WO2022245000A1 - Amino acid-producing microorganism exhibiting enhanced agl protein activity, and amino acid production method using same - Google Patents

Abstract

The present application relates to an amino acid-producing microorganism exhibiting enhanced Agl protein activity, and an amino acid production method using same.

Description

Microorganisms that produce amino acids with enhanced AGL protein activity and amino acid production methods using the same

The present application relates to an amino acid-producing microorganism with enhanced Agl protein activity and an amino acid production method using the same.

Amino acids are used in animal feed, pharmaceutical and cosmetic industries, and are mainly produced by fermentation using strains of the genus Corynebacterium or strains of the genus Escherichia. For the production of amino acids, various studies such as development of high-efficiency production strains and fermentation process technology are being conducted.

Specifically, target material-specific approaches such as increasing the expression of genes encoding enzymes involved in amino acid biosynthesis or removing genes unnecessary for biosynthesis are mainly used (US 8048650 B2). However, studies on the relationship between sugar utilization and amino acid biosynthesis of microorganisms are still lacking.

An object of the present application is to provide an amino acid-producing microorganism with enhanced Agl protein activity and an amino acid production method using the same.

The present application provides microorganisms of the genus Corynebacterium that produce amino acids with enhanced Agl protein activity.

The present application provides a method for producing amino acids, comprising culturing the microorganism in a medium.

The present application provides a method for producing the microorganism.

The present application provides a composition for amino acid production comprising the microorganism or its culture.

The microorganism of the present application can be usefully used for amino acid production.

A detailed description of this is as follows. Meanwhile, each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application is not to be construed as being limited by the specific descriptions described below.

In addition, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific aspects of the present application described herein. Also, such equivalents are intended to be included in this application.

One aspect of the present application provides a microorganism of the genus Corynebacterium that produces amino acids with enhanced Agl protein activity.

"Agl protein" in this application refers to a kind of protein having glucosidase activity.

In this application, "glucosidase" is an enzyme that catalyzes the cleavage of glycosidic bonds and is involved in breaking down carbohydrates into monomers. For example, the glucosidase may be an enzyme classified as EC 3.2.1, but is not limited thereto.

In one embodiment, the Agl protein of the present application may have alpha-glucosidase activity.

In the present application, "alpha-glucosidase" is a type of glucosidase that decomposes sugar into glucose, and means an enzyme capable of decomposing an alpha-glycosidic bond. . The alpha-glycosidic bond may be, for example, α(1→4), α(1→6), α(1→2), etc., but is not limited thereto.

In one embodiment, the alpha-glucosidase of the present application may have an activity of decomposing carbohydrates into glucose. In another embodiment, the alpha-glucosidase of the present application may have an activity of cleaving α(1→4) and/or α(1→6) bonds, but is not limited thereto.

For the purposes of the present application, the Agl protein may include any protein capable of enhancing amino acid production.

In one embodiment, the Agl protein of the present application may be an enzyme capable of degrading at least one selected from maltose and maltose isomers. Therefore, the microorganism of the present application may use at least one selected from maltose and maltose isomers as a carbon source. The microorganism may thus have increased sugar consumption or sugar utilization of maltose or isomers of maltose.

In one embodiment, the Agl protein of the present application comprises, has, consists of, or consists essentially of SEQ ID NO: 1 or an amino acid sequence having at least 70% homology or identity thereto, or consisting essentially of the amino acid sequence. can

Specifically, the amino acid sequence of the Agl protein of the present application may be a protein sequence having a glucosidase activity encoded by the agl gene. The amino acid sequence may be obtained from various databases such as NCBI's GenBank, which is a known database, but is not limited thereto.

In one embodiment, the Agl protein of the present application may be derived from Bifidobacterium adolescentis , but is not limited thereto, and a sequence having the same activity as the above amino acid sequence may be included without limitation.

In addition, although one embodiment of the Agl protein of the present application was described as a protein containing SEQ ID NO: 1, meaningless sequence additions to and from the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof ), and it is apparent to those skilled in the art that the Agl protein of the present application corresponds to the protein having the same or corresponding activity as the protein containing the amino acid sequence.

Specifically, the Agl protein of the present application comprises the amino acid sequence of SEQ ID NO: 1, or at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89% of the amino acid sequence of SEQ ID NO: 1 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity. In addition, it is obvious that any amino acid sequence having the above homology or identity and exhibiting efficacy corresponding to the protein is included within the scope of the present application even if some sequences have amino acid sequences that are deleted, modified, substituted or added.

In this application, it is described as 'a polypeptide or protein comprising the amino acid sequence described in a specific sequence number', 'a polypeptide or protein consisting of the amino acid sequence described in a specific sequence number', or 'a polypeptide or protein having an amino acid sequence described in a specific sequence number' Even if it is, if it has the same or equivalent activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number, a protein having an amino acid sequence in which some sequence is deleted, modified, substituted, conservatively substituted, or added can also be used in this application. is self-explanatory. For example, it is a case of adding a sequence that does not change the function of the protein, a naturally occurring mutation, a silent mutation thereof, or a conservative substitution to the N-terminus and/or C-terminus of the amino acid sequence. .

