WO2022245301A2 - De novo biosynthesis of glycosylated carotenoids - Google Patents

Abstract

The present invention relates to host cells comprising genes of the mevalonate, lycopene and carotenoid pathways, methods of producing glycosylated carotenoids, as well as kits for producing glycosylated carotenoids comprising the host cells.

Description

DE NOVO BIOSYNTHESIS OF GLYCOSYLATED CAROTENOIDS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of Singapore application No. 10202105409U, filed 21 May 2021, the contents of it being hereby incorporated by reference in its entirety for all purposes.

FIELD OF THE INVENTION

[0002] The invention is in the field of biotechnology. In particular, the invention pertains to the methods for the biosynthesis of glycosylated carotenoids and the optimization thereof.

BACKGROUND OF THE INVENTION

[0003] Carotenoids are natural pigments widely distributed in plants, animals, algae and microbes. Structurally, carotenoids consist of an electron-rich polyene chain with nine or more conjugated double bonds which contribute primarily to the photo-protection, light-harvesting and antioxidant properties including quenching free radicals, singlet oxygen and vivid colours. The carotenoids have important functions in photosynthesis, and photoprotection in photo synthetic organisms as well as non-photosynthetic organisms in bacteria, archaea and fungi, and modulating membrane fluidity in cells. The structural and functional diversity of the carotenoids have allowed carotenoids to have a wide range of industrial applications including food, feed, cosmetic, nutraceuticals and pharmaceuticals.

[0004] Most naturally occurring carotenoids are lipophilic and insoluble in water, and the hydrophobicity of the carotenoids has limited their applications in medicine and food. Despite attempts to utilize chemical approaches in increasing the hydrophilicity of the carotenoids in the conversion of carotenoids to salts of carotenoid esters, or forming carotenoid-cyclodextrin complex, the method of chemical synthesis of carotenoids is far from efficient. An alternative natural way is to utilize glycosylation of carotenoids by glycosyltransferase which catalyzes a hydroxyl group of lipophilic substrates as the substituent moiety. This process of glycosylation is advantageous as glycosylated carotenoids possess various properties including structural diversity and improved water solubility, bioavailability, efficacy, photo stability and biological activities. Although there are reports demonstrating biosynthesis of carotenoid glucosides in Escherichia coli and various natural microbial producers, the yield of the carotenoids is low and insufficient for industrial applications. The inability to produce carotenoids at high levels presents a significant hurdle to the current situation.

[0005] Therefore, there is a need for the identification of new methods of glycosylated carotenoids biosynthesis that produce higher yields of carotenoids.

SUMMARY

[0006] In one aspect, there is provided a host cell comprising a polynucleotide sequence encoding one or more genes of the mevalonate pathway; one or more genes of the lycopene pathway; and one or more genes of the carotenoid pathway.

[0007] In another aspect, there is provided a method of producing one or more glycosylated carotenoids comprising culturing the host cell as described herein in a culture medium.

[0008] In another aspect, there is provided a kit for producing glycosylated carotenoids, wherein the kit comprises the host cell as described herein with instructions for use.

DEFINITIONS

[0009] As used herein, the term “carotenoid” refers to a class of pigments synthesized by plants, animals, algae and microbes. Carotenoids have structures of an electron-rich polyene chain with nine or more conjugated bonds and possess photo-protection, light-harvesting and anti-oxidant properties.

[0010] As used herein, the term “glycosylated carotenoids” refers to carotenoids that are glycosylated by glycosyltransferases which belong to a large enzyme family. The process of glycosylation refers to the enzymatic modification of a molecule by the addition of one or multiple carbohydrate/glycosyl groups to the existing molecule. Glycosylated carotenoids are more soluble in water relative to carotenoids that are not glycosylated.

[0011] As used herein, the term “variant” refers to a modification in the DNA sequence. The modification in the DNA sequence includes mutation, truncation, translocation, substitution, deletion and insertion, resulting in the alteration of the activity of the gene.

[0012] The term “promoter” as used herein refers to a region of the DNA that initiates transcription of a gene. The region of the DNA is typically located near the transcription start site of a gene and upstream on the DNA. A promoter may be inducible or non-inducible. The term “inducible promoter” as used herein refers to a promoter that can be regulated in the response to specific stimuli, also known as inducers. The promoter system may be modified to be inducible. Examples of inducible promoter systems in include the Tet-on system, Tet-off system, T7 system, Trp system, Tac system, lambda cI857-PL system, bacterial EL222 system and Lac system. A promoter may also be a constitutive promoter which is a promoter that is always active.

[0013] The term “ribosomal binding site” as used herein in the context of the application refers to a site of an mRNA molecule which recruits and binds the ribosome, allowing the selection of the proper initiation codon during the initiation of translation. The ribosomal binding site controls the accuracy and efficiency of the initiation of mRNA translation.

[0014] As used herein, the term “about”, in the context of concentrations of components and percentages of compounds, typically refers to +/- 5% of the stated value, +/- 4% of the stated value, more typically +/- 3% of the stated value, more typically, +/- 2% of the stated value, even more typically +/- 1% of the stated value, and even more typically +/- 0.5% of the stated value. Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0016] Fig. 1 shows the biosynthetic pathway of carotenoid glucosides. The biosynthetic pathway consists of module 1 AHT, including atoB, hmgS and thmgR; module 2 MPPI, including mevk, pmk, pmd and idi; module 3 EBIA, including crtEBI and ispA ; and module 4 YZX or YZWX, including crtYZX or crtYZWX. Dashed arrow indicates multiple enzymatic steps. The glycosylation of all carotenoids required UDP-glucose (UDP-glc), here zeaxanthin glucosides are used as representatives. The genes expressed encode the following enzymes: crtY, lycopene beta-cyclase; crtW, b-carotene ketolase; crtZ, b-carotene hydroxylase; crtX, zeaxanthin glucosyltransferase (ZGT). Thicker and thinner arrows represent the higher and lower carbon flux, respectively; grey arrows represent that the metabolites (e.g., b- cryptoxanthin-β-D-glucoside and 3'-hydroxyechinenone-β-D-glucoside) were not detected in our strains.

[0017] Fig. 2 depicts the production of zeaxanthin glucosides. Fig. 2A shows the LC/MS chromatograms of zeaxanthin strains with and without the expression of crtX. Fig. 2B shows the mass spectra of zeaxanthin and its glucosides. Fig. 2C shows the water solutions of zeaxanthin and zeaxanthin glucosides.

[0018] Fig. 3 shows the tuning the translation of zeaxanthin glucosyltransferase. Fig. 3A shows the carotenoid contents of zeaxanthin glucoside strains. Fig. 3B shows the ODeoo of different strains. Error bars, mean ± s.d., n = 3. Fig. 3C shows different RBSs used for crtX and their relative strengths. Fig. 3D shows correlation between the glycosylation efficiency of zeaxanthin and the RBS strength of crtX. The glycosylation efficiency is defined as the percentage of zeaxanthin diglucoside yield to the total yield of zeaxanthin and its two glucosides.

[0019] Fig. 4 shows the effects of carbon sources on the production of zeaxanthin glucosides. Fig. 4A shows the carotenoid contents and OD600 of strain XI by comparison of different carbon sources: 10 g/L glucose, 10 g/L glycerol and their mixture, 5 g/L glucose + 5 g/L glycerol (glc+gly). Fig. 4B shows that carotenoid contents and OD600 of strains XI and “+crtY” by optimizing the concentrations of glucose and introduction of additional copies of crtY. Error bars, mean ± s.d., n = 2.

[0020] Fig. 5 shows the structural similarity between membrane and carotenoid diglucosides and its biological benefits. Fig. 5A shows the comparison between zeaxanthin and zeaxanthin glucosides strains. Fig. 5B shows the structural similarity between phospholipid bilayers and zeaxanthin diglucoside. Fig.5C shows the carotenoid distribution between cytosol and membrane.

[0021] Fig. 6 shows production of astaxanthin glucosides and other carotenoids. Fig. 6A shows the content sums of glycosylated and unglycosylated carotenoids in different strains. Fig. 6B shows carotenoid contents produced in different strains. Dark grey: 0.03 mM IPTG; light grey: 0.1 mM IPTG. ‘ Ast strain is the parental astaxanthin strain without expressing crtX. ‘GA01 is the control strain with the highest RBS strength of crtZ. Fig. 6C shows mass spectra of astaxanthin and its glucosides.

[0022] Fig. 7 shows the mass spectra of various carotenoids detected.

[0023] Fig. 8 shows the UPLC chromatograms of UV and extracted-ion monitoring.

