and DHHC5, was found to mediate CD36 palmitoylation, thus increasing fatty acid uptake.
  • CD36 could bind to fatty acids to get depalmitoylated and recruit tyrosine kinase to phosphorylate JNK and VAVs to initiate endocytic fatty acid uptake.
  • CD36 CD36 tango in cancer: signaling pathways and functions.
  • CD36 an emerging therapeutic target for cancer and its molecular mechanisms.
  • CD36 gene (Gene ID: 948) locus has fourteen exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and exon 14 (FIG. 1) .
  • the CD36 protein also has, from N-terminus to C-terminus, a first cytoplasmic region, a first transmembrane region, an extracellular region, a second transmembrane region, and a second cytoplasmic region.
  • the nucleotide sequence for human CD36 mRNA is NM_000072.3
  • amino acid sequence for human CD36 is NP_000063.2 (SEQ ID NO: 2) .
  • the location for each exon and each region in human CD36 nucleotide sequence and amino acid sequence is listed below:
  • the human CD36 gene (Gene ID: 948) is located in Chromosome 7 of the mouse genome, which is located from 80602207 to 80679277 (GRCh38. p13 (GCF_000001405.39) ) .
  • the 5’-UTR is from 80, 638, 676 to 80, 638, 746, 80, 646, 088 to 80, 646, 181, and 80646652 to 80646740
  • exon 1 is from 80, 638, 676 to 80, 638, 746
  • the first intron is from 80, 638, 747 to 80, 646, 087
  • exon 2 is from 80, 646, 088 to 80, 646, 181
  • the second intron is from 80, 646, 182 to 80, 646, 651
  • exon 3 is from 80, 646, 652 to 80, 646, 860
  • the third intron is from 80, 646, 861 to 80, 656, 539
  • exon 4 is from 80, 656, 540 to 80, 656, 700
  • CD36 gene locus has sixteen exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and exon 16 (FIG. 1) .
  • the mouse CD36 protein also has, from N-terminus to C-terminus, a first cytoplasmic region, a first transmembrane region, an extracellular region, a second transmembrane region, and a second cytoplasmic region.
  • the nucleotide sequence for mouse CD36 mRNA is NM_001159558.1
  • amino acid sequence for mouse CD36 is NP_001153030.1 (SEQ ID NO: 1) .
  • the location for each exon and each region in the mouse CD36 nucleotide sequence and amino acid sequence is listed below:
  • the mouse CD36 gene (Gene ID: 12491) is located in Chromosome 5 of the mouse genome, which is located from 17986688 to 18093957 (GRCm39 (GCF_000001635.27) ) .
  • the 5’-UTR is from 18, 093, 745 to 18, 093, 709, 18, 040, 669 to 18, 040, 616, 18, 034, 547 to 18, 034, 454, and 18033893 to 18033982
  • exon 1 is from 18, 093, 745 to 18, 093, 709
  • the first intron is from 18093708 to 18040670
  • exon 2 is from 18040669 to 18040616,
  • the second intron is from 18040615 to 18034548
  • exon 3 is from 18034547 to 18034454
  • the third intron is from 18034453 to 18033983
  • exon 4 is from 18033982 to 18033773
  • the fourth intron is from 18033772 to 18, 025, 599
  • exon 5
  • FIG. 17 shows the alignment between human CD36 amino acid sequence (NP_000063.2; SEQ ID NO: 2) and mouse CD36 amino acid sequence (NP_001153030.1; SEQ ID NO: 1) .
  • NP_000063.2 human CD36 amino acid sequence
  • NP_001153030.1 mouse CD36 amino acid sequence
  • CD36 genes, proteins, and locus of the other species are also known in the art.
  • the gene ID for CD36 in Rattus norvegicus (rat) is 29184
  • the gene ID for CD36 in Macaca mulatta (Rhesus monkey) is 574296
  • the gene ID for CD36 in Canis lupus familiaris (dog) is 475931
  • the gene ID for CD36 in Sus scrofa (pig) is 733702.
  • the relevant information for these genes can be found, e.g., intron sequences, exon sequences, amino acid residues of these proteins
  • NCBI database which is incorporated by reference herein in its entirety.
  • the present disclosure provides human or chimeric (e.g., humanized) CD36 nucleotide sequence and/or amino acid sequences.
  • human or chimeric e.g., humanized CD36 nucleotide sequence and/or amino acid sequences.
  • the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, extracellular region, transmembrane regions, and/or cytoplasmic regions are replaced by the corresponding human sequence.
  • a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, extracellular region, transmembrane regions, and/or cytoplasmic regions are replaced by the corresponding human sequence.
  • region can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, or 1200 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 amino acid residues.
  • the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, extracellular region, transmembrane regions, or cytoplasmic regions.
  • a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and/or exon 16 are replaced by a region, a portion, or the entire sequence of the human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and/or exon 14 (e.g., a portion of exon 3, exons 4-13, and a portion of exon 14) .
  • a “region” or “portion” of the extracellular region, one or both of the transmembrane regions, one or both of the cytoplasmic regions, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and/or exon 16 is deleted.
  • the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized ) CD36 nucleotide sequence.
  • the chimeric (e.g., humanized ) CD36 nucleotide sequence encodes a CD36 protein comprising an extracellular region.
  • the extracellular region described herein is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 30-439 of SEQ ID NO: 2.
  • the extracellular region comprises the entire or part of human CD36 extracellular region.
  • the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, or 10.
  • the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized CD36 protein.
  • the CD36 protein comprises, from N-terminus to C-terminus, a first cytoplasmic region, a first transmembrane region, an extracellular region, a second transmembrane region, and a second cytoplasmic region.
  • the humanized CD36 protein comprises a human or humanized first cytoplasmic region.
  • the humanized CD36 protein comprises an endogenous first cytoplasmic region.
  • the humanized CD36 protein comprises a human or humanized first transmembrane region.
  • the humanized CD36 protein comprises an endogenous first transmembrane region. In some embodiments, the humanized CD36 protein comprises a human or humanized extracellular region. In some embodiments, the humanized CD36 protein comprises an endogenous extracellular region. In some embodiments, the humanized CD36 protein comprises a human or humanized second transmembrane region. In some embodiments, the humanized CD36 protein comprises an endogenous second transmembrane region. In some embodiments, the humanized CD36 protein comprises a human or humanized second cytoplasmic region. In some embodiments, the humanized CD36 protein comprises an endogenous second cytoplasmic region.
  • the genetically-modified non-human animal described herein comprises a human or humanized CD36 gene.
  • the humanized CD36 gene comprises 16 exons.
  • the humanized CD36 gene comprises endogenous or humanized exon 1, endogenous or humanized exon 2, endogenous or humanized exon 3, humanized exon 4, humanized exon 5, humanized exon 6, humanized exon 7, humanized exon 8, humanized exon 9, humanized exon 10, humanized exon 11, humanized exon 12, humanized exon 13, humanized exon 14, humanized exon 15, and/or endogenous or humanized exon 16.
  • the humanized CD36 gene comprises endogenous or humanized intron 1, endogenous or humanized intron 2, endogenous or humanized intron 3, humanized intron 4, humanized intron 5, humanized intron 6, humanized intron 7, humanized intron 8, humanized intron 9, humanized intron 10, humanized intron 11, humanized intron 12, humanized intron 13, humanized intron 14, and/or endogenous or humanized intron 15.
  • the humanized CD36 gene comprises human or humanized 5’ UTR.
  • the humanized CD36 gene comprises human or humanized 3’ UTR.
  • the humanized CD36 gene comprises endogenous 5’ UTR.
  • the humanized CD36 gene comprises endogenous 3’ UTR.
  • the present disclosure also provides a chimeric (e.g., humanized) CD36 nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse CD36 mRNA sequence (e.g., NM_001159558.1) , mouse CD36 amino acid sequence (e.g., SEQ ID NO: 1) , or a portion thereof (e.g., exon 1, exon 2, exon 3, a portion of exon 4, a portion of exon 15, and exon 16) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%
  • sequence encoding amino acids 30-439 of mouse CD36 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CD36 (e.g., amino acids 30-439 of human CD36 (SEQ ID NO: 2) ) .
  • the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse CD36 promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.
  • a promotor or regulatory element e.g., an endogenous mouse CD36 promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.
