WO2022246000A1 - Compositions and methods for determining dna methylation level in cancer - Google Patents

Abstract

Provided herein, inter alia, are compositions and methods for detecting and treating a synchronous cancer in a subject who has or is suspected of having a cancer.

Description

COMPOSITIONS AND METHODS FOR DETERMINING DNA METHYLATION

LEVEL IN CANCER

CROSS-REFERENCES TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No. 63/190,752, filed May 19, 2021, the content of which is incorporated herein by reference in its entirety and for all purposes.

REFERENCE TO A “SEQUENCE LISTING,” A TABLE, OR A COMPUTER PROGRAM LISTING APPENDIX SUBMITTED AS AN ASCII FILE [0002] The Sequence Listing written in file 048440-808001WO_SL_ST25.TXT, created May 2, 2022, 4,437 bytes in size, machine format IBM-PC, MS-Windows operating system, is hereby incorporated by reference.

BACKGROUND

[0003] Patients with colorectal cancer (CRC) may present with solitary colorectal cancer (SoCRC) or multiple primary CRC, involving two or more tumors. Synchronous colorectal cancer (SyCRC) refers to two or more in number, detected in a single patient at the same time or within 6 months of the initial diagnosis [1] Moreover, metachronous colorectal cancer (MCRC) can be defined as those diagnosed 6 months after the operation for the primary lesion and located in a different part of the large intestine, so as to not represent a recurrence [2] SyCRC accounts for about 1.1-8.1% of all CRCs and is often seen in males, proximal location, and mucinous type, when compared to SoCRC. [3] So far, some known risk factor for SyCRC include familial adenomatous polyposis (FAP), Lynch syndrome, inflammatory bowel diseases (IBD), and serrated polyps/hyperplastic polyposis [3, 4] However, these features accounts for only 10% of SyCRC patients and its clinical, pathological features and prognosis are still controversial [5]

[0004] Precise diagnosis of SyCRC is important because SyCRC may require extensive resection or separated segmental resection [6, 7] However, preoperative total colonoscopy is often unachievable for the patients with the obstruction or stenosis of distal tumor. Although computed tomography (CT) colonography improved the detection of synchronous lesions, its diagnostic accuracy is still uncertain [8, 9] Moreover, the National Comprehensive Cancer Network (NCCN) guidelines recommend the colonoscopy in 1 year after surgery resection of the first tumor [10] This follow up interval is inadequate for the patients with SyCRC because the second tumor will emerge within 6 months after first tumor resection. If SyCRC is overlooked, a synchronous tumor might progress into a more advanced stage and even metastasize.

[0005] Deoxyribonucleic acid (DNA) methylation is an epigenetic modification regulating gene expression, and abnormal methylation is the most common epigenetic variation in the process of sporadic CRCs [11] DNA methylation alterations are remarkably stable and often occur early during carcinogenesis: represents a promising tool for minimally and noninvasive cancer detection [12] Although many DNA methylation biomarkers have been reported, they are still under the exploration process and rarely used in clinical applications [13-16] Recent previous studies have reported the epigenetic molecular features of SyCRC [17-20] For example, chromosomal instability (CIN) positive accounts for approximately 60% of synchronous cancer [20] The presence of SyCRC is reported to have a relatively high correlation with the microsatellite instability (MSI) pathway and the rate of MSI-high is about 30% in SyCRC, while that of SoCRC is about 10% [17, 21, 22] The CpG island methylation phenotype (CIMP) is a subset of colorectal cancers that happen through an epigenetic instability pathway [23] Compare to SoCRC, the patients with SyCRC have a higher frequency of CIMP positive [17] Moreover, certain genes, such as long interspersed nucleotide element- 1 (LINE1), are methylated frequently in SyCRC [17] However, few methylation markers are widely accepted for SyCRC. Thus, biomarkers for the correct identification of SyCRC and as an adjunct to the diagnostic procedure are a clear unmet clinical need.

BRIEF SUMMARY

[0006] Provided herein, inter alia, are methods of detecting a level of DNA methylation in a subject who has or is suspected of having a cancer. The disclosed methods comprise determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B,

ZNF511, ARFGAP2, or KIF22. In embodiments, determining the methylation level of the gene comprises determining the methylation level of a CpG site within the gene. In embodiments, the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, or cgl 1255039. In embodiments, the CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22.

[0007] Also provided herein are methods of treating a subject who has or is suspected of having a synchronous cancer. The disclosed methods comprise: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22; and (ii) administering to the subject an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

[0008] Additionally provided herein are methods of detecting a synchronous cancer in a subject with cancer. The disclosed methods comprise determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, and wherein an elevated methylation level the gene is indicative of synchronous cancer.

[0009] Also provided herein are methods of diagnosing a subject having a cancer as having a synchronous cancer, the methods comprising determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, wherein the subject is diagnosed as having a synchronous cancer if an elevated methylation level of the gene is detected in the biological sample.

[0010] Additionally provided herein are methods of monitoring a subject having a cancer for synchronous cancer. The disclosed methods comprise (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, at a first time point; and (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22 at a second time point later than the first time point.

[0011] Also provided herein are methods of monitoring a subject having cancer for synchronous cancer and treating synchronous cancer, the methods comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B,

ZNF511, ARFGAP2, or KIF22 at a first time point; (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, or KIF22 at a second time point later than the first time point; and (iii) treating the subject with surgery, an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy, if the methylation level of said gene at the second time point is elevated relative to the methylation level of said gene at the first time point.

[0012] In embodiments, monitoring a subject further comprises performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is one or more of a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, the presence of colorectal lesions is indicative of synchronous colorectal cancer.

[0013] In embodiments, a subject with no indication of synchronous colorectal cancer is monitored every 3 to 6 months for two years after testing, and thereafter every six months for three additional years.

BRIEF DESCRIPTION OF THE DRAWINGS [0014] FIGS. 1A-1D. Identification of a deoxyribonucleic acid (DNA) methylation signature for patients with synchronous colorectal cancer (SyCRC). FIG. 1A: Heatmap representing the significantly 12 differentially methylated CpG sites (DMPs) in patients with SyCRC (n=16) and with solitary colorectal cancer (SoCRC) (n=18) from methylation array analysis. FIG. IB: Multidimensional scaling (MDS) plot of SyCRC and SoCRC cases using 12 DMPs. FIG. 1C: The correlation heatmap displays the correlation coefficients (Spearman) among 12 DMPs. DMPs which were highly correlated with the others were excluded, and finally six DMPs were selected as candidates for the establishment of a methylation signature. FIG. ID: A Receiver Operator Characteristic (ROC) curve of the six-methylation panel for predicting the patients with SyCRC in discovery cohort.

[0015] FIGS. 2A-2D. Establishment of six methylation panel by polymerase chain reaction (PCR) in independent in-house clinical cohort. FIG. 2A: Univariate analysis derived odds ratios (OR) and 95% confidence interval (Cl) for individual genes in predicting patient with SyCRC. FIG. 2B: The violin plot representing risk scores of patients with SyCRC and with SoCRC in clinical cohort. FIG. 2C: A ROC curve for the prediction of patients with SyCRC. FIG. 2D: Risk score distribution plots in clinical independent cohort.

[0016] FIGS. 3A-3C. Comparison of the methylation signature in synchronous cancer pairs. FIG. 3A: Paired comparison of the methylation signature in synchronous cancer pairs. FIG. 3B: A ROC curve for the prediction of synchronous cancer pairs. FIG. 3C: Correlation of the methylation signature between synchronous cancer pairs. Tumor 1 refers to a tumor at a higher stage or a larger tumor if the two synchronous tumors were at the same stage. [0017] FIGS. 4A-4C: Prognostic potential of the methylation signature for patients with SyCRC in the clinical cohort. FIG. 4A: A ROC curve for the prediction of patients with SyCRC developed to metachronous colorectal cancer (MCRC). FIG. 4B: The violin plot representing risk scores of patients with SyCRC developed to MCRC and not developed to MCRC in clinical cohort. FIG. 4C: Kaplan Meier plots of relapse-free survival (RFS) between high and low-risk group estimated by the methylation panel model in clinical cohort. [0018] FIG. 5. Overview of the study design synchronous colorectal cancer (SyCRC); solitary colorectal cancer (SoCRC); differentially methylated region (DMR); differentially methylated CpG sites (DMPs).

[0019] FIGS. 6A-6B. Comparison of the methylation signature between patients with SoCRC and with SyCRC (lower stage). FIG. 6A: A ROC curve for the prediction of patients with SyCRC. FIG.6B: Risk score distribution plots in clinical independent cohort.

DETAILED DESCRIPTION

[0020] Provided herein are, inter alia, compositions and methods for detecting a level of DNA methylation in a subject that has or is suspected of having a cancer. The disclosed methods comprise determining the methylation level, relative to a standard control, of one or more genes or a combination of two or more thereof in a biological sample obtained from the subject. The one or more genes are SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22. These methods include treatment of a subject for cancer based on DNA methylation patterns.

[0021] Before the present invention is further described, it is to be understood that this invention is not strictly limited to particular embodiments described, as such may of course vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the claims. It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. It should further be understood that as used herein, the term “a” entity or “an” entity refers to one or more of that entity. For example, a nucleic acid molecule refers to one or more nucleic acid molecules. As such, the terms “a”, “an”, “one or more” and “at least one” can be used interchangeably. Similarly, the terms “comprising”, “including” and “having” can be used interchangeably.

[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0023] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub combination was individually and explicitly disclosed herein.

[0024] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0025] As used herein, the term “about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to +/- 10% of the specified value. In embodiments, about means the specified value.

[0026] “Nucleic acid” refers to nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and polymers thereof in either single-, double- or multiple-stranded form, or complements thereof. The terms “polynucleotide,” “oligonucleotide,” “oligo” or the like refer, in the usual and customary sense, to a linear sequence of nucleotides. The term “nucleotide” refers, in the usual and customary sense, to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of nucleic acids contemplated herein include single and double stranded DNA, single and double stranded RNA, and hybrid molecules having mixtures of single and double stranded DNA and RNA. Examples of nucleic acids contemplated herein include any types of RNA (e.g., antisense RNA, mRNA, siRNA, miRNA, shRNA, guide RNA, dicer substrate RNA, dicer substrate siRNAs (dsiRNAs) (dsiRNA are cleaved by the RNase III class endoribonuclease dicer into 21-23 base duplexes having 2-base 3 ’-overhangs siRNA), and any type of DNA, genomic DNA, plasmid DNA, and minicircle DNA, and any fragments thereof. The term “duplex” in the context of nucleic acids refers, in the usual and customary sense, to double strandedness. Nucleic acids can be linear or branched. For example, nucleic acids can be a linear chain of nucleotides or the nucleic acids can be branched, e.g., such that the nucleic acids comprise one or more arms or branches of nucleotides. Optionally, the branched nucleic acids are repetitively branched to form higher ordered structures such as dendrimers and the like. The terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, include, without limitation, phosphodiester derivatives including, e.g., phosphoramidate, phosphorodiamidate, phosphorothioate (also known as phosphorothioate having double bonded sulfur replacing oxygen in the phosphate), phosphorodithioate, phosphonocarboxylic acids, phosphonocarboxylates, phosphonoacetic acid, phosphonoformic acid, methyl phosphonate, boron phosphonate, or O- methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press) as well as modifications to the nucleotide bases such as 2’0-methyl, 2’ O-methoxy ethoxy, 2’fluoro, 5-methyl cytidine or pseudouridine; and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, modified sugars (e.g., deoxyribose), and non-ribose backbones (e.g. phosphorodiamidate morpholino oligos or locked nucleic acids (LNA) as known in the art), including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense Research, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. In aspects, the intemucleotide linkages in DNA are phosphodiester, phosphodiester derivatives, or a combination of both.

[0027] The terms “activation,” “activate,” “activating” and the like are used in accordance with its plain ordinary meaning and refer to an interaction that positively affects (e.g. increasing) the activity or function of a protein or cell relative to the activity or function of the protein or cell in the absence of the activator. In embodiments, activation means positively affecting (e.g. increasing) the concentration or levels of the protein relative to the concentration or level of the protein in the absence of the activator. The terms may reference activation, or activating, sensitizing, or up-regulating signal transduction or enzymatic activity or the amount of a protein decreased in a disease. Thus, activation may include, at least in part, partially or totally increasing stimulation, increasing or enabling activation, or activating, sensitizing, or up-regulating signal transduction or enzymatic activity or the amount of a protein associated with a disease (e.g., a protein that is decreased in a disease relative to a non-diseased control). Activation may include, at least in part, partially or totally increasing stimulation, increasing or enabling activation, or activating, sensitizing, or up- regulating signal transduction or enzymatic activity or the amount of a protein [0028] The terms “inhibition,” “inhibit,” “inhibiting” and the like are used in accordance with its plain ordinary meaning and refer to an interaction with in inhibitor that negatively affects (e.g. decreases) the activity or function of the protein or cell relative to the activity or function of the protein or cell in the absence of the inhibitor. In embodiments, inhibition means negatively affecting (e.g. decreasing) the concentration or levels of the protein relative to the concentration or level of the protein in the absence of the inhibitor. In embodiments, inhibition refers to reduction of a disease or symptoms of disease. In embodiments, inhibition refers to a reduction in the activity of a particular protein target. Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein. In embodiments, inhibition refers to a reduction of activity of a target protein resulting from a direct interaction (e.g. an inhibitor binds to the target protein). In embodiments, inhibition refers to a reduction of activity of a target protein or cell from an indirect interaction (e.g. an inhibitor binds to a protein that activates the target protein, thereby preventing target protein activation or cell activations).

[0029] As used herein, the terms “inhibitor,” “repressor” or “antagonist” or “downregulator” are used in accordance with its plain ordinary meaning and refer to a substance capable of detectably decreasing the expression or activity of a given gene or protein. The antagonist can decrease expression or activity 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control in the absence of the antagonist. In instances, expression or activity is 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or lower than the expression or activity in the absence of the antagonist.

[0030] A “primer” refers to a short, single-stranded DNA sequence used in the polymerase chain reaction (PCR) technique. In the PCR method, a pair of primers is used to hybridize with the sample DNA and define the region of the DNA that will be amplified. Primers are also referred to as oligonucleotides.

[0031] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (e.g., NCBI web site www.ncbi.nlm.nih.gov/BLAST/ or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

[0032] The term “promoter” refers to a nucleic acid sequence that regulates, either directly or indirectly, the transcription of a corresponding nucleic acid coding sequence to which it is operably linked. The promoter may function alone to regulate transcription, or, in some cases, may act in concert with one or more other regulatory sequences such as an enhancer or silencer to regulate transcription of the transgene. The promoter comprises a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene, which is capable of binding RNA polymerase and initiating transcription of a downstream (3'- direction) coding sequence.

[0033] As described herein, the complementarity of sequences may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing. Thus, two sequences that are complementary to each other, may have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,

96%, 97%, 98%, 99%, or higher identity over a specified region).

[0034] “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0035] A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA). Thus, the term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule; alternatively, the term may be applied to the polynucleotide molecule itself. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. Polynucleotides may optionally include one or more non-standard nucleotide(s), nucleotide analog(s) and/or modified nucleotides.

[0036] The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may be conjugated to a moiety that does not consist of amino acids. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. A “fusion protein” refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single moiety.

[0037] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, g- carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. The terms “non-naturally occurring amino acid” and “unnatural amino acid” refer to amino acid analogs, synthetic amino acids, and amino acid mimetics which are not found in nature.

[0038] As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid.

Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the disclosure.

[0039] The following eight groups each contain amino acids that are conservative substitutions for one another: (1) Alanine (A), Glycine (G); (2) Aspartic acid (D), Glutamic acid (E); (3) Asparagine (N), Glutamine (Q); (4) Arginine (R), Lysine (K); (5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); (6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); (7) Serine (S), Threonine (T); and (8) Cysteine (C), Methionine (M) (see, e.g.,

Creighton, Proteins (1984)).

[0040] The terms “treating” or “treatment” refers to any indicia of success in the therapy or amelioration of a disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient’s physical well being. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination. The term “treating” and conjugations thereof, may include prevention of a pathology, condition, or disease. In aspects, treating is preventing. In aspects, treating does not include preventing.

[0041] As used herein, the term “level” is used in accordance with its plain ordinary meaning and refers to a position on a scale of amount, quantity, extent, or quality. Here, level is in the context of DNA methylation which is identified by three methods. Sodium bisulfite conversion and sequencing, differential enzymatic cleavage of DNA, and affinity capture of methylated DNA (1). Restriction enzyme based differential cleavage of methylated DNA is locus-specific. However, affinity-capture and bisulphite conversion followed by sequencing methods have been used for both gene specific or genome-wide analysis (2). The most commonly reported DNA affinity capture method is methylated DNA immunoprecipitation (Me-DIP) that uses methyl DNA specific antibody, or methyl capture using methyl-CpG binding domain (MBD) proteins. Each approach is sensitive but has its own limitation like antibody cross reactivity or methylcytosine density dependency (3). There are also other reagents to study DNA methylation.

[0042] The terms “cell-free nucleic acid” or “cell-free DNA” refer to nucleic acids present in a sample from a subject or portion thereof that can be isolated or otherwise manipulated without applying a lysis step to the sample as originally collected (e.g., as in extraction from cells or viruses). Cell-free nucleic acids are thus unencapsulated or “free” from the cells or viruses from which they originate, even before a sample of the subject is collected. Cell-free nucleic acids may be produced as a byproduct of cell death (e.g. apoptosis or necrosis) or cell shedding, releasing nucleic acids into surrounding body fluids or into circulation. Accordingly, cell-free nucleic acids may be isolated from a non-cellular fraction of blood (e.g. serum or plasma), from other bodily fluids (e.g. urine), or from non-cellular fractions of other types of samples.

[0043] A “gene,” or a “sequence which encodes” a particular protein, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the gene are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A gene can include, but is not limited to, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the gene sequence. Typically, polyadenylation signal is provided to terminate transcription of genes inserted into a recombinant virus. The term "gene" means the segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene. Further, a "protein gene product" is a protein expressed from a particular gene.

[0044] As used herein, the term “expression” is used in accordance with its plain ordinary meaning and refers to any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression can be detected using conventional techniques for detecting protein (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.).

[0045] The term “gene region” is any portion of a full length gene, including non-coding regions, and can be defined by a beginning and end nucleotide of a DNA sequence.

[0046] The term “aberrant” as used herein refers to different from normal. When used to describe enzymatic activity or protein function, aberrant refers to activity or function that is greater or less than a normal control or the average of normal non-diseased control samples. Aberrant activity may refer to an amount of activity that results in a disease, wherein returning the aberrant activity to a normal or non-disease-associated amount (e.g. by administering a compound or using a method as described herein), results in reduction of the disease or one or more disease symptoms.

[0047] The terms "marker," and “biomarker” are used interchangeably throughout the disclosure, and are used in accordance with their plain and ordinary meaning. A marker refers generally to a selected gene or selected group of genes, the level or concentration of which is associated with a particular biological state, particularly a state associated with colorectal cancer and colorectal cancer liver metastasis. Panels, assays, kits and methods described herein may comprise antibodies, binding fragments thereof or other types of target-binding agents, which are specific for the markers described herein (e.g., SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22). In embodiments, no additional biomarkers are analyzed and/or detected in the methods described herein, other that the markers provided herein (e g., SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22).

[0048] The term “antibody” is used in the broadest sense and includes fully assembled antibodies, tetrameric antibodies, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), antibody fragments that can bind an antigen (e.g.,

Fab', F'(ab)2, Fv, single chain antibodies, diabodies), and recombinant peptides comprising the forgoing as long as they exhibit the desired biological activity. An “immunoglobulin” or “tetrameric antibody” is a tetrameric glycoprotein that consists of two heavy chains and two light chains, each comprising a variable region and a constant region. Antigen-binding portions may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Antibody fragments or antigen-binding portions include, inter aba, Fab, Fab', F(ab')2, Fv, domain antibody (dAb), complementarity determining region (CDR) fragments, CDR-grafted antibodies, single-chain antibodies (scFv), single chain antibody fragments, chimeric antibodies, diabodies, triabodies, tetrabodies, minibody, linear antibody; chelating recombinant antibody, a tribody or bibody, an intrabody, a nanobody, a small modular immunopharmaceutical (SMIP), an antigen-binding-domain immunoglobulin fusion protein, a camelized antibody, a VHH containing antibody, or a variant or a derivative thereof, and polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide, such as one, two, three, four, five or six CDR sequences, as long as the antibody retains the desired biological activity. [0049] “Monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.