The "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide.

In the present application, the term 'homology' or 'identity' refers to the degree of identical or similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity are often used interchangeably.

Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally the entire sequence or a portion corresponding to at least about 50%, 60%, 70%, 80% or 90% of the full-length and intermediate or It can hybridize under highly stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing common codons or codons considering codon degeneracy in polynucleotides.

Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the “FASTA” program using default parameters as in 2444. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.] (1988) SIAM J Applied Math 48: 1073. For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity or identity.

Homology, similarity or identity of polynucleotides or polypeptides can be found in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, eg, Needleman et al. (1970), J Mol Biol. It can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, the GAP program can define the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.

In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and appropriate hybridization conditions defined are within the scope of the art , methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

The microorganisms in which the activity of the Agl protein of the present application is enhanced include Agl protein; polynucleotides encoding them; And it may be a microorganism containing one or more of the vectors containing the polynucleotide.

As used herein, the term "polynucleotide" is a DNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds.

The polynucleotide sequence encoding the Agl protein of the present application may also be referred to as " agl gene" or " aglB gene", which may include the polynucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 1 above.

In the polynucleotide, various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in organisms in which the polypeptide is to be expressed. . Specifically, the polynucleotide may include, consist of, or consist essentially of SEQ ID NO: 2 or a polynucleotide sequence having 70% or more homology or identity thereto, but is not limited thereto. For example, the polynucleotide has 70% or more, 80% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more homology or identity with SEQ ID NO: 2 More specifically, it may consist of a nucleotide sequence of 99% or more, but is not limited thereto.

In addition, the polynucleotide of the present application may include without limitation any sequence capable of hybridizing with a probe, for example, a sequence complementary to all or part of the polynucleotide base sequence under stringent conditions. The "stringent condition" means a condition that allows specific hybridization between polynucleotides. Such conditions are specifically described in the literature (eg, J. Sambrook et al., ibid.). For example, polynucleotides with high homology or identity, 40% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, more specifically 99% or more 60 ° C., 1 × SSC, 0.1 washing conditions for hybridization under conditions in which polynucleotides having the same identity or identity do not hybridize and polynucleotides having less homology or identity do not hybridize, or washing conditions for typical southern hybridization Washing once, specifically 2 to 3 times, at a salt concentration and temperature corresponding to % SDS, specifically 60 ° C, 0.1 × SSC, 0.1% SDS, more specifically 68 ° C, 0.1 × SSC, 0.1% SDS may be a condition.

Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Thus, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.

Appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotide and the degree of complementarity, parameters well known in the art (J. Sambrook et al., supra).

In the present application, "vector" refers to a DNA preparation for inserting a polynucleotide encoding an Agl protein into a host chromosome or a suitable expression control region (or expression control sequence) so as to express a target polypeptide in a suitable host operably. It may include a DNA preparation containing the nucleotide sequence of the polynucleotide encoding the linked Agl protein. The expression control region may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can integrate into the genome itself.

The vector of the present application may be an expression vector for expressing the Agl protein of the present application in a host cell, but is not limited thereto.

In addition, the vector of the present application may be an insertion vector for inserting the polynucleotide encoding the Agl protein of the present application into a chromosome, but is not limited thereto. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for determining whether the chromosome is inserted may be further included. The selectable marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule has been inserted, and can exhibit selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, so transformed cells can be selected. The insertion vector may not contain an origin of replication required for replication in the transformed cell.

Vectors used in the present application are not particularly limited, and any vectors known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors , pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.

The term "transformation" in the present application means introducing a vector containing a polynucleotide encoding the protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be inserted into and located in the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and/or RNA encoding the protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression. The expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

In addition, the term "operably linked" in the present application means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the Agl protein of the present application and the gene sequence are functionally linked.

The method of transforming the vector of the present application includes any method of introducing nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposomal method, and lithium acetate -DMSO method, etc., but is not limited thereto.

In this application, the term "microorganism" or "strain" includes both wild-type microorganisms and naturally or artificially genetically modified microorganisms, and is derived from causes such as insertion of foreign genes or enhancement or inactivation of endogenous gene activity. As a microorganism in which a specific mechanism is weakened or enhanced, it may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.

The microorganism of the present application may be a microorganism having an amino acid production ability.

The microorganism of the present application may be one in which the Agl protein of the present application is introduced into a microorganism naturally having the ability to produce Agl protein or amino acid, or a mother strain having no ability to produce Agl protein or amino acid.

For example, the microorganism of the present application is a cell or microorganism in which the activity of the Agl protein is enhanced by being transformed with a polynucleotide encoding the Agl protein of the present application. It may include all microorganisms capable of producing amino acids, including.

For example, the microorganism of the present application may be a natural wild-type microorganism or a recombinant strain whose amino acid production ability is increased by enhancing the activity of the Agl protein by introducing a polynucleotide encoding the Agl protein of the present application into a natural wild-type microorganism or a microorganism producing amino acids. have. The recombinant strain with increased amino acid production ability may be a natural wild-type microorganism or a microorganism with increased amino acid production ability compared to a microorganism in which the activity of the Agl protein of the present application is not enhanced or does not express the Agl protein, but is not limited thereto. not.