[0024] Fig. 9 shows LC/MS chromatograms of various carotenoids. 3 '-hydroxy echinenone,β-cryptoxanthin-β-D-glucoside and 3'-hydroxyechinenone-P-D-glucoside were not detected (n.d.) in none of the nine strains GA01-09.

[0025] Fig. 10 shows the correction of RBS strength with the yields of different carotenoids and OD600.

DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0026] In a first aspect, the present invention refers to a host cell comprising a polynucleotide sequence encoding one or more genes of the mevalonate pathway; one or more genes of the lycopene pathway; and one or more genes of the carotenoid pathway.

[0027] In some examples, the polynucleotide sequences encoding the one or more genes of the mevalonate pathway, lycopene pathway and carotenoid pathway may be encoded on one or more vectors. For example, the polynucleotide sequences may be encoded on one vector, two vectors, three vectors, four vectors, five vectors or six vectors. It will be appreciated by a person skilled in the art that the one or more genes of the mevalonate pathway, lycopene pathway and the carotenoid pathways can be in one or more vectors in different combinations. In one example, the one or more genes of the mevalonate pathway may be encoded on one vector, the one or more genes of the lycopene pathway may be encoded on another vector and the one or more genes of the carotenoid pathway may be encoded on yet another vector. In another example, the one or more genes of the mevalonate pathway may be encoded on two vectors, the one or more genes of the lycopene pathway may be encoded on another vector, and the one or more genes of the carotenoid pathway are encoded on yet another vector. In another example, the one or more genes of the mevalonate pathway and the carotenoid pathway may be encoded on one vector and the one or more genes of the lycopene pathway may be encoded on another vector. In yet another example, the one or more genes of the carotenoid pathway and the lycopene pathway may be encoded on one vector and the one or more genes of the mevalonate pathway may be encoded on another vector, or another two vectors. It will also be appreciated by a person skilled in the art that where there are more than one genes of a pathway and these can be encoded on separate vectors in combination with one or more genes from another pathway.

[0028] In other examples, the one or more genes of the mevalonate pathway, one or more genes of the lycopene pathway and one or more genes of the carotenoid pathway may be inserted into the genome of the host cell. It will generally be understood that genes may be inserted into the genome of a host cell at any location that allows the expression of the inserted genes. Genes may be inserted together with genetic elements that allow or improve expression of the inserted genes. Genome integration of genes may be performed by conventional means known in the art.

[0029] The one or more genes of the mevalonate pathway, the lycopene pathway and the carotenoid pathway may be inserted into the genome of the host cell in different combinations and at different locations.

[0030] In some examples, the one or more genes of the mevalonate pathway, one or more genes of the lycopene pathway and one or more genes of the carotenoid pathway are encoded on one or more vectors. In other examples, the one or more genes of the mevalonate pathway, one or more genes of the lycopene pathway and one or more genes of the carotenoid pathway are integrated into the genome of the host cell. In yet other examples, the one or more genes of the mevalonate pathway, one or more genes of the lycopene pathway and one or more genes of the carotenoid pathway are encoded on a combination of one or more vectors and integrated into the genome.

[0031] In one example, the one or more genes of the mevalonate pathway may be encoded in the one or more vectors while the one or more genes of the lycopene pathway and the one or more genes of the carotenoid pathway may be inserted in the genome of the host cell. In another example, the one or more genes of the carotenoid pathway and the one or more genes of the lycopene pathway may be encoded in one or more vectors of the host cell while the one or more genes of the mevalonate pathway and the one or more genes of carotenoid pathway may be inserted into the genome of the host cell. In yet another example, the one or more genes of the lycopene pathway may be encoded in one or more vectors of the host cell while the one or more genes of the mevalonate pathway, the one or more genes of the carotenoid pathway and the one or more genes of the lycopene pathway are inserted into the genome of the host cell. It will generally be understood that the examples provided in the foregoing are not exhaustive and different combinations would be acceptable.

[0032] In one example, the one or more genes of the mevalonate pathway is selected from the group consisting of acetoacetyl-CoA thiolase ( atoB ), HMG-CoA synthase ( hmgS ), HMG- CoA reductase ( hmgR ), mevalonate kinase (nevk), phosphomevalonate kinase (pmk ), mevalonate pyrophosphate decarboxylase (pmd ) and isopentenyl diphosphate (IPP) isomerase (idi), the one or more genes of the lycopene pathway is selected from the group consisting of farnesyl pyrophosphate synthase (FPP) synthase ( ispA ), geranylgeranyl pyrophosphate (GGPP) synthase ( crtE ), phytoene synthase ( crtB ) and phytoene desaturase (crtP), and the one or more genes of the carotenoid pathway is selected from the group consisting of b-carotene ketolase ( crtW ), lycopene b-cyclase ( crtY ), b-carotene hydroxylase ( crtZ ) and zeaxanthin glucosyltransferase ( crtX ).

[0033] In one example, the one or more genes of the mevalonate pathway, the lycopene pathway and the carotenoid pathway are isolated from bacterium or yeast. In one example, the one or more genes of the mevalonate pathway, the lycopene pathway and the carotenoid pathway may be isolated from a bacterium selected from the group consisting of Escherichia coli, Pantoea agglomerans, Pantoea ananatis, uncultured marine bacterium HF10_19P19, Sulfolobus solfataricus, Anabaena variabilis and Brevundimonas sp. In one example, the one or more genes of the mevalonate pathway, the lycopene pathway and the carotenoid pathway may be isolated a yeast selected from the group consisting of Saccharomyces cerevisiae , Yarrowia lipolytica, Rhodosporidium toruloides, Candida and Pichia.

[0034] The one or more genes of the mevalonate pathway may be isolated from Escherichia coli and Saccharomyces cerevisiae. The Escherichia coli strain may be but not limited to K-12 substrain (substr.) MG1655. In one example, the atoB and idi genes of the mevalonate pathway are isolated from Escherichia coli K-12 substr. MG1655. In one example, the hmgS, hmgR, mevK, pmK and pmd genes of the mevalonate pathway are isolated from Saccharomyces cerevisiae. The one or more genes of the lycopene pathway may be isolated from Pantoea agglomerans and Escherichia coli. The Escherichia coli strain may be but not limited to K-12 substr. MG1655. In one example, the crtE, crtB and crtl genes may be isolated from Pantoea agglomerans. In one example, the ispA gene may be isolated from Escherichia coli K-12 substr. MG1655. The one or more genes of the carotenoid pathway may be isolated from a bacterium selected from the group consisting of Anabaena variabilis, Brevundimonas sp., Pantoea ananatis, uncultured marine bacterium and Sulfolobus solfataricus . The Anabaena variabilis strain may be but not limited to Anabaena variabilis ATCC 29413. The Brevundimonas sp. strain may be but not limited to Brevundimonas sp. SD212. The Pantoea ananatis strain may be but not limited to Pantoea ananatis LMG20103. The uncultured marine bacterium strain may be but not limited to uncultured marine bacterium HF10_19P19. The Sulfolobus solfataricus strain may be but not limited to Sulfolobus solfataricus P2. In one example, the crtW gene of the carotenoid pathway is isolated from Anabaena variabilis ATCC 29413 or Brevundimonas sp. SD212. In one example, the crtX gene of the carotenoid pathway is isolated from Pantoea ananatis LMG20103. In one example, the crtY gene of the carotenoid pathway is isolated from Pantoea ananatis LMG20103 or uncultured marine bacterium HF10_19P19. In one example, the crtZ gene of the carotenoid pathway is isolated from Sulfolobus solfataricus P2 or Pantoea ananatis LMG20103.

[0035] In one example, the polynucleotide sequence encoding atoB gene is SEQ ID NO: 19. In one example, the polynucleotide sequence encoding hmgS gene is SEQ ID NO: 18. In one example, the polynucleotide sequence encoding hmgR gene is SEQ ID NO: 20. In one example, the polynucleotide sequence encoding mevK gene is SEQ ID NO: 21. In one example, the polynucleotide sequence encoding pmk gene is SEQ ID NO: 22. In one example, the polynucleotide sequence encoding pmd gene is SEQ ID NO: 23. In one example, the polynucleotide sequence encoding idi gene is SEQ ID NO: 24. In one example, the polynucleotide sequence encoding crtE gene is SEQ ID NO: 25. In one example, the polynucleotide sequence encoding crtB gene is SEQ ID NO: 26. In one example, the polynucleotide sequence encoding crtl gene is SEQ ID NO: 27. In one example, the polynucleotide sequence encoding ispA gene is SEQ ID NO: 28. In one example, the polynucleotide sequence encoding crtW gene is SEQ ID NO: 29 or SEQ ID NO: 30. In one example, the polynucleotide sequence encoding crtX gene is SEQ ID NO: 31. In one example, the polynucleotide sequence encoding crtY gene is SEQ ID NO: 32 or SEQ ID NO: 33. In one example, the polynucleotide sequence encoding crtZ gene is SEQ ID NO: 34 or SEQ ID NO: 35.