[0050] “Antibody variant” as used herein refers to an antibody polypeptide sequence that contains at least one amino acid substitution, deletion, or insertion in the variable region of the reference antibody variable region domains. Variants may be substantially homologous or substantially identical to the unmodified antibody.

[0051] The terms “biological fluids”, “body fluids”, “bodily fluids” or “biofluids” refer to liquids within the human body. Such liquids can be blood, serum, plasma, saliva, ascites fluid, peritoneal fluid, and urine. In embodiments, the fluid is blood. In embodiment, the fluid is serum. In embodiments, the fluid is plasma. In embodiments, the fluid is saliva. In embodiments, the fluid is ascites fluid. In embodiments, the fluid is peritoneal fluid. In embodiments, the fluid is urine.

[0052] The term “confirmatory diagnostic procedure” as used herein refers to medical tests or procedures used to confirm a medical diagnosis. A confirmatory diagnostic procedure can be, e.g. an angiography, an alfa-fetoprotein (AFP) protein blood test, a tumor marker test, a microsatellite instability (MSI) test, a colonoscopy, an esophagus-gastric-duodenoscopy (EGD), an abdominal ultrasound, an endoscopic ultrasound, a bronchoscopy, a tissue biopsy, a fine needle aspiration, an esophagogastroduodenoscopy (EGD), a tissue biopsy, a CA19-9 antigen test, a fine needle aspiration, an endoscopy, biopsy collection, a blood test, a fecal test, a fecal occult blood test, a magnetic resonance imaging scan (MRI scan) (e.g. a cholangiopancreatography), a computed tomography scan (CT scan), a positron emission tomography scan (PET scan), or a carcinoembryonic antigen (CEA) test.

[0053] The terms “computed tomography scan” or “CT scan” refer to a medical imaging technique that uses computer-processed combinations of multiple X-ray measurements taken from different angles to produce tomographic (cross-sectional) images (virtual "slices") of a body, allowing the user to see inside the body without cutting.

[0054] The term “X-ray” or “X-radiation” refers to a penetrating form of high-energy electromagnetic radiation. Most X-rays have a wavelength ranging from 10 picometers to 10 nanometers, corresponding to frequencies in the range 30 petahertz to 30 exahertz (3 Ox 1015Hz to 30x1018 Hz) and energies in the range 124 eV to 124 keV. X-ray wavelengths are shorter than those of UV rays and typically longer than those of gamma rays. [0055] The terms “PET”, “PET scan”, “positron emission tomography”, or “positron emission tomography scan” refer to a functional imaging technique that uses radioactive substances known as radiotracers to visualize and measure changes in metabolic processes, and in other physiological activities including blood flow, regional chemical composition, and absorption. Different tracers are used for various imaging purposes, depending on the target process within the body. PET scan is a common imaging technique, a medical scintillography technique used in nuclear medicine. A radiopharmaceutical - a radioisotope attached to a drug is injected into the body as a tracer. Gamma rays are emitted and detected by gamma cameras to form a three-dimensional image, in a similar way that an X-ray image is captured.

[0056] The term “MRI” or “magnetic resonance imaging” refer to a medical imaging technique used in radiology to form pictures of the anatomy and the physiological processes of the body. MRI scanners use strong magnetic fields, magnetic field gradients, and radio waves to generate images of the organs in the body. MRI does not involve X-rays or the use of ionizing radiation, which distinguishes it from CT and PET scans. MRI is a medical application of nuclear magnetic resonance (NMR) which can also be used for imaging in other NMR applications, such as NMR spectroscopy.

[0057] The term “colonoscopy” refers to an endoscopic examination of the large bowel and the distal part of the small bowel with a CCD camera or a fiber optic camera on a flexible tube passed through the anus. It can provide a visual diagnosis as well as an opportunity for biopsy or removal of suspected colorectal cancer lesions. Colonoscopy can remove polyps smaller than one millimeter. Once polyps are removed, they can be studied with the aid of a microscope to determine if they are precancerous or not. It can take up to 1 5 years for a polyp to turn cancerous. In embodiments, colonoscopy is performed on a subject in need thereof as set forth herein. In embodiments, colonoscopy is performed on a subject following detection of elevated or abnormal methylation of one or more genes selected from SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, and combinations thereof. In such cases colonoscopy is carefully performed to determine the presence or absence of cololorectal lesions that are indicative of synschronous colorectal cancer. In embodiments, the doctor or medical practitioner takes additional time to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes additional time to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional 15 minutes to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional 30 minutes to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional 45 minutes to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional hour to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional hour and a half to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional hour and 45 minutes to review the results of the colonoscopy. In embodiments, the doctor or medical practitioner takes an additional two hours to review the results of the colonoscopy. In embodiments, colonoscopy is performed on a subject prior to determining the level of methylation of one or more genes, or a combination of two or more thereof, as described herein. [0058] As used herein, the term “CpG” is used in accordance with its plain ordinary meaning and refers to shorthand for 5 C phosphate G 3' , that is, cytosine and guanine separated by only one phosphate group; phosphate links any two nucleosides together in DNA. The CpG notation is used to distinguish this single-stranded linear sequence from the CG base-pairing of cytosine and guanine for double-stranded sequences. The CpG notation is therefore to be interpreted as the cytosine being 5 prime to the guanine base. CpG sites occur with high frequency in genomic regions called CpG islands (or CG islands). CpG sites can be, for example, cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, or cgl 1255039. CpG sites are associated with specific genes. Thus, the CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.

[0059] In some instances, a cytosine in a CpG dinucleotide is methylated to form 5 - methyl cytosine. In some instances, a cytosine in a CpG dinucleotide is methylated to form 5- hydroxymethylcytosine. Methylating the cytosine within a gene can change its expression, a mechanism that is part of epigenetic gene regulation. The term "methylation" refers to attaching a methyl group to a base constituting DNA. Methylation as provided herein means whether methylation occurs in cytosine of a specific CpG site of a specific gene. When methylation occurs, the binding of transcription factors is prevented, thereby inhibiting the expression of a specific gene. Conversely, when unmethylation or hypomethylation occurs, the expression of a specific gene increases.

[0060] The term “CpG detection site” as used herein refers to a region in a probe that is configured to hybridize to a CpG site of a target DNA molecule. The CpG site on the target DNA molecule can comprise cytosine and guanine separated by one phosphate group, where cytosine is methylated or unmethylated. The CpG site on the target DNA molecule can comprise uracil and guanine separated by one phosphate group, where the uracil is generated by the conversion of unmethylated cytosine.

[0061] The term “differentially methylated probes” or “DMPs” refers to CpG sites which have different methylation status among multiple samples, for example, between samples from patients with synchronous cancer and samples from patients with a solitary cancer, or between samples from patients with synchronous cancer and samples from healthy individuals. Thus, DMPs reflect the differences in the methylation status of CpGs between samples obtained from patients with synchronous colorectal cancer and samples obtained from patients with solitary colorectal cancer.

[0062] The term “DNA methyltransferases” refers to enzymes that add a methyl group to a DNA molecule. In mammals, 70% to 80% of CpG cytosines are methylated. Methylating the cytosine within a gene can change its expression. In humans, DNA methylation occurs at the 5’ position of the pyrimidine ring of the cytosine residues within CpG sites to form 5- methylcytosines. The presence of multiple methylated CpG sites in CpG islands of promoters causes stable silencing of genes. Silencing of a gene may be initiated by other mechanisms, but this is often followed by methylation of CpG sites in the promoter CpG island to cause the stable silencing of the gene. In humans, about 70% of promoters located near the transcription start site of a gene (proximal promoters) contain a CpG island.

[0063] The term “DNA methylation” or “methylation” refers to the addition of a methyl group to a DNA molecule. Methylation can change the activity of a DNA segment without changing the sequence. When located in a gene promoter, DNA methylation typically acts to repress gene transcription. In mammals, DNA methylation is essential for normal development and is associated with a number of key processes including genomic imprinting, X-chromosome inactivation, repression of transposable elements, aging, and carcinogenesis. DNA methylation in vertebrates typically occurs at CpG sites. This methylation results in the conversion of the cytosine to 5-methylcytosine. The formation of Me-CpG is catalyzed by the enzyme DNA methyltransferase. In mammals, DNA methylation is common in body cells. Human DNA has about 80-90% of CpG sites methylated, but there are certain areas, known as CpG islands, that are CG-rich (high cytosine and guanine content, made up of about 65% CG residues), wherein none is methylated.

[0064] The term “hypomethylated” or “hypermethyl ated” as used herein refers to a methylation status of a DNA molecule, such as a gene, containing multiple CpG sites (e.g., more than 3, 4, 5, 6, 7, 8, 9, 10, etc.) where a high percentage of the CpG sites (e.g., more than 80%, 85%, 90%, or 95%, or any other percentage within the range of 50%-100%) are unmethylated or methylated, respectively.

[0065] The terms “abnormal methylation,” “abherrant methylation” or “anomalous methylation” as used herein refer to a methylation pattern or status of a DNA molecule that is different from a regular threshold value.

[0066] The term “differentially methylated regions” (DMRs) refers to genomic regions comprising multiple consecutive methylated CpG sites. DMRs are defined as 100-bp genomic windows containing more than two adjacent DMPs. DMRs may have different DNA methylation statuses across different biological samples and are regarded as possible functional regions involved in gene transcriptional regulation. The biological samples can be different cells or tissues within the same individual, the same cell or tissue at different times, cells or tissues from different individuals, even different alleles in the same cell. There are several different types of DMRs. These include tissue-specific DMR (tDMR), cancer-specific DMR (cDMR), development stages-specific DMR (dDMRs), reprogramming-specific DMR (rDMR), allele-specific DMR (AMR), and aging-specific DMR (aDMR). DNA methylation is associated with cell differentiation and proliferation.

[0067] The terms “degree of methylation” and “level of methylation” are used interchangeably. In embodiments, “degree of methylation” and “level of methylation” refer to a detected level of methylation of a specific DNA sequence ( e.g . chromosome, gene, or non coding DNA region), which corresponds to an amount of methylation at the CpG sites within the DNA sequence being analyzed across the entire sample size of tumor cells, relative to a standard control. In embodiments, “degree of methylation” and “level of methylation” refer to a detected level of methylation of a specific CpG site within a DNA sequence, which corresponds to an amount of methylation of the specific CpG site being analyzed across the entire sample size of tumor cells, relative to a standard control. The level of methylation of each sample relative to the standard control is expressed as a percentage of methylated reference (PMR) value of the sample. In embodiments, the sample size of tumor cells is from about 0 tumor cells to one billion or more tumor cells. In embodiments, the tumor cell sample consists of one tumor cell. In embodiments, the tumor cell sample consists of 10 tumor cells. In embodiments, the tumor cell sample consists of 100 tumor cells. In embodiments, the tumor cell sample consists of 1,000 tumor cells. In embodiments, the tumor cell sample consists of 5,000 tumor cells. In embodiments, the tumor cell sample consists of 10,000 tumor cells. In embodiments, the tumor cell sample consists of 50,000 tumor cells. In embodiments, the tumor cell sample consists of 100,000 tumor cells. In embodiments, the tumor cell sample consists of 500,000 tumor cells. In embodiments, the tumor cell sample consists of one million tumor cells. In embodiments, the tumor cell sample consists of 10 million tumor cells. In embodiments, the tumor cell sample consists of 100 million tumor cells. Methylation level of one or more genes selected from the group consisting of SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22 can be measured by different methods including, but not limited to, methylation-specific PCR, such as methylation-specific polymerase chain reaction (MSP), real time methylation-specific polymerase chain reaction, methylated DNA-specific binding protein, pyro sequencing, bisulfite sequencing, and ten- eleven translocation protein (TET) (Nature Biotechnology 37: 424-429 (2019)).

[0068] The term “methylation analysis” refers to the determination of the methylation status of one or a plurality of CpG sites within a DNA sequence in a sample. Methylation analysis may be performed for absolute or relative quantification of methylated nucleic acids following nucleic acid extraction. Circulating DNA from a cell-free sample such as blood or urine is isolated and/or purified by methods known in the art. Such methods include, but are not limited to, the use of a protein degenerating reagent e.g. chaotropic salt e.g. guanidine hydrochloride or urea; or a detergent e.g. sodium dodecyl sulphate (SDS), cyanogen bromide, ethanol or propanol precipitation, vacuum concentration, ultrafiltration, silica surfaces or membranes, magnetic particles, polystyrol particles, polystyrol surfaces, positively charged surfaces, and positively charged membranes, charged membranes, charged surfaces, charged switch membranes, and charged switched surfaces. Once the nucleic acids have been extracted, methylation analysis is carried out by any means known in the art. A variety of methylation analysis procedures are known in the art and may be used to practice the invention. Such methylation assays involve, among other techniques, two major steps. The first step is a methylation specific reaction or separation, such as (i) bisulfite treatment, (ii) methylation specific binding, or (iii) methylation specific restriction enzymes. The second major step involves (i) amplification and detection, or (ii) direct detection, by a variety of methods such as (a) PCR (sequence-specific amplification) such as Taqman®, (b) DNA sequencing of untreated and bisulfite-treated DNA, (c) sequencing by ligation of dye- modified probes (including cyclic ligation and cleavage), (d) pyrosequencing, (e) single molecule sequencing, (f) mass spectroscopy, or (g) Southern blot analysis. Additionally, restriction enzyme digestion of PCR products amplified, for example, from bisulfite- converted DNA. PCR amplification of the bisulfite converted DNA is performed using primers specific for the CpG sites of interest, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes.

[0069] The term “methylation marker” as used herein refers to a specific gene that is potentially methylated. Methylation typically occurs in a CpG containing nucleic acid. The CpG containing nucleic acid may be present in, e.g., in a CpG island, a CpG doublet, a promoter, an intron, or an exon of a gene. [0070] The term “methylation status” as used herein refers to the presence or absence of methylation in a specific nucleic acid region e.g., genomic region. In the context of the present disclosure, the term “methylation status” encompasses methylation status or hydroxymethylation status of “ — C-phosphate-G-” (CpG) sites within a gene. A nucleic acid sequence may comprise one or more such CpG methylation sites. In embodiments, the “methylation status” is indicative of a level of the methylation in a nucleic acid. Herein, the methylation level may be expressed in any numeric form, e.g., total count, arithmetic mean, e.g., average per million base pairs (bp), geometric mean, etc. In embodiments, the methylation status is indicative of a pattern of the methylation in a nucleic acid. Epigenetic probing to determine methylation pattern can involve imaging stretched single molecules of DNA. The imaging can include simultaneously localizing the position of a DNA origami probe on a single molecule of DNA and reading the origami “barcode.” An exemplary method is described in US Pub. No. 2016/0168632, which is herein incorporated by reference in its entirety.

[0071] In the context of a gene or template DNA, its methylation status can include determining a methylation status of a methylation marker within or flanking about 10 bp to 50 bp, about 50 to 100 bp, about 100 bp to 200 bp, about 200 bp to 300 bp, about 300 to 400 bp, about 400 bp to 500 bp, about 500 bp to 600 bp, about 600 to 700 bp, about 700 bp to 800 bp, about 800 to 900 bp, 900 bp to 1 kb, about 1 kb to 2 kb, about 2 kb to 5 kb, or more of a named gene, or CpG position. The process may include “selective detection” of methylated nucleobase. Herein, the phrase “selectively detecting” refers to methods wherein only a finite number of methylation marker or genes (comprising methylation markers) are measured rather than assaying essentially all potential methylation marker (or genes) in a genome. [0072] In embodiments, the methylation profile of selected CpG sites is determined using methylation-specific PCR (MSP). MSP allows for assessing the methylation status of any group of CpG sites within a CpG island, independent of the use of methylation-sensitive restriction enzymes. In embodiments, the methylation profile of selected CpG sites is determined using MethyLight and/or Heavy Methyl Methods. The MethyLight and Heavy Methyl assays are a high-throughput quantitative methylation assay that utilizes fluorescence- based real-time PCR (Taq Man®) technology that requires no further manipulations after the PCR step (Eads, C. A. et al, 2000, Nucleic Acid Res. 28, e 32; Cottrell et al, 2007, J. Urology 177, 1753, U.S. Pat. No. 6,331,393 (Laird et al), the contents of which are hereby incorporated by reference in their entirety). Briefly, the MethyLight process begins with a mixed sample of genomic DNA that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an “unbiased” (with primers that do not overlap known CpG methylation sites) PCR reaction, or in a “biased” (with PCR primers that overlap known CpG dinucleotides) reaction. Sequence discrimination occurs either at the level of the amplification process or at the level of the fluorescence detection process, or both. In embodiments, the MethyLight assay is used as a quantitative test for methylation patterns in the genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization. In this quantitative version, the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides. Alternatively, a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not “cover” known methylation sites (a fluorescence- based version of the “MSP” technique), or with oligonucleotides covering potential methylation sites.

[0073] The term “disease” or “condition” refers to a state of being or health status of a patient or subject that is being treated with the compounds or methods provided herein. The disease may be a cancer. The disease may be an autoimmune disease. The disease may be an inflammatory disease. The disease may be an infectious disease. In some further instances, “cancer” refers to human cancers and carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., including solid and lymphoid cancers, kidney, breast, lung, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, glioma, esophagus, and liver cancer, including hepatocarcinoma, lymphoma, including B-acute lymphoblastic lymphoma, non-Hodgkin’s lymphomas (e.g., Burkitt’s, Small Cell, and Large Cell lymphomas), Hodgkin’s lymphoma, leukemia (including AML, ALL, and CML), or multiple myeloma.

[0074] As used herein, the term “cancer” is used in accordance with its plain ordinary meaning and refers to all types of cancer, neoplasm or malignant tumors found in mammals (e.g. humans), including leukemias, lymphomas, carcinomas and sarcomas. Exemplary cancers that may be treated with a compound or method provided herein include brain cancer, glioma, glioblastoma, neuroblastoma, prostate cancer, colorectal cancer, pancreatic cancer, Medulloblastoma, melanoma, cervical cancer, gastric cancer, ovarian cancer, lung cancer, cancer of the head, Hodgkin's Disease, and Non-Hodgkin's Lymphomas. Exemplary cancers that may be treated with a compound or method provided herein include cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, liver, kidney, lung, ovary, pancreas, rectum, stomach, and uterus. Additional examples include, thyroid carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, skin cutaneous melanoma, colon adenocarcinoma, rectum adenocarcinoma, stomach adenocarcinoma, esophageal carcinoma, head and neck squamous cell carcinoma, breast invasive carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, non-small cell lung carcinoma, mesothelioma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine or exocrine pancreas, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, or prostate cancer.

[0075] The term "carcinoma" refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. Exemplary carcinomas that may be treated with a compound or method provided herein include, for example, medullary thyroid carcinoma, familial medullary thyroid carcinoma, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatinifomi carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepi dermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky- cell carcinoma, large-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcinoma, carcinoma molle, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, Schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, or carcinoma villosum.

[0076] As used herein, the term “colorectal cancer” is used in accordance with its plain ordinary meaning and refers to the development of cancer from the colon or rectum (parts of the large intestine). Signs and symptoms may include blood in the stool, a change in bowel movements, weight loss, and fatigue. Most colorectal cancers are due to old age and lifestyle factors, with only a small number of cases due to underlying genetic disorders. Risk factors include diet, obesity, smoking, and lack of physical activity. Dietary factors that increase the risk include red meat, processed meat, and alcohol. Another risk factor is inflammatory bowel disease, which includes Crohn's disease and ulcerative colitis. Some of the inherited genetic disorders that can cause colorectal cancer include familial adenomatous polyposis and hereditary non-polyposis colon cancer; however, these represent less than 5% of cases. It typically starts as a benign tumor, often in the form of a polyp, which over time becomes cancerous.

[0077] As used herein, the term “solitary cancer” or “solitary tumor” refers to a case where only one primary tumor is detected in a single patient.

