WO2022244876A1

WO2022244876A1 - Antitumor agent

Info

Publication number: WO2022244876A1
Application number: PCT/JP2022/020990
Authority: WO
Inventors: 麻衣子松下; 豊服部; 裕河上
Original assignee: 慶應義塾
Priority date: 2021-05-20
Filing date: 2022-05-20
Publication date: 2022-11-24
Also published as: JPWO2022244876A1

Abstract

The purpose of the present invention is to provide a new antitumor agent. Specifically, the present invention uses, as an antitumor agent, T-cells expressing a T-cell receptor including a peptide represented by SEQ ID NO: 1 and a peptide represented by SEQ ID NO: 2, in a T-cell receptor gene introduction T-cell therapy.

Description

antitumor agent

The present invention relates to antitumor agents.

In recent years, T cell receptor (TCR) gene transfer T cell therapy (both TCR-T) has attracted attention as a treatment for tumors. It is a therapeutic method based on the principle that when T cells transfected with a TCR gene consisting of α and β chains recognize an antigen, the T cells are activated and exhibit an antitumor effect (Immunology. 2017, 152 (3) : 357-371.; Science. 2018, 359(6382): 1361-1365.).

CXorf48 is one of cancer testis (CT) antigens. Until now, CXorf48 has been expressed in many tumor cells such as leukemia, multiple myeloma, prostate cancer, and pancreatic cancer, but it has been clarified that in normal cells, strong expression is observed only in spermatogonia. (Blood Cancer J. 2017, 7 (9), e601; Vaccines (Basel). 2020, 8 (4): 579; JP 2013-256454). On the other hand, for CXorf48, an HLA-A*24:02-restricted CXorf48 epitope recognized by T cells has been identified (see Patent Document 1). HLA-A24*02 is an HLA molecule possessed by 60 to 70% of Japanese, and CXorf48 is highly expressed in cancer stem cells (Non-Patent Document 3), and is expressed in various cancers. , are considered promising targets in the treatment of tumors.

An object of the present invention is to provide a novel antitumor agent.

One embodiment of the present invention is a first peptide comprising the following sequence.

MWGVFLLYVSMKMGGTTGQNIDQPTEMTATEGAIVQINCTYQTSGFNGLFWYQQHAGEAPTFLSYNVLDGLEEKGRFSSFLSRSKGYSYLLLKELQMKDSASYLCAVRGVNTGGFKTIFGAGTRLFVKANIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSS（配列番号１）

This first peptide may have 10 or less amino acid mutations and may be a peptide that recognizes CXorf48 or a portion thereof by a T-cell receptor constituting the second peptide described below.

Another embodiment of the present invention is a second peptide comprising the following sequence.

MGIRLLCRVAFCFLAVGLVDVKVTQSSRYLVKRTGEKVFLECVQDMDHENMFWYRQDPGLGLRLIYFSYDVKMKEKGDIPEGYSVSREKKERFSLILESASTNQTSMYLCASSFGKGNEQYFGPGTRLTVTEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG（配列番号２）

This second peptide may have 10 or less amino acid mutations and may be a peptide that recognizes CXorf48 or a portion thereof by the T cell receptor constituting the first peptide.

A further embodiment of the invention is a T-cell receptor comprising a first peptide and a second peptide. The first peptide and/or the second peptide may have up to 10 amino acid mutations and the T cell receptor may recognize CXorf48 or a portion thereof.

A further embodiment of the present invention is a cell expressing the above T cell receptor. This cell may be a T cell.

A further embodiment of the present invention is a DNA encoding the first peptide and/or the second peptide.

A further embodiment of the present invention is an expression vector that expresses the peptide described in the first peptide and/or the second peptide.

A further embodiment of the present invention contains, as an active ingredient, at least one selected from the group consisting of any of the above peptides, any of the above T cell receptors, any of the above DNAs, and any of the above cells. , the composition. The composition may be a pharmaceutical composition or an antineoplastic agent. The antineoplastic agent may be an antineoplastic agent for prostate cancer. It may be co-administered with a DNA demethylating agent.

In a further embodiment of the present invention, the T cell receptor consisting of a peptide having 80% or more homology with SEQ ID NO: 1 and a peptide having 80% or more homology with SEQ ID NO:2 comprises HLA-A24*02 and CXorf48 or a portion thereof.