  • the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from part of or the entire mouse CD36 nucleotide sequence (e.g., a portion of exon 4, exons 5-14, and a portion of exon 15 NM_001159558.1) .
  • a portion e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides
  • part of or the entire mouse CD36 nucleotide sequence e.g., a portion of exon 4, exons 5-14, and a portion of exon 15 NM_001159558.1
  • the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as part of or the entire mouse CD36 nucleotide sequence (e.g., exons 1-3, a portion of exon 4, a portion of exon 15, and exon 16 of NM_001159558.1) .
  • the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from part of or the entire human CD36 nucleotide sequence (e.g., exon 1, exon 2, a portion of exon 3, and a portion of exon 14 of NM_000072.3) .
  • the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as part of or the entire human CD36 nucleotide sequence (e.g., a portion of exon 3 (e.g., at least 10 bp) , exons 4-13, and portion of exon 14 (e.g., at least 30 bp) of NM_000072.3) .
  • a portion of exon 3 e.g., at least 10 bp
  • exons 4-13 e.g., at least 30 bp
  • the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire mouse CD36 amino acid sequence (e.g., amino acids 30-439 of NP_001153030.1 (SEQ ID NO: 1) ) .
  • the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire mouse CD36 amino acid sequence (e.g., amino acids 1-29 and 440-472 of NP_001153030.1 (SEQ ID NO: 1) ) .
  • the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire human CD36 amino acid sequence (e.g., amino acids 1-29 and 440-472 of NP_000063.2 (SEQ ID NO: 2) ) .
  • the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire human CD36 amino acid sequence (e.g., amino acids 30-439 of NP_000063.2 (SEQ ID NO: 2) ) .
  • the present disclosure also provides a humanized CD36 mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:
  • nucleic acid sequence an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 1, 2, or 11 under a low stringency condition or a strict stringency condition;
  • amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 11;
  • amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 11 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid;
  • amino acid sequence that comprises a substitution, a deletion and /or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 11.
  • the present disclosure also provides a humanized CD36 amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:
  • an amino acid sequence have a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 30-439 of SEQ ID NO: 2;
  • amino acid sequence that is different from amino acids 30-439 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid;
  • amino acid sequence that comprises a substitution, a deletion and /or insertion of one or more amino acids to amino acids 30-439 of SEQ ID NO: 2.
  • the present disclosure also relates to a CD36 nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:
  • nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, or 10 under a low stringency condition or a strict stringency condition;
  • nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, or 10;
  • nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 11;
  • nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 11;
  • nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 11 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid;
  • nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and /or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 11.
  • the present disclosure further relates to a CD36 genomic DNA sequence of a humanized mouse.
  • the DNA sequence is obtained by reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 5 or 10.
  • the disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 1, 2, or 11, and has protein activity.
  • the homology with the sequence shown in SEQ ID NO: 1, 2, or 11 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%.
  • the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
  • the percentage identity with the sequence shown in SEQ ID NO: 1, 2, or 11 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
  • the disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, or 10, and encodes a polypeptide that has protein activity.
  • the homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, or 10 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%.
  • the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
  • the percentage identity with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, or 10 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
  • the disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein.
  • the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein.
  • the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides.
  • the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.
  • the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.
  • the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) .
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • the percentage of residues conserved with similar physicochemical properties can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
  • Cells, tissues, and animals are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) CD36 from an endogenous non-human CD36 locus.
  • the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal’s genome.
  • at least one or more cells e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome.
  • the cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, a macrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell.
  • genetically-modified non-human animals are provided that comprise a modified endogenous CD36 locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences.
  • the animals are generally able to pass the modification to progeny, i.e., through germline transmission.
  • chimeric gene or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal.
  • the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species.
  • the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.
  • chimeric protein or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal.
  • the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species.
  • the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.
  • humanized protein or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.
  • humanized nucleic acid refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be e.g., a human exon or a chimeric exon.
  • the chimeric gene or the chimeric nucleic acid is a humanized CD36 gene or a humanized CD36 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human CD36 gene, at least one or more portions of the gene or the nucleic acid is from a non-human CD36 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an CD36 protein. The encoded CD36 protein is functional or has at least one activity of the human CD36 protein or the non-human CD36 protein, e.g., regulating fatty acid metabolism, regulating glucose metabolism, interacting with immune cells and modulating immune response, and modulating tumor development.
  • the chimeric protein or the chimeric polypeptide is a humanized CD36 protein or a humanized CD36 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human CD36 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human CD36 protein.
  • the humanized CD36 protein or the humanized CD36 polypeptide is functional or has at least one activity of the human CD36 protein or the non-human CD36 protein.
  • the first cytoplasmic region is human or humanized. In some embodiments, the first transmembrane region is human or humanized. In some embodiments, the extracellular region is human or humanized. In some embodiments, the second transmembrane region is human or humanized. In some embodiments, the second cytoplasmic region is human or humanized.
  • the genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) .
  • ES embryonic stem
  • Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo.
  • a suitable cell e.g., an oocyte
  • gestating the modified cell e.g., the modified oocyte
  • the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea.
  • the genetically modified animal is a rodent.
  • the rodent can be selected from a mouse, a rat, and a hamster.
  • the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) .
  • Calomyscidae e.g., mouse-like hamsters
  • Cricetidae e.g., hamster, New World rats and mice, voles
  • Muridae true mice and rats, gerbils, spiny mice, crested rats
  • the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat.
  • the non-human animal is a mouse.
  • the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola.
  • a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola.
  • the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2.
