WO2022239916A1 - Novel bifidobacterium longum strain and use thereof - Google Patents

Abstract

The present invention relates to a novel Bifidobacterium longum strain and use thereof and, more particularly, to a novel Bifidobacterium longum subsp. Infantis YB0411 strain having anti-obesity activity, and a pharmaceutical composition, a health functional food, a cosmetic composition, a feed composition, a reagent composition, or the like for anti-obesity use, comprising a culture of the strain. The strain culture of Bifidobacterium longum subsp. Infantis YB0411 with the accession number of KCTC14393BP of the present invention has an inhibitory effect on the maturation process of pre-adipocytes into adipocytes. Thus, the strain culture can be applied for use in an anti-obesity pharmaceutical composition, health functional food, cosmetic composition, feed composition, reagent composition, and the like. Furthermore, when pre-adipocytes are treated with the strain culture of the present invention, the maturation of the pre-adipocytes into adipocytes may be inhibited, and thus the present invention can be actively utilized for research on the development of therapeutic agents related to obesity or the like.

Description

Novel Bifidobacterium longum strains and uses thereof

The present invention relates to a novel Bifidobacterium longum strain and its use, and more specifically, to a novel Bifidobacterium longum infantis having anti-obesity activity ( Bifidobacterium longum subsp. Infantis ) YB0411 strain And pharmaceutical compositions, health functional foods, cosmetic compositions, feed compositions and reagent compositions for anti-obesity use containing the culture of the strain.

Adipose tissue is a central tissue for maintaining systemic homeostasis, and excessive accumulation of white adipose tissue causes obesity. The conversion process from immature pre-adipocytes to adipocytes is called adipogenesis, and this process is regulated by several factors including hormonal signals and various transcriptional factors.

In the early stages of adipogenesis, adipogenic hormone stimulation is required to induce expression of early transcription factors such as CCAAT/enhancer-binding protein (C/EBP)-β and -δ, together with suppression of Wnt/β-catenin signaling. do. As a result, after the expression of these early genes, mid-stage adipogenesis stimulation stimulates master regulators, peroxisome prolifertor-activated receptor γ (PPARγ) and C/EBPα, and adiponectin and fatty acid-binding required for final differentiation and adipocyte formation. This leads to the expression of protein 4 (FABP4).

On the other hand, Korean Patent Publication No. 10-2019-0118985 discloses adipocyte differentiation inhibitory activity as an anti-obesity effect of Bifidobacterium longum strain. Although it is suggested that the expression of the gene is significantly increased compared to the untreated control, this is related to the brown adiposity of white adipocytes.

[Prior art literature]

[Patent Literature]

(Patent Document 1) KR10-2019-0118985A

An object to be solved by the present invention is to provide a novel Bifidobacterium longum strain that inhibits the maturation of pre-adipocytes into adipocytes.

In addition, the problem to be solved in the present invention is to provide a pharmaceutical composition for anti-obesity use, health functional food, cosmetic composition, feed composition and reagent composition containing the strain culture.

In addition, an object to be solved in the present invention is to provide a method of inhibiting maturation into adipocytes by treating the strain culture to isolated pre-adipocytes.

In order to solve the above problems, the present invention provides a Bifidobacterium longum subsp. Infantis YB0411 strain, accession number KCTC14393BP.

In addition, the present invention provides a pharmaceutical composition for preventing or treating obesity containing a culture of Bifidobacterium longum subsp .

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

In addition, the present invention provides a health functional food for preventing or improving obesity, including a culture of Bifidobacterium longum subsp .

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

In addition, the present invention provides a cosmetic composition for slimming comprising a culture of Bifidobacterium longum subsp. Infantis YB0411 strain having accession number KCTC14393BP.

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

The cosmetic composition is preferably a formulation selected from the group consisting of lotion, lotion, cream, essence, foam and pack.

In addition, the present invention provides a feed composition for the prevention or improvement of obesity (obesity) comprising a culture of Bifidobacterium longum subsp .

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

In addition, the present invention is for inhibiting the maturation of pre-adipocytes into adipocytes, including the culture of Bifidobacterium longum subsp. A reagent composition is provided.

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

In addition, the present invention is a pre-adipocyte comprising treating a culture of Bifidobacterium longum subsp. It provides a method for inhibiting maturation into adipocytes.