A further embodiment of the present invention is a T cell receptor consisting of a peptide having 80% or more homology with SEQ ID NO: 1 and a peptide having 80% or more homology with SEQ ID NO:2 pulsed CXorf48 or a portion thereof A method for assaying a T-cell receptor, comprising the step of determining whether it recognizes the cells that have been labeled.

== Cross-reference with related literature ==
This application claims priority based on Japanese Patent Application No. 2021-085406 filed on May 20, 2021, and the basic application is incorporated herein by reference.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows (A) the base sequence inserted into the EcoRI site of the expression vector pMIG and (B) the amino acid sequence encoded by this base sequence in the examples of the present invention. In (A), the EcoRI recognition sequence used for insertion is shown in lower case, the nucleotide sequences encoding the α and β chains of the T-cell receptor are shown in bold, and the nucleotide sequence encoding the T2A sequence is underlined. In (B), the amino acid sequences of the T-cell receptor α and β chains are shown in bold, and the amino acid sequence of the T2A sequence is underlined. FIG. 2 is a schematic diagram of CXorf48-specific dextramers used in the examples of the present invention. (A) Percentage of cells actually expressing the T cell receptor among the cells transfected with the T cell receptor expression vector obtained in the Examples of the present invention (B) T cell receptor expression vector [Fig. 10] A diagram showing the ratio of cells to which CXorf48-specific dextramer bound among cells into which was introduced. FIG. 10 shows the result that T cell receptor-expressing CD8 ⁺ Jurkat cells recognized CXorf48 peptide-pulsed B cells and IL-2 secreted into the supernatant was detected in Examples of the present invention. In the examples of the present invention, administration of the demethylating agent 5-aza-2'-deoxycytidine (DAC) to prostate cancer cell lines markedly enhanced the expression of the CXorf48 gene by RT-PCR. FIG. 10 is a diagram showing the results of the experiment.

M. R. Green & J. Sambrook (Ed.), Molecular cloning, a laboratory manual (4th edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2012); F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J.G. Seidman, J. A. Smith, K. Struhl (Ed.), Current Protocols in Molecular Biology, Use the method described in a standard protocol collection such as John Wiley & Sons Ltd., or a modified or modified method. When using commercially available reagent kits or measurement devices, the attached protocols are used unless otherwise specified.

It should be noted that the objects, features, advantages, and ideas of the present invention are apparent to those skilled in the art from the description of the present specification, and those skilled in the art can easily reproduce the present invention from the description of the present specification. can. DETAILED DESCRIPTION OF THE INVENTION The embodiments and specific examples of the invention set forth below are indicative of preferred embodiments of the invention and are presented by way of illustration or description without the intention that the invention be construed therein. It is not limited. Based on the description herein, it will be apparent to those skilled in the art that various alterations and modifications can be made within the spirit and scope of the invention disclosed herein.

== T cell receptor ==
One embodiment disclosed herein is a first peptide comprising or consisting of SEQ ID NO: 1 as the α chain and a second peptide comprising or consisting of SEQ ID NO: 2 as the β chain. T cell receptor with peptides.

A first peptide consisting of SEQ ID NO: 1:

A second peptide consisting of SEQ ID NO:2:

T cells expressing this T cell receptor can be used for T cell receptor gene transfer T cell therapy against tumors expressing CXorf48, and HLA-A ^* 2402-positive tumors expressing CXorf48. It is useful as an antitumor drug against cells. In addition, the first peptide and the second peptide are, in addition to the peptides of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, extra amino acid sequences, as long as the T cell receptor constituted by them recognizes CXorf48 or a part thereof. may have Although the length of the extra amino acid sequence is not particularly limited, it is preferably 100 or less amino acid residues, more preferably 50 or less amino acid residues, and 20 or less amino acid residues. is more preferred, more preferably 10 or less amino acid residues, and even more preferably 5 or less amino acid residues. In addition, the first peptide and the second peptide may have mutations in their sequences as long as the T cell receptor constituted by them recognizes CXorf48 or a portion thereof. The number of mutated amino acids is not particularly limited, but is preferably 10 or less, more preferably 5 or less, even more preferably 4 or less, even more preferably 3 or less, and 2 It is more preferably less than or equal to 1, more preferably 1. This mutation may be an insertion mutation, a deletion mutation, or a substitution mutation. The partial sequence of CXorf48 is not particularly limited, but preferably contains or consists of DYGMIDESI (SEQ ID NO:5).