  • a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2.
  • the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains.
  • the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) . In some embodiments, the non-human animal is a rodent.
  • the non-human animal is a mouse having a BALB/c, A, A/He, A/J, A/WySN, AKR, AKR/A, AKR/J, AKR/N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA/2, KM, NIH, ICR, CFW, FACA, C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL (C57BL/10Cr and C57BL/Ola) , C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, or CBA/H background.
  • the animal is a rat.
  • the rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti.
  • the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
  • the animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized CD36 animal is made.
  • suitable mice for maintaining a xenograft e.g., a human cancer or tumor
  • mice for maintaining a xenograft can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part.
  • Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and/or genetic modification (e.g., knocking out one or more genes) .
  • Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, IL2R ⁇ knockout mice, NOD/SCID/ ⁇ cnull mice (Ito, M.
  • a genetically modified mouse can include a humanization of at least a portion of an endogenous non-human CD36 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part.
  • modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, IL-2R ⁇ knockout mice, NOD/SCID/ ⁇ c null mice, nude mice, Rag1 and/or Rag2 knockout mice, NOD-Prkdc scid IL-2r ⁇ null mice, NOD-Rag 1 -/- -IL2rg -/- (NRG) mice, Rag 2 -/- -IL2rg -/- (RG) mice, and a combination thereof.
  • NSG NSG
  • RG Rag 2 -/- -IL2rg -/-
  • the mouse can include a replacement of all or part of mature CD36 coding sequence with human mature CD36 coding sequence.
  • genetically modified non-human animals that comprise a modification of an endogenous non-human CD36 locus.
  • the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature CD36 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the mature CD36 protein sequence) .
  • genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells)
  • the genetically modified non-human animals comprise the modification of the endogenous CD36 locus in the germline of the animal.
  • Genetically modified animals can express a human CD36 and/or a chimeric (e.g., humanized) CD36 from endogenous mouse loci, wherein the endogenous mouse CD36 gene has been replaced with a human CD36 gene and/or a nucleotide sequence that encodes a region of human CD36 sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human CD36 sequence.
  • an endogenous non-human CD36 locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature CD36 protein.
  • the genetically modified mice express the human CD36 and/or chimeric CD36 (e.g., humanized CD36) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements.
  • the replacement (s) at the endogenous mouse loci provide non-human animals that express human CD36 or chimeric CD36 (e.g., humanized CD36) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art.
  • the human CD36 or the chimeric CD36 (e.g., humanized CD36) expressed in animal can maintain one or more functions of the wild-type mouse or human CD36 in the animal.
  • human or non-human CD36 ligands can bind to the expressed CD36.
  • the animal does not express endogenous CD36.
  • the animal expresses a decreased level of endogenous CD36 as compared to a wild-type animal.
  • endogenous CD36 refers to CD36 protein that is expressed from an endogenous CD36 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.
  • the genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human CD36 (NP_000063.2) (SEQ ID NO: 2) .
  • the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 11.
  • the genome of the genetically modified animal can comprise a replacement at an endogenous CD36 gene locus of a sequence encoding a region of endogenous CD36 with a sequence encoding a corresponding region of human CD36.
  • the sequence that is replaced is any sequence within the endogenous CD36 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, 5’-UTR, 3’-UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, etc.
  • the sequence that is replaced is within the regulatory region of the endogenous CD36 gene. In some embodiments, the sequence that is replaced is exon 4, exon 5, exon 6, exon 6, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, or a portion thereof, of an endogenous mouse CD36 gene locus.
  • the genetically modified animal can have one or more cells expressing a human or chimeric CD36 (e.g., humanized CD36) having, from N-terminus to C-terminus, a first cytoplasmic region, a first transmembrane region, an extracellular region, a second transmembrane region, and a second cytoplasmic region.
  • a human or chimeric CD36 e.g., humanized CD36
  • the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the extracellular region of human CD36.
  • the extracellular region of the humanized CD36 has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 amino acids (e.g., contiguously or non-contiguously) that are identical to human CD36.
  • amino acids e.g., contiguously or non-contiguously
  • human CD36 and non-human CD36 e.g., mouse CD36 sequences
  • antibodies that bind to human CD36 will not necessarily have the same binding affinity with non-human CD36 or have the same effects to non-human CD36. Therefore, the genetically modified animal having a human or a humanized extracellular region can be used to better evaluate the effects of anti-human CD36 antibodies in an animal model.
  • the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and/or exon 14 of human CD36, a portion or the entire sequence of extracellular region of human CD36, or a portion or the entire sequence of amino acids 30-439 of SEQ ID NO: 2.
  • the genome of the genetically modified animal comprises a portion of exon 3, exons 4-13, and a portion of exon 14 of human CD36 gene.
  • the portion of exon 3 includes at least 10, 15, 20, 30, 31, 32, 33, 34, 35, 40, 50, 60, 70, 80, 90, 100, 120, 150, 170, 180, 190, 200, or 208 nucleotides.
  • the portion of exon 14 includes at least 30, 35, 40, 45, 50, 55, 60, 61, 62, 63, 64, 65, 70, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430, or 439 nucleotides.
  • the non-human animal can have, at an endogenous CD36 gene locus, a nucleotide sequence encoding a chimeric human/non-human CD36 polypeptide, wherein a human portion of the chimeric human/non-human CD36 polypeptide comprises a portion of human CD36 extracellular domain, and wherein the animal expresses a functional CD36 on a surface of a cell of the animal.
  • the human portion of the chimeric human/non-human CD36 polypeptide can comprise an amino acid sequence encoded by a portion of exon 3, exons 4-13, and/or a portion of exon 14 of human CD36.
  • the human portion of the chimeric human/non-human CD36 polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99%identical to amino acids 30-439 of SEQ ID NO: 2.
  • the first cytoplasmic region includes a sequence corresponding to the entire or part of amino acids 1-7 of SEQ ID NO: 1.
  • the first transmembrane region includes a sequence corresponding to the entire or part of amino acids 8-29 of SEQ ID NO: 1.
  • the second transmembrane region includes a sequence corresponding to the entire or part of amino acids 440-461 of SEQ ID NO: 1.
  • the second cytoplasmic region includes a sequence corresponding to the entire or part of amino acids 462-472 of SEQ ID NO: 1.
  • the non-human portion of the chimeric human/non-human CD36 polypeptide comprises transmembrane and/or cytoplasmic regions of an endogenous non-human CD36 polypeptide.
  • the genetically modified animal can be heterozygous with respect to the replacement at the endogenous CD36 locus, or homozygous with respect to the replacement at the endogenous CD36 locus.
  • the humanized CD36 locus lacks a human CD36 5’-UTR.
  • the humanized CD36 locus comprises an endogenous (e.g., mouse) 5’-UTR.
  • the humanization comprises an endogenous (e.g., mouse) 3’-UTR.
  • mouse and human CD36 genes appear to be similarly regulated based on the similarity of their 5’-flanking sequence.
  • humanized CD36 mice that comprise a replacement at an endogenous mouse CD36 locus which retain mouse regulatory elements but comprise a humanization of CD36 encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized CD36 are grossly normal.
  • the present disclosure further relates to a non-human mammal generated through the method mentioned above.
  • the genome thereof contains human gene (s) .
  • the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.
  • the non-human mammal expresses a protein encoded by a humanized CD36 gene.