Since the culture of Bifidobacterium longum subsp. Infantis YB0411 strain, accession number KCTC14393BP of the present invention, has the effect of inhibiting the maturation process in which pre-adipocytes are converted into adipocytes, it is anti-obesity It can be applied for purposes such as pharmaceutical compositions, health functional foods, cosmetic compositions, feed compositions, and reagent compositions, and furthermore, when pre-adipocytes are treated with the strain culture of the present invention, maturation into adipocytes can be inhibited. It can also be actively used in research on the development of related treatments such as obesity.

Figure 1 is a schematic diagram showing the screening process of Bifidobacterium longum subsp .

Figure 2 is the accession number KCTC14393BP of the present invention Bifidobacterium longum infantis ( Bifidobacterium longum subsp. Infantis ) The culture of strain YB0411 treated at various concentrations for 24, 48 and 72 h, the results of evaluating cell proliferation by MTT it is shown

Figure 3 is ORO staining the accumulation of intracellular neutral fat after treating the culture of Bifidobacterium longum subsp. is the result of evaluation. Results are expressed as mean ± SEM (n = 3), and significant differences are presented as (***) P < 0.001, (**) P < 0.01, (*) P < 0.05. Here, PA: Pre-adipocytes, MDI: Methylisobutylxanthine-Dexamethasone-Insulin, Rosi: Rosiglitazone, MRS: MRS medium, YB: B. longum subsp. Infantis YB0411 Each represents a cultural supernatant.

Figure 4 shows the pre-adipogenesis process (adipogenesis) early and late stage marker Cebp of pre-adipocytes after treating the culture of Bifidobacterium longum subsp. / β , Cebp/α , Cebp/δ , Pparγ , aP2 and adiponectin mRNA expression patterns are shown. Results are expressed as mean ± SEM (n = 3), and significant differences are presented as (***) P < 0.001, (**) P < 0.01, (*) P < 0.05. Here, PA: Pre-adipocytes, MDI: Methylisobutylxanthine-Dexamethasone-Insulin, Rosi: Rosiglitazone, MRS: MRS medium, YB: B. longum subsp. Infantis YB0411 Each represents a cultural supernatant.

Figure 5 shows the pre-adipogenesis process (adipogenesis) marker CEBP/ of pre-adipocytes after treating the culture of Bifidobacterium longum subsp. Protein expression patterns of α, CEBP/β, PPARγ, AP2 and SIRT1 are shown. Results are expressed as mean ± SEM (n = 3), and significant differences are presented as (***) P < 0.001, (**) P < 0.01, (*) P < 0.05. Here, PA: Pre-adipocytes, MDI: Methylisobutylxanthine-Dexamethasone-Insulin, Rosi: Rosiglitazone, MRS: MRS medium, YB: B. longum subsp. Infantis YB0411 Each represents a cultural supernatant.

Figure 6 shows the protein expression immunofluorescence image (magnification = 260 X) of CEBP/β after treating the culture of Bifidobacterium longum subsp. .

7 shows an immunofluorescence image (magnification = 360 X) of PPARγ protein expression after treating a culture of Bifidobacterium longum subsp .

Hereinafter, the present invention will be described in detail.

The inventors of the present invention tested the anti-obesity effect from various lactic acid bacteria cultures for the development of a novel anti-obesity treatment, and in the culture of Bifidobacterium longum subsp. The present invention was completed after confirming that there is an activity of inhibiting the maturation of pre-adipocytes into adipocytes.

Accordingly, the present invention provides a Bifidobacterium longum subsp. Infantis YB0411 strain with accession number KCTC14393BP.

The novel Bifidobacterium longum infantis of the present invention ( Bifidobacterium longum subsp. Infantis ) YB0411 strain was published on November 30, 2020 by the Korea Research Institute of Bioscience and Biotechnology (Korean Collection for Type Cultures, Korea Research Institute of Bioscience and Biotechnology) ) under the accession number KCTC14393BP.

The culture of Bifidobacterium longum subsp. Infantis YB0411 strain, accession number KCTC14393BP of the present invention, can be applied for anti-obesity purposes because it has the effect of inhibiting the maturation process of pre-adipocytes into adipocytes. have.