For example, a microorganism that does not express the Agl protein of the present application, which is a target strain for comparing the increase in the amino acid production ability, may be KCCM11016P (Korean Patent No. 10-0159812) or KCCM10770P (US 9109242 B2), Not limited to this.

For example, the recombinant strain with increased production capacity may have an amino acid production capacity increased by about 0.001% or more or 0.01% or more compared to the amino acid production capacity of the parent strain or non-modified microorganism before mutation, but the production of the parent strain or non-modified microorganism before mutation As long as it has an increased amount of + value compared to the ability, it is not limited to this. The term “about” includes all ranges of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges equivalent to or similar to the ranges following the term “about”. Not limited.

In this application, the term "unmodified microorganism" does not exclude strains containing mutations that may occur naturally in microorganisms, and are wild-type strains or wild-type strains themselves, or are genetically modified by natural or artificial factors. It may mean a strain before change. For example, the unmodified microorganism may refer to a strain without or before the introduction of the Agl protein of the present application. The "unmodified microorganism" may be used interchangeably with "strain before transformation", "microorganism before transformation", "non-mutated strain", "unmodified strain", "non-mutated microorganism" or "reference microorganism".

The microorganism of the present application may be a microorganism of the genus Corynebacterium. In this application, "microbes of the genus Corynebacterium" may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ) . _ _ _ Rium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans ( Corynebacterium imitans ), Corynebacterium testudino It may be Corynebacterium testudinoris or Corynebacterium flavescens , and more specifically Corynebacterium glutamicum.

As used herein, the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased relative to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.

Herein, activation, enhancement, upregulation, overexpression, and increase may include those that exhibit an activity that was not originally possessed, or those that exhibit enhanced activity compared to intrinsic activity or activity before modification.

Therefore, a microorganism expressing the Agl protein or a microorganism into which the Agl protein is introduced can also be referred to as a microorganism in which the activity of the Agl protein is enhanced.

The "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by a parent strain or unmodified microorganism before transformation when a character is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activation before transformation". "Enhancement", "upregulation", "overexpression" or "increase" of the activity of a polypeptide compared to the intrinsic activity means that the activity and/or concentration (expression amount) is improved.

The enhancement can be achieved by introducing a foreign polypeptide or by enhancing the activity and/or concentration (expression level) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from an increase in the activity level, expression level, or amount of a product released from the corresponding polypeptide.

Enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before transformation. Specifically, it may be using genetic engineering and / or protein engineering, which is well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

Specifically, enhancing the activity of the polypeptide of the present application

1) an increase in intracellular copy number of a polynucleotide encoding a polypeptide;

2) replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide;

4) modification of the amino acid sequence of the polypeptide to enhance the activity of the polypeptide;

5) modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide (eg, modification of the polynucleotide sequence of the polypeptide gene to encode the modified polypeptide to enhance the activity of the polypeptide);

6) introduction of a foreign polypeptide that exhibits the activity of the polypeptide or a foreign polynucleotide encoding the same;

7) codon optimization of polynucleotides encoding the polypeptide;

8) Analysis of the tertiary structure of the polypeptide to select exposed sites and modify or chemically modify them; or

9) It may be a combination of two or more selected from 1) to 8), but is not particularly limited thereto.

In this application, "amino acid" refers to a compound in which an amino group and a carboxy group are bonded to the same carbon atom, and includes proteinaceous amino acids that are the basic building blocks of proteins and non-proteins that are not encoded by the genetic code of organisms. Includes all non-proteinogenic amino acids.

In one embodiment, an amino acid of the present application may be an L-amino acid. The L-amino acids are, for example, L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic acid, L-glutamine, L-glycine, L-histidine, L-isoleucine Any one selected from the group consisting of L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine and L-valine may be ideal The L-amino acid may be, as a more specific example, L-lysine, but is not limited thereto.

In one embodiment, an amino acid of the present application may be a non-proteinaceous amino acid. The non-proteinaceous amino acid may be, for example, one or more selected from the group consisting of citrulline, ornithine, and GABA, but is not limited thereto.

Another aspect of the present application provides a method for producing amino acids comprising culturing the microorganism of the present application in a medium. The microorganisms are as described above.

Any medium and other culture conditions used for culturing the microorganism of the present application may be used without particular limitation as long as it is a medium used for culturing a common microorganism of the genus Corynebacterium. Specifically, the microorganism of the present application may be used as a suitable carbon source, It can be cultured while controlling temperature, pH, etc. under aerobic or anaerobic conditions in a conventional medium containing a nitrogen source, phosphorus, inorganic compounds, amino acids and/or vitamins.

In the present application, the carbon source includes carbohydrates such as glucose, fructose, sucrose, maltose and isomers thereof; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sorghum pomace and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e. converted to reducing sugar). Carbohydrates such as molasses) may be used, and other carbon sources in an appropriate amount may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

As a specific example, the carbon source that may be included in the culture medium of the present application may include maltose or isomers of maltose. More specifically, it may include one or more selected from glucose, maltose (maltose), and maltose isomers (isomaltose), or a combination of two or more, but is not limited thereto.

Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

The number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used.