T cells expressing this T cell receptor can be produced by introducing into T cells DNAs that express the first peptide and the second peptide, respectively.
==Antineoplastic drug==

The compositions, pharmaceutical compositions, or antineoplastic agents disclosed herein comprise a first peptide or a second peptide, DNA or RNA encoding the first peptide or the second peptide, the first peptide and T cells expressing a T cell receptor comprising the second peptide, or a T cell receptor comprising the first peptide and the second peptide, but comprising the first peptide and the second peptide It is preferred to contain T-cells expressing T-cell receptors comprising:

Tumors to be treated and prevented with this antitumor drug are not limited as long as they express CXorf48, and examples include hepatocellular carcinoma, colon cancer, gastric cancer, non-small cell lung cancer, and breast cancer. , malignant melanoma, glioblastoma, lung cancer, pancreatic cancer, bladder cancer, prostate cancer, leukemia, lymphoma, and multiple myeloma, with prostate cancer being particularly preferred. The primary targets for treatment and prophylaxis are human patients with such tumors, but also non-human vertebrate animals with tumors. In adult animals, the expression of CXorf48 is observed only in spermatogonia, so it is highly specific to tumor cells, and CXorf48 is very effective as a therapeutic target cancer antigen. Also, in myeloid leukemia and prostate cancer, it is known to be highly expressed in cancer stem cells, so this antitumor drug has a high ability to attack cancer stem cells.

A T cell expressing a T cell receptor containing the first peptide and the second peptide introduces DNA or RNA encoding the first peptide and the second peptide into the T cell, and intracellularly produces the first peptide. It can be produced by expressing a peptide and a second peptide. These peptides may be encoded by one DNA or RNA, or may be encoded by separate DNAs or RNAs. DNA or RNA sequences encoding the first and second peptides can be designed by conventional methods. A vector for expressing the first peptide and the second peptide in cells is not particularly limited, and can be selected by those skilled in the art using well-known techniques. Construction of the first peptide and the second peptide can also be performed using well-known gene recombination techniques. In this case, one expression vector may be used to express the first peptide and the second peptide, or each expression vector may be used to express the first peptide and the second peptide. When expressing both in one expression vector, the T2A sequence may be used, for example, as shown in FIG. 1A. The DNA encoding the first peptide and the DNA encoding the second peptide may have the following sequences, but the bases encoding the amino acid sequence of the first peptide and the amino acid sequence of the second peptide, respectively It is not limited to these as long as it is an array.

DNA encoding the first peptide consisting of SEQ ID NO: 1 (SEQ ID NO: 3):

ATGTGGGGAGTTTTCCTTCTTTATGTTTCCATGAAGATGGGAGGCACTACAGGACAAAACATTGACCAGCCCACTGAGATGACAGCTACGGAAGGTGCCATTGTCCAGATCAACTGCACGTACCAGACATCTGGGTTCAACGGGCTGTTCTGGTACCAGCAACATGCTGGCGAAGCACCCACATTTCTGTCTTACAATGTTCTGGATGGTTTGGAGGAGAAAGGTCGTTTTTCTTCATTCCTTAGTCGGTCTAAAGGGTACAGTTACCTCCTTTTGAAGGAGCTCCAGATGAAAGACTCTGCCTCTTACCTCTGTGCTGTGAGAGGGGTGAATACTGGAGGCTTCAAAACTATCTTTGGAGCAGGAACAAGACTATTTGTTAAAGCAAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTAG

DNA encoding the second peptide consisting of SEQ ID NO: 2 (SEQ ID NO: 4):

ATGGGAATCAGGCTCCTCTGTCGTGTGGCCTTTTGTTTCCTGGCTGTAGGCCTCGTAGATGTGAAAGTAACCCAGAGCTCGAGATATCTAGTCAAAAGGACGGGAGAGAAAGTTTTTCTGGAATGTGTCCAGGATATGGACCATGAAAATATGTTCTGGTATCGACAAGACCCAGGTCTGGGGCTACGGCTGATCTATTTCTCATATGATGTTAAAATGAAAGAAAAAGGAGATATTCCTGAGGGGTACAGTGTCTCTAGAGAGAAGAAGGAGCGCTTCTCCCTGATTCTGGAGTCCGCCAGCACCAACCAGACATCTATGTACCTCTGTGCCAGCAGTTTCGGCAAAGGTAACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTCACAGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTGTGCCTGGCCACAGGCTTCTACCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCTGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCTTGCTAGGGAAGGCCACCTTGTATGCCGTGCTGGTCAGTGCCCTCGTGCTGATGGCCATGGTCAAGAGAAAGGATTCCAGAGGCTAG