[0036] In one example, the one or more genes of the mevalonate pathway, lycopene pathway and the carotenoid pathway may be modified. The modification of the one or more genes may comprise mutation, truncation, translocation, substitution, deletion and insertion to improve the expression levels. The codon of one or more genes of the mevalonate pathway, lycopene pathway and the carotenoid pathway may be optimized for Escherichia coli. In one example, the hmgR gene of the mevalonate pathway may be truncated. In one example, the polypeptide sequence encoding the truncated hmgR is SEQ ID NO: 1 and the polynucleotide sequence encoding the truncated hmgR gene is SEQ ID NO: 20.

[0037] In one example, the one or more genes of the mevalonate pathway, the lycopene pathway and the carotenoid pathway are located on four vectors.

[0038] In one example, the host cell comprises a) a first vector comprising a polynucleotide sequence encoding atoB, hmgS and truncated hmgR genes of the mevalonate pathway; b) a second vector comprising a polynucleotide sequence encoding mevk, pmk, pmd and idi genes of the mevalonate pathway; c) a third vector comprising a polynucleotide sequence encoding ispA, crtE, crtB and crtl genes of the lycopene pathway; and d) a fourth vector comprising a polynucleotide sequence encoding crtY, crtZ and crtX genes of the carotenoid pathway.

[0039] In one example, the host cell comprises a) a first vector comprising a polynucleotide sequence encoding atoB, hmgS and truncated hmgR genes of the mevalonate pathway; b) a second vector comprising a polynucleotide sequence encoding mevk, pmk, pmd, idi genes of the mevalonate pathway; c) a third vector comprising a polynucleotide sequence encoding ispA, crtE, crtB and crtl genes of the lycopene pathway; and d) a fourth vector comprising a polynucleotide sequence encoding crtW, crtY, crtZ and crtX genes of the carotenoid pathway.

[0040] In some examples, one or more of the vectors may comprise one or more additional copies of a gene from the mevalonate, lycopene or carotenoid pathways. For example, the host cell may comprise an additional copy of the crtY gene. The additional copy of the crtY gene may be encoded on one or more vectors of the host cell or inserted into the genome of the host cell. In one example, the additional copy of the crtY gene is located on the first vector.

[0041] The polynucleotides sequences in the one or more vectors would be understood to be operably linked to a promoter. It would generally be understood that any promoter that allows expression of the polynucleotide sequence may be employed. Examples of promoters include but are not limited to the T7 RNA polymerase promoter, the lac promoter, araBAD promoter, tac promoter, lambda cI857-PL promoter and the T5 promoter.

[0042] In some examples, the promoter may be an inducible promoter. In one example, the promoter may be naturally inducible. In one example, the promoter may be engineered to be inducible. It will be appreciated that any suitable inducible promoter system may be used. Inducible promoter systems may be induced by an inducer or stimuli including but not limited to chemical inducers, light or heat.

[0043] In one example, the polynucleotide sequence is operably linked to an inducible promoter in one or more vectors and operably linked to an uninducible promoter in the other vectors. For example, the polynucleotide sequence is operably linked to an inducible promoter in each of the vectors. In another example, the polynucleotide sequence is operably linked to an inducible promoter in two vectors and the polynucleotide sequence is operably linked to an uninducible promoter in the other vectors.

[0044] In one example, the polynucleotide sequence in each of the vectors is operably linked to an inducible promoter. In one example, the inducible promoter is a wild-type T7 RNA polymerase promoter or a variant of the wild-type T7 RNA polymerase promoter. The variant of the wild-type T7 RNA polymerase promoter may be generated via mutations to the wild- type promoter. In another example, the T7 RNA polymerase promoter variant is selected from the group consisting of TM1, TM2, TM3, TV1, TV2, TV3 and TV4. In one example, the polynucleotide sequence encoding wild-type T7 RNA polymerase promoter is SEQ ID NO: 36. In one example, the polynucleotide encoding the TM1 promoter is SEQ ID NO: 37. In one example, the polynucleotide encoding the TM2 promoter is SEQ ID NO: 38. In one example, the polynucleotide encoding the TM3 promoter is SEQ ID NO: 39. In one example, the polynucleotide sequence encoding the TV1 promoter is SEQ ID NO: 40. In one example, the polynucleotide sequence encoding the TV2 promoter is SEQ ID NO: 41. In one example, the polynucleotide sequence encoding the TV3 promoter is SEQ ID NO: 42. In one example, the polynucleotide sequence encoding the TV4 promoter is SEQ ID NO: 43.

[0045] The inducible promoter in each of the vectors may be independently selected from the wild-type T7 RNA polymerase promoter or variants. In one example, the inducible promoter in each of the vectors may be the wild-type T7 RNA polymerase promoter. In another example, the inducible promoter in each of the vectors may be the same T7 RNA polymerase promoter variant. In yet another example, the inducible promoter in each of the vectors may be different or combinations of the wild-type T7 RNA polymerase promoter and variants.

[0046] In one example, the inducible promoter in the first vector comprising the polynucleotide sequence encoding atoB, hmgS and truncated hmgR genes of the mevalonate pathway in the host cell as described herein is TM1, the inducible promoter in the second vector comprising the polynucleotide sequence encoding mevk, pmk, pmd and idi genes of the mevalonate pathway in the host cell as described herein is TM2, the inducible promoter in the third vector comprising the polynucleotide sequence encoding ispA, crtE, crtB and crtl genes of the lycopene pathway in the host cell as described herein is TM1 and the inducible promoter in the fourth vector comprising a polynucleotide sequence encoding the genes of the carotenoid pathway in the host cell as described herein is a TM1 or a wild-type T7 RNA polymerase promoter. In one example, the inducible promoter in the first vector comprising the polynucleotide sequence encoding atoB, hmgS and truncated hmgR genes of the mevalonate pathway in the host cell as described herein is TM3, the inducible promoter in the second vector comprising the polynucleotide sequence encoding mevk , pmk , pmd and idi genes of the mevalonate pathway in the host cell as described herein is TM2, the inducible promoter in the third vector comprising the polynucleotide sequence encoding ispA, crtE, crtB and crtl genes of the lycopene pathway in the host cell as described herein is TM2 and the inducible promoter in the fourth vector comprising a polynucleotide sequence encoding the genes of the carotenoid pathway in the host cell as described herein is a TM1 or a wild-type T7 RNA polymerase promoter. In one preferred example, the inducible promoter in the first vector comprising the polynucleotide sequence encoding atoB , hmgS and truncated hmgR genes of the mevalonate pathway in the host cell as described herein is TM3, the inducible promoter in the second vector comprising the polynucleotide sequence encoding mevk , pmk , pmd and idi genes of the mevalonate pathway in the host cell as described herein is TM2, the inducible promoter in the third vector comprising the polynucleotide sequence encoding ispA , crtE , crtB and crtl genes of the lycopene pathway in the host cell as described herein is TM2 and the inducible promoter in the fourth vector comprising a polynucleotide sequence encoding the genes of the carotenoid pathway in the host cell as described herein is a TM1 or a wild-type T7 RNA polymerase promoter. It will generally be understood that apart from the examples provided herein, different combinations of inducible promoters may be used with each of the vectors of the invention. [0047] The inducer capable of inducing the inducible promoter operably linked to the polynucleotide sequence of each of the vectors may be lactose, galactose or isopropyl b-D-l- thiogalactopyranoside (IPTG). In a preferred example, the inducer is IPTG.

[0048] In one example, the concentration of the IPTG is between about 0.01 and about 0.2 mM. For example, the concentration of the IPTG may be about 0.01 mM, about 0.02 mM, 0.03 mM, about 0.04 mM, about 0.05 mM, about 0.06 mM, about 0.07 mM, about 0.08 mM, about 0.09 mM, about 0.1 mM, about 0.11 mM, about 0.12 mM, about 0.13 mM, about 0.14 mM, about 0.15 mM, about 0.16 mM, about 0.17 mM, about 0.18 mM, about 0.19, mM and about 0.2 mM. In one example, the concentration of IPTG is between about 0.03 mM and about 0.1 mM. In one example, the concentration of IPTG is between about 0.03 mM and about 0.06 mM. In a preferred example, the concentration of IPTG is about 0.03 mM.