In addition, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above substances. In addition, precursors suitable for the culture medium may be used. The above raw materials may be added in a batchwise or continuous manner by a method suitable for the culture during the culture process, but is not limited thereto.

In the present application, the pH of the culture may be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the culture in an appropriate manner during the culture of the microorganism. In addition, during cultivation, the formation of bubbles can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or nitrogen, hydrogen or carbon dioxide gas may be injected to maintain the anaerobic and non-aerobic state, but is limited thereto It doesn't work.

The temperature of the culture may be 25 °C to 40 °C, more specifically 28 °C to 37 °C, but is not limited thereto. The culturing period may be continued until a desired production amount of a useful substance is obtained, and specifically may be 1 hour to 100 hours, but is not limited thereto.

The amino acid production method of the present application may include recovering amino acids from the microorganism or medium.

According to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, a desired amino acid may be recovered from the medium using a suitable method known in the art. For example, centrifugation, filtration, treatment with a precipitating agent for crystallized protein (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis method, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography It may be used in combination of various chromatography, HPLC, and these methods, such as, but is not limited to these examples.

The method may include additional purification steps. The purification process may use a suitable method known in the art.

Another aspect of the present application provides a method for producing an amino acid-producing microorganism of the genus Corynebacterium, comprising enhancing the activity of the Agl protein in the microorganism of the genus Corynebacterium.

The step of enhancing the activity of the Agl protein may be a step of modifying a microorganism of the genus Corynebacterium to express the Agl protein, as described above.

Another aspect of the present application provides a composition for amino acid production comprising a microorganism of the genus Corynebacterium or a culture thereof having enhanced Agl protein activity.

The composition may include maltose and/or maltose isomers, but is not limited thereto.

The Agl protein, microorganisms of the genus Corynebacterium whose activity is enhanced, and amino acids are as described above.

Another aspect of the present application provides a use of the Agl protein of the present application to increase amino acid production.

Another aspect of the present application provides a use of a microorganism of the genus Corynebacterium in which the activity of the Agl protein of the present application is enhanced, for amino acid production.

The Agl protein, microorganisms of the genus Corynebacterium whose activity is enhanced, and amino acids are as described above.

Hereinafter, the present application will be described in more detail through Examples and Experimental Examples. However, these examples and experimental examples are for illustrative purposes of the present application, and the scope of the present application is not limited to these examples and experimental examples.

Example 1: Maltose Utilization Improvement Gene Search and Screening

In order to search for proteins that improve maltose utilization, candidate proteins were selected using the NCBI Protein Database.

No.	strain	protein registration number
One	Bifidobacterium adolescentis ATCC 15703	BAF40342
2	Bifidobacterium breve KCTC3220	BAQ99133
3	Saccharomyces cerevisiae	NP_011808
4	Corynebacterium glutamicum ATCC 13032	NP_601497

The protein derived from Bifidobacterium adolescentis has the amino acid sequence of SEQ ID NO: 1. Information on the gene encoding the protein and the surrounding nucleic acid sequence was obtained from NIH GenBank, and the gene has a nucleotide sequence of SEQ ID NO: 2. Based on the sequence, PCR (SolTM Pfu-X DNA polymerase) was performed using the genome of Bifidobacterium adolescentis ATCC15703 as a template and the primers of SEQ ID NOs: 3 and 4 to obtain the gene of SEQ ID NO: 2. amplified. Using the primers of SEQ ID NOs: 5 and 6, the CJ7 promoter (Korean Patent No. 10-0620092) PCR was amplified using the genome of Corynebacterium ammoniagenes as a template. The obtained gene fragments were ligated into vector pECCG117 (Korean Patent No. 0057684) digested with XbaI restriction enzyme and subjected to Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix ) method, E. coli DH5α was transformed and plated on LB solid medium containing kanamycin (25 mg/L). PCR was performed using primers of SEQ ID NOs: 7 and 8 to select colonies transformed with the vector linked to the gene of interest and pECCG117. A plasmid was obtained from the selected colonies using a commonly known plasmid extraction method, and was named pECCG117-Pcj7-agl (Bad).

The protein derived from Bifidobacterium breve has the amino acid sequence of SEQ ID NO: 9. Information on the gene encoding the protein and its surrounding nucleic acid sequence was obtained from NIH GenBank, and the gene has a nucleotide sequence of SEQ ID NO: 10. Based on the sequence, the gene of SEQ ID NO: 10 was amplified by performing PCR using the primers of SEQ ID NOs: 11 and 12 using the genome of Bifidobacterium breve (KCTC3220) as a template. A plasmid was obtained from the obtained gene fragment by the method described above, and it was named pECCG117-Pcj7-agl(Bbr).

The protein derived from Saccharomyces cerevisiae has the amino acid sequence of SEQ ID NO: 13. Information on the gene encoding the protein and the surrounding nucleic acid sequence was obtained from NIH GenBank, and the gene has a nucleotide sequence of SEQ ID NO: 14. Based on the sequence, the gene of SEQ ID NO: 14 was amplified by performing PCR (SolTM Pfu-X DNA polymerase) using the primers of SEQ ID NOs: 15 and 16 using the genome of Saccharomyces cerevisiae as a template. . A plasmid was obtained from the obtained gene fragment using the method described above, and it was named pECCG117-Pcj7-agl(Sce).