  • the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein.
  • the non-human mammal is a rodent (e.g., a mouse) .
  • the present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.
  • the present disclosure also provides non-human mammals produced by any of the methods described herein.
  • a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized CD36 in the genome of the animal.
  • the non-human mammal comprises the genetic construct as described herein (e.g., gene construct as shown in FIGS. 2, 3, and 5) .
  • a non-human mammal expressing human or humanized CD36 is provided.
  • the tissue-specific expression of human or humanized CD36 protein is provided.
  • the expression of human or humanized CD36 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance.
  • the specific inducer is selected from Tet-Off System/Tet-On System, or Tamoxifen System.
  • Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein.
  • Preferred non-human mammals are mammals, (e.g., rodents) .
  • the non-human mammal is a mouse.
  • the present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.
  • the present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof.
  • a model based on cell culture can be prepared, for example, by the following methods.
  • Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cells can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques.
  • the integration of genetic constructs containing DNA sequences encoding human CD36 protein can be detected by a variety of methods.
  • RNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization
  • protein level including histochemistry, immunoblot analysis and in vitro binding studies
  • RT-PCR reverse transcriptase polymerase chain reaction
  • protein level including histochemistry, immunoblot analysis and in vitro binding studies
  • the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art.
  • Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized CD36 protein.
  • the present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the CD36 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the CD36 gene genomic DNAs in the length of 100 to 10,000 nucleotides.
  • a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000071.7; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000071.7.
  • a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 18033806 to the position 18038888 of the NCBI accession number NC_000071.7; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 17986807 to the position 17990821 of the NCBI accession number NC_000071.7.
  • the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 3 kb, about 4 kb, about 5 kb, about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 15 kb, about 20 kb, about 21 kb, about 22 kb, about 23 kb, about 24 kb, or about 25 kb.
  • the region to be altered is exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and/or exon 15 of CD36 gene (e.g., a portion of exon 4, exons 5-14, and a portion of exon 15 of mouse CD36 gene) .
  • the targeting vector can further include one or more selectable markers, e.g., positive or negative selectable markers.
  • the positive selectable marker is a Neo gene or Neo cassette.
  • the negative selectable marker is a DTA gene.
  • sequence of the 5’ arm is shown in SEQ ID NO: 3; and the sequence of the 3’ arm is shown in SEQ ID NO: 4.
  • the sequence is derived from human (e.g., 80646828-80674045 of NC_000007.14) .
  • the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human CD36, preferably exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and/or exon 14 of the human CD36.
  • the nucleotide sequence of the humanized CD36 encodes the entire or the part of human CD36 protein with the NCBI accession number NP_000063.2 (SEQ ID NO: 2) .
  • the disclosure also relates to a cell comprising the targeting vectors as described above.
  • the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein.
  • the cell includes Cas9 mRNA or an in vitro transcript thereof.
  • the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.
  • the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.
  • Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system.
  • NHEJ nonhomologous end-joining
  • HR homologous recombination
  • ZFNs zinc finger nucleases
  • TALEN transcription activator-like effector-based nucleases
  • CRISPR clustered regularly interspaced short palindromic repeats
  • homologous recombination is used.
  • CRISPR-Cas9 genome editing is used to generate genetically modified animals.
  • genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety.
  • Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.
  • the disclosure provides replacing in at least one cell of the animal, at an endogenous CD36 gene locus, a sequence encoding a region of an endogenous CD36 with a sequence encoding a corresponding region of human or chimeric CD36.
  • the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc.
  • the nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.
  • FIG. 3 shows a humanization strategy for a mouse CD36 locus.
  • the targeting strategy involves a vector comprising the 5’ end homologous arm, human CD36 gene fragment, 3’ homologous arm.
  • the process can involve replacing endogenous CD36 sequence with human sequence by homologous recombination.
  • the cleavage at the upstream and the downstream of the target site e.g., by zinc finger nucleases, TALEN or CRISPR
  • the homologous recombination is used to replace endogenous CD36 sequence with human CD36 sequence.
  • the methods for making a genetically modified, humanized animal can include the step of replacing at an endogenous CD36 locus (or site) , a nucleic acid encoding a sequence encoding a region of endogenous CD36 with a sequence encoding a corresponding region of human CD36.
  • the sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and/or exon 14 of a human CD36 gene.
  • the sequence includes a portion of exon 3, exons 4-13, and a portion of exon 14 of a human CD36 gene (e.g., nucleic acids 502-1731 of NM_000072.3) .
  • the region is located within the extracellular region of CD36 (e.g., amino acids 30-439 of SEQ ID NO: 1 or 2) .
  • the endogenous CD36 locus is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, and/or exon 16 of mouse CD36.
  • the sequence includes a portion of exon 4, exons 5-14, and a portion of exon 15 of mouse CD36 gene (e.g., nucleic acids 575-1804 of NM_001159558.1) .
  • the methods of modifying a CD36 locus of a mouse to express a chimeric human/mouse CD36 peptide can include the steps of replacing at the endogenous mouse CD36 locus a nucleotide sequence encoding a mouse CD36 with a nucleotide sequence encoding a human CD36, thereby generating a sequence encoding a chimeric human/mouse CD36.
  • the nucleotide sequence encoding the chimeric human/mouse CD36 can include a first nucleotide sequence encoding a first cytoplasmic region and a first transmembrane region of mouse CD36; a second nucleotide sequence encoding an extracellular region of human CD36; and a third nucleotide sequence encoding a second transmembrane region and a second cytoplasmic region of mouse CD36.
  • the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence, the second nucleotide sequence, and/or the third nucleotide sequence do not overlap) .
  • the amino acid sequences as described herein do not overlap with each other.
  • the present disclosure further provides a method for establishing a CD36 gene humanized animal model, involving the following steps:
  • step (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .
  • the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 mouse) .
  • the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy) .
  • the fertilized eggs for the methods described above are C57BL/6 fertilized eggs.
  • Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB/N fertilized eggs, BALB/c fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.
  • Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein.
  • the fertilized egg cells are derived from rodents.
  • the genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.
  • methods of making the genetically modified animal comprises modifying the coding frame of the non-human animal’s CD36 gene, e.g., by inserting a nucleotide sequence (e.g., cDNA sequence) encoding human or humanized CD36 protein immediately after the endogenous regulatory element of the non-human animal’s CD36 gene.
  • a nucleotide sequence e.g., cDNA sequence
  • one or more functional region sequences of the non-human animal’s CD36 gene can be knocked out, or inserted with a sequence, such that the non-human animal cannot express or expresses a decreased level of endogenous CD36 protein.