[0078] As used herein, the term “synchronous tumor” or “synchronous cancer” refers to cancer in which two or more primary tumors are detected in a single subject (e.g. patient) at the same time or within 6 months of the initial diagnosis of a first primary tumor or cancer. I n embodiments, the two or more primary tumors are present in the same tissue. In embodiments, the two or more primary tumors are present in the same organ. In embodiments, the two or more primary tumors are detected within a month of the initial diagnosis of a first primary tumor or cancer. In embodiments, the two or more primary tumors are detected within two weeks of the initial diagnosis of a first primary tumor or cancer. In embodiments, the two or more primary tumors are detected within a week of the initial diagnosis of a first primary tumor or cancer. In embodiments, the two or more primary tumors are detected within a day of the initial diagnosis of a first primary tumor or cancer. [0079] As used herein, the term “synchronous colorectal cancer” denotes more than one primary colorectal carcinoma detected in a single subject. 3.5% of all colorectal carcinomas are synchronous colorectal carcinomas. Patients with inflammatory bowel diseases (ulcerative colitis and Crohn’s disease), hereditary non-polyposis colorectal cancer, familial adenomatous polyposis and serrated polyps/hyperplastic polyposis are known to have a higher risk of synchronous colorectal carcinoma. These predisposing factors account for slightly more than 10% of synchronous colorectal carcinomas. Synchronous colorectal carcinoma is more common in the right colon when compared to solitary colorectal cancer. On pathological examination, some synchronous colorectal carcinomas are mucinous adenocarcinomas. They are usually associated with adenomas and metachronous colorectal carcinomas. Most of the patients with synchronous colorectal cancer have two carcinomas but up to six have been reported in one patient. Patients with synchronous colorectal carcinoma have a higher proportion of microsatellite instability cancer than patients with a solitary colorectal carcinoma.

[0080] As used herein, the term “metachronous cancer” refers to primary tumors that occur more than six months after the first primary tumor is detected.

[0081] As used herein, the term “metachronous colorectal carcinoma” denotes the presence of more than one primary colorectal carcinoma detected consecutively in a single person after a set time interval. Metachronous colorectal cancer (MCRC) is diagnosed when the new primary tumor is detected at least 6 months after the resection of the primary lesion and is present in a different part of the large intestine, ruling out cancer recurrence from the initial diagnosis.

[0082] The term “metastasis” or the plural form “metastases” refers to the development of secondary malignant growths at a distance from a primary site of cancer. The condition refers to when cancer cells break away from the main tumor and enter the bloodstream or lymphatic system. The terms "metastasis," "metastatic," and "metastatic cancer" can be used interchangeably and refer to the spread of a proliferative disease or disorder, e.g., cancer, from one organ or another non-adjacent organ or body part. Cancer occurs at an originating site, e.g., colon, which site is referred to as a primary tumor, e.g., primary colon cancer. Some cancer cells in the primary tumor or originating site acquire the ability to penetrate and infiltrate surrounding normal tissue in the local area and/or the ability to penetrate the walls of the lymphatic system or vascular system circulating through the system to other sites and tissues in the body. A second clinically detectable tumor formed from cancer cells of a primary tumor is referred to as a metastatic or secondary tumor. When cancer cells metastasize, the metastatic tumor and its cells are presumed to be similar to those of the original tumor. Thus, if colorectal cancer metastasizes to the lymph nodes, the secondary tumor at the site of the lymph nodes consist of colorectal cells and not abnormal lymph node cells. The secondary tumor in the lymph nodes is referred to as lymph node metastasis. Thus, the phrase metastatic cancer refers to a disease in which a subject has or had a primary tumor and has one or more secondary tumors. The phrases non-metastatic cancer or subjects with cancer that is not metastatic refers to diseases in which subjects have a primary tumor but not one or more secondary tumors.

[0083] The terms “colorectal cancer”, also known as “bowel cancer”, “colon cancer”, or “rectal cancer”, refer to the development of cancer from the colon or rectum (parts of the large intestine). Risk factors for an individual to develop colorectal cancer (CRC) include obesity, diet, family history, tobacco use, alcohol use, age, gender, physical activity, diabetes, and diseases such as Barrett's esophagus, Lye, Achalasia, Human papillomavirus (HPV) infection, inflammatory bowel disease, Lynch syndrome, or familial adenomatous polyposis (FAP).

[0084] The term “diagnosis” refers to the identification of the nature and cause of a certain phenomenon. Diagnosis is used in many different disciplines, with variations in the use of logic, analytics, and experience, to determine "cause and effect". In medicine, a “diagnosis”, a “diagnostic procedure” or “medical diagnosis” is the process of determining which disease or condition explains a person's symptoms and signs. It is most often referred to as diagnosis with the medical context being implicit. The information required for diagnosis is typically collected from a history and physical examination of the person seeking medical care. Often, one or more diagnostic procedures, such as medical tests, are also done during the process. Sometimes posthumous diagnosis is considered a kind of medical diagnosis. The term “to diagnose” refers to the act of realizing a diagnosis. The terms “confirmatory diagnostic procedure” or “confirmatory diagnosis procedure” refer to a process of confirming a diagnosis.

[0085] The terms “fine-needle aspiration” refer to diagnostic procedure used to investigate lumps or masses. In this procedure a thin, hollow needle and a syringe are used to extract cells, fluid or tissue from a suspicious lump or other abnormal area of the body. The material is then examined under a microscope or tested in the laboratory to determine the cause of the abnormality. The sampling and biopsy considered together are called fine-needle aspiration biopsy or fine-needle aspiration cytology (the latter to emphasize that any aspiration biopsy involves cytopathology, not histopathology).

[0086] The term “biopsy” refers to a medical test which involves extraction of sample cells or tissues for examination to determine the presence or extent of a disease in a subject. The extracted tissue is generally examined under a microscope by a pathologist, and it may also be analyzed chemically. When an entire lump or suspicious area is removed, the procedure is called an excisional biopsy. An incisional biopsy or core biopsy samples a portion of the abnormal tissue without attempting to remove the entire lesion or tumor. When a sample of tissue or fluid is removed with a needle in such a way that cells are removed without preserving the histological architecture of the tissue cells, the procedure is called a needle aspiration biopsy. The terms “biopsy material” refer to the sample extracted from the subject. The terms “tissue biopsy” refer to the extraction of tissue from a subject.

[0087] The terms “DNA test” or “genetic test” refer to test of DNA material obtained from a subject or sample, which is used to identify changes in DNA sequence or chromosome structure. Genetic testing can also include measuring the results of genetic changes, such as RNA analysis as an output of gene expression, or through biochemical analysis to measure specific protein output. In a medical setting, genetic testing can be used to diagnose or rule out suspected genetic disorders, predict risks for specific conditions, or gain information that can be used to customize medical treatments based on an individual's genetic makeup.

Genetic testing can also be used to determine biological relatives, such as a child's parentage (genetic mother and father) through DNA paternity testing, or be used to broadly predict an individual's ancestry.

[0088] The terms “fecal test” or “stool test” refer to the collection and analysis of fecal matter to diagnose the presence or absence of a medical condition.

[0089] The terms “fecal occult blood test” refer to a test checking for blood that is not visibly apparent (occult), in the feces of a subject. [0090] The terms “fecal DNA test” refer to a DNA test realized on fecal material obtained from a subject.

[0091] The terms “blood test” refer to a laboratory analysis performed on a blood sample. Blood tests are often used in health care to determine physiological and biochemical states, such as disease, mineral content, pharmaceutical drug effectiveness, and organ function. Blood tests can involve different tests on the blood sample, such as biochemal analyses, molecular profiling, and cellular evaluation.

[0092] The term “distant metastasis” or “distant metastasis tumor” refers to a cancer that has spread from the original (primary) tumor to distant organs or distant lymph nodes.

[0093] The term “radiation therapy” or “radiotherapy” refers to a therapy that uses ionizing radiation, and is generally provided as part of cancer treatment to control or kill malignant cells. Radiation therapy is normally delivered by a linear accelerator. Radiation therapy may be curative in a number of types of cancer if they are localized to one area of the body. It may also be used as part of adjuvant therapy, to prevent tumor recurrence after surgery that removes a primary malignant tumor. Radiation therapy is synergistic with chemotherapy, and has been used before, during, and after chemotherapy in susceptible cancers.

[0094] The term “chemotherapy” refers to a type of cancer treatment that uses one or more anti-cancer drugs (chemotherapeutic agents) as part of a standardized chemotherapy regimen. Chemotherapy may be given with a curative intent (which almost always involves combinations of drugs), or it may aim to prolong life or to reduce symptoms (palliative chemotherapy). Chemotherapy drugs include, but are not limited to, alkylating agents, nitrosoureas, antimetabolites, alkaloids, antitumor antibiotics, hormonal agents and biological response modifiers, Traditional chemotherapeutic agents are cytotoxic by means of interfering with cell division (mitosis) but cancer cells vary widely in their susceptibility to these agents. Many of the side effects of chemotherapy can be traced to damage to normal cells that divide rapidly and are thus sensitive to anti-mitotic drugs such as, but not limited to, cells in the bone marrow, digestive tract and hair follicles. In embodiments, the chemotherapy includes administration of an effective amount of an anticancer agent as set forth herein. [0095] The term “targeted therapy” refers to a method for treating cancer that blocks the growth of cancer cells by interfering with specific targeted molecules needed for carcinogenesis and tumor growth, rather than by simply interfering with all rapidly dividing cells. Exemplary forms of targeted therapy include, but are not limited to, antibody-drug conjugates, nano-engineered enzymes that bind to a tumor cell, and chemical entities that target or preferentially target a protein or enzyme that carries a mutation or other genetic alteration that is specific to cancer cells and is not found in normal host tissue. In embodiments, the targeted therapy includes administration of an effective amount of an anticancer agent as set forth herein.

[0096] The term “immunotherapy” refers to methods of treating cancer that are based on the stimulation of the patient’s immune system. Cancer immunotherapy exploits the fact that cancer cells often have tumor antigens that can be detected and bound by the antibodies of the immune system. Clinical success of cancer immunotherapy is highly variable between different forms of cancer. Examples of immunotherapy include, but are not limited to, therapeutic cancer vaccines, CAR-T cell, and targeted antibody therapies. In embodiments, the immunotherapy includes administration of an effective amount of an anti cancer agent as set forth herein.

[0097] The term “hormonal therapy” refers to a type of a cancer treatment that slows or stops the growth of cancer that uses hormones to grow. Hormonal therapy may be used alone as the main treatment or with other treatments. It may be used before surgery or radiation therapy to shrink the tumor. Hormonal therapy may be given in addition to main treatments such as surgery, radiation therapy or chemotherapy to lower the risk of cancer recurrence. Hormonal therapy includes, but is not limited to, removing the gland or organ that makes the hormone, irradiating the gland or organ to destroy hormone-producing cells, and administration of drugs that suppress hormonal production. In embodiments, the hormonal therapy includes administration of an effective amount of an anticancer agent as set forth herein.

[0098] The term “angiogenesis inhibitor administration therapy” refers to methods of treating cancer that block the growth of blood vessels that support tumor growth rather than blocking the growth of tumor cells themselves. Exemplary angiogenesis inhibitors include, but are not limited to, monoclonal antibodies that specifically recognize and bind to vascular endothelial growth factor (VEGF) and thus block activation of the VEGF receptor, and immunomodulatory drugs that stimulate or suppress the immune system. For some cancers, angiogenesis inhibitors are most effective when combined with additional therapies. The term “synthetic lethality therapy” refers to a type of cancer treatment in which the simultaneous mutation of two genes leads to cell death, whereas mutation of only one of the genes is not lethal. For most cancer mutations caused by a loss-of-function, there are no targeted therapies available, and synthetic lethal therapy provides additional opportunities. It requires identification of inactive genes in a cancer and the targeting of their synthetic lethal partner genes. Examples of targeted therapies exploiting the synthetic lethality (SL) principle include, but are not limited to, the use of poly-ADP ribose polymerase (PARP) inhibitors in breast and ovarian cancer that harbor mutations in the breast cancer gene (BRCA). Treatment of BRCA-deficient tumors with PARP inhibitors generally selectively kills the cancer cells in breast and ovarian cancer. In embodiments, the angiogenesis inhibitor administration therapy includes administration of an effective amount of an anticancer agent as set forth herein. [0099] “Anti-cancer agent” and “anticancer agent” are used in accordance with their plain ordinary meaning and refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells. In some embodiments, an anti-cancer agent is a chemotherapeutic. In some embodiments, an anti-cancer agent is an agent identified herein having utility in methods of treating cancer. In some embodiments, an anti-cancer agent is an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer. Examples of anti-cancer agents include, but are not limited to, MEK (e.g. MEK1, MEK2, or MEK1 and MEK2) inhibitors (e.g. XL518, CI-1040, PD035901, selumetinib/ AZD6244, GSK1120212/ trametinib, GDC-0973, ARRY-162, ARRY-300, AZD8330, PD0325901, U0126, PD98059, TAK-733, PD318088, AS703026, BAY 869766), alkylating agents (e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambucil, meiphalan), ethylenimine and methylmelamines (e.g., hexamethlymelamine, thiotepa), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomusitne, semustine, streptozocin), triazenes (decarbazine)), anti-metabolites (e.g., 5- azathioprine, leucovorin, capecitabine, fludarabine, gemcitabine, pemetrexed, raltitrexed, folic acid analog (e.g., methotrexate), or pyrimidine analogs (e.g., fluorouracil, floxouridine, Cytarabine), purine analogs (e.g., mercaptopurine, thioguanine, pentostatin), etc.), plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel, docetaxel, etc.), topoisomerase inhibitors (e.g., irinotecan, topotecan, amsacrine, etoposide (VP 16), etoposide phosphate, teniposide, etc.), antitumor antibiotics (e.g., doxorubicin, adriamycin, daunorubicin, epirubicin, actinomycin, bleomycin, mitomycin, mitoxantrone, plicamycin, etc.), platinum-based compounds (e.g. cisplatin, oxaloplatin, carboplatin), anthracenedione (e.g., mitoxantrone), substituted urea (e.g., hydroxyurea), methyl hydrazine derivative (e.g., procarbazine), adrenocortical suppressant (e.g., mitotane, aminoglutethimide), epipodophyllotoxins (e.g., etoposide), antibiotics (e.g., daunorubicin, doxorubicin, bleomycin), enzymes (e.g., L- asparaginase), inhibitors of mitogen-activated protein kinase signaling (e.g. U0126,

PD98059, PD184352, PD0325901, ARRY-142886, SB239063, SP600125, BAY 43-9006, wortmannin, or LY294002, Syk inhibitors, mTOR inhibitors, antibodies (e.g., rituxan), gossyphol, genasense, polyphenol E, Chlorofusin, all trans-retinoic acid (ATRA), bryostatin, tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), 5-aza-2'-deoxycytidine, all trans retinoic acid, doxorubicin, vincristine, etoposide, gemcitabine, imatinib (Gleevec.RTM.), geldanamycin, 17-N-Allylamino-17-Demethoxygeldanamycin (17-AAG), flavopiridol, LY294002, bortezomib, trastuzumab, BAY 11-7082, PKC412, PD184352, 20- epi-1, 25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti- dorsalizing morphogenetic protein- 1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5 -azacyti dine; 9-dioxamycin; diphenyl spiromustine; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflomithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; immunostimulant peptides; insulin-like growth factor-1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1 -based therapy; mustard anti cancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N- substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; 06-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylerie conjugate; raf antagonists; raltitrexed; ramosetron; ras famesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone Bl; ruboxyl; safmgol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen-binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfmosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfm; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfm; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; zinostatin stimalamer, Adriamycin, Dactinomycin, Bleomycin, Vinblastine, Cisplatin, acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantrone acetate; aminoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone; caracemide; carbetimer; carboplatin; carmustine; carubicin hydrochloride; carzelesin; cedefmgol; chlorambucil; cirolemycin; cladribine; crisnatol mesylate; cyclophosphamide; cytarabine; dacarbazine; daunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; eflomithine hydrochloride; elsamitrucin; enloplatin; enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; iimofosine; interleukin II (including recombinant interleukin II, or rlL.sub.2), interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa-n3; interferon beta-la; interferon gamma-lb; iproplatin; irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansine; mechlorethamine hydrochloride; megestrol acetate; melengestrol acetate; melphalan; menogaril; mercaptopurine; methotrexate; methotrexate sodium; metoprine; meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazoie; nogalamycin; ormaplatin; oxisuran; pegaspargase; peliomycin; pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; plomestane; porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safmgol; safmgol hydrochloride; semustine; simtrazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride; spiromustine; spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfm; teniposide; teroxirone; testolactone; thiamiprine; thioguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfm; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate; vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin; zinostatin; zorubicin hydrochloride, agents that arrest cells in the G2-M phases and/or modulate the formation or stability of microtubules, (e.g. Taxol.TM (i.e. paclitaxel), Taxotere.TM, compounds comprising the taxane skeleton, Erbulozole (i.e. R- 55104), Dolastatin 10 (i.e. DLS-10 and NSC-376128), Mivobulin isethionate (i.e. as CI-980), Vincristine, NSC-639829, Discodermolide (i.e. as NVP-XX-A-296), ABT-751 (Abbot, i.e. E-7010), Altorhyrtins (e.g. Altorhyrtin A and Altorhyrtin C), Spongistatins (e.g. Spongistatin 1, Spongistatin 2, Spongistatin 3, Spongistatin 4, Spongistatin 5, Spongistatin 6, Spongistatin 7, Spongistatin 8, and Spongistatin 9), Cemadotin hydrochloride (i.e. LU-103793 andNSC- D-669356), Epothilones (e.g. Epothilone A, Epothilone B, Epothilone C (i.e. desoxyepothilone A or dEpoA), Epothilone D (i.e. KOS-862, dEpoB, and desoxyepothilone B), Epothilone E, Epothilone F, Epothilone B N-oxide, Epothilone AN-oxide, 16-aza- epothilone B, 21-aminoepothilone B (i.e. BMS-310705), 21-hydroxyepothilone D (i.e. Desoxyepothilone F and dEpoF), 26-fluoroepothilone, Auristatin PE (i.e. NSC-654663), Soblidotin (i.e. TZT-1027), LS-4559-P (Pharmacia, i.e. LS-4577), LS-4578 (Pharmacia, i.e. LS-477-P), LS-4477 (Pharmacia), LS-4559 (Pharmacia), RPR-112378 (Aventis), Vincristine sulfate, DZ-3358 (Daiichi), FR-182877 (Fujisawa, i.e. WS-9885B), GS-164 (Takeda), GS- 198 (Takeda), KAR-2 (Hungarian Academy of Sciences), BSF-223651 (BASF, i.e. ILX-651 and LU-223651), SAH-49960 (Lilly/Novartis), SDZ-268970 (Lilly/Novartis), AM-97 (Armad/Kyowa Hakko), AM-132 (Armad), AM-138 (Armad/Kyowa Hakko), IDN-5005 (Indena), Cryptophycin 52 (i.e. LY-355703), AC-7739 (Ajinomoto, i.e. AVE-8063A and CS- 39.HC1), AC-7700 (Ajinomoto, i.e. AVE-8062, AVE-8062A, CS-39-L-Ser.HCl, and RPR- 258062A), Vitilevuamide, Tubulysin A, Canadensol, Centaureidin (i.e. NSC-106969), T- 138067 (Tularik, i.e. T-67, TL-138067 and TI- 138067), COBRA-1 (Parker Hughes Institute, i.e. DDE-261 and WHI-261), H10 (Kansas State University), H16 (Kansas State University), Oncocidin A1 (i.e. BTO-956 and DIME), DDE-313 (Parker Hughes Institute), Fijianolide B, Laulimalide, SPA-2 (Parker Hughes Institute), SPA-1 (Parker Hughes Institute, i.e. SPIKET- P), 3-IAABU (Cytoskeleton/Mt. Sinai School of Medicine, i.e. MF-569), Narcosine (also known as NSC-5366), Nascapine, D-24851 (Asia Medica), A-105972 (Abbot), Hemiasterlin, 3-BAABU (Cytoskeleton/Mt. Sinai School of Medicine, i.e. MF-191), TMPN (Arizona State University), Vanadocene acetylacetonate, T-138026 (Tularik), Monsatrol, lnanocine (i.e. NSC-698666), 3-IAABE (Cytoskeleton/Mt. Sinai School of Medicine), A-204197 (Abbot), T-607 (Tuiarik, i.e. T-900607), RPR-115781 (Aventis), Eleutherobins (such as Desmethyleleutherobin, Desaetyleleutherobin, lsoeleutherobin A, and Z-Eleutherobin), Caribaeoside, Caribaeolin, Halichondrin B, D-64131 (Asia Medica), D-68144 (Asia Medica), Diazonamide A, A-293620 (Abbot), NPI-2350 (Nereus), Taccalonolide A, TUB-245 (Aventis), A-259754 (Abbott), Diozostatin, (-)-Phenylahistin (i.e. NSCL-96F037), D-68838 (Asia Medica), D-68836 (Asia Medica), Myoseverin B, D-43411 (Zentaris, i.e. D-81862), A- 289099 (Abbott), A-318315 (Abbott), HTI-286 (i.e. SPA- 110, trifluoroacetate salt) (Wyeth), D-82317 (Zentaris), D-82318 (Zentaris), SC-12983 (NCI), Resverastatin phosphate sodium, BPR-OY-007 (National Health Research Institutes), and SSR-250411 (Sanofi)), steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, gonadotropin-releasing hormone agonists (GnRH) such as goserelin or leuprolide, adrenocorticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate), estrogens (e.g., diethlystilbestrol, ethinyl estradiol), antiestrogen (e.g., tamoxifen), androgens (e.g., testosterone propionate, fluoxymesterone), antiandrogen (e.g., flutamide), immunostimulants (e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha- interferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA- DR, and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody -pseudomonas exotoxin conjugate, etc.), immunotherapy (e.g., cellular immunotherapy, antibody therapy, cytokine therapy, combination immunotherapy, etc.), radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to lllln, 90Y, or 1311, etc.), immune checkpoint inhibitors (e.g., CTLA4 blockade, PD-1 inhibitors, PD-L1 inhibitors, etc.), triptolide, homoharringtonine, dactinomycin, doxorubicin, epirubicin, topotecan, itraconazole, vindesine, cerivastatin, vincristine, deoxyadenosine, sertraline, pitavastatin, irinotecan, clofazimine, 5-nonyloxytryptamine, vemurafenib, dabrafenib, erlotinib, gefitinib, EGFR inhibitors, epidermal growth factor receptor (EGFR)-targeted therapy or therapeutic (e.g. gefitinib (Iressa ™), erlotinib (Tarceva ™), cetuximab (Erbitux™), lapatinib (Tykerb™), panitumumab (Vectibix™), vandetanib (Caprelsa™), afatinib/BIBW2992, CI- 1033/canertinib, neratinib/HKI-272, CP-724714, TAK-285, AST-1306, ARRY334543, ARRY-380, AG-1478, dacomitinib/PF299804, OSI-420/desmethyl erlotinib, AZD8931, AEE788, pelitinib/EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626), sorafenib, imatinib, sunitinib, dasatinib, or the like.