Specifically, the culture of Bifidobacterium longum subsp. Infantis YB0411 strain (1 μl / ml or 5 μl / ml) of the present invention, accession number KCTC14393BP, is treated with pre-adipocytes for 24 to 72 hours. No cytotoxicity was observed even in the case of

In addition, when the culture (1 μl / ml or 5 μl / ml) of Bifidobacterium longum subsp. It was confirmed that there was almost no accumulation of neutral fat.

In addition, when the culture of Bifidobacterium longum subsp. Infantis YB0411 strain of the present invention, accession number KCTC14393BP, is treated with pre-adipocytes, early and late stage markers of adipogenesis, Cebp/ β , Cebp/α , Cebp/δ , Pparγ , aP2 and adiponectin mRNA expression significantly decreased.

In addition, when the culture of Bifidobacterium longum subsp. Infantis YB0411 strain, accession number KCTC14393BP of the present invention, is treated with pre-adipocytes, adipogenesis markers CEBP/α and CEBP/β , it was confirmed that the protein expression of PPARγ, AP2 and SIRT1 was significantly decreased.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating obesity, containing a culture of Bifidobacterium longum subsp .

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

The pharmaceutical composition comprising the culture of Bifidobacterium longum subsp. It can be formulated and used in various forms such as oral formulations such as capsules, suspensions, emulsions, syrups, and aerosols, and injections of sterile injection solutions. It can be administered through various routes.

These pharmaceutical compositions may further include carriers, excipients, or diluents, and examples of suitable carriers, excipients, or diluents that may be included include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, Starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. etc. can be mentioned. In addition, the pharmaceutical composition of the present invention may further include fillers, anti-agglomerating agents, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, and the like.

As a preferred embodiment, solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the pharmaceutical composition, for example, starch, calcium carbonate, It is formulated by mixing sucrose, lactose, gelatin, etc. In addition, lubricants such as magnesium stearate and talc may be used in addition to simple excipients.

As a preferred embodiment, liquid preparations for oral use may include suspensions, internal solutions, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, Fragrance, preservatives, etc. may be included.

As a preferred embodiment, preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, suppositories, and the like. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Conventional additives such as solubilizers, tonicity agents, suspending agents, emulsifiers, stabilizers, preservatives and the like may be included in the injection.

The culture of YB0411 strain of Bifidobacterium longum subsp. Infantis , accession number KCTC14393BP of the present invention, is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type, severity, drug activity, It may be determined according to factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.

As a preferred embodiment, in the pharmaceutical composition of the present invention, the effective amount of the culture of Bifidobacterium longum subsp. Generally, 1 to 5,000 mg, preferably 100 to 3,000 mg per kg of body weight may be administered daily or every other day or divided into 1 to 3 times a day. However, since it may increase or decrease according to the route of administration, severity of disease, sex, weight, age, etc., the dosage is not limited to the scope of the present invention in any way.

The pharmaceutical composition of the present invention may be administered to a subject through various routes. All modes of administration can be envisaged, for example by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

In the present invention, "administration" means providing a predetermined substance to a patient by any suitable method, and the route of administration of the pharmaceutical composition of the present invention is oral or parenteral through all common routes as long as it can reach the target tissue. can be administered orally. In addition, the composition of the present invention may be administered using any device capable of delivering active ingredients to target cells.

In the present invention, "subject" includes, but is not particularly limited to, for example, human, monkey, cow, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit or guinea pig. and, preferably, a mammal, more preferably a human.

In addition, the present invention provides a health functional food for preventing or improving obesity, including a culture of Bifidobacterium longum subsp .

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

The health functional food of the present invention can be used in a variety of ways, such as foods and beverages effective for preventing or improving obesity. The health functional food of the present invention includes, for example, various foods, beverages, gum , tea, There are vitamin complexes, health supplements, etc., and can be used in the form of powder, granules, tablets, capsules or beverages.

The culture of Bifidobacterium longum subsp. Infantis YB0411 strain, accession number KCTC14393BP of the present invention, can generally be added in an amount of 0.01 to 15% by weight of the total food weight, and the health drink composition is based on 100 ml It may be added at a rate of 0.02 to 10 g, preferably 0.3 to 1 g.

In addition to containing the above compound as an essential component in the indicated ratio, the health functional food of the present invention may contain food additives such as natural carbohydrates and various flavors as additional components.

