WO2022234843A1

WO2022234843A1 - Drug kit and method for rebuilding damaged neural pathways

Info

Publication number: WO2022234843A1
Application number: PCT/JP2022/019484
Authority: WO
Inventors: 淳 ▲高▼橋; 諒輔土持
Original assignee: 国立大学法人京都大学
Priority date: 2021-05-07
Filing date: 2022-05-02
Publication date: 2022-11-10
Also published as: JPWO2022234843A1

Abstract

The present invention provides a drug kit for rebuilding a damaged neural pathway, wherein the drug kit comprises a first formulation comprising axonal elongation-inducing protein, nucleic acid encoding said protein, or a vector that expressibly contains DNA encoding said protein. The present invention also provides a method for rebuilding a damaged neural pathway in a patient, the method comprising the administration of the first formulation of this drug kit.

Description

Pharmaceutical kits and methods for rebuilding damaged neural pathways

The present invention relates to a pharmaceutical kit for reconstructing damaged neural pathways.
The invention also relates to methods of reconstructing damaged neural pathways.

Neural pathways are damaged by various factors, which impairs the functions that the pathways are responsible for. For example, in cerebral infarction or stroke, nerve cells exposed to ischemia are lost, and the nerve pathways formed by these nerve cells are damaged, resulting in functional impairment. A typical example is voluntary movement disorder (for example, hemiplegia, etc.) due to damage to the corticospinal tract. The same applies to the loss of specific nerve cells due to neurodegenerative disease, head injury, or the like. Thus, cell transplantation to replenish the nerve cells forming the neural pathway is considered to be the most effective therapeutic method for diseases caused by disorders of neural pathways.

In cell transplantation therapy of nerve cells, nerve cells and/or neural progenitor cells are usually transplanted into or near the site of injury. In order to obtain a sufficient therapeutic effect, it is necessary for the transplanted cells to engraft (in some cases, differentiate into the desired nerve cells), extend their axons to the desired target cells, and form neural connections. . However, the axon elongation efficiency of transplanted cells is generally low, and furthermore, there is a problem that the percentage of axons that can elongate axons over a long distance is very low.

For example, the axons of upper motor neurons in the cerebral cortex motor cortex pass through the ventral midbrain peduncle via the internal capsule, penetrate the pontine nucleus, ventral medulla oblongata, and cross the pyramidal chiasma to the spinal cord. Enters and descends the spinal cord, connecting to the lower motor neurons in the anterior horn of the spinal cord. This pathway is called the corticospinal tract, and as mentioned above, there is a high demand for reconstruction. Therefore, various methods for reconstructing the corticospinal tract by cell transplantation are being investigated.

For example, in Non-Patent Document 1, in an adult mouse brain injury model, almost no transplanted cell-derived nerve axons reached the spinal cord when mouse fetal brains were transplanted immediately after injury. They reported that when transplanted, the transplanted cell-derived axons reaching the spinal cord were significantly observed, and a tendency toward improvement in exercise capacity was also observed. This suggested the importance of the timing of cell transplantation.

In addition, the present inventors have found that in a system in which human ES cell-derived brain organoids are transplanted into an adult mouse brain injury model, CTIP2 or L1CAM can be a marker for neurons that can project to the spinal cord (Patent document 1, Non-Patent Document 2). In particular, since L1CAM is a membrane protein expressed on the cell surface, it is suitable for the reconstruction of cells with the ability to extend axons to the spinal cord, that is, the corticospinal tract, in the preparation of cells for human transplantation. It is now possible to enrich the cells

However, the effect obtained by optimizing the timing of transplantation is limited, and the proportion of L1CAM-positive cells contained in brain organoids is very small, so relying on cell concentration alone would be a very expensive treatment method. Therefore, alternatives to, or in combination with, these methods are methods for effecting axonal outgrowth of transplanted cells that also enable remodeling of neural pathways over long distances, such as the corticospinal tract. There has been a need for a method to effectively promote

International publication WO2020/138510

The present invention has been made in view of the above background, and is used in a method for reconstructing neural pathways by cell transplantation, even in long-distance neural pathways such as the corticospinal tract. The challenge is to provide a kit.