  • the coding frame of the modified non-human animal’s CD36 gene can be all or part of the nucleotide sequence from exon 4 to exon 15 of the non-human animal’s CD36 gene.
  • methods of making the genetically modified animal comprises inserting a nucleotide sequence encoding human or humanized CD36 protein and/or an auxiliary sequence after the endogenous regulatory element of the non-human animal’s CD36 gene.
  • the auxiliary sequence can be a stop codon, such that the CD36 gene humanized animal model can express human or humanized CD36 protein in vivo, but does not express non-human animal’s CD36 protein.
  • the auxiliary sequence includes WPRE (WHP Posttranscriptional Response Element) and/or polyA.
  • the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal.
  • the disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.
  • Genetically modified animals that express human or humanized CD36 protein provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or the efficacy of these human therapeutics in the animal models.
  • genetically modified animals are provided that express human or humanized CD36, which are useful for testing agents that can decrease or block the interaction between CD36 and CD36 ligands (e.g., long-chain fatty acids) or the interaction between CD36 and anti-human CD36 antibodies, testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an CD36 agonist or antagonist.
  • the genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout) .
  • the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor or a blood cell tumor (e.g., a lymphocyte tumor, a B or T cell tumor) .
  • the anti-CD36 antibody blocks or inhibits the CD36-related signaling pathway.
  • the anti-CD36 antibody described herein can block the interaction between CD36 and its ligand.
  • the CD36 ligand is a lipid-related ligand, e.g., long-chain fatty acids (LCFAs) , oxidized low-density lipoprotein (ox-LDL) , anionic phospholipids, and oxidized phospholipids (ox-PLs) .
  • the CD36 ligand is a protein-related ligand, e.g., TSP-1, TSP-2, amyloid proteins, AOPPs, and advanced glycation end products (AGEs) .
  • the genetically modified animals can be used for determining effectiveness of an anti-CD36 antibody for the treatment of cancer.
  • the methods involve administering the anti-CD36 antibody (e.g., anti-human CD36 antibody) to the animal as described herein, wherein the animal has a tumor; and determining inhibitory effects of the anti-CD36 antibody to the tumor.
  • the anti-CD36 antibody e.g., anti-human CD36 antibody
  • the inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc.
  • the tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT. In addition, a delicate balance is required for these antibodies, as CD36 is also expressed on many other cells.
  • the humanized CD36 functions in a largely similar way as compared to the endogenous CD36, so that the results in the humanized animals can be used to predict the efficacy or toxicity of these therapeutic agents in the human.
  • the anti-CD36 antibody can directly target cancer cells expressing CD36, e.g., by inducing complement mediated cytotoxicity (CMC) or antibody dependent cellular cytoxicity (ADCC) to kill the cancer cells.
  • CMC complement mediated cytotoxicity
  • ADCC antibody dependent cellular cytoxicity
  • the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal.
  • the anti-CD36 antibody prevents LCFAs or ox-LDL from binding to CD36. In some embodiments, the anti-CD36 antibody does not prevent LCFAs or ox-LDL from binding to CD36.
  • the genetically modified animals can be used for determining whether an anti-CD36 antibody is a CD36 agonist or antagonist.
  • the methods as described herein are also designed to determine the effects of the agent (e.g., anti-CD36 antibodies) on CD36, e.g., whether the agent can stimulate immune cells or inhibit immune cells (e.g., T cells, B cells, or NK cells) , whether the agent can increase or decrease the production of cytokines, whether the agent can activate or deactivate immune cells (e.g., T cells, B cells, or NK cells) , whether the agent can upregulate the immune response or downregulate immune response, and/or whether the agent can induce complement mediated cytotoxicity (CMC) or antibody dependent cellular cytoxicity (ADCC) .
  • the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer, or autoimmune diseases.
  • the inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI TV ) .
  • the anti-CD36 antibody is designed for treating various cancers.
  • cancer refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness.
  • tumor refers to cancerous cells, e.g., a mass of cancerous cells.
  • Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.
  • the agents described herein are designed for treating or diagnosing a carcinoma in a subject.
  • carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas.
  • the cancer is renal carcinoma or melanoma.
  • Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary.
  • carcinosarcomas e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues.
  • an “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
  • the term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.
  • the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas.
  • the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia.
  • the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia.
  • the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma , and chondrosarcoma.
  • the tumor is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or liver cancer.
  • the CD36 antibody is designed for treating myeloid leukemia (AML) , breast cancer, colorectal cancer, gastric cancer, cervical cancer, glioblastoma, and/or pancreatic ductal adenocarcinoma (PDAC) .
  • AML myeloid leukemia
  • breast cancer colorectal cancer
  • gastric cancer gastric cancer
  • cervical cancer glioblastoma
  • PDAC pancreatic ductal adenocarcinoma
  • the anti-CD36 antibody is designed for treating various autoimmune diseases, including rheumatoid arthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, or scleroderma.
  • the anti-CD36 antibody is designed for treating various immune disorders, including allergy, asthma, and/or atopic dermatitis.
  • the methods as described herein can be used to determine the effectiveness of an anti-CD36 antibody in inhibiting immune response.
  • the immune disorders described herein is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc.
  • the present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-CD36 antibody) .
  • the methods involve administering the antibody to the animal as described herein.
  • the animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin.
  • the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%.
  • the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40%smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody) .
  • the genetically modified animals can be used for determining effectiveness of an anti-CD36 antibody for treating a disease or a condition.
  • the disease or condition is related to fatty acid metabolism, heart disease, taste, and dietary fat processing in the intestine, glucose intolerance, atherosclerosis, arterial hypertension, diabetes, cardiomyopathy, obesity, or Alzheimer's disease.
  • the methods involve administering the anti-CD36 antibody (e.g., anti-human CD36 antibody) to the animal as described herein; and determining effects of the anti-CD36 antibody on the disease or condition.
  • the present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
  • the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.
  • the disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the CD36 gene function, human CD36 antibodies, drugs for human CD36 targeting sites, the drugs or efficacies for human CD36 targeting sites, the drugs for immune-related diseases and antitumor drugs.
  • the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and/or other immunotherapies (e.g., T-cell adoptive transfer therapies) .
  • the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated.
  • the animal is selected from the CD36 gene humanized non-human animal prepared by the methods described herein, the CD36 gene humanized non-human animal described herein, the double-or multi-humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized CD36 protein, or the tumor-bearing or inflammatory animal models described herein.
  • the TCR-T, CAR-T, and/or other immunotherapies can treat the CD36-associated diseases described herein.
  • the TCA-T, CAR-T, and/or other immunotherapies provides an evaluation method for treating the CD36-associated diseases described herein.
  • the present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes.
  • the animal can comprise a human or chimeric CD36 gene and a sequence encoding an additional human or chimeric protein.