Examples of the natural carbohydrate include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.

As the flavoring agent, natural flavoring agents such as stevia such as thaumatin, rebaudioside A or glycyrrhizin, and synthetic flavoring agents such as saccharin and aspartame may be used. The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 ml of the health functional food of the present invention. In addition to the above, the health functional food of the present invention is various nutrients, vitamins, minerals, flavors such as synthetic flavors and natural flavors, colorants and enhancers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloids It may contain thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, and the like. In addition, the health functional food of the present invention may contain fruit flesh for production of natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is generally selected from the range of 0.01 to about 20 parts by weight per 100 parts by weight of delphinidin and pharmaceutically acceptable salts thereof of the present invention.

In addition, the present invention provides a cosmetic composition for slimming comprising a culture of Bifidobacterium longum subsp. Infantis YB0411 strain having accession number KCTC14393BP.

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

The "slimming" refers to a phenomenon in which the volume of the entire body or a specific region is reduced, and for example, it may be the removal or reduction of fat in the entire body or a specific region.

The active ingredient of the cosmetic composition of the present invention may be included in an amount of 0.01 to 50% by weight, preferably 0.1 to 20% by weight, more preferably 1 to 10% by weight, based on the total weight of the composition. Appropriate formulation stability can be secured within this content range, and a desired slimming effect can be expected.

The composition of the present invention, in addition to the active ingredient of the present invention, can be used by further including known natural extracts or other ingredients for the effects of antioxidant, anti-aging, moisturizing, and skin regeneration promotion within the range that does not inhibit the effective activity of the present invention. can

In addition, the composition may include ingredients commonly added to cosmetic compositions, for example, fatty substances, organic solvents, solubilizers, thickeners, gelling agents, softeners, antioxidants, suspending agents, stabilizers, foaming agents, Cosmetics such as fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, humectants, essential oils, dyes, pigments, hydrophilic or lipophilic actives; It can be molded into a specific dosage form including adjuvants or carriers commonly used in the field of dermatology.

The cosmetic composition of the present invention can be prepared in any formulation commonly prepared in the art, for example, solution, suspension, emulsion, paste, gel, cream, lotion, powder, pack, soap, surfactant- It may be formulated as containing cleansing, oil and spray, etc., but is not limited thereto. More specifically, lotion, lotion, softening lotion, nourishing lotion, cream, nourishing cream, massage cream, essence, eye cream, powder foundation, emulsion foundation, wax foundation, cleansing cream, foam, cleansing foam, cleansing water, pack , Spray, powder, pact, lip gloss, lipstick, shadow, may be prepared in formulations such as shampoo and rinse.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additionally chlorofluorohydrocarbon, propellants such as propane/butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent or emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, fatty acid esters of glycerol, polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Star cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.

When the formulation of the present invention is surfactant-containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide Ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used.

In addition, the present invention provides a feed composition for the prevention or improvement of obesity (obesity) comprising a culture of Bifidobacterium longum subsp .

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

In the present invention, the term "feed" may refer to any natural or artificial diet, one meal, etc., or a component of the one meal meal, for or suitable for eating, ingesting, and digesting by an animal. The type of feed is not particularly limited, and feeds commonly used in the art may be used. Non-limiting examples of the feed include vegetable feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products, proteins, inorganic materials, and animal feeds such as oils and fats, mineral oils, fats and oils, unicellular proteins, zooplankton, or food. These may be used alone or in combination of two or more.

In addition, the present invention is for inhibiting the maturation of pre-adipocytes into adipocytes, including a culture of Bifidobacterium longum subsp. A reagent composition is provided.

The culture is preferably selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.

The reagent composition may be applied as a reagent composition for research, for example. The reagent composition of the present invention can be administered to cells or laboratory animals under normal laboratory conditions, and specific administration methods and safety rules are preferably carried out according to the internal regulations of each laboratory of the experimenter.

In addition, the present invention is a pre-adipocyte comprising treating a culture of Bifidobacterium longum subsp. It provides a method for inhibiting maturation into adipocytes.

The pre-adipocytes are those isolated from a subject by natural or artificial methods. The cells isolated from the subject may be cultured for several days to several weeks under appropriate culture conditions, and in some cases may be cryopreserved.