The protein derived from Corynebacterium glutamicum has the amino acid sequence of SEQ ID NO: 17. Information on the gene encoding the protein and the surrounding nucleic acid sequence was obtained from NIH GenBank, and the gene has a nucleotide sequence of SEQ ID NO: 18. Based on the sequence, PCR (SolTM Pfu-X DNA polymerase) was performed using the genome of Corynebacterium glutamicum as a template and primers of SEQ ID NOs: 19 and 20 to amplify the gene of SEQ ID NO: 18 did A plasmid was obtained from the obtained gene fragment by the method described above, and it was named pECCG117-Pcj7-agl (cgl).

The nucleic acid sequences of the primers used above are summarized in Table 2 below.

No.	designation	DNA sequence (5'-3')
SEQ ID NO: 3	Bad-f	caacgaaaggaaacactc ATGacagcaaacaacatgcg
SEQ ID NO: 4	Bad-r	TGGCGGCCGCTCTAGA tcagcccagcagcagccag
SEQ ID NO: 5	Pcj7-f	GGATCCACTAGTTCTAGA atcggagtgcctaaaacc
SEQ ID NO: 6	Pcj7-r	gagtgtttcctttcgttgg
SEQ ID NO: 7	pECCG-f	AGTACTGATCCTCCGGCGTT
SEQ ID NO: 8	pECCG-r	GTGATATGGGGCAAATGGTG
SEQ ID NO: 11	Bbr-f	caacgaaaggaaacactc atgaccgccaacaacctc
SEQ ID NO: 12	Bbr-r	TGGCGGCCGCTCTAGA ctacttgataacccacgc
SEQ ID NO: 15	Sce-f	caacgaaaggaaacactc atgactatttctgatcat
SEQ ID NO: 16	Sce-r	TGGCGGCCGCTCTAGA ttatttgacgaggtagat
SEQ ID NO: 19	Cgl-f	caacgaaaggaaacactc gtgactgctcgcagattt
SEQ ID NO: 20	Cgl-r	TGGCGGCCGCTCTAGA ctaatctcgcttgcttgc

The control pECCG117 vector and the above-constructed four vectors (pECCG117-Pcj7-agl (Bad), pECCG117-Pcj7-agl (Bbr), pECCG117-Pcj7-agl (Sce) and pECCG117-Pcj7-agl (cgl)) Transformation of Corynebacterium glutamicum ATCC13032 by electroporation (Van der Rest et al., Appl. Microbiol. Biotecnol. 52:541-545, 1999), kanamycin (25 mg/L) It was smeared on a complex plate medium containing this, and colonies were obtained after incubation at 30 ° C for 48 hours.

The composite plate medium composition used above was as follows:

<Complex plate medium (pH 7.0)>

Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, Agar 20 g, Kanamycin 25 mg (based on 1 liter of distilled water)

13032::pECCG, 13032::pECCG-Pcj7-agl (Bad), 13032::pECCG-Pcj7-agl (Bbr), 13032::pECCG-Pcj7-agl (Sce), 13032 ::pECCG-Pcj7-agl (cgl) was named sequentially. First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium containing 25 mg/L of kanamycin, and cultured at 32° C. for 24 hours with shaking at 200 rpm. Thereafter, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the selection medium, and incubated at 32° C. for 24 hours with shaking at 200 rpm. After the completion of the culture, the residual amount and amount of maltose used were measured.

The composition of the selective medium used above is as follows.

<Species medium (pH 7.0)>

Glucose 12 g, peptone 10 g, yeast extract 10 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 0.1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 20 mg , kanamycin 25 mg (based on 1 liter of distilled water)

<Selection medium (pH 7.0)>

Maltose 12 g, peptone 10 g, yeast extract 10 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 0.1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 20 mg , kanamycin 25 mg (based on 1 liter of distilled water)

The experiment was repeated three times, and the culture results (average values) are shown in Table 3.

strain	OD 562	Maltose (g/L)	Maltose consumption (g/L)
13032::pECCG	16.9	2.1	9.9
13032::pECCG-Pcj7-agl (Bad)	21.0	0.0	12.0
13032::pECCG-Pcj7-agl (Bbr)	18.0	1.1	10.9
13032::pECCG-Pcj7-agl (Sce)	17.0	1.8	10.2
13032::pECCG-Pcj7-agl (cgl)	17.8	1.6	10.4

As shown in Table 3, the 13032::pECCG-Pcj7-agl(Bad) strain into which the Bifidobacterium adolescentis-derived protein was introduced showed the best maltose utilization ability.

Example 2: agl Creation of transgenic vectors

In order to construct a vector introducing the Bifidobacterium adolescentis protein selected in Example 1 into the genome of Corynebacterium glutamicum, SEQ ID NO: 21 and PCR (SolTM Pfu-X DNA polymerase) was performed using the primers of 22 to amplify the gene of SEQ ID NO: 2. Using the primers of SEQ ID NOs: 23 and 24, the genome of Corynebacterium ammoniagenes as a template, the genome of Corynebacterium glutamicum using the CJ7 promoter (US 7662943 B2) and the primers of SEQ ID NOs: 25 and 26 Using as a template, the promoter of gapA (NCgl1526) was amplified by PCR.