The T cells into which DNA or RNA is introduced are not particularly limited, but are preferably cells of the patient himself/herself. For example, mature T cells, blood stem cells, or pluripotent stem cells may be used. In the case of stem cells, DNA or RNA may be introduced to express the T cell receptor. is preferably differentiated into mature T cells. Mature T cells may be CD8 positive cytotoxic T cells (CTL) or CD4 positive helper T cells and the like.

Regarding the site of administration of the T cells, intradermal administration, subcutaneous administration, intravenous administration, lymph node administration, intraperitoneal administration, etc. are possible, and although not particularly limited, intravenous administration is preferable. Alternatively, in the case of cytotoxic T cells, intratumoral administration is preferred as it can directly attack cells expressing the antigen.

The T cells obtained in this manner may be used as they are after isolation, or may be further cultured in the presence of an interleukin such as IL-2, an antigen-presenting cell, and a peptide consisting of sequence 1. may be used. This manipulation can enhance T cell cytotoxicity.

When administering this antitumor drug to cancer patients, a DNA demethylating agent may be co-administered. A DNA demethylating agent enhances the expression level of CXorf48 in tumor cells, but does not affect the expression level of CXorf48 in normal cells. Conceivable. Examples of DNA demethylating agents include, but are not limited to, 5-azacytidine and 5-aza-2'-deoxycytidine. As used herein, the term "co-administration" refers to administering the other while one effect is occurring, and may be a combination drug, but may be administered independently, or , administration may be simultaneous, but may be administered at different times.

== Methods for Screening T-Cell Receptors for Use in T-Cell Receptor Transgenic T-Cell Therapy ==
Based on the first peptide and the second peptide, new peptides can be identified for use in T cell receptor transgenic T cell therapy. First, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more homology to the first peptide consisting of SEQ ID NO: 1 and / or the second peptide consisting of SEQ ID NO: 2 Design a first variant peptide and/or a second variant peptide with The base sequence of DNA encoding the designed mutant peptide is determined, and the DNA is produced. It can be produced by conventional gene recombination technology. These DNAs are introduced into cells to express the first mutant peptide and the second mutant peptide in the same cell to form a mutant T cell receptor in the cell. At this time, one of them may be the original first peptide or the second peptide that has not been mutated.

Next, we will examine whether the formed mutant T cell receptor can be used for T cell receptor gene transfer T cell therapy against tumors expressing CXorf48. The method of examination is not particularly limited, but any method that allows a person skilled in the art to see the results and determine whether it can be used for the production of an antitumor agent. For example, determine whether the mutant T-cell receptor binds to a complex of HLA-A24*02 and CXorf48 or a portion thereof, or whether it recognizes cells pulsed with CXorf48 or a portion thereof. By doing so, we can know whether it can be used for T cell receptor gene transfer T cell therapy. Mutant T-cell receptors determined to be useful for T-cell receptor gene-transferred T-cell therapy can then be transferred to the next stage, such as clinical trials. The partial sequence of CXorf48 is not particularly limited, but preferably contains or consists of DYGMIDESI (SEQ ID NO:5).

By applying this method, it is also possible to screen T-cell receptors for use in T-cell receptor gene transfer T-cell therapy. That is, in a T-cell receptor library containing a plurality of mutant T-cell receptors, each mutant T-cell receptor is assayed for its applicability to T-cell receptor transgenic T-cell therapy as described herein. Mutant T-cell receptors for use in T-cell receptor transgenic T-cell therapy can be identified from among T-cell receptor libraries.

(1) Formation of T cell receptor The base sequence shown in Fig. 1A was inserted into the EcoRI site of the expression vector pMIG to prepare a T cell receptor expression vector. This nucleotide sequence encodes the peptide shown in FIG. 1B, and consists of α chain, T2A sequence, and β chain linked from the N-terminal side. Upon intracellular expression, the T2A sequence is cleaved, resulting in α and β chains that combine to form the T cell receptor.