A method of administering the active ingredient of the present invention to the isolated cells is obvious to those skilled in the art, and may be preferably followed as described in the following examples of the present specification.

Hereinafter, the present invention will be described in more detail through specific examples. The following examples describe a preferred embodiment of the present invention, and it is clear that the scope of the present invention is not construed as being limited by the matters described in the following examples.

[Example]

1. Materials and Methods

1.1. chemicals and reagents

Dexamethasone, Isobutyl-1-metylxanthine (IBMX), Insulin, Rosiglitazone (ROSI), Oil Red O dye, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and 4% formaldehyde was purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco's modified Eagle's medium (DMEM) and newborn calf serum (NBCS) were purchased from Gibco (Grand Island, NY, USA). Fetal bovine serum was purchased from Atlas Biologicals (Fort Collins, CO, USA). Penicillin-streptomycin solution was manufactured by Hyclone Laboratories, Inc. (South Logan, NY, USA). Antibodies against C/EBPβ, C/EBPα, PPARγ, AP2 and SIRT1 were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against β-actin were purchased from Abcam (Cambridge, MA, USA). BCA protein assay kit was purchased from Thermo Scientific (Rockford, IL, USA), and protein loading buffer was purchased from Bio-Rad Laboratories, Inc. (Hercules, CA, USA). A lipolysis assay kit was purchased from Biovision (Milpitas, CA, USA).

1.2. Cell culture, differentiation and treatment

3T3-L1 mouse embryo fibroblasts were obtained from the Korean Cell Line Bank (KCLB-10092.1), and 10% (v/v) heat-inactivated NCS and 1% (v/v) antibiotic/antimycotic solution (100 U/ml penicillin, In a high-glucose DMEM medium supplemented with 100 U/ml streptomycin), the cells were cultured at 37° C. in a humidified incubator containing 5% CO ₂ . 3T3-L1 pre-adipocyte differentiation was induced by replacement with DMEM (MDI) containing 10% fetal bovine serum (FBS), 0.5 mM IBMX, 1 μM dexamethasone and 10 μg/ml insulin. After 2 days, the MDI medium was replaced with DMEM supplemented with 10% FBS and 10 μg/ml insulin. After 5-7 days of induction of differentiation, about 90% of pre-adipocytes were converted into round-shaped mature adipocytes. The insulin-fed medium was changed every 2 days.

1.3. Cell viability assay

3T3-L1 pre-adipocytes were seeded, grown on a 96-well plate at a density of 1×10 ⁴ cells/well, and treated with strain cultures at various concentrations for the indicated times. After incubation was complete, 20 μl of 5 mg/ml MTT solution was added, and the cells were incubated at 37° C. for 3 hours. The obtained formazan crystals were dissolved in 150 μl of DMSO, and absorbance was measured at 590 nm using a Victor™ X3 multilabel reader (Perkin Elmer, Waltham, MA, USA).

1.4. Isolation and identification of lactic acid bacteria

For the isolation of various lactic acid bacteria, MRS medium was used under absolutely anaerobic conditions, and oxygen present in the medium was removed using N ₂ gas for anaerobic conditions, followed by sterilization. 0.1 g of the collected fecal sample was suspended in 10 ml MRS medium, diluted in stages, and 100 μl each was spread on MRS plate medium or blood agar medium, and cultured at 37 ° C. for 2 days under anaerobic conditions. As a result, the resulting single colony was subcultured, pure isolated, long-term preserved, and used.

For molecular biological identification of the isolated lactic acid bacteria, universal primers targeting the 16S rRNA gene, 27F (5'-AGA GTT TGA TCM TGG CTC A-3': SEQ ID NO: 1) and 1492R (5'-TAC GGY TAC CTT GTT ACG ACT T-3': SEQ ID NO: 2) was used, and sequencing of the 16S rRNA gene was performed. The nucleotide sequences obtained from the analysis were confirmed through identification search on EZbiocloud (http://www.ezbiocloud.net/).