[0049] The one or more vectors in the host cell as described herein may further comprise a polynucleotide sequence encoding a ribosomal binding site (RBS). Each vector in the host cell may further comprise the polynucleotide sequence encoding the RBS or some of vectors may further comprise the polynucleotide sequence encoding the RBS while the others do not. For example, each of the first and second vectors may further comprise the polynucleotide sequence encoding the RBS, and the polynucleotide sequence encoding the RBS is absent from the third and fourth vectors. In another example, the fourth vector may further comprise the polynucleotide sequence encoding the RBS while the first, second and third vectors do not. [0050] It will be appreciated by one of skill in the art that the sequence encoding the RBS may be optimized for translational efficiency and the strength of the RBS with respect to the polynucleotide sequence to be translated. Optimization of a RBS would generally be understood to involve modification of the polynucleotide sequence of the RBS. The RBS may be modified by substitution, deletion, insertion or combinations thereof of one or more nucleotide bases. The RBS may be modified using degenerate oligonucleotide bases.

[0051] The polynucleotide sequence encoding the RBS may be synthesized and inserted upstream of one or more genes located in one or more vectors. For example, the RBS may be synthesized and inserted upstream of two genes in two vectors. In another example, the polynucleotide sequence encoding the RBS may be synthesized and inserted upstream of one gene in one vector. The synthesis of the RBS is based on the modification of a reference sequence of the RBS. In one example, the polynucleotide reference sequence of the RBS may be but not limited to SEQ ID NO: 2 or SEQ ID NO: 3. In one example, the polynucleotide reference sequence of the RBS for crtX is SEQ ID NO: 2. In one example, the polynucleotide reference sequence of the RBS for crtZ is SEQ ID NO: 3.

[0052] In one example, the polynucleotide sequence encoding the RBS for crtX is modified with respect to the polynucleotide reference sequence template SEQ ID NO: 2. In another example, the polynucleotide sequence encoding the RBS for crtZ is modified with respect to the polynucleotide reference sequence template SEQ ID NO: 3.

[0053] The polynucleotide sequence encoding the modified RBS may be selected independently from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17. In one example, the polynucleotide sequence encoding the RBS is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 11 and SEQ ID NO: 13.

[0054] In a preferred example, the modified RBS for crtX is encoded by SEQ ID NO: 5.

[0055] In another preferred example, the modified RBS for crtZ is encoded by SEQ ID NO:

11 or SEQ ID NO: 13.

[0056] The one or more genes of the carotenoid pathway may be isolated from a bacterium selected from the group consisting of Pantoea ananatis, Anabaena variabilis, Brevundimonas sp., uncultured marine bacterium, Sulfolobus solfataricus, Pantoea Agglomerans, Paracoccus sp, Nostoc sp., Agrobacterium aurantiacum, Erwinia sp, Enterobacterales bacterium, Pseudescherichia vulneris, Consotaella salsifontis, Franconibacter pulveris. In one example, the crtW gene is isolated from Anabaena variabilis or Brevundimonas sp. In one example, the crtY gene is isolated from Pantoea ananatis or uncultured marine bacterium. In one example, crtZ gene is isolated from Sulfolobus solfataricus or Pantoea ananatis.

[0057] In one example, the crtX gene is isolated from a bacterium. In one example, the crtX gene is isolated from the bacterium selected from the group consisting of the genus Pseudomonas, Pantoea, Massilia, Mycobacteroides, Microcystis and Paracoccus. In one example, the bacterium is Pantoea ananatis. The polynucleotide sequence encoding crtX is SEQ ID NO: 31.

[0058] As described herein, the host cell may be a bacterial cell. The bacterial cell may be selected from the group consisting of the genus Escherichia, Pantoea, Bacillus, Corynebacterium, Paracoccus, Streptomyces and Synechococcus. In one example, the genus of the bacterial cell is Escherichia. In one example, the bacterial cell is Escherichia coli. [0059] The Escherichia coli strain may be selected from the group consisting of BL21 DE3 strain, K-12(RV308), K-12(HMS174), K-12 substr. MG1655, W strain (ATCC 9637), JM109(DE3), BW25113, JM109 DE3, Machl and any strain comprising T7 RNA polymerase gene. In one example, the Escherichia coli is a BL21 DE3 strain.

[0060] In one example, the host cell is an Escherichia coli cell that comprises: a) a first vector comprising a polynucleotide sequence encoding the atoB, hmgS and truncated hmgR genes of the mevalonate pathway and crtY gene of the carotenoid pathway operably linked to a TM3 promoter; b) a second vector comprising a polynucleotide sequence encoding the mevk, pmk, pmd and idi genes of the mevalonate pathway operably linked to a TM2 promoter; c) a third vector comprising a polynucleotide sequence encoding crtEBI and ispA genes of the lycopene pathway operably linked to a TM2 promoter; and d) a fourth vector comprising a polynucleotide sequence encoding crtY, crtZ and crtX operably linked to a T7 promoter or a TM1 promoter, and a polynucleotide sequence encoding a RBS, wherein the RBS is selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.

[0061] In another example, the host cell is an Escherichia coli that comprises: a) a first vector comprising a polynucleotide sequence encoding the atoB, hmgS and truncated hmgR genes of the mevalonate pathway operably linked to a TM3 promoter; b) a second vector comprising a polynucleotide sequence encoding the mevk, pmk, pmd and idi genes of the mevalonate pathway operably linked to a TM2 promoter; c) a third vector comprising a polynucleotide sequence encoding crtEBI and ispA genes of the lycopene pathway operably linked to a TM2 promoter; and d) a fourth vector comprising a polynucleotide sequence encoding crtY, crtZ, crtX and crtW, operably linked to a T7 promoter or a TM1 promoter, and a polynucleotide sequence ending a RBS, wherein the RBS is selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0062] In another aspect, there is provided a method of producing one or more glycosylated carotenoids comprising culturing the host cell as described herein in a culture medium.

[0063] The one or more glycosylated carotenoids may include but not limited to glycosylated zeaxanthin, glycosylated astaxanthin, glycosylated adonimbin, glycosylated b- cryptoxanthin, glycosylated 3' -hydroxy echinenone and glycosylated adonixanthin. In one example, glycosylated zeaxanthin may comprise zeaxanthin-P-D-glucoside and zeaxanthin-b- D-diglucoside. In one example, glycosylated astaxanthin may comprise astaxanthin-P-D- glucoside and astaxanthin-P-D-diglucoside. In one example, glycosylated adonirubin may comprise ado n i ru b i n - b - D-g 1 uco s i dc . In one example, glycosylated b-cryptoxanthin may comprise β-cryptoxanthin-β-D-glucoside. In one example, the glycosylated 3'- hydroxyechinenone may comprise 3'-hydroxyechinenone-β-D-glucoside. In one example, the glycosylated adonixanthin may comprise ado n i x an t h i n - b- D-g 1 uco s i dc and adonixanthin-P-D- diglucoside.-. Non-glycosylated carotenoids, also known as aglycones, may include but not limited to b-carotene, lycopene, echinenone, b-cryptoxanthin, canthaxanthin, 3'- hydroxyechinenone, zeaxanthin, adonirubin, adonixanthin and astaxanthin. In one example, the method may produce at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight and at least nine glycosylated carotenoids. In one example, the method may produce at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine and at least ten non-glycosylated carotenoids. The glycosylated carotenoids and non-glycosylated carotenoids may be produced together in the culture medium. For example, zeaxanthin-P-D-glucoside and astaxanthin-P-D-glucoside are produced. In another example, zeaxanthin-P-D-glucoside, zeaxanthin-β-D-diglucoside, astaxanthin-P-D-glucoside and astaxanthin-β-D-diglucoside. In another example, zeaxanthin- P-D-glucoside, zeaxanthin-P-D-diglucoside, astaxanthin-P-D-glucoside, astaxanthin-P-D- diglucoside, b-carotene, zeaxanthin and adonixanthin are produced. In yet another example, zeaxanthin-P-D-glucoside, astaxanthin-P-D-glucoside, astaxanthin-P-D-diglucoside, zeaxanthin, astaxanthin and adonirubin are produced. In one example, zeaxanthin-P-D- glucoside, adonimbin-β-D-glucoside, adonixanthin-β-D-glucoside, astaxanthin-P-D- glucoside, zeaxanthin-P-D-diglucoside, adonixanthin-β-D-diglucoside and astaxanthin-P-D- diglucoside are produced.