The promoter obtained above, the gene fragment derived from Bifidobacterium adolescentis, and the vector pDZTn (US 8323933 B2) digested with SpeI restriction enzyme were prepared by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY). 2009, NEBuilder HiFi DNA Assembly Master Mix) method, and then transformed into E. coli DH5α and plated on LB solid medium containing kanamycin (25 mg/L). PCR was performed using the primers of SEQ ID NOs: 27 and 28 to select colonies transformed with the vector in which the target gene and pDZTn were ligated. Plasmids were obtained using a commonly known plasmid extraction method using the selected colonies, and these plasmids were named pDZTn-Pcj7-agl and pDZTn-PgapA-agl in that order.

No.	designation	DNA sequence (5'-3')
SEQ ID NO: 21	Agl-F	Atgacagcaaacaacatgcgt
SEQ ID NO: 22	Agl-R	TAGATGTCGGGCCCACTAGT tcagcccagcagcagccagac
SEQ ID NO: 23	Pcj7-F	ATGAGTTCCTCGAGACTAGT agaaacatcccagcgctact
SEQ ID NO: 24	Pcj7-R	cgcatgttgtttgctgtcaTgagtgtttcctttcgttggg
SEQ ID NO: 25	PgapA-F	ATGAGTTCCTCGAGACTAGTTTGGGATTACCATTGAAGCC
SEQ ID NO: 26	PgapA-R	cgcatgttgtttgctgtCATGTGTCTCCTCTAAAGATTGT
SEQ ID NO: 27	pDZTn-1	ACGACGCTGGTATTTCTCCC
SEQ ID NO: 28	pDZTn-2	TGATTGTCGATATGACCGGG

Example 3: agl Creation of transgenic strains

Electroporation (Appl. Microbiol Biotechnol. PCR and sequencing were performed using primers of SEQ ID NOs: 29 and 30 capable of amplifying adjacent regions including the site where the gene was inserted, and the corresponding genetic manipulation was confirmed. The strains thus obtained were named Corynebacterium glutamicum KCCM11016P::Pcj7-agl and KCCM11016P::PgapA-agl in order.

sequence number	designation	DNA sequence (5'-3')
29	Tn-1	TAAGGCACCGCAGAATGTAG
30	Tn-2	TAGGACTCACCATCACCGGC

Example 4: In medium containing glucose agl Comparison of L-lysine production ability of transgenic strains

KCCM11016P::Pcj7-agl, KCCM11016P::PgapA-agl strains and control KCCM11016P were cultured in the following manner, and cell mass, sugar consumption, and lysine production were compared.

First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured at 30° C. for 20 hours with shaking at 200 rpm. A 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and incubated at 37° C. for 42 hours with shaking at 200 rpm. After completion of the culture, the production of L-lysine was measured by HPLC.

<Seed medium (pH 7.0)>

Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 0.1 mg, thiamine HCl 1 mg, calcium-pantothenic acid 22 mg, nicotinamide 2 mg ( based on 1 liter of distilled water)

<Production medium (pH 7.0)>

Glucose 45 g, (NH4)2SO4 15 g, soy protein 10 g, molasses containing 50% sugar 10 g, KH2PO4 0.55 g, MgSO4 7H2O 0.6 g, biotin 0.9 mg, thiamine hydrochloride 4.5 mg, calcium-pantothenic acid 4.5 mg, nicotine Amide 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, CaCO3 30 g (based on 1 liter of distilled water).

The experiment was repeated three times, and the culture results (average values) are shown in Table 6.

Comparison of L-lysine production capacity (KCCM11016P)

strain	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM11016P	33.6	50.0	12.1	24.2
KCCM11016P::Pcj7-agl	33.0	50.0	12.4	24.8
KCCM11016P::PgapA-agl	33.1	50.0	12.3	24.6

As shown in Table 6, KCCM11016P::Pcj7-agl and KCCM11016P::PgapA-agl strains with enhanced Agl protein activity of the present application showed increased lysine yield compared to the control strain KCCM11016P.

Example 5: In medium containing maltose agl Comparison of L-lysine production ability of transgenic strains

KCCM11016P::Pcj7-agl, KCCM11016P::PgapA-agl strains and control KCCM11016P were cultured in the same manner as in Example 4, but 45 g of glucose in the production medium was replaced with maltose by 1 g, 5 g, and 20 g, thereby increasing cell mass and sugar consumption. performance and lysine production ability were compared.

The experiment was repeated three times, and the culture results (average values) are shown in Tables 7, 8, and 9 in order.