1.5 Evaluation of anti-obesity activity

To investigate anti-obesity activity, 3T3-L1 cells were mixed with 10% NBCS and 1% penicillin-streptomycin in DMEM GlutaMax and cultured in a 5% CO ₂ incubator at 37 °C. When the cell concentration of 3T3-L1 cells reaches 70-80%, they are seeded into 48-well plates. When the cell concentration reached 100%, it was changed to adipocyte differentiation medium MDI (Insulin, Dexamethasone, Isobutyl-1-methylxanthine (IBMX)). On Day 2, insulin, insulin and ROSI, insulin and sample (strain culture medium) were treated, and on Day 4, only insulin was treated. And, on day 6, cells were fixed without sample treatment. At this time, for the anti-obesity effect of the lactic acid bacteria solution, 1, 5, and 10 μl of the sample were added to the medium on Days 0 and 2, respectively. The MDI was changed every 2 days during cell differentiation. The day when the cell concentration was 100% was designated as Day 0, and on Day 0, MDI, ROSI and MDI, and sample and MDI were configured and treated. In this experiment, three independent repetitions were conducted for each sample.

1.6. Oil Red O staining

After 6 days of differentiation, cells were washed with 1x PBS, fixed with 10% formalin for at least 1 hour, and stained with 0.3% filtered Oil Red O solution for 15 minutes. The stained cells were thoroughly rinsed with distilled water, and phenotypic changes of fully differentiated cells were photographed with an Axiovert-25 microscope (Carl Zeiss, Jena, Germany). Images of the entire culture well were captured using a Canon 6D digital camera. To quantify the amount of Oil Red O, the stained cells were eluted with 100% isopropanol, and absorbance was measured at 520 nm using Victor™ X3.

1.7. Quantitative reverse transcription-polymerase chain reaction (RT-PCT) assay

Total RNA was extracted using an RNA extraction kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions, and the concentration was measured using a scandrop analytik jena AG spectrophotometer (Jena, Germany). To apply total RNA (1 μg) to reverse transcription-polymerase chain reaction (RT-PCR), cDNA was synthesized with Maxime RT PreMix kit (Intron Biotechnology, Seoul, Korea), and Veriti 96-Well Thermal Cycler (Applied Biosystems , Singapore). Quantitative real-time PCR was performed using the iQ ^TM SYBR Green Supermix kit (Bio-Rad, Singapore) on a CFX96 ^TM Real-Time PCR detection system (Bio-Rad, Singapore). The sequences of the primers used in this study are shown in Table 1. The target gene expression level was normalized to Tbp .

name	Primer sequence (5'→3')
	sense	antisense
Tbp	GAAGCTGCGGTACAATTCCAG (SEQ ID NO: 3)	CCCCTTGTACCCTTCACCAAT (SEQ ID NO: 4)
Pparg	TTTGAAAGAAGCGGTGAACCAC (SEQ ID NO: 5)	ACCATTGGGTCAGCTCTTGTG (SEQ ID NO: 6)
Cebpb	CAAGCTGAGCGACGAGTACA (SEQ ID NO: 7)	CAGCTGCTCCACCTTCTTCT (SEQ ID NO: 8)
Cebpa	GAGCCGAGATAAAGCCAAACA (SEQ ID NO: 9)	CGGTCATTGTCACTGGTCAACT (SEQ ID NO: 10)
Cebpd	ACGACGAGAGCGCCATC (SEQ ID NO: 11)	TCGCCGTCGCCCCAGTC (SEQ ID NO: 12)
Adipoq	GATGCAGGTCTTCTTGGTCCTAA (SEQ ID NO: 13)	GGCCCTTCAGCTCCTGTC (SEQ ID NO: 14)
aP2	GTGATGCCTTTGTGGGGAAACCTGGAAG (SEQ ID NO: 15)	TCATAAACTCTTGTGGAAGTCACGCC (SEQ ID NO: 16)