[0100] “Remission” means that the clinical signs and symptoms of cancer have been significantly diminished or have disappeared entirely based on clinical diagnostics, although cancerous cells can still exist in the body. Thus, it is contemplated that remission encompasses partial and complete remission. Remission can occur for any period of time, such as from one month to several years or more. [0101] “Relapse” or “Recurrence” refers to the clinical diagnosis of a return of cancer after a period of remission.

[0102] “Relapse-free survival” or “Recurrence-free survival” or “RFS” refers to the time from the date of diagnosis of cancer to the date of relapse.

[0103] “Good prognosis” refers to a normal risk of relapse, a reduced risk of relapse, an increased chance for remission, an increased relapse-free survival time, or a high survival rate. In embodiments, a “good prognosis” refers to a reduced risk of relapse, an increased chance for remission, an increased relapse-free survival time, or a high survival rate. In embodiments, a “good prognosis” refers to a reduced risk of relapse. In embodiments, a “good prognosis” refers to an increased chance for remission. In embodiments, a “good prognosis” refers to an increased relapse-free survival time. In embodiments, a “good prognosis” refers to a high survival rate. In embodiments, a high survival rate refers to a 5- year survival rate greater than 50%. In embodiments, a high survival rate refers to a 5-year survival rate greater than 60%, greater than 70%, greater than 80%, or greater than 90%. In embodiments, “good prognosis” is an increased likelihood of a good prognosis.

[0104] The term “biological sample" refers to a material of biological origin (e.g., blood, plasma, cells, tissues, organs, fluids). In embodiments, biological sample is blood. In embodiments, the biological sample is a tumor. In embodiments, the biological sample is tumor tissue. In embodiments, the biological sample is tumor cells. The term “biological sample” is used in accordance with its plain ordinary meaning and refers to a specimen obtained from a subject. The specimen can be tissue or a liquid component. The terms “liquid biological sample” “biological fluids”, “body fluids”, “bodily fluids” or “biofluids” refer to liquids within the human body. Such liquids can be blood, serum, plasma, saliva, ascites fluid, peritoneal fluid, and urine. In embodiments, the fluid is blood. In embodiment, the fluid is serum. In embodiments, the fluid is plasma. In embodiments, the fluid is saliva. In embodiments, the fluid is ascites fluid. In embodiments, the fluid is peritoneal fluid. In embodiments, the fluid is urine. A “liquid biological sample” refers to a specimen that has a fluid component, such as blood, serum, plasma, urine or saliva.

[0105] “Peripheral blood” refers to blood circulating throughout the body. The components of peripheral blood include red blood cells (erythrocytes), white blood cells (leukocytes), and platelets.

[0106] “Peripheral blood mononuclear cell” or “PBMC” refers to cells in peripheral blood that have a nucleus, generally a round nucleus. Exemplary peripheral blood mononuclear cells include lymphocytes and monocytes. Exemplary lymphocytes are T cells, B cells, and NK cells.

[0107] “Gene expression” refers to the conversion of genetic information from genes via messenger RNA (mRNA) to proteins. The genetic information (base sequence) on DNA is copied to a molecule of mRNA (transcription). The mRNA molecules then leave the cell nucleus and enter the cytoplasm, where they participate in protein synthesis by specifying the particular amino acids that make up individual proteins (translation).

[0108] The terms an “elevated level” or an “increased level” or a “high level” of gene expression is an expression level of the gene or protein that is higher than the expression level of the gene or protein in a standard control or in a control with no or very low risk of recurrence (e.g. a control biological sample derived from a subject or subjects with no or low risk of recurrence). The standard control may be any suitable control, examples of which are described herein. The control with no risk of recurrence may be a patient or subject who has undergone hepatectomy for treatment of colorectal liver matastases (CRLM) and is at no risk or very low risk of developing cancer recurrence within the first 5 years after surgery, examples of which are described herein.

[0109] The terms a “reduced level” or a “decreased expression level” or a “low level” of gene expression is an expression level of the gene or protein that is lower than the expression level of the gene or protein in a standard control or in a control with no risk of recurrence.

The standard control may be any suitable control, examples of which are described herein. The control with no risk of recurrence is a patient or subject who has undergone hepatectomy for treatment of colorectal liver matastases (CRLM) and is at no risk or very low risk of developing cancer recurrence within the first 5 years after surgery, examples of which are described herein.

[0110] “Pathway” refers to a set of system components involved in two or more sequential molecular interactions that result in the production of a product or activity. A pathway can produce a variety of products or activities that can include, for example, intermolecular interactions, changes in expression of a nucleic acid or polypeptide, the formation or dissociation of a complex between two or more molecules, accumulation or destruction of a metabolic product, activation or deactivation of an enzyme or binding activity. Thus, the term "pathway" includes a variety of pathway types, such as, for example, a biochemical pathway, a gene expression pathway, and a regulatory pathway. Similarly, a pathway can include a combination of these exemplary pathway types. [0111] The terms “control,” or “standard control,” are used in accordance with their plain ordinary meaning and refer to samples obtained from different subjects (also referred to herein as a standard control subject). In embodiments, the standard control refers to the DNA methylation level of SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and or KIF22 in a sample from a standard control subject. In embodiments, the standard control refers to the DNA methylation level of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, cgl 1255039 in a sample from a standard control subject. In embodiments, the standard control subject is a subject that does not have cancer. In embodiments, the standard control subject is a subject that does not have synchronous cancer. In embodiments, the standard control subject is a subject that does not have colorectal cancer. In embodiments, the standard control subject is a subject that does not have synchronous colorectal cancer. For example, a test sample can be taken from a patient suspected of having a given disease (cancer) and compared to samples from a known cancer patient or a known normal (non disease) individual. A control can also represent an average value gathered from a population of similar individuals, e.g., cancer patients or healthy individuals with a similar medical background, same age, weight, etc. A control can also be obtained from the same individual, e.g., from an earlier-obtained sample, prior to disease, or prior to treatment. One of skill will recognize that controls can be designed for assessment of any number of parameters. In embodiments, a control is a negative control. In embodiments, t the number of standard control subjects (n) is 10 or more, 25 of more, 50 or more, 100 or more, 1000 or more, or 5000 or more. In embodiments, the standard control is a population of standard control cancer subjects. In embodiments, the standard control is a population of standard control cancer subjects that do not have synchronous cancer (e.g. synchronous colorectal cancer). One of skill in the art will understand which controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant . In embodiments, the standard control is a population of standard control healthy subjects. In embodiments, a “standard control” in the context of the measuring of DNA methylation levels in a biological sample from a subject suffering from cancer, refer to the detected levels of DNA methylation in a biological sample from a subject not suffering from cancer or not suffering from a different type of cancer. In embodiments, the standard control subject is a cancer patient who is responsive to surgery and can be spared intensive chemotherapy treatment. In embodiments, the standard control subject is a cancer patient or a population of cancer patients with no risk (e.g. no measurable risk) of cancer recurrence. In embodiments, the standard control subject is a cancer patient or a population of cancer patients with a low (e.g. very low) risk of cancer recurrence. In embodiments, the standard control subject is a cancer patient or a population of cancer patients who are at no risk or very low risk of developing cancer recurrence within the first 5 years after surgery. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 10%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 8%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 2%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 1%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.1%. In embodiments, the standard control is a sample obtained from a healthy subject, or a sample from a subject with colorectal cancer who has undergone surgery and has a low risk of cancer recurrence. In embodiments, the standard control is a sample obtained from a healthy subject. In embodiments, the standard control is a sample from a subject with colorectal cancer who has no synchronous cancer. In embodiments, the standard control is a subject with no synchronous colorectal cancer. In embodiments, the standard control is a healthy subject. In embodiments, the standard control is a subject with a solitary colorectal cancer.

[0112] As used herein, the term “positive control” is used in accordance with its plain ordinary meaning and refers to an indicator with a known response, so that this positive response can be compared to the unknown response in a controlled experiment. The positive controls are particularly useful for validating the experimental procedure. For determination of DNA methylation level, a positive control can be a fully methylated human bisulfhe- converted DNA.

[0113] As used herein, the term “beta-actin” or “b-actin gene” is used in accordance with its plain ordinary meaning and refers to one of six different actin isoforms which have been identified in humans. The b-actin is one of the two non-muscle cytoskeletal actins. The actins are highly conserved proteins that are involved in cell motility, cell structure and cell integrity.

[0114] As used herein, the term “bisulfite-converted DNA” is used in accordance with its plain ordinary meaning and refers to chemical treatment of DNA wherein the DNA is denatured (made single-stranded) and treated with sodium bisulfite, leading to deamination of unmethylated cytosines into uracils, while methylated cytosines (both 5-methylcytosine and 5-hydroxymethylcytosine) remain unchanged.

[0115] The terms “treating” and “treatment” refers to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; or making the final point of degeneration less debilitating. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination. Treating does not include preventing.

[0116] “Treating” or “treatment” as used herein (and as well-understood in the art) also broadly includes any approach for obtaining beneficial or desired results in a subject’s condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, "treatment" as used herein includes any cure or amelioration of a disease. Treatment may inhibit the disease’s spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things.

[0117] “Treating” and “treatment” as used herein include prophylactic treatment. Treatment methods include administering to a subject a therapeutically effective amount of an active agent. The administering step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of active agent, the activity of the compositions used in the treatment, or a combination thereof. It will be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. Changes in dosage may result and become apparent by standard diagnostic assays known in the art. In embodiments, the treating or treatment is not prophylactic treatment.

[0118] Cancer treatment refers to, but are not limited to, surgery, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, and synthetic lethality therapy.

[0119] It is contemplated that the methods of treatment herein reduce tumor size or tumor burden in the subject, and/or reduce metastasis in the subject. In various embodiments, the methods reduce the tumor size by 10%, 20%, 30% or more. In various embodiments, the methods reduce tumor size by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,

60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0120] “Patient” or “subject” in need thereof refers to a living organism suffering from or prone to a disease or condition. In embodiments, a patient is human. In embodiments, a patient is a human with cancer. In embodiments, a patient is a human with colorectal cancer. In embodiments, a patient is a human with colorectal liver metastasis.

[0121] An “effective amount,” as used herein, is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g. achieve the effect for which it is administered, treat a disease, reduce a signaling pathway, or reduce one or more symptoms of a disease or condition). In these methods, the effective amount of the active agent (e.g., oncolytic virus, viral vector) described herein is an amount effective to accomplish the stated purpose of the method. An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0122] The term “therapeutically effective amount,” as used herein, refers to that amount of the therapeutic agent sufficient to ameliorate the disorder, as described above. For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5- fold, or more effect over a control. For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art. As is in the art, therapeutically effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.

[0123] Dosages may be varied depending upon the requirements of the patient and the compound being employed. The dose administered to a patient, in the context of the present disclosure, should be sufficient to effect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached. Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.

[0124] As used herein, the term "administering" is used according to its plain and ordinary meeting and includes means oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. In embodiments, the administering does not include administration of any active agent other than the recited active agent.

[0125] The term “administering” includes intranasal administration, inhalation administration, oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini- osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include the use of lipid nanoparticles, aerosols, liposomal formulations, intravenous infusion, transdermal patches, and the like.

[0126] As used herein, the term “cg20275528” refers to an Infmium probe binding sequence corresponding to SEQ ID NO: 3. In embodiments, there is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90% or higher sequence homology across the whole sequence of said probe. Thus, where “one or more gene regions” includes cg20275528, the gene region corresponds to SEQ ID NO: 3 or the complementary sequence thereof.

[0127] As used herein, the term “cg03578926” refers to an Infmium probe binding sequence corresponding to SEQ ID NO: 6. In embodiments, there is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90% or higher sequence homology across the whole sequence of said probe. Thus, where “one or more gene regions” includes cg03578926, the gene region corresponds to SEQ ID NO: 6 or the complementary sequence thereof.

[0128] As used herein, the term “cg22084339” refers to an Infmium probe binding sequence corresponding to SEQ ID NO: 9. In embodiments, there is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90% or higher sequence homology across the whole sequence of said probe. Thus, where “one or more gene regions” includes cg22084339, the gene region corresponds to SEQ ID NO: 9 or the complementary sequence thereof.

[0129] As used herein, the term “cg27332938” refers to an Infmium probe binding sequence corresponding to SEQ ID NO: 12. In embodiments, there is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90% or higher sequence homology across the whole sequence of said probe. Thus, where “one or more gene regions” includes cg27332938, the gene region corresponds to SEQ ID NO: 12 or the complementary sequence thereof.

[0130] As used herein, the term “cgl0461088” refers to an Infmium probe binding sequence corresponding to SEQ ID NO: 15. In embodiments, there is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90% or higher sequence homology across the whole sequence of said probe. Thus, where “one or more gene regions” includes cgl 0461088, the gene region corresponds to SEQ ID NO: 15 or the complementary sequence thereof.

[0131] As used herein, the term “cgl 1255039” refers to an Infmium probe binding sequence corresponding to SEQ ID NO: 18. In embodiments, there is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90% or higher sequence homology across the whole sequence of said probe. Thus, where “one or more gene regions” includes cgl 1255039, the gene region corresponds to SEQ ID NO: 18 or the complementary sequence thereof.

[0132] As used herein, the term “SEPT9” or “SEPTIN9” refers to a gene that is a member of the septin family involved in cytokinesis and cell cycle control. Generally, the genes of the septin family are candidates for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described in the literature. In embodiments, diseases associated with SEPT9 include, but are not limited to, amyotrophy, hereditary neuralgic and acute megakaryocytic leukemia. Related pathways include, but are not limited to, shigellosis and actin nucleation by ARP -WASP complex. Reference to the sequence is made at https : / / www. ncbi . nlm nih gov/ gene/ 10801.

[0133] As used herein, “SHANK2” refers to a member of a gene family (i.e., Shank family) of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. In embodiments, diseases associated with SHANK2 include, but are not limited to, autism 17 and autism spectrum disorder. Related pathways include, but are not limited to, protein-protein interactions at synapses and regulation of CFTR activity (norm and CF). Gene Ontology (GO) annotations related to this gene include SH3 domain binding and GKAP/Homer scaffold activity. Reference to the sequence is made at https : / / www. ncbi . nlm nih gov/ gene/ 5575.

[0134] As used herein, “PRKAR1B” refers to a gene encoding Protein Kinase CAMP- Dependent Type I Regulatory Subunit Beta, which is a regulatory subunit of cyclic AMP- dependent protein kinase A (PKA), which is involved in the signaling pathway of the second messenger cAMP. Two regulatory and two catalytic subunits form the PKA holoenzyme, disbands after cAMP binding. The holoenzyme is involved in many cellular events, including ion transport, metabolism, and transcription. Several transcript variants encoding the same protein have been found for this gene. In embodiments, diseases associated with PRKAR1B include, but are not limited to, include PRKAR1B -related neurodegenerative dementia with intermediate filaments and ciliary dyskinesia, primary, 18. Related pathways include, but are not limited to, are G-Beta Gamma Signaling and Integrin Pathway. Gene Ontology (GO) annotations related to this gene include cAMP binding and cAMP-dependent protein kinase regulator activity.

[0135] As used herein, “ZNF511” refers to zinc finger 511. The gene, ZBRK1, encodes a 60kDA protein with an N-terminal KRAB domain and eight central zinc fingers. ZBRK1 binds to a specific sequence, GGGxxxCAGxxxTTT, within GADD45 intron 3 that supports the assembly of a nuclear complex minimally containing both ZBRK1 and BRCA1. ZBRK1 represses transcription through this recognition sequence in a BRCA1 -dependent manner. Reference to the sequence is made at https://www.ncbi.nlm.nih. gov/gene/118472.

[0136] As used herein, “ARFGAP2” refers to a gene that encodes ADP ribosylation factor GTPase activating protein 2. In embodiments, diseases associated with ARFGAP2 include, but are not limited to, autoimmune lymphoproliferative syndrome. Related pathways include, but are not limited to, Golgi-to-ER retrograde transport and vesicle-mediated transport. Gene Ontology (GO) annotations related to this gene include GTPase activator activity. Reference to the sequence is made at https://www.ncbi.nlm.nih. gov/ gene/84364. [0137] As used herein, “KIF22” refers to a Kinesin Family Member 22. Generally, these genes are responsible for encoding proteins that are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C- terminal half of KIF22 has been shown to bind DNA. In embodiments, diseases associated with KIF22 include, but are not limited to spondyloepimetaphyseal dysplasia with joint laxity, type 2 and spondyloepimetaphyseal dysplasia with multiple dislocations. Related pathways include, but are not limited to, golgi-to-ER retrograde transport and vesicle- mediated transport. Reference to the sequence is made at https://www.ncbi.nlm.nih.gov/gene/3835.

[0138] As used herein, the term “internal reference” is used in accordance with its plain ordinary meaning and refers to a marker that is within the same sample as a test biomarker. The internal reference can be a marker than remains constant under different conditions (e.g. when comparing a biomarker in a diseased individual to the same biomarker in an unaffected individual). An internal reference can be the methylation level of a b-actin gene.

[0139] An “epigenetic inhibitor” as used herein, refers to an inhibitor of an epigenetic process, such as DNA methylation (a DNA methylation Inhibitor) or modification of histones (a Histone Modification Inhibitor). An epigenetic inhibitor may be a histone-deacetylase (HD AC) inhibitor, a DNA methyltransferase (DNMT) inhibitor, a histone methyltransferase (HMT) inhibitor, a histone demethylase (HDM) inhibitor, or a histone acetyltransferase (HAT). Examples of HD AC inhibitors include Vorinostat, romidepsin, CI-994, Belinostat, Panobinostat , Givinostat, Entinostat, Mocetinostat, SRT501, CUDC-101, JNJ-26481585, or PCI24781. Examples of DNMT inhibitors include azacitidine and decitabine. Examples of HMT inhibitors include EPZ-5676. Examples of HDM inhibitors include pargyline and tranylcypromine. Examples of HAT inhibitors include CCT077791 and garcinol.