  • the additional human or chimeric protein can be tumor necrosis factor alpha (TNF ⁇ ) , programmed cell death protein 1 (PD-1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD27, CD28, CD47, CD137, CD154, CD226, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , Signal regulatory protein ⁇ (SIRP ⁇ ) or TNF Receptor Superfamily Member 4 (TNFRSF4 or OX40) .
  • TNF ⁇ tumor necrosis factor alpha
  • PD-1 programmed cell death protein 1
  • CTL-4 Ly
  • the methods of generating genetically modified animal model with two or more human or chimeric genes can include the following steps:
  • the genetically modified animal in step (b) of the method, can be mated with a genetically modified non-human animal with human or chimeric TNF ⁇ , PD-1, CTLA-4, LAG-3, BTLA, PD-L1, CD27, CD28, CD47, CD137, CD154, CD226, TIGIT, TIM-3, GITR, SIRP ⁇ , or OX40.
  • the CD36 humanization is directly performed on a genetically modified animal having a human or chimeric TNF ⁇ , PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, CD47, CD137, CD154, CD226, TIGIT, TIM-3, GITR, SIRP ⁇ , or OX40 gene.
  • a combination therapy that targets two or more of these proteins thereof may be a more effective treatment.
  • many related clinical trials are in progress and have shown a good effect.
  • the genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-CD36 antibody and an additional therapeutic agent for the treatment of cancer.
  • the methods include administering the anti-CD36 antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor.
  • the additional therapeutic agent is an antibody that specifically binds to TNF ⁇ , CD122, CD132, PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, CD47, CD137, CD154, CD226, TIGIT, TIM-3, GITR, SIRP ⁇ or OX40.
  • the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-PD-1 antibody (e.g., nivolumab) , or an anti-PD-L1 antibody.
  • the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4.
  • the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab) , an anti-PD-L1 antibody, or an anti-CTLA-4 antibody.
  • the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and/or PD-L2.
  • the combination treatment is designed for treating various cancer as described herein, e.g., melanoma, non-small cell lung carcinoma (NSCLC) , small cell lung cancer (SCLC) , bladder cancer, prostate cancer (e.g., metastatic hormone-refractory prostate cancer) , advanced breast cancer, advanced ovarian cancer, and/or advanced refractory solid tumor.
  • the combination treatment is designed for treating metastatic solid tumors, NSCLC, melanoma, B-cell non-Hodgkin lymphoma, colorectal cancer, and multiple myeloma.
  • the combination treatment is designed for treating melanoma, carcinomas (e.g., pancreatic carcinoma) , mesothelioma, hematological malignancies (e.g., Non-Hodgkin's lymphoma, lymphoma, chronic lymphocytic leukemia) , or solid tumors (e.g., advanced solid tumors) .
  • the combination treatment is designed for treating breast cancer, colon cancer, cervical cancer, fibrosarcoma, liver cancer, lung cancer, non-small cell lung cancer (NSCLC) , melanoma, ovarian cancer, renal cancer, skin cancer, plasmacytoma, lymphoma, and/or leukemia.
  • the methods described herein can be used to evaluate the combination treatment with some other methods.
  • the methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and/or methotrexate.
  • the methods can include performing surgery on the subject to remove at least a portion of the subject to remove at least
  • ScaI and EcoNI restriction enzymes were purchased from NEB (Catalog numbers: R3122S and R0521S, respectively) .
  • C57BL/6 mice and Flp transgenic mice were purchased from the China Food and Drugs Research Institute National Rodent Experimental Animal Center.
  • PerCP anti-mouse Ly-6G/Ly-6C (Gr-1) Antibody was purchased from BioLegend (Catalog number: 108426) .
  • V450 Rat Anti-mouse CD11b was purchased from BioLegend (Catalog number: 8232657) .
  • FITC anti-mouse F4/80 was purchased from BioLegend (Catalog number: 123108) .
  • APC anti-mouse CD36 Antibody was purchased from BioLegend (Catalog number: 102611) .
  • PE anti-human CD36 Antibody was purchased from BioLegend (Catalog number: 336205) .
  • Mouse IgG2A PE-conjugated Antibody was purchased from R&D Systems (Catalog number: IC003P) .
  • APC Armenian Hamster IgG Isotype Ctrl Antibody was purchased from BioLegend (Catalog number: 400912) .
  • Purified anti-mouse CD16/32 was purchased from BioLegend (Catalog number: 101302) .
  • EXAMPLE 1 Mice with humanized CD36 gene
  • a non-human animal e.g., a mouse
  • a non-human animal was modified to include a nucleotide sequence encoding human CD36 protein
  • the obtained genetically-modified non-human animal can express a human or humanized CD36 protein in vivo.
  • the mouse CD36 gene (NCBI Gene ID: 12491, Primary source: MGI: 107899, UniProt ID: Q08857) is located at 17986688 to 18093957 of chromosome 5 (NC_000071.7)
  • the human CD36 gene NCBI Gene ID: 948, Primary source: HGNC: 1663, UniProt ID: P16671-1) is located at 80602207 to 80679277 of chromosome 7 (NC_000007.14) .
  • the mouse CD36 transcript is NM_001159558.1, and the corresponding protein sequence NP_001153030.1 is set forth in SEQ ID NO: 1.
  • the human CD36 transcript is NM_000072.3, and the corresponding protein sequence NP_000063.2 is set forth in SEQ ID NO: 2.
  • Mouse and human CD36 gene loci are shown in FIG. 1.
  • nucleotide sequences encoding human CD36 protein can be introduced into the mouse endogenous CD36 locus, so that the mouse expresses human or humanized CD36 protein.
  • a mouse CD36 gene sequence of about 43 kb (starting from within exon 4 and ending within exon 15) under the control of mouse CD36 gene regulatory element was replaced with a human CD36 gene sequence of about 27 kb (starting from within exon 3 and ending within exon 14) , to obtain a humanized CD36 gene locus as shown in FIG. 2, thereby humanizing mouse CD36 gene.
  • the targeting vector contains homologous arm sequences upstream and downstream of the mouse CD36 gene, and an “A Fragment” containing DNA sequences of human CD36 gene.
  • sequence of the upstream homologous arm (5' homologous arm, SEQ ID NO: 3) is identical to nucleotide sequence of 18033806-18038888 of NCBI accession number NC_000071.7
  • sequence of the downstream homologous arm (3' homologous arm, SEQ ID NO: 4) is identical to nucleotide sequence of 17986807-17990821 of NCBI accession number NC_000071.7.
  • the A Fragment contains a human genomic DNA sequence from CD36 genes (SEQ ID NO: 5) , which is identical to nucleotide sequence of 80646828-80674045 of NCBI accession number NC_000007.14.
  • connection between the 5’ end of the human CD36 sequence and the mouse sequence was designed as: 5’-TGTGTTTGGAGGCATTCTCATGCC AGTC ACCTGCTTATCCAGAAGACAATTAAA AAGG-3’ (SEQ ID NO: 6) , wherein the “C” in sequence “ AGTC ” is the last nucleotide of the mouse sequence, and the first “G” in sequence “ ” is the first sequence of the human sequence.
  • connection between the 3’ end of the human CD36 sequence and mouse sequence was designed as: 5’-AAGTCAAGTAACTGGAAAAAT AAAC TTGGCATGGTAGAGATGGC-3’ (SEQ ID NO: 7) , wherein the “C” in sequence “ AAAC ” is the last nucleotide of the human sequence, and the first “C” in sequence “ ” is the first nucleotide of the mouse sequence.
  • the targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo) , and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette (within the A Fragment) .
  • Neo cassette within the A Fragment
  • the connection between the 5’ end of the Neo cassette and the human sequence was designed as: 5’-TGTGGACATGGCAGGA GATC CCCCTAGGAGTACTATCATCTG-3’ (SEQ ID NO: 8) , wherein the “C” in sequence “ GATC ” is the last nucleotide of the human sequence, and the first “G” in sequence “ ” is the first nucleotide of the Neo cassette.
  • the connection between the 3’ end of the Neo cassette and the human sequence was designed as: 5’-TAGATTACCACAACTCCG AGCC TGAACTTCACTGGAAGAAAAG-3’ (SEQ ID NO: 9) , wherein the last “C” in sequence “ AGCC ” is the last nucleotide of the Neo cassette, and the “C” in sequence “ ” is the first nucleotide of the human sequence.
  • a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA) ) was also constructed downstream of the 3' homologous arm of the targeting vector.
  • DTA diphtheria toxin A subunit
  • the targeting vector was constructed, e.g., by restriction enzyme digestion and ligation.
  • the constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing.
  • Embryonic stem cells of C57BL/6 mice were transfected with the correct targeting vector by electroporation.