1.8. Preparation of whole cell extracts and Western blot analysis Prior to recovery, lactic acid bacteria treatment-treated or untreated cells were washed twice with ice cold 1× PBS, and protease inhibitor cocktail, 2 mM PMSF and 1 mM sodium orthovanadate were added to RIPA lysis buffer. (Santa Cruz Biotechnology, Inc.). Lysates were recovered by scraping, cells were incubated on ice for 15 minutes, and samples were centrifuged at 10,000×g, 4° C. for 15 minutes to obtain supernatants. Protein concentration was determined using the BCA protein assay kit (Pierce, Rockford, IL). The same amount of protein was loaded for each sample and separated on a 4-20% sodium dodecyl sulfate polyacrylamide gradient gel (Mini-PROTEAN Precast Gel, Bio-Rad). After electrophoresis, the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Trans-Blot SD Semi-Dry Cell, Bio-Rad) for about 1.5 hours at 13 V using a semi-dry transfer cell (Bio-Rad). The membrane was blocked with 5% dried skim milk containing 1× Tris-buffered saline (TBS) containing 0.1% Tween 20 (TBST) on a shaker for 1 hour at room temperature, and the primary antibody was incubated overnight at 4°C. Incubated. After incubation of the primary antibody, the membrane was washed 3 times for 5 minutes each with 1× TBST. The membrane was incubated with the specific horseradish peroxidase-conjugated secondary antibody at room temperature for 1.5 hours on a shaker and washed three times for about 5 minutes. All washing steps were performed in 1× TBST. Immune response protein signals were detected using a chemiluminescent ECL assay and measured using molecular imaging software (Bio-Rad). Brightness and contrast were slightly adjusted for better visualization of the data, but the same changes were applied across the entire image panel, so that no part was lost from the image. Anti-β-actin was used as a control. Western blot data were quantified using ImageJ software (National Institutes of Health, USA).

1.9. Immunofluorescence staining evaluation

In order to observe the protein expression regulation of C/EBPβ and PPARγ, which are transcriptional regulators of adipocyte differentiation by lactic acid bacteria YB0411, immunofluorescence staining was used using 3T3-L1 pre-adipocytes. In this experiment, 3T3-L1 pre-adipocytes were treated with Rosiglitazone (Rosi), a PPARγ antagonist, as a positive control, and lactic acid bacteria culture at a concentration of 5 μl/ml. 3T3-L1 preadipocytes were reacted with ice-cold MetOH at -20 °C for 15 minutes, and then treated with 3% BSA and 0.1% Triton X-100 for 15 minutes to permearbilize. Then, after treatment with blocking solution (1% BSA, 5% goat serum, 0.3% Triton X-100), primary antibodies C/EBPβ (CST) and PPARγ (Santa Cruz Biotechnology) were incubated at 4°C for one day. react Then, Alexa Fluor 594-conjugated anti-rabbit IgG and Alexa Fluor 594-conjugated anti-mouse IgG secondary antibodies were reacted for 1 hour, respectively. For DNA staining, the cells were reacted with 1ug/ml DAPI for 1 minute, washed three times with 1x PBST, mounted with mounting medium containing an anti-fading agent (Dako, CA, USA) and mounted under a confocal microscope (Olympus, Tokyo, USA). Japan).

1.10. statistical analysis

All data are expressed as mean ± standard deviation (SD). Significant differences between different treatment groups were detected using Student's t-test and two-way ANOVA followed by post-hoc Bonferroni test. A p value < 0.05 was considered statistically significant.

2. Results

2.1. Inhibition of intracellular triglyceride accumulation by lactic acid bacteria culture medium

Before elucidating the function of lactic acid bacteria cultures in the maturation of 3T3-L1 pre-adipocytes into adipocytes, the inventors of the present invention determined an appropriate dose of lactic acid bacteria cultures for use in 3T3-L1 pre-adipocytes and differentiated 3T3-L1 cells. was determined through cell viability assay. As shown in FIG. 2, when 3T3-L1 pre-adipocytes were treated with lactic acid bacteria cultures at concentrations of 1 μl/ml or 5 μl/ml for 24, 48, and 72 hours, no remarkable cytotoxicity was observed.

Next, in order to confirm the effect of intracellular triglyceride accumulation of the lactic acid bacteria culture medium, post-confluent 3T3-L1 pre-adipocytes were treated with MDI medium in the presence or absence of lactic acid bacteria culture medium at a concentration of 1 μl / ml or 5 μl / ml. Differentiation into adipocytes was induced by treatment. Microscopic observation after Oil Red O staining on day 6 showed that the treatment with the lactic acid bacteria culture medium had an inhibitory effect on intracellular triglyceride accumulation in a concentration-dependent manner compared to the control group exposed to the MDI medium alone (FIG. 3).