[0140] A “multi-kinase inhibitor” is a small molecule inhibitor of at least one protein kinase, including tyrosine protein kinases and serine/threonine kinases. A multi-kinase inhibitor may include a single kinase inhibitor. Multi-kinase inhibitors may block phosphorylation. Multi-kinases inhibitors may act as covalent modifiers of protein kinases. Multi-kinase inhibitors may bind to the kinase active site or to a secondary or tertiary site inhibiting protein kinase activity. A multi-kinase inhibitor may be an anti-cancer multi-kinase inhibitor. Exemplary anti-cancer multi-kinase inhibitors include dasatinib, sunitinib, erlotinib, bevacizumab, vatalanib, vemurafenib, vandetanib, cabozantinib, poatinib, axitinib, ruxolitinib, regorafenib, crizotinib, bosutinib, cetuximab, gefitinib, imatinib, lapatinib, lenvatinib, mubritinib, nilotinib, panitumumab, pazopanib, trastuzumab, or sorafenib.

[0141] As used herein, the term “tissue sample” is used in accordance with its plain ordinary meaning and refers to a piece of tissue removed from an organism for examination, analysis, or propagation.

[0142] As used herein, the term “formalin fixed paraffin -embedded (FFPE)” is used in accordance with its plain ordinary meaning and refers to a long-term tissue preservation approach and preparation for biopsy specimens that aids in examination, experimental research, and diagnostic/drug development and is widely used in pathology. In FFPE a tissue specimen is preserved by formalin fixing. This step helps to preserve the vital structures and protein within the tissue. It is then embedded into a paraffin wax block and sliced into the required slices.

[0143] The term “prevent” refers to a decrease in the occurrence of disease symptoms in a patient. As indicated above, the prevention may be complete (no detectable symptoms) or partial, such that fewer symptoms are observed than would likely occur absent treatment. [0144] The term “subject” refer to any living or non-living organism, including but not limited to a human, non-human animal, plant, bacterium, fungus, virus or protist. A subject may be any age (e.g., an embryo, a fetus, infant, child, adult). A subject can be of any sex (e.g., male, female, or combination thereof). A subject may be pregnant. In some embodiments, a subject is a mammal. In some embodiments, a subject is a human subject. A subject can be a patient (e.g. , a human patient). In some embodiments a subject is at risk of developing a cancer.

[0145] “Patient” or “subject in need thereof’ refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. In some embodiments, a patient is human.

[0146] An “effective amount” is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, increase enzyme activity, reduce a signaling pathway, or reduce one or more symptoms of a disease or condition). An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. An “activity decreasing amount,” as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme relative to the absence of the antagonist. A “function disrupting amount,” as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0147] The term "surgery" refers to a medical or dental specialty that uses operative manual and instrumental techniques on a person to investigate or treat a pathological condition such as a disease or injury, to help improve bodily function, appearance, or to repair unwanted ruptured areas. The act of performing surgery may be called a surgical procedure, operation, or simply "surgery". In this context, the verb "operate" means to perform surgery. The adjective surgical means pertaining to surgery; e.g. surgical instruments or surgical nurse.

[0148] The term "ablation" refer to the removal of a part of biological tissue, usually by surgery.

[0149] The term "embolization" refer to to the passage and lodging of an embolus within the bloodstream. It may be of natural origin (pathological), in which sense it is also called embolism, for example a pulmonary embolism; or it may be artificially induced (therapeutic), as a hemostatic treatment for bleeding or as a treatment for some types of cancer by deliberately blocking blood vessels to starve the tumor cells. The term "embolus" refers to an unattached mass that travels through the bloodstream and is capable of creating blockages. When an embolus occludes a blood vessel, it is called an embolism or embolic event.

[0150] The terms "endoscopic therapy" refer to treatments performed using an endoscope. An endoscope is a small, tube-like instrument that is inserted into the body through a tiny incision or a body opening, such as the mouth.

[0151] The term "resection" refers to surgical procedure to partially remove an organ or other bodily structure.

[0152] A “cell” as used herein, refers to a cell carrying out metabolic or other function sufficient to preserve or replicate its genomic DNA. A cell can be identified by well-known methods in the art including, for example, presence of an intact membrane, staining by a particular dye, ability to produce progeny or, in the case of a gamete, ability to combine with a second gamete to produce a viable offspring. Cells may include prokaryotic and eukaroytic cells. Prokaryotic cells include but are not limited to bacteria. Eukaryotic cells include but are not limited to yeast cells and cells derived from plants and animals, for example mammalian, insect (e.g., spodoptera) and human cells. Cells may be useful when they are naturally nonadherent or have been treated not to adhere to surfaces, for example by trypsinization. [0153] “Cancer model organism,” as used herein, is an organism exhibiting a phenotype indicative of cancer, or the activity of cancer causing elements, within the organism. The term cancer is defined above. A wide variety of organisms may serve as cancer model organisms, and include for example, cancer cells and mammalian organisms such as rodents (e.g. mouse or rat) and primates (such as humans). Cancer cell lines are widely understood by those skilled in the art as cells exhibiting phenotypes or genotypes similar to in vivo cancers. Cancer cell lines as used herein includes cell lines from animals (e.g. mice) and from humans. [0154] As used herein, the term “Multidimensional scaling (MDS)” is used in accordance with its plain ordinary meaning and refers to visualizing the level of similarity of individual cases of a dataset. MDS is used to translate information about the pairwise 'distances' among a set of objects or individuals into a configuration of points mapped into an abstract Cartesian space.

[0155] As used herein, the term “specificity” is used in accordance with its plain ordinary meaning and refers to measures the proportion of negatives that are correctly identified (i.e. the proportion of those who do not have the condition (unaffected) who are correctly identified as not having the condition). [0156] As used herein, the term “sensitivity” is used in accordance with its plain ordinary meaning and refers to measures the proportion of positives that are correctly identified (i.e. the proportion of those who have some condition (affected) who are correctly identified as having the condition).

[0157] As used herein, the term “odds ratio (OR)” is used in accordance with its plain ordinary meaning and refers to a statistic that quantifies the strength of the association between two events such as A and B. The odds ratio is defined as the ratio of the odds of A in the presence of B and the odds of A in the absence of B, or equivalently (due to symmetry), the ratio of the odds of B in the presence of A and the odds of B in the absence of A. Two events are independent if OR equals 1, i.e., the odds of one event are the same in either the presence or absence of the other event. If the OR is greater than 1, then A and B are associated (correlated) in the sense that, compared to the absence of B, the presence of B raises the odds of A, and symmetrically the presence of A raises the odds of B. Further, if the OR is less than 1, then A and B are negatively correlated, and the presence of one event reduces the odds of the other event.

[0158] As used herein, the term “risk score” is used in accordance with its plain ordinary meaning and refers to a general practice in applied statistics, bio-statistics, econometrics and other related disciplines, of creating an easily calculated number that reflects the level of risk in the presence of some risk factors.

[0159] As used herein, the term “tumor” is used in accordance with its plain ordinary meaning and refers to an abnormal mass of tissue that forms when cells grow and divide more than they should or do not die when cells should. Tumors may be benign (non- cancerous) or malignant (cancerous).

[0160] As used herein, the term “recurrence rate” is used in accordance with its plain ordinary meaning and refers to the rate at which a disease or medical condition, recurs or returns (after treatment).

Methods of Detecting a Synchronous Cancer

[0161] Provided herein inter alia are methods of detecting the level of DNA methylation in a subject that has or is suspected of having a cancer. The disclosed methods comprise determining the methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject. In embodiments, the gene is SEPT9, SHANK2,

PRKAR1B, ZNF511, ARFGAP2, KIF22, or any combination thereof. [0162] Also provided herein are methods of detecting a synchronous cancer in a subject with cancer. The disclosed methods comprise determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22.

[0163] In embodiments, determining the DNA methylation level of the gene comprises determining the methylation level of a CpG site within the gene. The CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039, or a combination of two or more thereof. The CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22. In embodiments, the gene being analyzed is SEPT9, and the CpG site is cg20275528. In embodiments, the gene being analyzed is SHANK2, and the CpG site is cg03578926. In embodiments, the gene being analyzed is PRKAR1B, and the CpG site is cg22084339. In embodiments, the gene being analyzed is ZNF511, and the CpG site is cg27332938. In embodiments, the gene being analyzed is ARFGAP2, and the CpG site is cgl0461088. In embodiments, the gene being analyzed is KIF22, and the CpG site is cgl 1255039.

[0164] In embodiments, the CpG site is cg20275528. In embodiments, CpG site is cg03578926. In embodiments, the CpG site is cg22084339. In embodiments, the CpG site is cg27332938. In embodiments, the CpG site is cgl 0461088. In embodiments, the CpG site is cgl 1255039. In embodiments, the method comprises determining the methylation level of one CpG site selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of two CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of three CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of four CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of five CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of six CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039.

[0165] In embodiments, the subject has or is suspected of having colorectal cancer.

[0166] In embodiments, the biological sample is a tissue sample. In embodiments, the tissue sample is a formalin fixed paraffin -embedded (FFPE) tissue sample. In embodiments, the biological sample is a bodily fluid. In embodiments, the bodily fluid is blood, urine, plasma or saliva.

[0167] In embodiments, an elevated level of methylation in the biological sample of a gene as provided herein, relative to the standard control, is indicative of the subject having or being suspected of having a synchronous cancer.

[0168] In embodiments, the standard control is the detected level of DNA methylation in one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof in a biological sample from a healthy subject. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a subject with a solitary colorectal cancer. In embodiments, the standard control is the detected level of DNA methylation in one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof in a biological sample from a a cancer patient who is responsive to surgery and can be spared intensive chemotherapy treatment. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients with no risk of cancer recurrence. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKARIB,

ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients with a low (e.g. very low) risk of cancer recurrence. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients who are at no risk or very low risk of developing cancer recurrence within the first 5 years after surgery. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 10%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 8%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 2%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 1%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.1%. In embodiments, the standard control is a sample obtained from a healthy subject, or a sample from a subject with colorectal cancer who has undergone surgery and has a low risk of cancer recurrence. In embodiments, the standard control is a sample obtained from a healthy subject. In embodiments, the standard control is a sample from a subject with colorectal cancer who has no synchronous cancer. In embodiments, the standard control is a subject with no synchronous colorectal cancer.

[0169] In embodiments, an elevated methylation level of a gene relative to the standard control is indicative of synchronous cancer. In embodiments, the synchronous cancer is a synchronous colorectal cancer. In embodiments, the subject has synchronous colorectal cancer. In embodiements, the subject is at risk of developing a synchronous cancer.

[0170] In embodiments, the disclosed methods further comprise treating the subject with an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, synthetic lethality therapy, or a combination of two or more thereof. In embodiments, the methods comprise administering to the subject an effective amount of an anticancer agent. In embodiments, the methods comprise administering to the subject an effective amount of radiation therapy. In embodiments, the methods comprise administering to the subject an effective amount of chemotherapy. In embodiments, the methods comprise administering to the subject an effective amount of targeted therapy. In embodiments, the methods comprise administering to the subject an effective amount of immunotherapy. In embodiments, the methods comprise administering to the subject an effective amount of hormonal therapy. In embodiments, the methods comprise administering to the subject an effective amount of angiogenesis inhibitor. In embodiments, the methods comprise administering to the subject an effective amount of synthetic lethality therapy. In embodiments, the methods comprise administering to the subject an effective amount of any combination of an anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, and synthetic lethality therapy. In embodiments, the disclosed methods further comprise surgically removing all or a portion of a tumor associated with the cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s synchronous tumors. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s synchronous tumors.

[0171] In embodiments, the subject undergoes surgery after detection in the biological sample of an elevated level of methylation of one of the genes SEPT9, SHANK2,

PRKAR1B, ZNF511, ARFGAP2, KIF22, or a combination thereof. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer immediately after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511 , ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer two days after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer one week after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer two weeks after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511 , ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer one month after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer three months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer six months after detection of an elevated methylation level of one of the genes selected from SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer twelfe months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample.

[0172] In embodiments, the disclosed methods further comprise performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, colonoscopy is performed on a subject prior to determining the level of methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, as described herein. In embodiments, colonoscopy is performed on a subject following detection of elevated or abnormal methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, colonoscopy is carefully performed to determine the presence or absence of cololorectal lesions that are indicative of synschronous colorectal cancer. In embodiments, the results of the colonoscopy are reviewed prior to detection of said DNA methylation level. In embodiments, the results of the colonoscopy are reviewed after detection of said DNA methylation level in addition to an earlier review performed prior to detection of said DNA methylation level. In embodiments, said later review of the results of the colonoscopy is performed for a longer time than the initial review. In embodiments, the later review takes 15 minutes longer than the initial review of the results of the colonosclopy. In embodiments, the later review takes 30 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes 45 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and a half longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and 45 minutes longer than the review of the results of the colonoscopy. In embodiments, the later review takes two hours longer than the initial review of the results of the colonoscopy. In embodiments, a finding of one or more colorectal lesions in the colonoscopy of a subject is indicative of synchronous colorectal cancer.

Methods of Treating a Synchronous Cancer

[0173] In embodiments, provided herein are methods of treating a subject who has or is suspected of having a synchronous cancer. The disclosed methods comprise: (i) determining the methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22; and (ii) administering to the subject an effective amount of an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, synthetic lethality therapy, or a combination of two or more thereof. In embodiments, determining the methylation level of the gene comprises determining the methylation level of a CpG site within the gene. In embodiments, the CpG sites is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039, or a combination thereof. In embodiments, the CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.

[0174] In embodiments, the CpG site is cg20275528. In embodiments, the CpG site is cg03578926. In embodiments, the CpG site is cg22084339. In embodiments, the CpG site is cg27332938. In embodiments, the CpG site is cgl 0461088. In embodiments, the CpG site is cgl 1255039. In embodiments, the method comprises determining the methylation level of one CpG site selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of two CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of three CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of four CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of five CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of six CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039.

[0175] In embodiments, an elevated level of methylation, relative to the standard control, of one of the genes EPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof in the biological sample is indicative of the subject having or being suspected of having a synchronous cancer. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B,

ZNF511, ARFGAP2, and KIF22, or a combination thereof in a biological sample from a healthy subject. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a subject with a solitary colorectal cancer. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof in a biological sample from a a cancer patient who is responsive to surgery and can be spared intensive chemotherapy treatment. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients with no risk of cancer recurrence. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients with a low (e.g. very low) risk of cancer recurrence. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKARIB,

ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients who are at no risk or very low risk of developing cancer recurrence within the first 5 years after surgery. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 10%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 8%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 2%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 1%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.1%. In embodiments, the standard control is a sample obtained from a healthy subject, or a sample from a subject with colorectal cancer who has undergone surgery and has a low risk of cancer recurrence. In embodiments, the standard control is a sample obtained from a healthy subject. In embodiments, the standard control is a sample from a subject with colorectal cancer who has no synchronous cancer. In embodiments, the standard control is a subject with no synchronous colorectal cancer.

[0176] In embodiments, the synchronous cancer is a synchronous colorectal cancer. In embodiments, the subject has synchronous colorectal cancer. In embodiments, the subject is suspected of having synchronous colorectal cancer.

[0177] In embodiments, the methods provided herein comprise administering to the subject an effective amount of radiation therapy. In embodiments, the methods comprise administering to the subject an effective amount of chemotherapy. In embodiments, the methods comprise administering to the subject an effective amount of targeted therapy. In embodiments, the methods comprise administering to the subject an effective amount of immunotherapy. In embodiments, the methods comprise administering to the subject an effective amount of hormonal therapy. In embodiments, the methods comprise administering to the subject an effective amount of angiogenesis inhibitor. In embodiments, the methods comprise administering to the subject an effective amount of synthetic lethality therapy. In embodiments, the methods comprise administering to the subject an effective amount of any combination of an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, and synthetic lethality therapy. In embodiments, the disclosed methods further comprise surgically removing all or a portion of a tumor associated with the cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s synchronous tumors. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s synchronous tumors.

[0178] In embodiments, the subject undergoes surgery after detection in the biological sample of an elevated level of methylation of one of the genes EPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer immediately after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer two days after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer one week after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer two weeks after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer one month after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer three months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer six months after detection of an elevated methylation level of one of the genes selected from SEPT9, SHANK2, PRKARIB, ZNF511 , ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer twelfe months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample.

[0179] In embodiments, the disclosed methods further comprise performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, colonoscopy is performed on a subject prior to determining the level of methylation of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, as described herein. In embodiments, colonoscopy is performed on a subject following detection of elevated or abnormal methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, colonoscopy is carefully performed to determine the presence or absence of cololorectal lesions that are indicative of synschronous colorectal cancer. In embodiments, the results of the colonoscopy are reviewed prior to detection of said DNA methylation level. In embodiments, the results of the colonoscopy are reviewed after detection of said DNA methylation level in addition to an earlier review performed prior to detection of said DNA methylation level. In embodiments, said later review of the results of the colonoscopy is performed for a longer time than the initial review. In embodiments, the later review takes 15 minutes longer than the initial review of the results of the colonosclopy. In embodiments, the later review takes 30 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes 45 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and a half longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and 45 minutes longer than the review of the results of the colonoscopy. In embodiments, the later review takes two hours longer than the initial review of the results of the colonoscopy. In embodiments, a finding of one or more colorectal lesions in the colonoscopy of a subject is indicative of synchronous colorectal cancer.

[0180] In embodiments, the subject undergoes surgery after detection in the biological sample of an elevated level of methylation of one of the genes SEPT9, SHANK2, PRKA1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer immediately after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer two days after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer one week after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer two weeks after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer one month after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer three months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer six months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample. In embodiments, the disclosed methods comprise surgically removing all or a portion of the subject’s cancer twelfe months after detection of an elevated methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, in the biological sample.

Methods of Diagnosing a Synchronous Cancer

[0181] Provided herein are methods of diagnosing a subject having a cancer or suspected of having a cancer as having a synchronous cancer. The disclosed methods comprise determining the methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is selected from the group consisting of SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof.

In embodiments, the subject has a synchronous cancer if an elevated methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, KIF22, or a combination thereof is detected in the biological sample. In embodiments, determining the methylation level of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof comprises determining the methylation level of a CpG site within the gene. In embodiments, the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, cgl 1255039, or a combination thereof. In embodiments, the CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22. [0182] In embodiments, the CpG site is cg20275528. In embodiments, the CpG site is cg03578926. In embodiments, the CpG site is cg22084339. In embodiments, the CpG site is cg27332938. In embodiments, the CpG site is cgl 0461088. In embodiments, the CpG site is cgl 1255039. In embodiments, the method comprises determining the methylation level of one CpG site selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of two CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of three CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of four CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of five CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the method comprises determining the methylation level of six CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039.

[0183] In embodiments, the subject has colorectal cancer. In embodiments, the subject is suspected of having colorectal cancer.

[0184] In embodiments, the biological sample is a tissue sample. In embodiments, the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

[0185] In embodiments, the biological sample is a bodily fluid. In embodiments, the bodily fluid is blood, urine, plasma or saliva.

[0186] In embodiments, an elevated level of methylation of one of the genes SEPT9, SHANK2, PRKAR1 IB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, relative to the standard control in the biological sample is indicative of the subject having or being suspected of having a synchronous cancer.

[0187] In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof in a biological sample from a healthy subject. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a subject with a solitary colorectal cancer. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof in a biological sample from a a cancer patient who is responsive to surgery and can be spared intensive chemotherapy treatment. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients with no risk of cancer recurrence. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKAR1B,

ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients with a low (e.g. very low) risk of cancer recurrence. In embodiments, the standard control is the detected level of DNA methylation of one of the genes SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, KIF22, or a combination thereof in a biological sample from a a cancer patient or a population of cancer patients who are at no risk or very low risk of developing cancer recurrence within the first 5 years after surgery. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 10%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 8%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 2%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 1%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.5%. In embodiments, the standard control subject has a risk of developing cancer recurrence within the first 5 years after surgery below 0.1%. In embodiments, the standard control is a sample obtained from a healthy subject, or a sample from a subject with colorectal cancer who has undergone surgery and has a low risk of cancer recurrence. In embodiments, the standard control is a sample obtained from a healthy subject. In embodiments, the standard control is a sample from a subject with colorectal cancer who has no synchronous cancer. In embodiments, the standard control is a sample from a subject with no synchronous colorectal cancer.