[0064] The glycosylated carotenoids are generally understood to be water-soluble, have increased biological activities and bioavailability while the unglycosylated carotenoids are generally understood to be not water-soluble or less water-soluble and have less biological activities and bioavailability compared to glycosylated carotenoids. The biological activities may comprise but are not limited to anti-oxidant activity. [0065] In one example, the method comprising culturing the host cell as described herein may produce at least two glycosylated carotenoids.

[0066] In a preferred example, the at least two glycosylated carotenoids are zeaxanthin-b- D-glucoside and zeaxanthin-P-D-diglucoside.

[0067] In another preferred example, the at least two glycosylated carotenoids are astaxanthin-P-D-glucoside and astaxanthin-P-D-diglucoside.

[0068] The method comprises the culturing of the host cell as described herein in a culture medium. The culture medium may comprise but not limited to components in the TB medium and the 2XPY medium. The components that may be added to the culture medium include antibiotics, inducers and carbon substrates.

[0069] The antibiotics may be supplemented in the culture medium at the beginning of the culturing process. The antibiotics may be added continuously throughout the culturing process. Examples of antibiotics that may be used include but are not limited to chloramphenicol, kanamycin, spectinomycin and ampicillin.

[0070] The inducer in the culture medium capable of inducing the inducible promoter may be galactose, lactose or isopropyl b-D-l-thiogalactopyranoside (IPTG). In a preferred example, the inducer is IPTG.

[0071] The inducer may be added in the culture medium at the beginning of the of the culturing process. The culture medium may be supplemented with the inducer when the host cell has grown to an optical density. The culture medium may be supplemented continuously to the culture medium throughout the culturing process.

[0072] The concentration of the IPTG is between about 0.01 and about 0.2 mM. The concentration of the IPTG may be about 0.01 mM, about 0.02 mM, about 0.03 mM, about 0.04 mM, about 0.05 mM, about 0.06 mM, about 0.07 mM, about 0.08 mM, about 0.09 mM, about 0.01 mM, about 0.1 mM, about 0.11 mM, about 0.12 mM, about 0.13 mM, about 0.14 mM, about 0.15 mM, about 0.16 mM, about 0.17 mM, about 0.18 mM, about 0.19, mM and about 0.2 mM. In one example, IPTG is supplemented to the culture medium at the concentration between about 0.03 mM and about 0.1 mM. In a preferred example, IPTG is supplemented to the culture medium at the concentration of about 0.03 mM.

[0073] The IPTG may be added to the culture medium when the host cell has grown to an optical density of about 0.1 to about 1.5. The optical density may be about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4 and about 1.5. In one example, the optical density is about 0.8.

[0074] The carbon substrates may be added to the culture medium at the start of the culturing process. The culture medium may be supplemented with the carbon substrates continuously throughout the process, when the host cell has been cultured to an optical density and when the host cell has been cultured for a fixed duration. In one example, the carbon substrates are added at the start of the culturing process.

[0075] In one example, the carbon substrates may be selected from the group consisting of glucose, glycerol, sucrose, lactose and the combinations thereof. In a preferred example, the carbon substrate is glucose.

[0076] In one example, the concentration of the glucose in the culture medium is between about 5 g/L and about 30 g/L. The concentration of glucose may be about 5 g/L, about 10 g/L, about 15 g/L, about 20 g/L, about 25 g/L and about 30 g/L. In one example, the concentration of glucose is between about 10 g/L and about 20 g/L. In a preferred example, the concentration of glucose is about 20 g/L.

[0077] In one example, the host cell as described herein is cultured in a culture medium comprising IPTG and glucose.

[0078] In one example, the more than about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% and about 90% of total carotenoids produced is glycosylated zeaxanthin. In one example, more about 50% of total carotenoids produced is glycosylated zeaxanthin. The glycosylated zeaxanthin may comprise but not limited to zeaxanthin-β-D-glucoside, zeaxanthin-β-D-diglucoside or both zeaxanthin-β-D-glucoside and zeaxanthin-β-D-diglucoside.

[0079] In one example, the yield of glycosylated zeaxanthin is at least 30 mg/L, at least 40 mg/L, at least 50 mg/L and at least 60 mg/L. In a preferred example, the yield of glycosylated zeaxanthin is at least 40 mg/L. In one example, the yield of zeaxanthin-β-D-glucoside is at least 30 mg/L and the yield of zeaxanthin-β-D-diglucoside is at least 16 mg/L.

[0080] The method comprising of culturing the host cell as described herein may produce glycosylated astaxanthin comprising more than about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% and about 90% of the total carotenoids. The method comprising of culturing the host cell as described herein may produce glycosylated astaxanthin comprising more than about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% and about 90% of the total glycosylated carotenoids. In one example, the glycosylated astaxanthin may comprise but limited to astaxanthin-β-D-glucoside, astaxanthin-β-D-diglucoside or both astaxanthin-β-D-glucoside and astaxanthin-β-D- diglucoside. In one example, more than about 15% of the total carotenoids produced is astaxanthin-β-D-glucoside. In one example, more than about 60% of the total glycosylated carotenoids produced is astaxanthin-β-D-glucoside.

[0081] In one example, the yield of glycosylated astaxanthin is at least 4 mg/L, at least 4.5 mg/L, at least 5.5 mg/L, at least 6 mg/L, at least 6.5 mg/L and at least 7 mg/L. In a preferred example, the yield of glycosylated astaxanthin is at least 5.5 mg/L.

[0082] In another aspect, there is provided a kit for producing glycosylated carotenoids, wherein the kit comprises the host cell as described herein with instructions for use.

[0083] In one example, the host cell is dissolved in solution or lyophilized. In another example, the host cell is preserved by deep freezing.

[0084] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred examples and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0085] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0086] Other examples are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

EXPERIMENTAL SECTION [0087] Non-limiting examples of the invention and comparative examples will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.

[0088] Materials and Methods

[0089] Strain and plasmid construction [0090] E. coli B121 DE3 strain was used in this study. The plasmids pl5A -spec-hmgS-atoB- hmgR (L2-8), pl5A -spec-crtY-hmgS-atoB-hmgR (L2-8) pl5A -cam-mevK-pmk-pmd-idi (L2- 5), pl5A -kan-crtEBI-ispA were designed. The zeaxanthin GT gene (crtX) from Pantoea ananatis was inserted in the operon of the plasmids pl5A-amp-crtYZ (L2-9) and pl5A-amp- crtYZW (L2-9) to obtain pl5A-amp-crtYZX and pl5A-amp-crtYZWX, respectively (Table 1). [0091] Table 1. Strain Nomenclature

[0092] Construction of RBS library

[0093] CrtZ and CrtX RBS library was created using the degenerate primer and followed by screening and sequencing validations, using a cloning method. Firstly, the degenerate primers were designed with targeted region in the RBS and PCR reactions were performed to generate and amplify the DNA fragments for both the inserts and vector. The PCR products of the inserts and vector were purified and mixed at a molar ratio of 1:1 to 10:1 and an aliquot of the reaction was used to transform the Escherichia Coli competent cells. For each transformation, ten to twenty colonies were selected randomly and inoculated in Luria Broth overnight. Subsequently, the plasmid DNA was extracted and collected, and the RBS region was confirmed by DNA sequencing. RBS strengths or translation efficiencies were predicted by RBS Calculator, version 2.0. The forward and reverse primers of the RBS used for CrtZ library are SEQ ID NO: 44 and SEQ ID NO: 45 respectively, and the forward and reverse primers of the RBS used for CrtX library are SEQ ID NO: 46 and SEQ ID NO: 47 respectively. [0094] Tube culture of the E. coli strains

[0095] The medium used was TB medium (20 g/L tryptone, 24 g/L Yeast extract, 17 mM KH2PO4, and 72 mM K2HPO4) and 2XPY medium (20 g/L Peptone, 10 g/L Yeast extract and 10 g/L NaCl), supplemented with 10 g/L glycerol or 10-20 g/L glucose or their mixture (5g/L glucose + 5 g/L glycerol), 50 mM 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid (HEPES). For strain optimization, the cells were grown in 1 mL of TB or 2XPY medium in 14 ml BD Falcon™ tube at 28 °C/250 rpm for 2-3 days. The cells were also grown in 50 mL culture in shaking flasks for validation of the carotenoid production. The cells were initially grown at 37 °C/250 rpm until OD600 reached -0.8, induced by 0.03-0.1 mM IPTG, and were subsequently grown at 28 °C for 2 days. The antibiotics (34 μg/ml chloramphenicol, 50 μg/ml kanamycin, 50 pg/ml spectinomycin and 100 pg/ml ampicillin) were supplemented in the culture to maintain the four plasmids.