This T-cell receptor expression vector is introduced into PLAT-A cells and packaged into retroviruses, and the cell supernatant containing the retroviruses is transferred to Jurkat 76.7 cells (from Osaka University, Dr. Fumihiro Fujiki and Dr. Soyoko Morimoto). The retrovirus was added to the culture medium of the donor), and the retrovirus was introduced into Jurkat 76.7 cells to obtain T cell receptor-expressing CD8 ⁺ Jurkat cells. The Jurkat 76.7 cell is a Jurkat cell line lacking the expression of the endogenous T-cell receptor β-chain and highly expressing CD8.

(2) Binding to CXorf48-Specific Dextramer A CXorf48-specific dextramer as shown in FIG. 2 was synthesized (commissioned to Immudex). An HIV-specific dextramer (Immudex) was used as a comparative example.

A CXorf48-specific dextramer was allowed to bind to the T cell receptor-expressing CD8 ⁺ Jurkat cells prepared in (1) and analyzed by a flow cytometer (FACS). Specifically, T cell receptor-expressing CD8 ⁺ Jurkat cells were suspended in 5% FBS-containing PBS, and phycoerythrin (PE)-labeled CXorf48-specific dextramer or HIV-specific dextramer was added for 15 minutes at room temperature. reacted. Subsequently, allophycocyanin (APC)-labeled anti-CD8 antibody was added and allowed to react on ice for 20 minutes, then the cells were washed with 5% FBS-containing PBS, resuspended in 5% FBS-containing PBS, and subjected to FACS. Fluorescence intensity from PE and APC was measured.

As a result, as shown in Figure 3, T cell receptor expression was observed in about 16.7% of the cells (Figure 3A), and CXorf48-specific dextramer bound to about 6.61% of the cells (Figure 3A). 3B). No binding was detected when an HIV-specific dextramer was used as a control.

Thus, the T cell receptor of the present disclosure can specifically bind to CXorf48 on cells.

(3) Reactivity of CXorf48-specific TCR-T cells In this example, T-cell receptor-expressing CD8 ⁺ Jurkat cells recognized cells pulsed with a CXorf48 peptide (DYGMIDESI: SEQ ID NO: 5) consisting of a portion of CXorf48. and release IL-2, an inflammatory cytokine.

4 μg/mL of CXorf48 peptide was added to HLA-A*2402-positive human B cell line C1R-A24 and left at 37° C. for 1 hour to pulse the cells with CXorf48 peptide. After incubating these cells with Phorbol-12-myristate-13-acetate (PMA)-supplemented T-cell receptor-expressing CD8 ⁺ Jurkat cells (denoted as J767-TCR1 in FIG. 4) for 24 hours, the T-cell receptor The amount of IL-2 in the culture supernatant secreted by the expressing CD8 ⁺ Jurkat cells upon recognition of C1R-A24 was measured by ELISA using an anti-IL-2 antibody (denoted as C1R-A24+CXorf48peptide in FIG. 4). ). As a control, experiments were performed using DMSO or HIV peptide (RYLRDQQLL: SEQ ID NO: 6) instead of CXorf48 peptide (denoted as C1R-A24+DMSO and C1R-A24+HIVpeptide in FIG. 4). As a control on the T cell receptor side, CD8 ⁺ Jurkat cells transfected with a GFP expression vector without the TCR gene (denoted as J767empty in FIG. 4) were used.

As a result, IL-2 was detected in the supernatant only when T cell receptor-expressing CD8 ⁺ Jurkat cells and CXorf48 peptide-pulsed C1R-A24 were combined, as shown in FIG. It was confirmed that expressing CD8 ⁺ Jurkat cells recognize CXorf48 peptide-bound B cells.

Thus, T-cell receptor-expressing CD8 ⁺ Jurkat cells express the T-cell receptor of the present disclosure, thereby enabling them to recognize CXorf48 peptide-binding B cells. Accordingly, T-cell receptor-expressing T-cells that express the T-cell receptors of the present disclosure are useful for T-cell receptor-expressing T-cell therapy.

(4) Effect of demethylating agent This example shows that administration of a demethylating agent to cancer cells enhances the expression of CXorf48.