[0188] In embodiments, the synchronous cancer is a synchronous colorectal cancer. In embodiments, the subject has synchronous colorectal cancer. In embodiments, the subject is suspected of having a synchronous colorectal cancer.

[0189] In embodiments, the disclosed methods further comprise proposing to or providing the subject with one or more treatments. In embodiments, the one or more treatments comprise surgery, an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, synthetic lethality therapy, or a combination of thereof. In embodiments, the methods comprise administering to the subject an effective amount of an anticancer agent. In embodiments, the methods comprise administering to the subject an effective amount of radiation therapy. In embodiments, the methods comprise administering to the subject an effective amount of chemotherapy. In embodiments, the methods comprise administering to the subject an effective amount of targeted therapy. In embodiments, the methods comprise administering to the subject an effective amount of immunotherapy. In embodiments, the methods comprise administering to the subject an effective amount of hormonal therapy. In embodiments, the methods comprise administering to the subject an effective amount of angiogenesis inhibitor. In embodiments, the methods comprise administering to the subject an effective amount of synthetic lethality therapy. In embodiments, the methods comprise administering to the subject an effective amount of any combination of an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, and synthetic lethality therapy. In embodiments, the disclosed methods further comprise surgically removing all or a portion of a tumor associated with the cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s synchronous tumors. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s synchronous tumors.

[0190] In embodiments, the disclosed methods further comprise performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, colonoscopy is performed on a subject prior to determining the level of methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, as described herein. In embodiments, colonoscopy is performed on a subject following detection of elevated or abnormal methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, colonoscopy is carefully performed to determine the presence or absence of cololorectal lesions that are indicative of synschronous colorectal cancer. In embodiments, the results of the colonoscopy are reviewed prior to detection of said DNA methylation level. In embodiments, the results of the colonoscopy are reviewed after detection of said DNA methylation level in addition to an earlier review performed prior to detection of said DNA methylation level. In embodiments, said later review of the results of the colonoscopy is performed for a longer time than the initial review. In embodiments, the later review takes 15 minutes longer than the initial review of the results of the colonosclopy. In embodiments, the later review takes 30 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes 45 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and a half longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and 45 minutes longer than the review of the results of the colonoscopy. In embodiments, the later review takes two hours longer than the initial review of the results of the colonoscopy. In embodiments, a finding of one or more colorectal lesions in the colonoscopy of a subject is indicative of synchronous colorectal cancer.

Methods of Monitoring for a Synchronous Cancer

[0191] Provided herein are methods of monitoring a subject having cancer for an increased risk of synchronous cancer. The disclosed methods comprise (i) determining the methylation level, relative to a standard control, of a gene in a biological sample obtained from the subj ect, wherein the gene is SEPT9, SHANK2, PRKAR1 B, ZNF511 , ARFGAP2, and KIF22, or a combination thereof at a first time point; and (ii) determining the methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof at a second time point later than the first time point. In embodiments, an elevated methylation level of SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof detected in the sample at the second time point compared to the methylation level of the genes EPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof, at the first time point is indicative of the presence of or an increased risk for syncronous cancer. In embodiments, a non-elevated methylation level of SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, and KIF22, or a combination thereof detected in the sample at the second time point compared to the methylation level of SEPT9, SHANK2, PRKARIB, ZNF511, ARFGAP2, or a combination thereof at the first time point is indicative of no synchronous cancer or no increased risk for synchronous cancer.

[0192] In embodiments, determining the methylation level of the gene comprises determining the methylation level of a CpG site within the gene. In embodiments, the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039, or a combination thereof. In embodiments, the CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.

[0193] In embodiments, the CpG site is cg20275528. In embodiments, the CpG site is cg03578926. In embodiments, the CpG site is cg22084339. In embodiments, the CpG site is cg27332938. In embodiments, the CpG site is cgl 0461088. In embodiments, the CpG site is cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of one CpG site selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of two CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of three CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of four CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of five CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of six CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039.

[0194] In embodiments, the subject has colorectal cancer. In embodiments, the subject is suspected of having colorectal cancer.

[0195] In embodiments, the biological sample is a tissue sample. In embodiments, the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

[0196] In embodiments, the biological sample is a bodily fluid. In embodiments, the bodily fluid is blood, urine, plasma or saliva.

[0197] In embodiments, the monitoring further comprises performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, the disclosed methods further comprise performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, colonoscopy is performed on a subject prior to determining the level of methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, as described herein. In embodiments, colonoscopy is performed on a subject following detection of elevated or abnormal methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, colonoscopy is carefully performed to determine the presence or absence of cololorectal lesions that are indicative of synschronous colorectal cancer. In embodiments, the results of the colonoscopy are reviewed prior to detection of said DNA methylation level. In embodiments, the results of the colonoscopy are reviewed after detection of said DNA methylation level in addition to an earlier review performed prior to detection of said DNA methylation level. In embodiments, said later review of the results of the colonoscopy is performed for a longer time than the initial review. In embodiments, the later review takes 15 minutes longer than the initial review of the results of the colonosclopy. In embodiments, the later review takes 30 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes 45 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and a half longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and 45 minutes longer than the review of the results of the colonoscopy. In embodiments, the later review takes two hours longer than the initial review of the results of the colonoscopy. In embodiments, a finding of one or more colorectal lesions in the colonoscopy of a subject is indicative of synchronous colorectal cancer. In embodiments, the disclosed methods further comprise monitoring the subject every 3 to 6 months for two years, and thereafter every six months for three additional years, if the subject presents no difference in level of DNA methylation of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination of two or more thereof, between the first time point and the second time point.

[0198] In embodiments, the disclosed methods further comprise proposing further treatment or treatments to a subject who has or is at risk of developing a synchronous cancer. [0199] In embodiments, the treatment or treatments comprise one or more of surgery, anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, synthetic lethality therapy, or a combination of two or more thereof. In embodiments, the methods comprise administering to the subject an effective amount of an anticancer agent. In embodiments, the methods comprise administering to the subject an effective amount of radiation therapy. In embodiments, the methods comprise administering to the subject an effective amount of chemotherapy. In embodiments, the methods comprise administering to the subject an effective amount of targeted therapy. In embodiments, the methods comprise administering to the subject an effective amount of immunotherapy. In embodiments, the methods comprise administering to the subject an effective amount of hormonal therapy. In embodiments, the methods comprise administering to the subject an effective amount of angiogenesis inhibitor. In embodiments, the methods comprise administering to the subject an effective amount of synthetic lethality therapy. In embodiments, the methods comprise administering to the subject an effective amount of any combination of an anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, and synthetic lethality therapy.

[0200] In embodiments, the disclosed methods further comprise surgically removing all of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s cancer. In embodiments, the disclosed methods further comprise surgically removing all of the subject’s synchronous tumors. In embodiments, the disclosed methods further comprise surgically removing a portion of the subject’s synchronous tumors.

Methods of Monitoring for a Synchronous Cancer and Treating a Synchronous Cancer [0201] Provided herein are methods of monitoring a subject having cancer or suspected of having a cancer for an increased risk of developing a synchronous cancer and treating a synchronous cancer in the subject. The disclosed methods comprise (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22 at a first time point; (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511 , ARFGAP2, or KIF22 at a second time point later than the first time point; and (iii) treating the subject with surgery, an anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy, if the methylation level of said gene at the second time point is elevated relative to the methylation level of said gene at the first time point.

[0202] In embodiments, determining the methylation level of the gene comprises determining the methylation level of a CpG site within the gene. In embodiments, the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039, or a combination thereof. In embodiments, the CpG sites cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.

[0203] In embodiments, the CpG site is cg20275528. In embodiments, the CpG site is cg03578926. In embodiments, the CpG site is cg22084339. In embodiments, the CpG site is cg27332938. In embodiments, the CpG site is cgl 0461088. In embodiments, the CpG site is cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of one CpG site selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of two CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of three CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of four CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of five CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039. In embodiments, the methods provided herein comprise determining the methylation level of six CpG sites selected from the group consisting of cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039.

[0204] In embodiments, the subject has colorectal cancer. In embodiments, the subject is suspected of having colorectal cancer.

[0205] In embodiments, the biological sample is a tissue sample. In embodiments, the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

[0206] In embodiments, the biological sample is a bodily fluid. In embodiments, the bodily fluid is blood, urine, plasma or saliva. [0207] In embodiments, the methods provided herein comprise administering to the subject an effective amount of an anti cancer agent. In embodiments, the methods provided herein comprise administering to the subject an effective amount of radiation therapy. In embodiments, the methods provided herein comprise administering to the subject an effective amount of chemotherapy. In embodiments, the methods provided herein comprise administering to the subject an effective amount of targeted therapy. In embodiments, the methods provided herein comprise administering to the subject an effective amount of immunotherapy. In embodiments, the methods provided herein comprise administering to the subject an effective amount of hormonal therapy. In embodiments, the methods provided herein comprise administering to the subject an effective amount of angiogenesis inhibitor. In embodiments, the methods provided herein comprise administering to the subject an effective amount of synthetic lethality therapy. In embodiments, the methods provided herein comprise administering to the subject an effective amount of any combination of an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, and synthetic lethality therapy.

[0208] In embodiments, the disclosed methods comprise surgically removing all of the subject’s cancer. In embodiments, the disclosed methods comprise surgically removing a portion of the subject’s cancer. In embodiments, the disclosed methods comprise surgically removing all of the subject’s synchronous tumors. In embodiments, the disclosed methods comprise surgically removing a portion of the subject’s synchronous tumors.

[0209] In embodiments, the monitoring further comprises performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, the disclosed methods further comprise performing a diagnostic procedure on the subject. In embodiments, the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test. In embodiments, colonoscopy is performed on a subject prior to determining the level of methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, as described herein. In embodiments, colonoscopy is performed on a subject following detection of elevated or abnormal methylation level of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof. In embodiments, colonoscopy is carefully performed to determine the presence or absence of cololorectal lesions that are indicative of synschronous colorectal cancer. In embodiments, the results of the colonoscopy are reviewed prior to detection of said DNA methylation level. In embodiments, the results of the colonoscopy are reviewed after detection of said DNA methylation level in addition to an earlier review performed prior to detection of said DNA methylation level. In embodiments, said later review of the results of the colonoscopy is performed for a longer time than the initial review. In embodiments, the later review takes 15 minutes longer than the initial review of the results of the colonosclopy. In embodiments, the later review takes 30 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes 45 minutes longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and a half longer than the initial review of the results of the colonoscopy. In embodiments, the later review takes an hour and 45 minutes longer than the review of the results of the colonoscopy. In embodiments, the later review takes two hours longer than the initial review of the results of the colonoscopy. In embodiments, a finding of one or more colorectal lesions in the colonoscopy of a subject is indicative of synchronous colorectal cancer. In embodiments, the disclosed methods further comprise monitoring the subject every 3 to 6 months for two years, and thereafter every six months for three additional years, if the subject presents no difference in level of DNA methylation of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination of two or more thereof, between the first time point and the second time point.

[0210] In embodiments, all the methods provided herein comprise determining the level of methylation of one of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, or a combination thereof, and no other genes are analyzed or detected.

Kits

[0211] Provided herein are primers and probes for the detection of DNA methylation. Primers include one or more of those listed in Supplementary Table 2.1 and 2.2. Probes include one or more of those listed in Supplementary Table 2.3.

[0212] Also provided herein are kits comprising reagents and reaction mixtures for the detection, analysis and measurement of DNA methylation of one or more genes in a biological sample. As part of the kit, materials and instruction are provided, e.g., for storage and use of kit components. [0213] In embodiments, the kits provided herein comprise reagents and reaction mixtures for the detection of DNA methylation of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, and any combination thereof, and instructions for storage and use.

[0214] “Assaying" or “detecting” means using an analytical procedure to qualitatively assess or quantitatively measure the level of methylation of the genes as described herein such as, for example, detecting the DNA methylation level of the genes SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, KIF22, and any combination thereof, using an analytic procedure (such as an in vitro procedure) to qualitatively assess or quantitatively measure the DNA methylation level of the selected genes. In embodiments, the detecting includes or is assaying, which includes wet lab analysis, physical steps and/or physical manipuatlion of the sample, for example in a laboratory setting involving physical assaying techniques.

[0215] In embodiments, the kit comprises one or more of a probe that can hybridize to a biomarker, pairs of primers for PCR amplification, instructions on how to use the kit, and a label or insert indicating regulatory approval for diagnostic use.

[0216] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Embodiments 1-80

[0217] Embodiment 1. A method of detecting a level of DNA methylation in a subject that has or is suspected of having a cancer, wherein the method comprises determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subj ect, wherein the gene is SEPT9, SHANK2, PRKAR1 B, ZNF511 , ARFGAP2, KIF22, or a combination thereof.

[0218] Embodiment 2. The method of Embodiment 1, wherein determining the methylation level the gene comprises determining the methylation level of a CpG site, and wherein the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl 0461088, or cgl 1255039.

[0219] Embodiment 3. The method of Embodiment 1 or Embodiment 2, wherein the subject has or is suspected of having a colorectal cancer. [0220] Embodiment 4. The method of anyone of Embodiments 1-3, wherein the biological sample is a tissue sample.

[0221] Embodiment 5. The method of Embodiment 4, wherein the tissue sample is a formalin fixed paraffin -embedded (FFPE) tissue sample.

[0222] Embodiment 6. The method of anyone of Embodiment 1-3, wherein the biological sample is a bodily fluid.

[0223] Embodiment 7. The method of Embodiment 6, wherein the bodily fluid is blood, urine, plasma or saliva.

[0224] Embodiment 8. The method of anyone of Embodiments 1-7, wherein the level of DNA methylation of said gene is elevated relative to said standard control.

[0225] Embodiment 9. The method of Embodiment 8, wherein said elevated level DNA methylation is indicative of the subject having synchronous cancer.

[0226] Embodiment 10. The method of Embodiment 9, wherein the synchronous cancer is a synchronous colorectal cancer.

[0227] Embodiment 11. The method of Embodiment 10, wherein the subject has synchronous colorectal cancer.

[0228] Embodiment 12. The method of anyone of Embodiments 8-11, wherein the method further comprising treating said subject with surgery, anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

[0229] Embodiment 13. The method of Embodiment 1, further comprising performing a diagnostic procedure on the subject.

[0230] Embodiment 14. The method of Embodiment 13, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

[0231] Embodiment 15. The method of Embodiment 14, where the diagnostic procedure is performed prior to said detecting of said level of DNA methylation.

[0232] Embodiment 16. The method of Embodiment 15, wherein if the level of DNA methylation of said gene is elevated relative to said standard control, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

[0233] Embodiment 17. The method of anyone of Embodiments 1-16, wherein an elevated methylation level of said gene is indicative of synchronous colorectal cancer. [0234] Embodiment 18. A method of treating a subject who has or is suspected of having a synchronous cancer, the method comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22; and (ii) administering to the subject an effective amount of an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

[0235] Embodiment 19. The method of Embodiment 18, wherein determining the methylation level of said gene comprises determining the methylation level a CpG site within said gene, and wherein the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, or cgl 1255039.

[0236] Embodiment 20. The method of Embodiment 18 or Embodiment 19, wherein an elevated methylation level of said gene, relative to the standard control, is indicative of synchronous cancer.

[0237] Embodiment 21. The method of Embodiment 20, wherein the synchronous cancer is a synchronous colorectal cancer.

[0238] Embodiment 22. The method of anyone of Embodiments 18-20, further comprising performing a diagnostic procedure on the subject.

[0239] Embodiment 23. The method of Embodiment 22, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

[0240] Embodiment 24. The method of Embodiment 23, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

[0241] Embodiment 25. The method of Embodiment 24, wherein if the level of DNA methylation of said gene is elevated relative to said standard control, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

[0242] Embodiment 26. The method of Embodiment 25, wherein the presence of one or more colorectal lesions is indicative of synchronous colorectal cancer.

[0243] Embodiment 27. The method of anyone of Embodiments 18-26, wherein the subject undergoes surgical removal of all or a portion of the cancer prior to or after detection of an elevated methylation level of said gene.

[0244] Embodiment 28. A method of detecting a synchronous cancer in a subject with cancer, the method comprising determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, and wherein an elevated methylation level of said gene relative to said standard control is indicative of synchronous cancer.

[0245] Embodiment 29. A method of diagnosing a subject having a cancer as having a synchronous cancer, the method comprising determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, and wherein the subject has a synchronous cancer if an elevated methylation level of said gene is detected in the biological sample.

[0246] Embodiment 30. The method of Embodiment 28 or Embodiment 29, wherein determining the methylation level of said gene comprises determining the methylation level of a CpG site within the gene, and wherein the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, or cgl 1255039.

[0247] Embodiment 31. The method of anyone of Embodiments 28-30, wherein the subject has colorectal cancer.

[0248] Embodiment 32. The method of anyone of Embodiments 28-31, wherein the biological sample is a tissue sample.

[0249] Embodiment 33. The method of Embodiment 32, wherein the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

[0250] Embodiment 34. The method of anyone of Embodiments 28-31, wherein the biological sample is a bodily fluid.

[0251] Embodiment 35. The method of Embodiment 34, wherein the bodily fluid is blood, urine, plasma or saliva.

[0252] Embodiment 36. The method of anyone of Embodiments 28-35, wherein an elevated methylation level of said gene relative to said standard control is indicative of synchronous cancer.

[0253] Embodiment 37. The method of Embodiment 36, wherein the synchronous cancer is a synchronous colorectal cancer.

[0254] Embodiment 38. The method of Embodiment 37, further comprising treating the subject with surgery, an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy. [0255] Embodiment 39. The method of anyone of Embodiments 28-38, wherein the subject undergoes surgical removal of all or a portion of the cancer prior to or after detection of an elevated methylation level of said gene.

[0256] Embodiment 40. The method of anyone of Embodiments 28-39, further comprising performing a diagnostic procedure on the subject.

[0257] Embodiment 41. The method of Embodiment 40, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

[0258] Embodiment 42. The method of Embodiment 41, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

[0259] Embodiment 43. The method of Embodiment 42, wherein if the level of DNA methylation of said gene is elevated relative to said standard control, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

[0260] Embodiment 44. The method of Embodiment 43, wherein the presence of colorectal lesions is indicative of synchronous colorectal cancer.

[0261] Embodiment 45. A method of monitoring a subject having cancer for synchronous cancer, the method comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, at a first time point; and (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B,

ZNF511, ARFGAP2, or KIF22, at a second time point later than the first time point.

[0262] Embodiment 46. The method of Embodiment 45, wherein the monitoring further comprises performing a diagnostic procedure on the subject.

[0263] Embodiment 47. The method of Embodiment 46, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

[0264] Embodiment 48. The method of Embodiment 47, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

[0265] Embodiment 49. The method of Embodiment 48, wherein if the level of DNA methylation of said gene at the second time point is elevated relative to the level of DNA methylation of said gene at the first time point, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer. [0266] Embodiment 50. The method of Embodiment 49, wherein the presence of colorectal lesions is indicative of synchronous colorectal cancer.

[0267] Embodiment 51. The method of Embodiment 50, wherein the subject with no elevated level of DNA methylation of said gene at the second time point is monitored every 3 to 6 months for two years therefrom, and thereafter every six months for three additional years.

[0268] Embodiment 52. The method of Embodiment 45, wherein detection of an elevated methylation level of said gene at the second time point indicates that the subject has an increased risk of developing a synchronous cancer.

[0269] Embodiment 53. The method of Embodiment 52, wherein if an elevated methylation level of said gene is detected at the second time point compared to the methylation level of said gene at the first time point, the method further comprises treating the subject with surgery, an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

[0270] Embodiment 54. The method of Embodiment 53, wherein the subject undergoes surgical removal of all or a portion of the cancer prior to or after detection of an elevated methylation level of said gene.

[0271] Embodiment 55. The method of anyone of Embodiments 45-54, wherein the biological sample is a tissue sample.

[0272] Embodiment 56. The method of Embodiment 55, wherein the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

[0273] Embodiment 57. The method of anyone of Embodiments 45-56, wherein the biological sample is a bodily fluid.

[0274] Embodiment 58. The method of Embodiment 57, wherein the bodily fluid is blood, urine, plasma or saliva.

[0275] Embodiment 59. A method of monitoring a subject having cancer for synchronous cancer and treating synchronous cancer, the method comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22 at a first time point; (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511 , ARFGAP2, or KIF22 at a second time point later than the first time point; and (iii) treating the subject with surgery, an anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy, if the methylation level of said gene at the second time point is elevated relative to the methylation level of said gene at the first time point.