[0096] Microscope imaging of E. coli cells

[0097] For microscopy assay, E. coli cells were directly sampled from cell cultures. Cell amount was normalized by OD600 and directly observed at 1000 magnitude using a Leica DM6000B microscope. Neither centrifuge nor washing steps was introduced to avoid perturbation of the cells.

[0098] Extraction and quantification of carotenoids

[0099] Total intracellular carotenoids were extracted from cellular pellets according to the acetone extraction method. Briefly, 10-50 pL bacterial culture (depending on the content of carotenoids in the cells) was collected and centrifuged. Cell pellets were washed with PBS and were resuspended in 20 pL of water, followed by addition of 180 pL of acetone and vigorous homogenization for 20 min. After 10 minutes of centrifugation at 14,000 g, the supernatant was collected and filtered using a PTFE, 0.45pm filter.

[00100] The separation of carotenoids from cytosol and cell membranes was done by cell lysis method. Briefly, cell pellets collected from lmL of culture were resuspended in 1ml lysis buffer (50mM Tris HC1 of pH 7.5, 200mM NaCl, 1 mg/ml lysozyme of pH 8) before 3x30 sec sonication at 4 °C (75% amplitude). The cell lysate was subsequently centrifugated for 10 minutes at 14,000 g. The supernatant containing the cytosol fraction of carotenoids and the pellet debris containing the membrane fraction were extracted separately with by lmL of extraction buffer (hexane: acetone: ethanol at 2:1:1 volumetric ratio).

[00101] Quantification of carotenoids

[00102] All the carotenoids were analysed by Agilent 1290 Infinity II UHPLC System coupled with Diode Array Detector (DAD) detector and 6230B TOF MS platform using a LC/MS method. Briefly, 1 μL of purified carotenoids in acetone was injected into the Agilent ZORBAX RRHD Eclipse Plus C18 2.1X50 mm, 1.8 um. Separation was carried out at a flow rate of 0.5 mL/min. The mobile phase and gradient used were as follows. The analysis started from 10% water (0.1% formic acid), 10% methanol (0.1% formic acid) and 80% acetonitrile (0.1% formic acid) and this condition was maintained for 2 min, followed by the increase in methanol from 10% to 90% and the decrease in water from 10% to 0 and acetonitrile from 80% to 10% within 0.1 min. The condition (90% methanol and 10% acetonitrile) was continued for 7 min. The whole analysis finished at 10 min. Mass spectrometry was operated to scan 100- 1100 m/z in ESI-positive mode with 4000 V capillary voltage. Nebulizer gas was supplied at 35 psig and dry gas flow was 10 L/min. Gas temperature was set at 325 °C. Shealth gas was set at 350 °C and 12 L/min. Retention time was determined with chemical standards or calculated based on chromatography profile for those carotenoids without standards.

[00103] Carotenoid concentrations were calculated based on the peak area of each compound extracted by their corresponding m/z value (Table 3) or UV absorbance at 450 nm (Fig. 8). Standard curves were generated for the five chemical standards with extracted-ion chromatogram (EIC) peak areas (Fig. 9): lycopene, b-carotene, astaxanthin, canthaxanthin (Sigma- Aldrich, St. Luis, MO, USA), and zeaxanthin (Santa Cruz Biotechnology, Dallas, TX, USA). For those carotenoids without standards, the concentration was calculated based on the relative peak area to its close compartment. For example, the concentrations of zeaxanthin glucoside and zeaxanthin diglucoside were calculated based on that of zeaxanthin; the concentrations of astaxanthin glucosides, adonixanthin and its diglucosides were calculated based on that of astaxanthin. Carotenoid contents were calculated by normalizing the titres with dry cell weight (pg carotenoids per gram DCW, or ppm).

[00104] Results [00105] Example 1

[00106] The pathway design for glycosylated carotenoids

[00107] The metabolic pathway for glycosylated carotenoids was designed using an Escherichia coli. Briefly, the mevalonate pathway genes were cloned into the modules 1 (AHT, the genes atoB, hmgB and truncated hmgR ) and 2 (MPPI, the genes mevk, pmk, pmd and idi) and the lycopene pathway genes ( crtEBI and ispA) were located in module 3 (EBIA). The last module (module 4, YZX or YZWX) consists of the genes to produce zeaxanthin glucosides ( crtY , crtZ, and crtX) or to produce astaxanthin glucosides ( crtY , crtZ, crtW, and crtX) (Fig. 1). All the modules were controlled by T7 and its variants (e.g., TM1, TM2, TM3, TV1, TV2, TV3 and TV4) and induced by isopropyl b-d-l-thiogalactopyranoside (IPTG). This modular arrangement provides the flexibility to balance the global pathways (14-15 genes) and to fine tune the local pathways (e.g., module 4). In addition, as the module 4 controls the cyclization (crtY), hydroxylation (crtZ), ketolation (crtW), and glycosylation (crtX) of carotenoids, it is relatively simple to switch from one carotenoid (e.g., using crtYZ to produce zeaxanthin) to another one (e.g., using crtYZWX to astaxanthin glucoside) without modifying the upstream pathways genes. The crtY, crtZ, crtW and crtX genes are isolated from various organisms including Anabaena variabilis, Brevundimonas sp., Pantoea ananatis, uncultured marine bacterium and Sulfolobus solfataricus (Table 2).

[00108] Table 2. Genes of the carotenoid pathway

00109] Example 2

[00110] The production of glycosylated zeaxanthin

[00111] Firstly, the modules 1-3 and the module 4 (YZX) were used to demonstrate the capability to produce zeaxanthin glucoside. A FC-TOF-MS and UHPFC method was developed to detect the carotenoids and their glucosides (Table 3). In the constructed strain with crtX, five carotenoids were detected: lycopene, b-carotene, zeaxanthin, zeaxanthin^-D- glucoside and zeaxanthin-β-D-diglucoside, whereas the control strain without crtX did not produce either glycosylated zeaxanthin (Fig. 2A). The intermediate b-cryptoxanthin was not detected in either strain. The LC chromatograms and mass spectra for zeaxanthin (m/z 568.428, Table 3), zeaxanthin-β-D-glucoside (m/z 730.481) and zeaxanthin-β-D-diglucoside (m/z 892.534) were shown in Fig. 2A and B. In addition, some zeaxanthin diglucosides from the strain with crtX were purified and a yellow aqueous solution (~30 mg/L) was obtained. In contrast, zeaxanthin barely dissolves in water and its extracted solution is transparent (Fig. 2C). [00112] Table 3. Carotenoid information

¹ Here, n.d. stands for not detected.

[00113] Example 3

[00114] Optimization of glycosylation of zeaxanthin

[00115] In the first design strain X0, the glycosylation of zeaxanthin was incomplete: -26.8 % of monoglycosylated and 59.0% of diglycosylated (here the percentage was calculated by normalizing to the total yield of zeaxanthin and its two glucosides) and 14.2% of zeaxanthin remained unglycosylated (Fig. 3A and 3B). It was hypothesized that glycosylation of zeaxanthin could be limited by insufficient activity of ZGT. Another four RBSs of crtX were redesigned which have relatively higher translational efficiencies than the initial RBS in strain X0 (Fig. 3C). Indeed, it was observed that using stronger RBS for ZGT (crtX) led to higher glycosylation of zeaxanthin (Fig. 3A and D). Strain XI had the strongest RBS and produced the highest amount of zeaxanthin-P-D-diglucoside (-3139 ppm and -87.4% of total zeaxanthin and its glucosides). The correlation of RBS strengths to zeaxanthin-P-D-diglucoside production was determined. Zeaxanthin-P-D-glucoside produced appears to reach a saturated percentage when RBS relative strength was higher than 0.3 (Fig. 3D).

[00116] The effect of different carbon sources on the biosynthesis of zeaxanthin glucosides was evaluated. Glucose and glycerol were the carbon substrates used in the experiment. It was hypothesized that glucose might be advantageous to supply additional UDP-glucose, which is the key cofactor for carotenoid glycosylation. UDP-glucose is produced from glucose with three enzymes: glk: glucokinase, pgm: phosphoglucomutase, galU: UDP-glucose pyrophosphorylase. It was reported that glycerol was a better carbon source for carotenoid production. For XI strain, the glucose supplementation (10 g/L) led to higher production of zeaxanthin glucosides (-3650 ppm) than the supplementation of glycerol (10 g/L) or the mixture of glucose (5 g/L) and glycerol (5 g/L) (Fig. 4A). Subsequently, the amount of supplemented glucose was increased from 10 to 20 g/L, the yield of zeaxanthin diglucoside was further increased from -3400 (or 15.1 mg/L) to -4690 ppm (or 25.3 mg/L). At the same time, OD₆₀₀ was also increased from 10.8 to 13.1 (Fig. 4B). Of the total carotenoids produced, zeaxanthin glucosides reached about 64% in XI strain.