Alternative to 1g maltose, comparison of L-lysine production capacity (KCCM11016P)

strain	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM11016P	33.9	50.0	11.9	23.8
KCCM11016P::Pcj7-agl	32.8	50.0	12.3	24.6
KCCM11016P::PgapA-agl	33.0	50.0	12.3	24.6

5g maltose substitute, comparison of L-lysine production capacity (KCCM11016P)

strain	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM11016P	35.0	50.0	11.3	22.6
KCCM11016P::Pcj7-agl	33.0	50.0	12.4	24.8
KCCM11016P::PgapA-agl	33.2	50.0	12.3	24.6

Alternative to 20g maltose, comparison of L-lysine production capacity (KCCM11016P)

strain	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM11016P	36.8	50.0	10.1	20.2
KCCM11016P::Pcj7-agl	33.5	50.0	12.4	24.8
KCCM11016P::PgapA-agl	34.0	50.0	12.2	24.4

As shown in Tables 7. 8 and 9, the KCCM11016P::Pcj7-agl and KCCM11016P::PgapA-agl strains with enhanced Agl protein activity of the present application were compared to the control strain KCCM11016P in a production medium containing maltose. Comparatively, it showed an increased lysine yield.

Example 6: KCCM10770P strain in maltose containing medium agl Confirmation of gene introduction effect

Using the method described in Example 3, a strain in which the PgapA-agl gene was inserted at the transposon position on the genome of the Corynebacterium glutamicum KCCM10770P (US 9109242 B2) strain was obtained. The strain thus obtained was named Corynebacterium glutamicum KCCM10770P::PgapA-agl.

KCCM10770P::PgapA-agl strain and control KCCM10770P were cultured, and cell mass, sugar consumption, and lysine production were compared. As in Example 5, 45 g of glucose in the production medium was replaced with 1 g, 5 g, and 20 g of maltose. The experiment was repeated three times, and the culture results (average values) are shown in Table 10.

strain	production badge	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM10770P	Glucose 45	67.3	50.0	8.0	16.0
KCCM10770P::PgapA-agl	Glucose 45	66.9	50.0	8.1	16.2
KCCM10770P	Glucose 44 Maltose 1	67.9	50.0	7.9	15.8
KCCM10770P::PgapA-agl	Glucose 44 Maltose 1	67.1	50.0	8.1	16.2
KCCM10770P	Glucose 40 Maltose 5	68.3	50.0	7.1	14.2
KCCM10770P::PgapA-agl	Glucose 40 Maltose 5	67.0	50.0	8.2	16.4
KCCM10770P	Glucose 25 Maltose 20	70.0	50.0	6.0	12.0
KCCM10770P::PgapA-agl	Glucose 25 Maltose 20	66.9	50.0	8.2	16.4

As shown in Table 10, the KCCM10770P :: PgapA-agl strain with enhanced Agl protein activity of the present application showed an increased lysine yield compared to the control strain KCCM10770P in a production medium containing maltose.

Example 7: In a medium containing maltose isomers agl Comparison of L-lysine production ability of transgenic strains

The KCCM11016P::PgapA-agl, KCCM10770P::PgapA-agl strains and the control were cultured in the same manner as in Example 4, but 45 g of glucose in the production medium was replaced with maltose isomers (iso-maltose) by 1 g and 5 g, thereby increasing cell mass and sugar consumption. performance and lysine production ability were compared.

The experiment was repeated three times, and the culture results (average values) are shown in Table 11 in order.

strain	production badge	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM11016P	Glucose 44 Isomaltose 1	33.3	49.0	11.9	24.3
KCCM11016P::PgapA-agl	Glucose 44 Isomaltose 1	33.1	50.0	12.3	24.6
KCCM10770P	Glucose 44 Isomaltose 1	66.5	49.0	7.9	16.1
KCCM10770P::PgapA-agl	Glucose 44 Isomaltose 1	67.0	50.0	8.1	16.2
KCCM11016P	Glucose 40 Isomaltose 5	31.9	45.0	10.8	24.0
KCCM11016P::PgapA-agl	Glucose 40 Isomaltose 5	33.2	50.0	12.4	24.8
KCCM10770P	Glucose 40 Isomaltose 5	61.5	45.0	7.2	16.0
KCCM10770P::PgapA-agl	Glucose 40 Isomaltose 5	66.9	50.0	8.1	16.2

As shown in Table 11, KCCM11016P::PgapA-agl and KCCM10770P::PgapA-agl strains with enhanced Agl protein activity of the present application were prepared in a production medium containing iso-maltose, the control strain KCCM11016P, Compared to KCCM10770P, maltose isomer availability was shown.

Example 8: agl Construction of secreted transgenic vectors

To express the agl gene in a secreted form using the method described in Example 2, a vector was constructed by linking the signal sequences NCgl0801 (SEQ ID NO: 31) and NCgl2101 (SEQ ID NO: 32) between the gapA promoter and the agl gene. Information on the gene encoding the signal sequence and surrounding nucleic acid sequences was obtained from the National Institutes of Health GenBank (NIH GenBank), and the gapA promoter was prepared using SEQ ID NOs: 25 and 37 using the genome of Corynebacterium glutamicum as a template. SEQ ID NO: 31 was amplified using the primers of SEQ ID NOS: 33 and 34, and SEQ ID NO: 32 was amplified using the primers of SEQ ID NOS: 35 and 36. The prepared plasmids were named pDZTn-PgapA-SP0801-agl and pDZTn-PgapA-SP2101-agl in order.