[0276] Embodiment 60. The method of Embodiment 59, wherein detection of an elevated methylation level of said gene at the second time point compared to the methylation level of said gene at the first time point indicates that the subject has an increased risk of developing a synchronous cancer.

[0277] Embodiment 61. The method of Embodiment 60 or Embodiment 61, wherein the monitoring further comprises performing a diagnostic procedure on the subject.

[0278] Embodiment 62. The method of Embodiment 61, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

[0279] Embodiment 63. The method of Embodiment 62, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

[0280] Embodiment 64. The method of Embodiment 63, wherein if the level of DNA methylation of said gene at the second time point is elevated relative to the level of DNA methylation of said gene at the first time point, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

[0281] Embodiment 65. The method of Embodiment 64, wherein the presence of colorectal lesions is indicative of synchronous colorectal cancer.

[0282] Embodiment 66. The method of Embodiment 59, wherein the subject with no elevated level of DNA methylation of said gene at the second time point is monitored every 3 to 6 months for two years therefrom, and thereafter every six months for three additional years.

[0283] Embodiment 67. The method of anyone of Embodiments 59-66, wherein the biological sample is a tissue sample.

[0284] Embodiment 68. The method of Embodiment 67, wherein the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

[0285] Embodiment 69. The method of anyone of Embodiments 59-66, wherein the biological sample is a bodily fluid. [0286] Embodiment 70. The method of Embodiment 69, wherein the bodily fluid is blood, urine, plasma or saliva.

[0287] Embodiment 71. A kit comprising reagents for detection and measurement of DNA methylation of one or more genes in a biological sample, wherein the one or more genes are SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.

[0288] Embodiment 72. A method of detecting a level of DNA methylation in a subject that has or is suspected of having cancer, wherein the method comprises determining the degree of methylation of CpG sites within one or more gene regions in a biological sample obtained from said subject in comparison to controls, wherein the one or more gene regions are cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039, or a combination of two or more thereof. Embodiment 73. The method of Embodiment 72, wherein the one or more gene regions cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 respectively correspond to SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.

[0289] Embodiment 74. The method of Embodiment 72, wherein the controls are an internal reference and a positive control, wherein the internal reference is the methylation level of b-actin in said biological sample, and the positive control is fully methylated human bisulfite-converted DNA. Embodiment 75. The method of Embodiment 72, wherein the subject has colorectal cancer. Embodiment 76. The method of Embodiment 72, wherein the biological sample is a tissue sample.

[0290] Embodiment 77. The method of Embodiment 76, wherein the tissue sample is a formalin fixed paraffin -embedded (FFPE) tissue sample.

[0291]

[0292] Embodiment 78. The method of Embodiment 72, wherein the subject is suffering from synchronous colorectal cancer if the degree of methylation of CpG sites in the one or more gene regions are below that of the methylation level of b-actin in the same biological sample.

[0293] Embodiment 79. The method of Embodiment 78, wherein the subject is proposed or provided one or more treatments.

[0294] Embodiment 80. The method of Embodiment 79, wherein the one or more treatment or treatments are surgery, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, synthetic lethality therapy, or a combination of two or more thereof. EXAMPLES

[0295] Synchronous CRC (SyCRC) is diagnosed when two or more tumors are detected in a single patient at the same time or within 6 months of the initial diagnosis (1). In contrast, metachronous CRC (MCRC) is diagnosed when the new primary tumor is detected at least 6 months after the resection of the primary lesion and in present in a different part of the large intestine, hence to rule out cancer recurrence from the initial diagnosis (2). Multiple primary CRCs are thought to have characteristics different from those of SoCRCs due to various environmental and hereditary factors 17, 30-31). For example, compared to SoCRC, a SyCRC — which accounts for about 1.2-8.1% of all CRCs - is more frequently found in men, at a proximal location, and are generally of a mucinous subtype (3). The precise and accurate diagnosis of SyCRC is important because patients with such cancers may require extensive resection around the cancer or may even be considered for more extensive segmental resection (6, 7). If overlooked, a synchronous tumor might progress to a more advanced stage and could metastasize. Furthermore, complete pre-operative colonoscopy is often unachievable for patients with distal colonic obstruction or stenosis; hence, raising the possibility of missing such lesions.

[0296] Although computed tomography (CT) colonography has improved the detection of synchronous lesions, its diagnostic accuracy still remains largely uncertain (8, 9). NCCN guidelines recommend colonoscopy in 3-6 months when the patients with CRC could not be achieved total colonoscopy before surgery due to obstructing lesion (10). Unfortunately, up to 50% of patients experience the postoperative complications (43). Therefore, these patients with lower health related quality of life are not often able to receive the colonoscopy within the recommended interval. Thus, it is critical to develop more robust strategies to identify patients with or likely to develop SyCRC before treatment. Known risk factors for SyCRC include familial adenomatous polyposis, Lynch syndrome, inflammatory bowel diseases, and serrated polyps/hyperplastic polyposis (3, 4); however, these features are present in only 10% of patients with SyCRC (5).

[0297] Previous studies have identified DNA methylation biomarkers of several cancers based on differentially methylated CpG sites/probes (DMPs) or genes (13-14, 16, 32-34). DNA methylation alterations are remarkably stable, cancer-specific and often occur early during carcinogenesis, representing a promising tool for minimally and noninvasive cancer detection (12). Considering that aberrant DNA methylation is the most common epigenetic variation in sporadic CRCs (11), we sought to develop a DNA methylation-based signature that can facilitate detection of SyCRC on its own, or in conjunction with currently used diagnostic screening approaches.

[0298] Recent studies have identified various genetic and epigenetic features of SyCRC (17-19). For example, certain genes, such as long interspersed nucleotide element-1 ( LINE1 ), are frequently methylated in SyCRC (17). Moreover, approximately 60% of patients with SyCRC exhibit chromosomal instability (CIN)(20), and the presence of these lesions is also highly correlated with the microsatellite instability pathway, with high-frequency microsatellite instability (MSI-high) occurring in about 30% of SyCRC, compared to only 10-12% of SoCRC (17, 21-22). Similarly, in contrast to SoCRC, patients with SyCRC more frequently exhibit the CpG island methylation phenotype (CIMP), which arises through increased accumulation of aberrantly methylated CpG sites within gene promoters of various tumor suppressor genes (17, 23). In spite of this, none of the previous studies have performed a thorough interrogation of DNA methylation profiles in SyCRC, which could offer additional clues for the underlying disease biology and may yield clinically useful biomarkers for disease detection.

[0299] To address this important unmet need and gap in knowledge, herein, we performed a systematic and comprehensive genomewide analysis of SoCRC and SyCRC specimens to discover DNA methylation biomarkers for the identification of SyCRC. By undertaking an extensive analysis of methylation sequencing data and using rigorous bioinformatic and statistical approaches, we established six-gene methylation signature that robustly identified patients with SyCRC. These results were subsequently validated in an independent clinical cohort of patients with SyCRC. Equally importantly, we also compared the methylation signatures of paired-SyCRCs with SoCRC, which also showed significant difference of this methylation panel. We subsequently evaluated the prognostic potential of our methylation panel for its ability to identify patients that are likely to develop MCRC. Our identified methylation panel could predict the patients which were developed MCRC and the patient with recurrence. Furthermore, our final risk stratification model which combined the methylation panel with clinical risk factors dichotomized high- and low-risk patient with recurrence. In summary, thorough genome-wide DNA methylation profiling analysis, we successfully established a novel methylation signature for the identification of SyCRC, which has the potential to more accurately identify and risk-stratify patients with SyCRC in the clinic. Example 1: Results

Genome-wide methylation profiling identifies a panel of six DMPs that discriminate patients with SyCRC from those with SoCRC

[0300] Relevant methylation changes are regional during cancer progression; thus, the general pattern demonstrated by several adjacent CpGs represents a more robust biologic effect than any single CpG alone (15, 35). Therefore, to obtain SyCRC specific biomarkers, we initially identified 1,184 DMPs which were associated with 175 DMRs after performing DMR filtering based on the restrictive criteria. Next, we used the LASSO-based regression algorithms to establish a methylation-based signature that discriminated patients with SyCRC from those with SoCRC. This analysis, which is described in detail below, further reduced the list of candidate DMPs to 12, among which half were significantly hypermethyl ated and the other half were hypomethylated in SyCRCs.

[0301] 1,254 differentially methylated region (DMRs) and 149,356 differentially methylated CpG sites (DMPs) were identified by a genome wide methylation analysis between patients with SyCRC and those with solitary colorectal cancer (SoCRC). 175 DMRs and 1184 DMPs were selected under the conditions that one DMR should include at least 2 DMRs and the b difference for each DMP should be no less than 0.15 between SyCRC and SoCRC groups. Least absolute shrinkage and selection operator (LASSO) algorithms were used to further narrow down a methylation-based signature for patients with SyCRC in the house cohort. As a result, 12 DMPs were identified. Among the 12 DMPs, six were significantly hypermethylated and the other were hypomethylated (FIG. 1A). Subsequently, a multidimensional scaling (MDS) plot visualized sample distribution in a two-dimensional scatter plot, revealing separate clusters between SyCRC and SoCRC groups (FIG. IB). From an initially selected 12 DMPs, those which were highly correlated with the others were excluded, and six DMPs: cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039 corresponding to SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22, respectively, were identified (FIG. 1C). Further, risk scores were calculated by constructing a logistic regression model with these six DMPs in the discovery cohort; which demonstrated excellent predictive performance for SyCRC (area under curve [AUC], 1.00; 95% confidence interval [Cl] = [1.00, 1.00], FIG. ID) highlighting the epigenetic difference between SyCRC and SoCRC, and provided a rationale to systematically interrogate its clinical significance in this disease. [0302] Subsequently, we visualized the distribution of all CRC samples based on these DMPs using a two-dimensional scatter plot produced by multidimensional scaling, which revealed that the two clusters corresponding to SyCRC and SoCRC were distinct and clearly discriminated by these differentially methylated loci. From this initial set of 12 DMPs, we excluded those that were highly correlated with each other and did not add any further value to the discriminatory model, which led us to finally establish a panel of six DMPs: cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, and cgl 1255039, which corresponded to SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22 genes, respectively. Next, we constructed a logistic regression model with these six DMPs to calculate the risk scores for patients with SyCRC in the discovery cohort. Our model demonstrated excellent predictive performance (area under the curve [AUC]=1.00; 95% confidence interval [CI]=1.00— 1.00; Fig. ID), highlighting the significance of the epigenetic biomarkers we discovered and their ability to discriminate patients with SyCRC from those with SoCRC which provides a rationale for these alterations for their biological and clinical significance for interrogating the differences between these two subtypes of CRC.

Clinical validation for the establishment of a methylation panel in house clinical cohort.

[0303] To further validate the performance of the six-methylation panel into a clinically translatable prognostic assay, a Methylight polymerase chain reaction (PCR) based validation was performed in an independent in-house clinical cohort (n=80; 38 SyCRC and 42 SoCRC). Univariate analysis for the identification of SyCRC showed that each of the six genes corresponding to identified DMPs individually were associated with patients with SyCRC (Odds ratio: 3.13-32.77) (FIG. 2A). Subsequently, the SyCRC identification score model based on the coefficients weighted by the logistic regression analysis was developed. The risk score was calculated as follows: risk score = (0.076389*methylation level of SEPT9) + (- 0.054988*methylation level of SHANK2) + (0.00072293 *methylati on level of PRKAR1B) + (0.29380*methylation level of ZNF511) + (0.086657*methylation level of ARFGAP2) + (- 0.031170*methylati on level of KIF22) - 5.71048. Patients with SyCRC had significantly higher risk score than those with SoCRC (P < 0.001, Mann-Whitney test) (FIG. 2B). Moreover, this six-methylation model robustly identified patients with SyCRC (AUC, 0.91; 95% Cl, 0.82-0.96) (FIG. 2C). On plotting the risk scores, 93.9% of patients with SyCRC had a positive score and 85.1% of those with SoCRC had a negative score (FIG. 2D).

Differences in methylation signature between synchronous cancer pairs [0304] Previous studies on SyCRCs have reported high heterogeneity of variants between tumor pairs [28, 29] Therefore, the relationship between the methylation risk scores of other SyCRC and those of SoCRC was assessed. As with higher stage of SyCRC tumor, a significant association for high risk score in patients with SyCRC was observed (AUC, 0.93; 95% Cl, 0.84-0.98) (FIG. 6A and FIG. 6B).

[0305] The differences of methylation signature between paired synchronous tumors was investigated. The tumor information of the 38 pairs are summarized in Supplementary Table SI. Comparing both paired synchronous tumors, no significant differences were found between the methylation score of tumors and it yielded an AUC value of 0.51 (95% Cl, 0.39- 0.62) for distinguishing paired synchronous tumors (FIG. 3 A and FIG. 3B). Moreover, the methylation risk score between synchronous tumors showed a positive association (r=0.52, P0.001; FIG. 3C). Taken together, these data indicate that the methylation risk score of either tumor can predict the patients with SyCRC.

[0306] High methylation score was associated with patients with SyCRC which developed to Metachronous colorectal cancer (MCRC).

[0307] Among the 38 SyCRC patients, seven patients were detected newly developing metachronous lesions in time. Methylation signature might also be able to identify development group. A significant association for higher risk score in the patients with SyCRC developed to MCRC (AUC, 0.87; 95% Cl, 0.72-0.96) (FIG. 4A). Likewise, the overall methylation score was significantly higher in the development to MCRC group than the no development group (P<0.001; FIG. 4B).

[0308] Because development to MCRC is often associated with poor prognosis in patients with CRC, the prognostic potential of our methylation biomarkers was examined.

The median follow-up times were 133.42 months (95% Cl, 120.73-146.12) in the clinical cohort. 16 high risk patients had poorer relapse-free survival (RFS) than 27 low risk patients (P<0.05; FIG. 4C). In addition, in univariate analysis using the Cox proportional hazard model along with other clinicopathologic factors, the methylation panel was the only factor that associated with a significantly worse RFS in this cohorts (hazard ratio, 2.72; 95% Cl, 1.12-6.61) (Table 1). Collectively, these results highlight that in addition to the diagnostic ability of the methylation signature in distinguishing patients with SyCRC, it has significant prognostic ability.

Table 1: Univariate Cox proportional analysis of RFS in the SyCRC patients

HR, hazard ratio; Cl, confidence interval

Supplementary Table SI: Synchronous colorectal cancer pairs with clinical data

AJCC, American Joint Committee on Cancer; N/A, not available

Example 2: Discussion

[0309] Multiple primary cancer is thought to have the different characteristics from SoCRC such as environmental and hereditary factors [17, 30, 31] However, its features are still poorly understood, and no tools are currently available for the diagnosis of SyCRC. In the present study, using a systematic and comprehensive discovery approach, a six- methylation signature to diagnose patients with SyCRC was developed, followed by clinical validation in independent in-house clinical cohort. Moreover, synchronous pair tumors exhibited a significant correlation of amethylation signature score. Further, the methylation signature was quite robust in identifying poor RFS. These results highlight the potential clinical significance of the novel methylation signature for the identification of patients with SyCRC.

[0310] Previous studies have reported DNA methylation biomarkers based on DMPs or single candidates in several cancers [13, 14, 16, 32-34] However, in cancer progression process, relevant methylation changes are regional, with the general pattern demonstrated by a number of adjacent CpGs providing a more robust biologic effect than any single CpG alone [15, 35, 36] The candidate biomarkers were screened by interrogating these based on DMR. The final candidates were identified using LASSO to develop a methylation signature Furthermore, for the first time, these six gene methylations associated with SyCRC were identified. Several previous reports indicated that the hypermethylated SEPT9 is associated with tumorigenesis in CRC [37-39] The detection of circulating methylated SEPT9 DNA in blood has been approved by Food and Drug Administration (FDA) of the United States for CRC screening.

[0311] Comparing SoCRC with lower stage synchronous tumor, a similar result with comparison SoCRC with higher synchronous tumor in the methylation signature was observed. Moreover, a significant correlation of methylation signature risk score was shown within SyCRC pairs, which might have been due to field cancerization. Previous studies of the epigenetic signature of synchronous paired tumors in patients with SyCRC performed comprehensively [17, 24, 40] Moreover, some previous studies showed high heterogeneity between synchronous tumor pairs by conducting whole-genome sequencing [41, 42] Although paired tumors within the same patient might present genetic heterogeneity in the instantcohort, the methylation signature was developed by comparing SoCRC with SyCRC. Paired tumors had a similar methylation score in the cohort; demonstrating that the methylation signature is useful for the management of patients with SyCRC type whichever tumor is tested.

[0312] The expected 5-year survival rates of patients affected by SyCRCs are still controversial. While one study found a poorer survival in patients with SyCRC [17], others have demonstrated that the overall survival of patients with SyCRC are not significantly different from that of patients with SoCRC [5, 31] In the present study, there is no significant survival difference between patients with SyCRC and with SoCRC (data not shown) because the cohort might have included patients with stage 0 cancer. However, the methylation signature was able to predict a poor prognosis by focusing on the patients with SyCRC developing to MCRC, suggesting that the instant methylation signature provides prognostic as well as diagnostic effect.

[0313] In conclusion, using a genome-wide methylation profiling effort, a novel methylation signature was developed and validated for the identification of patients with SyCRC.

Example 3: Study design and patient cohorts

[0314] A total of 114 CRC formalin-fixed paraffin-embedded (FFPE) specimens (54 SyCRC and 60 SoCRC samples) were included in this study from the 12 de Octubre University Hospital, Spain, between 2006 and 2018; and de Donostia University Hospital from Spain, between 2010 and 2017. SyCRC was defined 2 or more histologically distinct colorectal tumors were identified in the same patient at the same time or in a period less than six months after the first diagnosis [1, 24] For patients with SyCRC, results were analyzed from the higher stage or a larger tumor if the two synchronous tumors were same stage.

None of the patients with surgical treatment received preoperative cancer treatment.

[0315] As shown in Table 2, 16 patients with SyCRC and 18 patients with SoCRC were enrolled for the systematic discovery phase. Then, 38 SyCRC and 42 SoCRC tissue samples were validated for a given list of candidates to assess the reproducibility of discovery results. The study workflow is summarized in FIG. 5. All patients were followed until death or July 2018. The study was conducted in accordance with the Declaration of Helsinki. A written informed consent was obtained from all patients, and the study was approved by the institutional review boards of all participating institutions.

[0316] Table 2: Clinicopathological characteristics of clinical cohorts

0317] AJCC, American Joint Committee on Cancer; * Fisher's exact test; ** Wilcoxon's signed rank test

Example 4: Materials and Methods DNA extraction and bisulfite conversion

[0318] DNA was isolated from 10-mm-thick FFPE surgical and endoscopic biopsy specimens by manual microdissection from cancer cell rich areas that evaluated on H&E stained slides, using AllPrep DNA/ RNA FFPE Kit (Qiagen, Hilden, Germany). Following DNA quantification using Nanodrop system (ThermoFisher Scientific, Massachusetts, United States of America), 500 ng of genomic DNA was bisulfite converted with EZ-DNA methylation Gold-Kit (Zymo, Irvine, California, United States of America). All procedures were conducted according to the manufacturer’s instructions.