  • the positive selectable marker genes were used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Specifically, after mouse embryonic stem cells were transfected with targeting vectors, the clones identified as positive by PCR were then verified by Southern Blot (cell DNA was digested with ScaI and EcoNI, respectively, and hybridized with two probes) to screen out correct positive clone cells.
  • the restriction enzymes, probes, and the size of target fragments are shown in the table below.
  • the Southern Blot detection results are shown in FIG. 4. The results indicate that the among the 4 PCR-positive embryonic stem cells, 4 clones (2-B04, 2-D02, 2-D03, and 3-F05) were verified as positive clones without random insertions.
  • WT-F 5’-AACCAGTGCTCTCCCTTGATTCTG-3’ (SEQ ID NO: 12) ,
  • the positive clones that had been screened were introduced into isolated blastocysts (white mice) , and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white) .
  • the F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other.
  • the positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker genes (schematic diagram shown in FIG. 5) , and then the humanized homozygous mice with a humanized CD36 gene were obtained by breeding the heterozygous mice with each other.
  • the genotype of the CD36 gene humanized mice can be verified by PCR using primers shown in the table below.
  • the identification results of exemplary F1 generation mice are shown in FIGS. 6A-6D, wherein two mice numbered F1-01 and F1-02 were identified as positive heterozygous mice.
  • the results indicate that genetically engineered mice with a humanized CD36 gene can be constructed using the methods described herein.
  • humanized CD36 protein in positive mice can be confirmed, e.g., by flow cytometry. Specifically, one 7-week-old female C57BL/6 wild-type mouse and one 7-week-old female CD36 gene humanized heterozygous mouse were selected.
  • Bone marrow tissues were collected after euthanasia by cervical dislocation, and the cells were stained with APC anti-mouse CD36 Antibody (mCD36; an anti-mouse CD36 antibody) ; PE anti-human CD36 Antibody (hCD36; an anti-human CD36 antibody) ; Brilliant Violet 510 TM anti-mouse CD45 (mCD45; an antibody recognizing mouse leukocytes) ; PerCP anti-mouse Ly-6G/Ly-6C (Gr-1) Antibody (mGr-1) ; V450 Rat Anti-mouse CD11b (mCD11b; a mouse monocyte/macrophage-specific antibody) ; FITC Anti-mouse F4/80 (mF4/80; a mouse macrophage-specific antibody) ; Mouse IgG2A PE-conjugated Antibody (an anti-mouse IgG2A antibody) ; APC Armenian Hamster IgG Isotype Ctrl Antibody (a mouse antibody
  • CD36 mRNA in mice was further detected by RT-PCR. Specifically, one 10-week-old female C57BL/6 wild-type mouse and one 10-week-old female CD36 gene humanized homozygous mouse were selected. Lung tissues were collected after euthanasia by cervical dislocation. Cellular RNA was extracted according to the instructions of the TRIzol TM kit. The cellular RNA was then reverse transcribed into cDNA, and then detected by RT-PCR using the primers shown in the table below. As shown in FIGS. 7A-7C, only mouse CD36 mRNA, but not human CD36 mRNA, was detected in the C57BL/6 wild-type mouse. By contrast, only human CD36 mRNA, but not mouse CD36 mRNA, was detected in the CD36 gene humanized homozygous mouse.
  • mice three C57BL/6 wild-type mice and three CD36 gene humanized homozygous mice (H/H) were detected by flow cytometry. After euthanasia, the spleen, peripheral blood, and lymph node tissues were collected for immuno-phenotyping detection. The detection results of leukocyte subtypes and T cell subtypes in the spleen are shown in FIG. 8 and FIG. 9, respectively. The detection results of leukocyte subtypes and T cell subtypes in peripheral blood are shown in FIG. 10 and FIG. 11, respectively.
  • mice The results showed that the percentages of B cells, T cells, NK cells, CD4+ T cells, CD8+ T cells, granulocytes, dendritic cells (DC cells) , macrophages, monocytes, and other leukocyte subtypes in the spleen and peripheral blood of CD36 gene humanized homozygous mice were basically the same as those in C57BL/6 wild-type mice (FIG. 8 and FIG. 10) .
  • the percentages of CD4+ T cells, CD8+ T cells, and Treg cells (Tregs) were basically the same as those in C57BL/6 wild-type mice (FIG. 9 and FIG. 11) .
  • the detection results of leukocyte subtypes and T cell subtypes in lymph nodes are shown in FIG. 12 and FIG. 13, respectively.
  • the results showed that the leukocyte subtypes, e.g., B cells, T cells, NK cells, CD4+ T cells, CD8+ T cells and other leukocyte subtypes in the lymph nodes of CD36 gene humanized homozygous mice were basically the same as those of C57BL/6 wild-type mice (FIG. 12) .
  • the percentages of T cell subtypes, e.g., CD4+ T cells, CD8+ T cells and Tregs cells were basically the same as those of C57BL/6 wild-type mice (FIG. 13) .
  • the CD36 gene humanized mice prepared described herein can be used to construct a tumor model, which is useful for testing the efficacy of drugs targeting human CD36.
  • the CD36 gene humanized homozygous mice (8 weeks old, female) prepared in Example 1 were selected and subcutaneously inoculated with mouse colon cancer cells MC38 (5 ⁇ 10 5 per mouse) .
  • the tumor volume grew to about 100-150 mm 3
  • the mice were randomly placed into a control group (G1) and two treatment groups (G2-G3) based on tumor size (6 mice per group) .
  • the treatment group mice were administered with anti-human CD36 antibody 1G04 disclosed in PCT Publication No.
  • WO2021176424A1 at 3 mg/kg (G2) or 10 mg/kg (G3) , via intraperitoneal injection (i. p. ) , whereas the control group mice were injected with an equal volume of phosphate-buffered saline (PBS) . All mice were administered with 1G04 or PBS on the grouping day. The frequency of administration was 3 times a week, and there were 6 times of administrations in total. The tumor volume was measured twice a week and the body weight of the mice was weighed as well. Euthanasia was performed when the tumor volume of the mouse reached 3000 mm 3 . The specific grouping and dosing schedule are shown in the table below. The body weight, body weight change, and tumor volume measurement results of mice during the experimental period are shown in FIGS. 14-16, respectively.
  • tumor volume at the time of grouping (Day 0) , 11 days after grouping (Day 11) , and 18 days after grouping (Day 18) , survived mouse number on Day 18, tumor-free mouse number on Day 18, tumor growth inhibition value based on tumor volume (TGI TV ) , and the statistical difference (P value) of body weight and tumor volume between the treatment group and control group.
  • the animals in each group were healthy, and the body weights of all the treatment group mice (G2-G3) and control group mice (G1) increased on Day 18, and were not significantly different from each other (P > 0.05) during the experimental period (FIG. 14 and FIG. 15) .
  • the results indicate that the treatment group mice tolerated the anti-human CD36 antibody 1G04. According to the results shown in FIG. 16 and the table above, the tumor volume of all control group mice continued to grow during the experimental period. By contrast, all treatment group mice showed different degrees of tumor growth inhibition.
  • mice treated in Group G3 showed a significant (P ⁇ 0.05) inhibitory effect of tumor growth.
  • the experimental results indicate that the CD36 gene humanized homozygous mice prepared by the methods described herein can be used for the development and screening of drugs (e.g., antibody drugs) targeting human CD36 in vivo.
  • the CD36 gene humanized mice generated using the methods described herein can also be used to generate double-or multi-gene humanized mouse models.
  • the embryonic stem (ES) cells for blastocyst microinjection can be selected from mice comprising other genetic modifications such as modified (e.g., human or humanized) PD-1, PD-L1, TIGIT, and/or CD226 genes.
  • embryonic stem cells from humanized CD36 mice described herein can be isolated, and gene recombination targeting technology can be used to obtain double-gene or multi-gene-modified mouse models of CD36 and other gene modifications.
  • the homozygous or heterozygous CD36 gene humanized mice obtained by the methods described herein with other genetically modified homozygous or heterozygous mice, and the offspring can be screened.
  • Mendel it is possible to generate double-gene or multi-gene modified heterozygous mice comprising modified (e.g., human or humanized) CD36 gene and other genetic modifications.
  • the heterozygous mice can be bred with each other to obtain homozygous double-gene or multi-gene modified mice.
  • These double-gene or multi-gene modified mice can be used for in vivo validation of gene regulators targeting human CD36 and other genes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Animal Husbandry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)