2.2. Regulation and suppression of expression of adipogenic transcription factors by lactic acid bacteria culture medium during adipogenesis

Differentiation and maturation of pre-adipocytes into adipocytes are regulated by many transcription factors. C/EBPβ plays an important role in the early differentiation process into adipocytes, and expression of PPARγ is very important in the later maturation process. In addition, C/EBPδ and C/EBPα play an important role in regulating the expression of C/EBPβ and PPARγ in adipocyte differentiation. AdipoQ and aP2, as PPARγ target genes, are highly expressed during the maturation process of adipocytes. The inventors of the present invention investigated whether lactic acid bacteria cultures affect the expression of adipogenic transcription factors during adipogenesis. To induce pre-adipocyte differentiation, the 3T3-L1 culture medium was replaced with MDI medium. When the lactic acid bacteria culture of the present invention was treated, the mRNA expression of Cebp β, Cebpδ , Cebpα , PPARγ , adipoQ and aP2 was significantly decreased (FIG. 4). In addition, the lactic acid bacteria culture greatly reduced the concentrations of C/EBPα, C/EBPβ, PPARγ, and aP2 even at the translation stage (FIG. 5). These results suggest that lactic acid cultures can effectively inhibit important adipogenic transcription factors.

[Accession number]

Name of Depositary Institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC14393BP

Entrusted date: 20201130

[National R&D Project]

[Assignment identification number] 2015161030

[Assignment number] 2015R1A6A1A03032522

[Name of Department] Ministry of Education

[Name of project management institution] National Research Foundation of Korea

[Research project name] Key research institute support project

[Research project title] Development of metal-ceramic-polymer hybrid biomaterials for clinical treatment and tissue regeneration research

[Contribution rate] 1/2

[Name of project performing organization] Soonchunhyang University Industry-University Cooperation Foundation

[Research Period] 2015.06.01. - 2024.05.31.

[National R&D Project]

[Assignment identification number] 2017395051

[Assignment number] NRF-2017M3A9A5051180

[Name of Department] Ministry of Science and ICT

[Name of project management institution] National Research Foundation of Korea

[Research project name] Biomedical technology development project

[Name of research project] Securing, managing and utilizing biological resources research results

[Contribution rate] 1/2

[Name of project performing organization] Korea Research Institute of Bioscience and Biotechnology

[Research Period] 2020.01.01. - 2020.12.31.

Claims (13)

1. Bifidobacterium longum infantis ( Bifidobacterium longum subsp. Infantis ) strain YB0411 with accession number KCTC14393BP.
2. A pharmaceutical composition for preventing or treating obesity, comprising a culture of YB0411 strain of Bifidobacterium longum subsp. Infantis , accession number KCTC14393BP, as an active ingredient.
3. The pharmaceutical composition according to claim 2, wherein the culture is selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.
4. A health functional food for preventing or improving obesity, comprising a culture of YB0411 strain of Bifidobacterium longum subsp. Infantis , accession number KCTC14393BP.
5. The health functional food according to claim 4, wherein the culture is selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.
6. A cosmetic composition for slimming comprising a culture of strain YB0411 of Bifidobacterium longum subsp. Infantis with accession number KCTC14393BP.
7. The cosmetic composition according to claim 6, wherein the culture is selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.
8. The cosmetic composition according to claim 6, wherein the cosmetic composition is a formulation selected from the group consisting of lotion, lotion, cream, essence, foam and pack.
9. A feed composition for preventing or improving obesity, comprising a culture of YB0411 strain of Bifidobacterium longum subsp. Infantis , accession number KCTC14393BP.
10. The feed composition according to claim 9, wherein the culture is selected from the group consisting of culture medium, culture concentrate, dried culture medium, culture medium extract, culture supernatant, culture supernatant concentrate, culture supernatant dried material and culture supernatant extract.
11. A reagent composition for inhibiting maturation of pre-adipocytes into adipocytes, comprising a culture of strain YB0411 of Bifidobacterium longum subsp .
12. 12. The reagent composition according to claim 11, wherein the culture is selected from the group consisting of a culture medium, a culture concentrate, a dried culture medium, a culture medium extract, a culture supernatant, a culture supernatant concentrate, a dried culture supernatant, and a culture supernatant extract.
13. Adipocytes of pre-adipocytes, including treating the culture of strain YB0411 of Bifidobacterium longum subsp. ) to inhibit maturation.

Images