Genome-wide DNA methylation analysis

[0319] For the comprehensive biomarker discovery, DNA methylation analysis using an Infmium MethylationEPIC array (GenomesSan B.V., Leiden, Netherlands) was performed, which covers more than 850,000 CpG sites [25] Raw fluorescence intensities were loaded in BeadStudio software to field b values, which represent the methylation score of each CpG site. They range from 0 (non-methyl ated) to 1 (fully methylated). Prior to identification of differentially methylated probes, preprocessing steps, including data filtering, correction, and normalization, were implemented. Differentially methylated CpG sites (DMPs) were identified when b difference > 0.15 and adjusted P value ((Benjamini-Hochberg method,

False Discovery Rate (FDR)) < 0.05. A differentially methylated region (DMR) was defined as more than two adjacent DMPs within 100 bp genomic window [13]

Methylight quantitative polymerase chain reaction (qPCR) assays [0320] Methylight polymerase chain reaction (PCR) assays were performed using QuantStudio 7 Flex RT-PCR System ((Applied Biosystems, Foster City, California (CA)) using SensiFAST™ Probe Lo-ROX Kit (Bioline, London, United Kingdom) as described previously [26] The primers and probes were designed using Beacon Designer™ (version 8.21; Premier Biosoft International, Palo Alto, CA, USA). The PCR primers and probes are listed in Supplementary Tables S2.1-S2.3. b-actin was used as an internal reference and a fully methylated human bisulfite-converted DNA (Qiagen Hilden, Germany) was used as a positive control to calculate the percentage of methylated reference (PMR) of the samples. PMR is the degree of methylation of each sample relative to the fully methylated control [27] [0321] Supplementary Table S2.1: Primers

[0322] Supplementary Table S2.2: Primers

[0323] Supplementary Table S2.3: Probes

Statistical analysis

[0324] Statistical analyses were performed using Medcalc statistical software V.16.2.0 (Medcalc Software, Ostend, Belgium), GraphPad Prism V8.0 (GraphPad Software, San Diego, CA), and R (3.5.0, R Development Core Team, https://cran.r-project.org/). Beta Mixture Quantile dilation (BMIQ) method is used for original beta value normalization. Linear models for microarray (limma) package is used to calculate differential methylation probes between two phenotypes. Bumphunter method is applied to detect differentially methylated genomic regions between two populations. Association between categorical variables were assessed by the c2 test, Fisher’s exact test, or Wilcoxson’s signed rank sum test. A paired t-test or Mann Whitney U test was used to compare the methylation signature risk score between tumors. Correlation between two continuous values was analyzed by Pearson’s correlation. The relapse-free survival (RFS) times were calculated from the date of surgery to the date of death from any cause or recurrence, or last follow-up date. Kaplan- Meier analysis and log-rank test were used to estimate and compare the RFS differences between groups. The methylation panel value was dichotomized into high-expression and low-expression groups based on receiver operating characteristic (ROC) curves along with Youden’s index correction. All P values were 2-sided, and those less than 0.05 were considered statistically significant. REFERENCES

E Lee, B.C., et al., Clinicopathological features and surgical options for synchronous col orectal cancer. Medicine (Baltimore), 2017. 96(9): p. e6224.

2. Cunliffe, W.J., et al., Incidence of synchronous and metachronous colorectal carcinom a. Br J Surg, 1984. 71(12): p. 941-3.

3. Lam, A.K., S.S. Chan, and M. Leung, Synchronous colorectal cancer: clinical, patholo gical and molecular implications. World J Gastroenterol, 2014. 20(22): p. 6815-20.

4. Chin, C.C., Y.H. Kuo, and J.M. Chiang, Synchronous colorectal carcinoma: predispos ing factors and characteristics. Colorectal Dis, 2019. 21(4): p. 432-440.

5. Lam, A.K., et al., Clinicopathological significance of synchronous carcinoma in color ectal cancer. Am J Surg, 2011. 202(1): p. 39-44.

6. Wang, H.Z., et al., Clinical features, diagnosis, treatment and prognosis of multiple pri mary colorectal carcinoma. World J Gastroenterol, 2004. 10(14): p. 2136-9.

7. Passman, M.A., R.F. Pommier, and J.T. Vetto, Synchronous colon primaries have the same prognosis as solitary colon cancers. Dis Colon Rectum, 1996. 39(3): p. 329-34.

8. Latoumerie, M., et al., Epidemiology and prognosis of synchronous colorectal cancers . Br J Surg, 2008. 95(12): p. 1528-33.

9. Johnson, C.D., et al., Accuracy of CT colonography for detection of large adenomas a nd cancers. N Engl J Med, 2008. 359(12): p. 1207-17.

10. Provenzale, D., et al., NCCN Guidelines Insights: Colorectal Cancer Screening, Versi on 1.2018. JNatl Compr Cane Netw, 2018. 16(8): p. 939-949.

11. Jung, G, et al., Epigenetics of colorectal cancer: biomarker and therapeutic potential. Nat Rev Gastroenterol Hepatol, 2020. 17(2): p. 111-130.

12. Heyn, H. and M. Esteller, DNA methylation profiling in the clinic: applications and ch allenges. Nat Rev Genet, 2012. 13(10): p. 679-92.

13. Dong, S., et al., Histone-Related Genes Are Hypermethylated in Lung Cancer and Hy permethylated HIST1H4F Could Serve as a Pan-Cancer Biomarker. Cancer Res, 2019 . 79(24): p. 6101-6112.

14. Diaz-Lagares, A., et al., A Novel Epigenetic Signature for Early Diagnosis in Lung Ca ncer. Clin Cancer Res, 2016. 22(13): p. 3361-71.

15. Roy, R., et al., A comprehensive methylation signature identifies lymph node metastas is in esophageal squamous cell carcinoma. Int J Cancer, 2019. 144(5): p. 1160-1169.

16. Qiu, J., et al., CpG Methylation Signature Predicts Recurrence in Early-Stage Hepatoc ellular Carcinoma: Results From a Multicenter Study. J Clin Oncol, 2017. 35(7): p. 73 4-742. Nosho, K., et al., A prospective cohort study shows unique epigenetic, genetic, and pr ognostic features of synchronous colorectal cancers. Gastroenterology, 2009. 137(5): p. 1609-20.el-3. de Macedo, M.P., et al., RAS mutations vary between lesions in synchronous primary colorectal cancer: testing only one lesion is not sufficient to guide anti-EGFR treatmen t decisions. Oncoscience, 2015. 2(2): p. 125-30. Lawes, D.A., et al., The role of MLH1, MSH2 and MSH6 in the development of multi pie colorectal cancers. Br J Cancer, 2005. 93(4): p. 472-7. Leggett, B.A. and D.L. Worthley, Synchronous colorectal cancer: not just bad luck? G astroenterology, 2009. 137(5): p. 1559-62. Dykes, S.L., et al., Evidence of a preferred molecular pathway in patients with synchr onous colorectal cancer. Cancer, 2003. 98(1): p. 48-54. Boland, C.R. and A. Goel, Microsatellite instability in colorectal cancer. Gastroenterol ogy, 2010. 138(6): p. 2073-2087.e3. Lao, V.V. and W.M. Grady, Epigenetics and colorectal cancer. Nat Rev Gastroenterol Hepatol, 2011. 8(12): p. 686-700. Perea, J., et al., Redefining synchronous colorectal cancers based on tumor clonality. I nt J Cancer, 2019. 144(7): p. 1596-1608. Moran, S., C. Arribas, and M. Esteller, Validation of a DNA methylation microarray f or 850,000 CpG sites of the human genome enriched in enhancer sequences. Epigeno mics, 2016. 8(3): p. 389-99. Eads, C. A., et al., MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res, 2000. 28(8): p. E32. Friedrich, M.G., et al., Detection of methylated apoptosis-associated genes in urine se diments of bladder cancer patients. Clin Cancer Res, 2004. 10(22): p. 7457-65. Cereda, M., et al., Patients with genetically heterogeneous synchronous colorectal can cer carry rare damaging germline mutations in immune-related genes. Nat Commun, 2 016. 7: p. 12072. Hanninen, U. A., et al., Exome and immune cell score analyses reveal great variation w ithin synchronous primary colorectal cancers. Br J Cancer, 2019. 120(9): p. 922-930. Pajares, J. A. and J. Perea, Multiple primary colorectal cancer: Individual or familial pr edisposition? World J Gastrointest Oncol, 2015. 7(12): p. 434-44. Yang, J., J.Y. Peng, and W. Chen, Synchronous colorectal cancers: a review of clinica 1 features, diagnosis, treatment, and prognosis. Dig Surg, 2011. 28(5-6): p. 379-85. Fan, J., et al., Genome-wide DNA methylation profiles of low- and high-grade adeno ma reveals potential biomarkers for early detection of colorectal carcinoma. Clin Epig enetics, 2020. 12(1): p. 56. Luo, Y., et al., Differences in DNA methylation signatures reveal multiple pathways o f progression from adenoma to colorectal cancer. Gastroenterology, 2014. 147(2): p. 4 18-29.e8. Gallardo-Gomez, M., et al., A new approach to epigenome-wide discovery of non-inv asive methylation biomarkers for colorectal cancer screening in circulating cell-free D NA using pooled samples. Clin Epigenetics, 2018. 10: p. 53. Hotta, K., et al., Identification of differentially methylated region (DMR) networks ass ociated with progression of nonalcoholic fatty liver disease. Sci Rep, 2018. 8(1): p. 13 567. Lehmann- Werman, R., et al., Identification of tissue-specific cell death using methylat ion patterns of circulating DNA. Proc Natl Acad Sci U S A, 2016. 113(13): p. E1826- 34. Model, F., et al., Identification and validation of colorectal neoplasia-specific methyla tion markers for accurate classification of disease. Mol Cancer Res, 2007. 5(2): p. 153 -63. Church, T.R., et al., Prospective evaluation of methylated SEPT9 in plasma for detecti on of asymptomatic colorectal cancer. Gut, 2014. 63(2): p. 317-25. Lofton-Day, C., et al., DNA methylation biomarkers for blood-based colorectal cancer screening. Clin Chem, 2008. 54(2): p. 414-23. Tapial, S., et al., Cimp-Positive Status is More Representative in Multiple Colorectal Cancers than in Unique Primary Colorectal Cancers. Sci Rep, 2019. 9(1): p. 10516. Wang, X., et al., The molecular landscape of synchronous colorectal cancer reveals ge netic heterogeneity. Carcinogenesis, 2018. 39(5): p. 708-718. Thomas, V., et al., Personalised mapping of tumour development in synchronous colo rectal cancer patients. NPJ Genom Med, 2020. 5: p. 27. van Rooijen S, Carli F, Dalton S, Thomas G, Bojesen R, Le Guen M, et al. Multimoda 1 prehabilitation in colorectal cancer patients to improve functional capacity and red uce postoperative complications: the first international randomized controlled trial for multimodal prehabilitation. BMC Cancer. 2019;19(1):98.

INFORMAL SEQUENCE LISTING cg20275528, forward sequence:

TTT ATTT AGT C GG AGGT GAGGA A (SEQ ID NO:l) cg20275528, reverse sequence:

CTTTAACTCTCCCCGACGAC (SEQ ID NO:2) cg20275528, probe:

CCCGCTTAAACCCGACAACGAAATAAA (SEQ ID NO:3) cg03578926, forward sequence:

GCGGGATGACGTTTAGGTAG (SEQ ID NO: 4) cg03578926, reverse sequence: CCGACGATATACGACAAACAAA (SEQ ID NO:5) cg03578926, probe:

CCACAATCATCTAACGAACCCACAATACG (SEQ ID NO:6) cg22084339, forward sequence:

GT GGGTTTT AGGT C GGTTTT (SEQ ID NO:7)

[0001] cg22084339, reverse sequence: TCCCGTAATCCTCGAAAACTA (SEQ ID NO: 8) cg22084339, probe:

AAACTATCTACCGTCCTACAAATCCTTCC (SEQ ID NO:9) cg27332938, forward sequence: GGAGTAAATATTTTCGTGTAGCG (SEQ ID NO: 10) cg27332938, reverse sequence:

CCAAATAACCGACTACTACCAAA (SEQ ID NO:l 1) cg27332938, probe:

CCCTAAACGACTACGAACACCACTACC (SEQ ID NO: 12) cgl 0461088, forward sequence: CGGAGAGTTTATTTGATGAAGT (SEQ ID NO: 13) cgl0461088, reverse sequence:

GTACGATATTTTCTTATACATTAACTAT (SEQ ID NO: 14) cgl0461088, probe:

CCGAAATACACCGCTCCCTAAACG (SEQ ID NO: 15) cgl 1255039, forward sequence:

GGTATTCGTTTTGTTTAGGTCG (SEQ ID NO: 16) cgl 1255039, reverse sequence:

A A AC GAC GC GA A AT A AC GAC (SEQ ID NO: 17) cgl 1255039, probe:

ACTTCAACGACGACGATCTCAAATACTT (SEQ ID NO: 18) Beta-actin, forward sequence:

T GGT GAT GGAGGAGGTTT AGT AAGT (SEQ ID NO: 19) Beta-actin, reverse sequence:

AACCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 20) Beta-actin, probe:

ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO:21)

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A method of detecting a level of DNA methylation in a subj ect that has or is suspected of having a cancer, wherein the method comprises determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22.

2. The method of claim 1, wherein determining the methylation level the gene comprises determining the methylation level of a CpG site, and wherein the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, or cgl 1255039.

3. The method of claim 1 or claim 2, wherein the subject has or is suspected of having a colorectal cancer.

4. The method of anyone of claims 1-3, wherein the biological sample is a tissue sample.

5. The method of claim 4, wherein the tissue sample is a formalin fixed paraffin -embedded (FFPE) tissue sample.

6. The method of anyone of claims 1-3, wherein the biological sample is a bodily fluid.

7. The method of claim 6, wherein the bodily fluid is blood, urine, plasma or saliva.

8. The method of anyone of claims 1-7, wherein the level of DNA methylation of said gene is elevated relative to said standard control.

9. The method of claim 8, wherein said elevated level DNA methylation is indicative of the subject having synchronous cancer.

10. The method of claim 9, wherein the synchronous cancer is a synchronous colorectal cancer.

11. The method of claim 10, wherein the subj ect has synchronous colorectal cancer.

12. The method of anyone of claims 8-11, wherein the method further comprising treating said subject with surgery, anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

13. The method of claim 1, further comprising performing a diagnostic procedure on the subject.

14. The method of claim 13, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

15. The method of claim 14, where the diagnostic procedure is performed prior to said detecting of said level of DNA methylation.

16. The method of claim 15, wherein if the level of DNA methylation of said gene is elevated relative to said standard control, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

17. The method of anyone of claims 1-16, wherein an elevated methylation level of said gene is indicative of synchronous colorectal cancer.

18. A method of treating a subject who has or is suspected of having a synchronous cancer, the method comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22; and (ii) administering to the subject an effective amount of an anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

19. The method of claim 18, wherein determining the methylation level of said gene comprises determining the methylation level a CpG site within said gene, and wherein the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl 0461088, or cgl 1255039.

20. The method of claim 18 lor claim 19, wherein an elevated methylation level of said gene, relative to the standard control, is indicative of synchronous cancer.

21. The method of claim 20, wherein the synchronous cancer is a synchronous colorectal cancer.

22. The method of anyone of claims 18-20, further comprising performing a diagnostic procedure on the subject.

23. The method of claim 22, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

24. The method of claim 23, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

25. The method of claim 24, wherein if the level of DNA methylation of said gene is elevated relative to said standard control, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

26. The method of claim 25, wherein the presence of one or more colorectal lesions is indicative of synchronous colorectal cancer.

27. The method of anyone of claims 18-26, wherein the subject undergoes surgical removal of all or a portion of the cancer prior to or after detection of an elevated methylation level of said gene.

28. A method of detecting a synchronous cancer in a subject with cancer, the method comprising determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, and wherein an elevated methylation level of said gene relative to said standard control is indicative of synchronous cancer.

29. A method of diagnosing a subject having a cancer as having a synchronous cancer, the method comprising determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, and wherein the subject has a synchronous cancer if an elevated methylation level of said gene is detected in the biological sample.

30. The method of claim 28 or claim 29, wherein determining the methylation level of said gene comprises determining the methylation level of a CpG site within the gene, and wherein the CpG site is cg20275528, cg03578926, cg22084339, cg27332938, cgl0461088, or cgl 1255039.

31. The method of anyone of claims 28-30, wherein the subject has colorectal cancer.

32. The method of anyone of claims 28-31, wherein the biological sample is a tissue sample.

33. The method of claim 32, wherein the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

34. The method of anyone of claims 28-31, wherein the biological sample is a bodily fluid.

35. The method of claim 34, wherein the bodily fluid is blood, urine, plasma or saliva.

36. The method of anyone of claims 28-35, wherein an elevated methylation level of said gene relative to said standard control is indicative of synchronous cancer.

37. The method of claim 36, wherein the synchronous cancer is a synchronous colorectal cancer.

38. The method of claim 37, further comprising treating the subject with surgery, an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

39. The method of anyone of claims 28-38, wherein the subject undergoes surgical removal of all or a portion of the cancer prior to or after detection of an elevated methylation level of said gene.

40. The method of anyone of claims 28-39, further comprising performing a diagnostic procedure on the subject.

41. The method of claim 40, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

42. The method of claim 41, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

43. The method of claim 42, wherein if the level of DNA methylation of said gene is elevated relative to said standard control, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

44. The method of claim 43, wherein the presence of colorectal lesions is indicative of synchronous colorectal cancer.

45. A method of monitoring a subject having cancer for synchronous cancer, the method comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22, at a first time point; and (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B,

ZNF511, ARFGAP2, or KIF22, at a second time point later than the first time point.

46. The method of claim 45, wherein the monitoring further comprises performing a diagnostic procedure on the subject.

47. The method of claim 46, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

48. The method of claim 47, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

49. The method of claim 48, wherein if the level of DNA methylation of said gene at the second time point is elevated relative to the level of DNA methylation of said gene at the first time point, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

50. The method of claim 49, wherein the presence of colorectal lesions is indicative of synchronous colorectal cancer.

51. The method of claim 50, wherein the subject with no elevated level of DNA methylation of said gene at the second time point is monitored every 3 to 6 months for two years therefrom, and thereafter every six months for three additional years.

52. The method of claim 45, wherein detection of an elevated methylation level of said gene at the second time point indicates that the subject has an increased risk of developing a synchronous cancer.

53. The method of claim 52, wherein if an elevated methylation level of said gene is detected at the second time point compared to the methylation level oof said gene at the first time point, the method further comprises treating the subject with surgery, an anticancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy.

54. The method of claim 54, wherein the subject undergoes surgical removal of all or a portion of the cancer prior to or after detection of an elevated methylation level of said gene.

55. The method of anyone of claims 45-54, wherein the biological sample is a tissue sample.

56. The method of claim 55, wherein the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

57. The method of anyone of claims 45-56, wherein the biological sample is a bodily fluid.

58. The method of claim 57, wherein the bodily fluid is blood, urine, plasma or saliva.

59. A method of monitoring a subject having cancer for synchronous cancer and treating synchronous cancer, the method comprising: (i) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, or KIF22 at a first time point; (ii) determining a methylation level, relative to a standard control, of a gene in a biological sample obtained from the subject, wherein the gene is SEPT9, SHANK2, PRKAR1B, ZNF511 , ARFGAP2, or KIF22 at a second time point later than the first time point; and (iii) treating the subject with surgery, an anti cancer agent, radiation therapy, chemotherapy, targeted therapy, immunotherapy, hormonal therapy, angiogenesis inhibitor administration therapy, or synthetic lethality therapy, if the methylation level of said gene at the second time point is elevated relative to the methylation level of said gene at the first time point.

60. The method of claim 59, wherein detection of an elevated methylation level of said gene at the second time point compared to the methylation level of said gene at the first time point indicates that the subject has an increased risk of developing a synchronous cancer.

61. The method of claim 60 or claim 61, wherein the monitoring further comprises performing a diagnostic procedure on the subject.

62. The method of claim 61, wherein the diagnostic procedure is a colonoscopy, a CT scan, an MRI, a PET scan, a blood test or a fecal test.

63. The method of claim 62, where the diagnostic procedure is performed prior to said determining of said level of DNA methylation.

64. The method of claim 63, wherein if the level of DNA methylation of said gene at the second time point is elevated relative to the level of DNA methylation of said gene at the first time point, the method further comprises reviewing the results of said diagnostic procedure to determine whether said subject has a synchronous cancer.

65. The method of claim 64, wherein the presence of colorectal lesions is indicative of synchronous colorectal cancer.

66. The method of claim 59, wherein the subject with no elevated level of DNA methylation of said gene at the second time point is monitored every 3 to 6 months for two years therefrom, and thereafter every six months for three additional years.

67. The method of anyone of claims 59-66, wherein the biological sample is a tissue sample.

68. The method of claim 67, wherein the tissue sample is a formalin fixed paraffin-embedded (FFPE) tissue sample.

69. The method of anyone of claims 59-66, wherein the biological sample is a bodily fluid.

70. The method of claim 69, wherein the bodily fluid is blood, urine, plasma or saliva.

71. A kit comprising reagents for detection and measurement of DNA methylation of one or more genes in a biological sample, wherein the one or more genes are

72. SEPT9, SHANK2, PRKAR1B, ZNF511, ARFGAP2, and KIF22.