5-aza-2'-deoxycytidine (DAC), a demethylating agent, was added to the culture medium of prostate cancer cell lines LNCaP, DU145, and PC3 cells at a final concentration of 200 nM, and cultured for 48 hours. , the expression of the CXorf48 gene was examined by RT-PCR (indicated by DAC+ in FIG. 5). As a control, the expression of the CXorf48 gene was examined in cells similarly cultured in a medium without DAC (indicated by DAC- in FIG. 5). In addition, the leukemia cell line K562 was used as a positive control. As an internal standard, the expression of the GAPDH gene was examined at the same time. The primer sequences used for PCR are as follows.

CXorf48-F (forward): 5-gttgtgcctcgccatctttatg-3' (SEQ ID NO: 7)

CXorf48-R (reverse): 5-tgcactggggtgatagaaatcg-3' (SEQ ID NO: 8)

GAPDH-F (forward): 5-tgaacgggaagctcactgg-3' (SEQ ID NO: 9)

GAPDH-R (reverse): 5-tccaccaccctgttgctgta-3' (SEQ ID NO: 10)

As a result, as shown in Figure 5, when cultured in a medium containing DAC, the expression of the CXorf48 gene was significantly increased.

Since the antitumor agent disclosed herein targets CXorf48, it is believed that simultaneous administration of a demethylating agent enhances the effect of the antitumor agent.

The present invention has made it possible to provide a novel antitumor agent.

Claims

A first peptide comprising the sequence:
MWGVFLLYVSMKMGGTTGQNIDQPTEMTATEGAIVQINCTYQTSGFNGLFWYQQHAGEAPTFLSYNVLDGLEEKGRFSSFLSRSKGYSYLLLKELQMKDSASYLCAVRGVNTGGFKTIFGAGTRLFVKANIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSS（配列番号１）
A second peptide comprising the sequence:
MGIRLLCRVAFCFLAVGLVDVKVTQSSRYLVKRTGEKVFLECVQDMDHENMFWYRQDPGLGLRLIYFSYDVKMKEKGDIPEGYSVSREKKERFSLILESASTNQTSMYLCASSFGKGNEQYFGPGTRLTVTEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG（配列番号２）
having no more than 10 amino acid mutations,
The T-cell receptor that constitutes the second peptide of claim 2 recognizes CXorf48 or a portion thereof,
A first peptide according to claim 1 .
having no more than 10 amino acid mutations,
A T-cell receptor that constitutes the first peptide of claim 1 recognizes CXorf48 or a portion thereof,
A second peptide according to claim 2 .
A T cell receptor comprising the first peptide according to claim 1 and the second peptide according to claim 2.
The first peptide and / or the second peptide has no more than 10 amino acid mutations,
recognizes CXorf48 or a portion thereof;
6. The T cell receptor of claim 5.
A DNA encoding the first peptide according to claim 1 or 3 and/or the second peptide according to claim 2 or 4.
An expression vector that expresses the first peptide according to claim 1 or 3 and/or the second peptide according to claim 2 or 4.
A cell expressing the T cell receptor according to claim 5 or 6.
The cell according to claim 9, which is a T cell.
Selected from the group consisting of the peptide of any one of claims 1 to 4, the T cell receptor of claim 5 or 6, the DNA of claim 7, and the cell of claim 9 or 10 A composition containing as an active ingredient at least one of
Selected from the group consisting of the peptide of any one of claims 1 to 4, the T cell receptor of claim 5 or 6, the DNA of claim 7, and the cell of claim 9 or 10 A pharmaceutical composition containing as an active ingredient at least one of
Selected from the group consisting of the peptide of any one of claims 1 to 4, the T cell receptor of claim 5 or 6, the DNA of claim 7, and the cell of claim 9 or 10 as an active ingredient, an anti-tumor agent.
The antitumor drug according to claim 13, which is an antitumor drug against prostate cancer.
The antitumor drug according to claim 13 or 14, which is co-administered with a DNA demethylating agent.
A T cell receptor consisting of a peptide having 80% or more homology with SEQ ID NO: 1 and a peptide having 80% or more homology with SEQ ID NO: 2, in a complex of HLA-A24*02 and CXorf48 or a part thereof A method for assaying a T-cell receptor comprising the step of determining whether it binds.
Whether the T cell receptor consisting of a peptide having 80% or more homology with SEQ ID NO: 1 and a peptide having 80% or more homology with SEQ ID NO: 2 recognizes cells pulsed with CXorf48 or a portion thereof. A method for assaying a T-cell receptor comprising the step of examining.