Abstract

La présente invention concerne des animaux non humains génétiquement modifiés exprimant une CD36 humaine ou chimérique (par exemple, humanisée), ainsi que des procédés d'utilisation associés.
PCT/CN2022/095669 2021-05-28 2022-05-27 Animal non humain génétiquement modifié avec cd36 humaine ou chimérique WO2022247936A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110593226.7 2021-05-28
CN202110593226 2021-05-28

Publications (1)

Publication Number Publication Date
WO2022247936A1 true WO2022247936A1 (fr) 2022-12-01

Family

ID=82572021

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/095669 WO2022247936A1 (fr) 2021-05-28 2022-05-27 Animal non humain génétiquement modifié avec cd36 humaine ou chimérique

Country Status (2)

Country Link
CN (1) CN114835798B (fr)
WO (1) WO2022247936A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104378976A (zh) * 2012-06-18 2015-02-25 瑞泽恩制药公司 人源化il-7啮齿动物
CN106470545A (zh) * 2014-05-07 2017-03-01 瑞泽恩制药公司 人源化IL‑4和IL‑4Rα动物
CN107287204A (zh) * 2016-06-28 2017-10-24 北京百奥赛图基因生物技术有限公司 一种pd‑1基因修饰人源化动物模型的构建方法及其应用
WO2018113774A1 (fr) * 2016-12-23 2018-06-28 Beijing Biocytogen Co., Ltd Animal non humain génétiquement modifié avec un cd27 humain ou chimérique
CN108531487A (zh) * 2017-03-31 2018-09-14 北京百奥赛图基因生物技术有限公司 人源化sirpa基因改造动物模型的制备方法及应用
US20190174731A1 (en) * 2016-08-22 2019-06-13 Chugai Seiyaku Kabushiki Kaisha Gene-modified non-human animal expressing human gpc3 polypeptide

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112458117B (zh) * 2021-02-02 2021-05-04 百奥赛图(北京)医药科技股份有限公司 Cd155基因人源化的非人动物的构建方法及应用

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104378976A (zh) * 2012-06-18 2015-02-25 瑞泽恩制药公司 人源化il-7啮齿动物
CN106470545A (zh) * 2014-05-07 2017-03-01 瑞泽恩制药公司 人源化IL‑4和IL‑4Rα动物
CN107287204A (zh) * 2016-06-28 2017-10-24 北京百奥赛图基因生物技术有限公司 一种pd‑1基因修饰人源化动物模型的构建方法及其应用
US20190174731A1 (en) * 2016-08-22 2019-06-13 Chugai Seiyaku Kabushiki Kaisha Gene-modified non-human animal expressing human gpc3 polypeptide
WO2018113774A1 (fr) * 2016-12-23 2018-06-28 Beijing Biocytogen Co., Ltd Animal non humain génétiquement modifié avec un cd27 humain ou chimérique
CN108531487A (zh) * 2017-03-31 2018-09-14 北京百奥赛图基因生物技术有限公司 人源化sirpa基因改造动物模型的制备方法及应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 2 March 2021 (2021-03-02), LI，LL ET AL.: "platelet glycoprotein 4 isoform 1[Homo sapiens] ", XP009541607, retrieved from NCBI Database accession no. NP_001358006 *
KARTZ GABRIELLA A., HOLME REBECCA L., NICHOLSON KAY, SAHOO DAISY: "SR-BI/CD36 Chimeric Receptors Define Extracellular Subdomains of SR-BI Critical for Cholesterol Transport", BIOCHEMISTRY, vol. 53, no. 39, 7 October 2014 (2014-10-07), pages 6173 - 6182, XP093007213, ISSN: 0006-2960, DOI: 10.1021/bi500706x *
MEYRE DAVID, ANDRESS EDWARD J., SHARMA TANMAY, SNIPPE MARJOLEIN, ASIF HAMZA, MAHARAJ ARJUNA, VATIN VINCENT, GAGET STEFAN, BESNARD : "Contribution of rare coding mutations in CD36 to type 2 diabetes and cardio-metabolic complications", SCIENTIFIC REPORTS, vol. 9, no. 1, 1 December 2019 (2019-12-01), XP093007222, DOI: 10.1038/s41598-019-53388-8 *
SILVERSTEIN ROY L., FEBBRAIO MARIA: "CD36, a Scavenger Receptor Involved in Immunity, Metabolism, Angiogenesis, and Behavior", SCIENCE SIGNALING, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 2, no. 72, 26 May 2009 (2009-05-26), US , XP093007211, ISSN: 1945-0877, DOI: 10.1126/scisignal.272re3 *

Also Published As

Publication number Publication date
CN114835798A (zh) 2022-08-02
CN114835798B (zh) 2024-02-23

Similar Documents

Publication Publication Date Title
US11723348B2 (en) Genetically modified mice expressing humanized CD47
US10973212B2 (en) Genetically modified non-human animal with human or chimeric SIRPa
US20220071185A1 (en) Genetically modified non-human animal with human or chimeric cd137
US11497198B2 (en) Genetically modified mice expressing humanized CD40
US10980222B2 (en) Genetically modified non-human animal with human or chimeric CD27
US11464876B2 (en) Genetically modified mouse comprising a chimeric TIGIT
US11350614B2 (en) Genetically modified non-human animal with human or chimeric CD28
US11154040B2 (en) Genetically modified non-human animal with human or chimeric CD137
WO2018113774A1 (fr) Animal non humain génétiquement modifié avec un cd27 humain ou chimérique
US10945419B2 (en) Genetically modified non-human animal with human or chimeric GITR
WO2023284850A1 (fr) Animal non humain génétiquement modifié comportant un tfr1 humain ou chimérique
US20220312749A1 (en) Genetically modified non-human animal with human or chimeric il2ra
WO2019072241A1 (fr) Animal non humain génétiquement modifié avec pd-1 humain ou chimérique
WO2018233607A1 (fr) Animal non humain génétiquement modifié avec cd40 humain ou chimérique
US20230165227A1 (en) Genetically modified non-human animal with human or chimeric cd276
WO2021136537A1 (fr) ANIMAL NON HUMAIN IMMUNODÉFICIENT GÉNÉTIQUEMENT MODIFIÉ À SIRPα/CD47 HUMAIN OU CHIMÉRIQUE
US11564381B2 (en) Genetically modified non-human animal with human or chimeric LAG3
WO2018233606A1 (fr) Animal non humain génétiquement modifié avec gitr humain ou chimérique
WO2022247936A1 (fr) Animal non humain génétiquement modifié avec cd36 humaine ou chimérique
WO2023066250A1 (fr) Animal non humain génétiquement modifié portant un trem1 humain ou chimérique
WO2023046061A1 (fr) Animal non humain génétiquement modifié comportant une trop2 humaine ou chimérique
WO2022258049A1 (fr) Animal non humain génétiquement modifié comportant des pvrig humains ou chimériques
WO2022253322A1 (fr) Animal non humain génétiquement modifié comportant vsig4 humain ou chimérique
WO2023083250A1 (fr) Animal non humain génétiquement modifié comportant un cd2 humain ou chimérique
WO2018233608A1 (fr) Animal non humain génétiquement modifié à cd28 humaine ou chimérique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22810660

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22810660

Country of ref document: EP

Kind code of ref document: A1