[00117] In addition, it was observed that lycopene was accumulated as the main intermediate carotenoid for all the strains and conditions in Fig. 3 A and 4A. It was hypothesized that the accumulation of lycopene could arise from the insufficient activity of lycopene cyclase (or crtY, Fig. 1). Hence, extra copies of crtY (“+crtY” strain) were introduced, and indeed, this significantly boosted zeaxanthin diglucoside yield from 3400 to 7150 ppm (or 23.1 mg/L) and zeaxanthin diglucoside yield from 350 to 4520 ppm (14.6 mg/L) of in the medium supplemented with 10 g/L glucose (Fig. 4B). Furthermore, for the “+crtY” strain, the titres of zeaxanthin diglucoside and glucoside were further increased to 31.0 and 16.3 mg/L, respectively, as the supplemented glucose was increased from 10 to 20 g/L. However, the carotenoid contents of “+crtY” strain slight dropped as the ODeoo increased from 7.9 to 13.2 which offset the titre increase (Fig. 4B). Lastly, the yields of zeaxanthin glucosides of “+crtY” strain were about 78% of that of total carotenoids produced.

[00118] Example 4

[00119] Distribution of carotenoids in E. coli cells

[00120] While studying the zeaxanthin glucoside strain, it was observed that some cells of zeaxanthin production strain were longer than others in microscopes (Fig. 5A). In comparison, there were no elongated cells for zeaxanthin glucoside production strain. The cells producing zeaxanthin glucosides may be less stressful than the cells producing zeaxanthin. Structurally, the glucoside and carotene of carotenoid glucosides resemble the hydrophilic head and the hydrophobic tail of phospholipid bilayers, respectively (Fig. 5B), carotenoid glucosides are reported to be clustered in rigid patches and such local rigidity can protect the membrane integrity under internal or external stress (e.g., oxidative and extreme temperature). Experiments were performed to evaluate if glycosylated carotenoids can potentially protect E. coli cells from stressful conditions. Thus, the distribution of carotenoids between cytosol and membrane was analysed. It was found that all the four carotenoids (lycopene, b-carotene, zeaxanthin and zeaxanthin glucosides) were predominantly localized in membrane (Fig. 5C). Less than 2% of them were present in cytosol. In addition, less zeaxanthin glucosides (0.08%) was distributed in cytosol as compared to zeaxanthin (1.13%). The high -percentage localization in membrane of zeaxanthin glucosides was unexpected as it initially thought that zeaxanthin glucosides might be more distributed in cytosol as they are more soluble. The data supported the notion that zeaxanthin and its glucosides have higher affinity with membrane than cytosol. [00121] Example 5

[00122] The production of glycosylated astaxanthin

[00123] After demonstrating that the design was working for zeaxanthin glycosylation, the other design with module YZWX to produce astaxanthin glucosides was further tested. With the addition of the gene crtX in one of the best astaxanthin producer strains in this study (Ast strain, Fig. 6A and B), the astaxanthin glycosylation capability (the resulting strain was named GA01) was tested. Overall, seven carotenoid glucosides are detected in GAOl: zeaxanthin-b- D-glucoside, adonirubin-β-D-glucoside (m/z 742.444), adonixanthin^-D-glucoside (m/z 744.460), astaxanthin-β-D-glucoside (m/z 758.439), zeaxanthin^-D-diglucoside, adonixanthin-β-D-diglucoside (m/z 906.513) and astaxanthin^-D-diglucoside (m/z 920.492, Fig. 6 A and B, Table 3, mass spectra in Fig. 6C and 7, and LC chromatograms in Fig. 8 and 9). Among them, astaxanthin-β-D-glucoside was the main glycosylated product with a yield of 4.51 mg/L (968 ppm), about 68% of total carotenoid glucosides. In addition, about 4.82 mg/L astaxanthin (1035 ppm) was not glycosylated and larger amount of b-carotene (16.0 mg/L, 3426 ppm) remained in GA01 strain. Furthermore, it was observed that the introduction of crtX resulted in the total carotenoid yields in GAOl strain dropped by 54%, as compared to its parental Ast strain (Fig. 6A), which might be due to the overall perturbation to the mevalonate and carotenoid pathway carbon fluxes or feedback regulations.

[00124] Example 6

[00125] Optimization of glycosylation of astaxanthin

[00126] Moreover, the higher IPTG concentration failed to increase but reduced the total yield of glycosylated carotenoids from 6.61 to 3.60 mg/L (1418 to 799 ppm) and non- glycosylated (or aglycones) carotenoids from 24.8 to 15.7 mg/L (5320 to 3485 ppm, Fig. 6A), possibly because IPTG perturbed the whole biosynthetic pathway where all the genes were controlled by T7 promoter variants and/or it promoted a competition between CrtZ and CrtW with intermediate accumulation (Fig. 1). Previously, it was observed the translational efficiency of the b-carotene hydroxylase ( crtZ ) has a stronger effect than that of b-carotene ketolase ( crtW) on astaxanthin production. Therefore, nine different ribosomal binding sites (RBSs, Table 4) were used, covering from 1% to 100% of translational efficiencies (the strains were named GO 1-09, translational efficiencies were normalized to that of strain GA01, the strongest among them) to optimize the production of glycosylated carotenoids, especially glycosylated astaxanthin.

[00127] Essentially, GA01-09 were strains with the same design except for the different RBSs of crtZ (Table 4). Indeed, the RBS had marked effects on the carotenoid production and distribution (Fig. 6A and B). For GA08 and GA09, the total carotenoid yields were very low, below 10 mg/L (<2000 ppm), and the carotenoid glucosides were also very low, below 0.4 mg/L (<100 ppm). GA01 and GA02 had the highest glycosylation efficiency (-21%, Figure 6 A), but with relatively lower total carotenoid yields as compared to GA03, GA04 and GA05. Surprisingly, GA03, with a relatively weaker RBS (Table 4), had the highest yield of total carotenoids (11623 ppm) and total glycosylated carotenoids (1774 ppm). Similar to GA01, strains GA02-07 had lower yields of carotenoids (including glycosylated carotenoids) when IPTG concentrations increased from 0.03 to 0.1 mM. In contrast, strains GA08-09 had higher yields when IPTG dosage increased, likely due to the relatively weaker RBSs of crtZ.

[00128] RBS engineering of crtZ has enhanced the production of glycosylated and total carotenoids by 25% and 72%, respectively, as compared to that of GA01. However, unlike the obvious positive effect of RBS of crtX on zeaxanthin glucosides (Fig. 3D), the data in Fig. 10 indicated the lack of correlation between the RBS strength of crtZ and carotenoid production. The lack of correlation was not surprising as the top two producers, GA03 and GA05, had relative weaker RBSs.

[00129] Table 4. RBS information for 9 strains

GA01

(SEQ ID C A A ACTTG AC GCA ATT AT A AT A AGG AGGTT C A A AC 43498 1.00

NO: 9)

GA02

(SEQ ID CAAACTTTACGCAATTATAATAAGGAGGTTCAAAC 29805 0.69

NO: 10)

GA03

(SEQ ID CAAACTTGACGCAATTATAATAAGGAGGGTCAAAC 2085 0.05

NO: 11)

GA04

(SEQ ID CATACTTGACGCAATTATAATAAGGAGGATCAAAC 7473 0.17

NO: 12)

GA05

(SEQ ID CAT ACTTG AC GCA ATT ATG AT A AGG AGGTT C A A AC 4355 0.10

NO: 13)

GA06

(SEQ ID C AAACTTT ACGC AATT ATAAT AAGGAGGGTC AAAC 2858 0.07

NO: 14)

GA07

(SEQ ID CAT ACTTT ACGC AATT ATAAT AAGGAGGATC AAAC 29538 0.68

NO: 15)

GA08

(SEQ ID CAGACTTGACGCAATTATGATAAGGAGGGTCAAAC 2973 0.07

NO: 16)

GA09

(SEQ ID CAT ACTTGACGC AATT ATGATAAGGAGGGTCAAAC 585 0.01

NO: 17)

[00130] Table 5. Summary of sequence listing.

00131] An E. coli host cell is engineered to produce carotenoid glucosides in high amounts. Particularly, the zeaxanthin-glucoside strain produced 11670 ppm of two zeaxanthin glucosides (-7150 ppm of zeaxanthin diglucose, -4520 ppm of zeaxanthin glucoside) in 2-day batch fermentation (Fig. 4B). In contrast, the astaxanthin-glucoside strains (GA01-09) produced lower amount of total carotenoid glucosides (1774 ppm) but with high diversity where 7 carotenoid glucosides were detected. To date, this present disclosure is the first to produce these carotenoid glucosides (up to 7 varieties) in recombinant microbes.