No.	designation	DNA sequence (5'-3')
SEQ ID NO: 33	SP0801-F	CAATCTTTAGAGGAGACAC ATGCAAATAAACCGCCGAG
SEQ ID NO: 34	SP0801-R	cacgcatgttgtttgctgtTGCTCCAAGGGCGTTGGC
SEQ ID NO: 35	SP2101-F	ACAATCTTTAGAGGAGACAC ATGCATTCAAAGGAAGAGTT
SEQ ID NO: 36	SP2101-R	tcacgcatgttgtttgctgt TTGAGCTGCTGCGATGCCGG
SEQ ID NO: 37	PgapA-R	GTGTCTCCTCTAAAGATTGT

Example 9: agl Production of secreted transgenic strain

Using the pDZTn-PgapA-SP0801-agl and pDZTn-PgapA-SP2101-agl vectors prepared in Example 8 using the method described in Example 3, PgapA-SP0801-agl and PgapA-SP2101-agl were added to the KCCM11016P strain. Each of these inserted strains was obtained. The strains thus obtained were named Corynebacterium glutamicum KCCM11016P::PgapA-SP0801-agl and KCCM11016P::PgapA-SP2101-agl in that order. The KCCM11016P::PgapA-SP0801-agl strain was named CM03-1572, and on March 31, 2021, it was internationally deposited at the Korea Center for Microorganism Conservation (KCCM), an international depository under the Budapest Treaty, and was given an accession number as KCCM12968P.

Example 10: In a medium containing maltose or maltose isomers agl Comparison of L-lysine production ability of secretory transgenic strains

The strain prepared in Example 9 was cultured by the method described in Example 4, and the cell mass, sugar consumption capacity, and lysine production capacity were compared (see Example 4, Example 5, and Example 7). The experiment was repeated three times, and the culture results (average values) are shown in Table 13.

strain	production badge	OD 562	Consumed sugar (g/L)	Lysine production (g/L)	Lysine yield (%)
KCCM11016P	Glucose 45	33.9	50.0	12.0	24.0
KCCM11016P::PgapA-SP0801-agl	Glucose 45	33.5	50.0	12.2	24.4
KCCM11016P::PgapA-SP2101-agl	Glucose 45	33.6	50.0	12.1	24.2
KCCM11016P	Glucose 40 Maltose 5	35.0	50.0	11.3	22.6
KCCM11016P::PgapA-SP0801-agl	Glucose 40 Maltose 5	33.4	50.0	12.3	24.6
KCCM11016P::PgapA-SP2101-agl	Glucose 40 Maltose 5	33.3	50.0	12.2	24.4
KCCM11016P	Glucose 40 Isomaltose 5	31.9	45.0	10.8	24.0
KCCM11016P::PgapA-SP0801-agl	Glucose 40 Isomaltose 5	33.5	50.0	12.3	24.6
KCCM11016P::PgapA-SP2101-agl	Glucose 40 Isomaltose 5	33.4	50.0	12.2	24.4

As shown in Table 13, the KCCM11016P::PgapA-SP0801-agl and KCCM11016P::PgapA-SP2101-agl strains with enhanced Agl protein activity of the present application increased lysine compared to the control strain in a production medium containing maltose. Yield is shown. In addition, in the production medium containing maltose isomers (iso-maltose), maltose isomer availability was shown compared to the control strain, KCCM11016P.

From the above description, those skilled in the art to which this application pertains will be able to understand that this application can be implemented in other specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the following patent claims and their equivalent concepts rather than the detailed description above.

[Correction 26.05.2022 under Rule 91]

Claims (15)

1. A microorganism of the genus Corynebacterium sp. that produces amino acids with enhanced Agl protein activity.
2. The microorganism according to claim 1, wherein the Agl protein is a protein comprising SEQ ID NO: 1 or an amino acid sequence having 90% or more sequence homology thereto.
3. The microorganism according to claim 1, wherein the Agl protein is derived from Bifidobacterium adolescentis .
4. The microorganism according to claim 1, wherein the protein is encoded by the agl gene of SEQ ID NO: 2 or a polynucleotide sequence having 90% or more sequence homology thereto.
5. The microorganism according to claim 1, wherein the microorganism uses at least one selected from maltose (maltose) and maltose isomers (isomaltose) as a carbon source.
6. The microorganism according to claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum .
7. The microorganism according to claim 1, wherein the amino acid is L-lysine.
8. A method for producing amino acids comprising culturing the microorganism of any one of claims 1 to 7 in a medium.
9. The method of claim 8, wherein the medium contains at least one selected from maltose (maltose) and maltose isomers (isomaltose).
10. The method of claim 8, wherein the production method comprises recovering the amino acid from the cultured medium or microorganism.
11. The method of claim 8, wherein the amino acid is L-lysine.
12. A method for producing an amino acid-producing microorganism of the genus Corynebacterium comprising enhancing the activity of an Agl protein in the microorganism of the genus Corynebacterium.
13. A composition for amino acid production comprising a microorganism of the genus Corynebacterium or a culture thereof having enhanced Agl protein activity.
14. Use of Agl protein to increase amino acid production.
15. Use of microorganisms of the genus Corynebacterium with enhanced Agl protein activity to increase amino acid production.