[00132] Equivalents

[00133] The foregoing examples are presented for the purpose of illustrating the invention and should not be construed as imposing any limitation on the scope of the invention. It will readily be apparent that numerous modifications and alterations may be made to the specific embodiments of the invention described above and illustrated in the examples without departing from the principles underlying the invention. All such modifications and alterations are intended to be embraced by this application.

Claims

Claims

1. A host cell comprising a polynucleotide sequence encoding one or more genes of the mevalonate pathway; one or more genes of the lycopene pathway; and one or more genes of the carotenoid pathway.

2. The host cell of claim 1, wherein the one or more genes of the mevalonate pathway; one or more genes of the lycopene pathway; and one or more genes of the carotenoid pathway are encoded on one or more vectors.

3. The host cell of claim 1 or 2, wherein the one or more genes of the mevalonate pathway is selected from the group consisting of acetoacetyl-CoA thiolase ( atoB ), HMG-CoA synthase ( hmgS ), HMG-CoA reductase ( hmgR ), mevalonate kinase (nevk), phosphomevalonate kinase ( pmk ), mevalonate pyrophosphate decarboxylase ( pmd ) and isopentenyl diphosphate (IPP) isomerase (idi), the one or more genes of the lycopene pathway is selected from the group consisting of farnesyl pyrophosphate (FPP) synthase ( ispA ), geranylgeranyl pyrophosphate (GGPP) synthase ( crtE ), phytoene synthase ( crtB ) and phytoene desaturase ( crtl ), and the one or more genes of the carotenoid pathway is selected from the group consisting of b-carotene ketolase ( crtW ), lycopene b-cyclase ( crtY ), b-carotene hydroxylase ( crtZ) and zeaxanthin glucosyltransferase ( crtX ).

4. The host cell of claim 3, wherein the hmgR gene is truncated.

5. The host cell of any one of claims 2 to 4, wherein the host cell comprises a) a first vector comprising a polynucleotide sequence encoding atoB, hmgS and truncated hmgR genes of the mevalonate pathway; b) a second vector comprising a polynucleotide sequence encoding mevk, pmk, pmd and idi genes of the mevalonate pathway; c) a third vector comprising a polynucleotide sequence encoding ispA, crtE, crtB and crtl genes of the lycopene pathway; and d) a fourth vector comprising a polynucleotide sequence encoding crtY, crtZ and crtX genes of the carotenoid pathway.

6. The host cell of claim 5, wherein the host cell further comprises a crtY gene.

7. The host cell of any one of claims 2 to 4, wherein the host cell comprises a) a first vector comprising a polynucleotide sequence encoding atoB, hmgS and truncated hmgR genes of the mevalonate pathway; b) a second vector comprising a polynucleotide sequence encoding mevk, pmk, pmd, idi genes of the mevalonate pathway; c) a third vector comprising a polynucleotide sequence encoding ispA, crtE, crtB and crtl genes of the lycopene pathway; and d) a fourth vector comprising a polynucleotide sequence encoding crtW, crtY , crtZ and crtX genes of the carotenoid pathway.

8. The host cell of any one of claims 2 to 7, wherein the polynucleotide sequence in each of the vectors is operably linked to an inducible promoter.

9. The host cell of claim 8, wherein the inducible promoter is a wild-type T7 RNA polymerase promoter or a variant of a wild-type T7 RNA polymerase promoter.

10. The host cell of claim 9, wherein the T7 promoter variant is selected from the group consisting of TM1, TM2, TM3, TV1, TV2, TV3 and TV4.

11. The host cell of any one of claims 8 to 10, wherein the inducible promoter in each vector is independently selected from the group consisting of the wild-type T7 RNA polymerase promoter, TM1, TM2, TM3, TV1, TV2, TV3 and TV4.

12. The host cell of any one of claims 8 to 11, wherein the inducible promoter is induced by isopropyl b-D-l-thiogalactopyranoside (IPTG).

13. The host cell of claim 12, wherein the concentration of IPTG is between about 0.01 to about 0.2 mM.

14. The host cell of claim 13, wherein the concentration of IPTG is about 0.03 mM to about 0.06 mM.

15. The host cell of any one of claims 2 to 14, wherein the one or more vectors further comprises a polynucleotide sequence encoding a ribosomal binding site (RBS).

16. The host cell of claim 15, wherein the polynucleotide sequence encoding the RBS on the one or more vectors is selected independently from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

17. The host cell of any one of claims 1 to 16, wherein the zeaxanthin glucosyltransferase gene is isolated from a bacterium.

18. The host cell of claim 17, wherein the bacterium is selected from the group consisting of the genus Pseudomonas, Pantoea, Massilia, Mycobacteroides, Microcystis and Paracoccus.

19. The host cell of claim 18, wherein the bacterium is Pantoea ananatis.

20. The host cell of any one of claims 1 to 19, wherein the host cell is a bacterial cell.

21. The host cell of claim 20, wherein the bacterial cell is selected from the group consisting of the genus Escherichia, Pantoea, Bacillus, Corynebacterium, Paracoccus, Streptomyces and Synechococcus.

22. The host cell of claim 21, wherein the bacterial cell is Escherichia coli.

23. The host cell according to claim 22, wherein the Escherichia coli is selected from the group consisting of BL21 DE3 strain, K-12(RV308), K-12(HMS174), K-12 substr. MG1655, W strain (ATCC 9637), JM109(DE3), BW25113, JM109 DE3, Machl and any strain comprising T7 RNA polymerase gene.

24. The host cell of claim 23, wherein the Escherichia coli is a BL21 DE3 strain.

25. A method of producing one or more glycosylated carotenoids comprising culturing the host cell of any one of claims 1 to 24 in a culture medium.

26. The method of claim 25, wherein the one or more glycosylated carotenoids produced comprises glycosylated zeaxanthin, glycosylated astaxanthin or both glycosylated zeaxanthin and glycosylated astaxanthin.

27. The method of claim 26, wherein the glycosylated zeaxanthin comprises zeaxanthin-b- D-glucoside, zeaxanthin-β-D-diglucoside or both zeaxanthin-β-D-glucoside, zeaxanthin-β-D-diglucoside.

28. The method of claim 26, wherein glycosylated astaxanthin comprises astaxanthin-β-D- glucoside, astaxanthin-β-D-diglucoside or both astaxanthin-β-D-glucoside and astaxanthin-P-D-diglucoside.

29. The method of any one of claims 25 to 28, wherein the glycosylated carotenoids are produced are glycosylated zeaxanthin, and wherein the host cell is a host cell of any one of claims 1 to 6 and 8 to 24.

30. The method of any one of claims 25 to 28, wherein the glycosylated carotenoids are glycosylated astaxanthin, and wherein the host cell is a host cell of any one of claims 1 to 4 and 7 to 24.

31. The method of any one of claims 25 to 30, wherein the host cell is cultured in a culture medium comprising an inducer and at least one carbon substrate.

32. The method of claim 31, wherein the inducer is IPTG and wherein the at least one carbon substrate is selected from the group consisting of glucose, glycerol, lactose, sucrose and combinations thereof.

33. The method of any one of claims 25 to 32, wherein the culture medium comprises IPTG and glucose.

34. The method of claim 33, wherein the concentration of IPTG is between about 0.01 and about 0.2 mM and the concentration of glucose is between about 5 and about 30 g/L.

35. The method of claim 34, wherein the concentration of IPTG is about 0.03 mM and the concentration of glucose is about 20 g/L.

36. The method of any one of claims 25 to 35, wherein the more than about 50% of total carotenoids produced is glycosylated zeaxanthin.

37. The method of claim 36, wherein the yield of glycosylated zeaxanthin is at least 40 mg/L.

38. The method of any one of claims 25 to 37, wherein more than about 15% of the total carotenoids produced is glycosylated astaxanthin.

39. The method of claim 38, wherein the yield of glycosylated astaxanthin is at least 5.5 mg/L.

40. The method of any one of claims 25 to 39, wherein the method further comprises the step of isolating the one or more glycosylated carotenoids from the culture medium.

41. A kit for producing glycosylated carotenoids, wherein the kit comprises the host cell of any one of claims 1 to 24 with instructions for use.

42. The kit of claim 41, wherein the host cell is dissolved in solution or lyophilized.

43. The kit of claim 42, wherein the host cell is preserved by deep freezing.