As a result of intensive studies, the present inventors found that when an axonal outgrowth-inducing protein such as L1CAM is overexpressed in the motor area of the mouse cerebral cortex, and then cerebral cortical neurons (population) are transplanted to the site, the transplanted cells We found that the derived nerve axons can reach the spinal cord. L1CAM is a membrane protein involved in axonal growth and guidance in mammalian neurogenesis (Maness, PF & Schachner, M. Nature Neuroscience, 10 (1), 19-26, 2007; Neural Other proteins known as recognition molecules of the immunoglobulin superfamily: signaling transducers of axon guidance and neuronal migration, axon guidance cues, may have similar effects.

The above findings were completely unexpected. This is because even if the axonal guidance factor is expressed in viable residual neurons near the site of injury in the central and peripheral nervous systems, it is not possible to induce axonal outgrowth to the transplanted neurons (population) to a distant extent. was expected to be difficult. Specifically, since the axons are surrounded by a myelin sheath consisting of oligodendrocytes (central nervous system) or Schwann cells (peripheral nervous system), the transplanted nerve cells are the axis of the remaining nerve cells. It was thought that it would be difficult to interact with axonal guidance factors (eg, L1CAM, etc.) expressed on the cord. However, when L1CAM, which is an axonal guidance factor, was actually expressed in residual nerve cells at the planned transplantation site, it was unexpectedly found that L1CAM was also expressed on the myelin sheath.

The present invention includes the following features.
(1) To reconstruct damaged neural pathways, which contains a first preparation containing, as an active ingredient, an axonal outgrowth-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing the DNA encoding the protein. medicine kit.
(2) The pharmaceutical kit according to (1) above, wherein the neural pathway is the corticospinal pathway or other neural pathway.
(3-1) The pharmaceutical kit according to (1) or (2) above, wherein the first formulation is administered to a patient with a neural pathway disorder at or near the site of the disorder.
(3-2) The pharmaceutical kit according to any one of (1) to (3-1) above, wherein the first formulation is administered to the cortical motor area of a patient with corticospinal tract disorder.
(4) The pharmaceutical kit according to any one of (1) to (3-2) above, further comprising a second preparation containing a cell population containing nerve cells and/or their progenitor cells.
(5-1) The pharmaceutical kit according to (4) above, wherein the second preparation contains a cell population containing cerebral cortical cells and/or their progenitor cells.
(5-2) The pharmaceutical kit according to (5-1) above, wherein the cells are cells expressing Ctip2.
(6) The pharmaceutical kit according to any one of (4) to (5-2) above, wherein the cell population is derived from pluripotent stem cells or somatic stem cells.
(7) The pharmaceutical kit according to (6) above, wherein the pluripotent stem cells are induced pluripotent stem (iPS) cells or embryonic stem (ES) cells.
(8) the axon outgrowth-inducing protein is from the group consisting of L1CAM, Netrin family, Semaphorin family, Slit family, Ephrin family, morphogen and neurotrophic factor The pharmaceutical kit according to any one of (1) to (7) above, which is at least one selected axonal guidance factor.
(9) The pharmaceutical kit according to any one of (1) to (8) above, wherein the axonal outgrowth-inducing protein is L1CAM.
(10) The pharmaceutical kit according to any one of (1) to (9) above, wherein the protein or nucleic acid is contained in a drug delivery system.
(11) The pharmaceutical kit according to any one of (1) to (10) above, wherein the vector is a viral vector.
(12) The pharmaceutical kit according to (11) above, wherein the viral vector is an adeno-associated virus (AAV) vector.
(13) Any of the above (4) to (12), comprising a first preparation containing an AAV vector containing DNA encoding L1CAM, and a second preparation containing the iPS cell-derived or somatic stem cell-derived cell population. A pharmaceutical kit according to .
(14) a patient with a neuropathy disorder, comprising administering the first formulation of the pharmaceutical kit according to any one of (1) to (13) above to a patient with a neuropathy disorder at or near the site of the disorder; A method for reconstructing neural pathways.
(15) The method according to (14) above, further comprising transplanting the second formulation of the pharmaceutical kit to or near the lesion site of the patient.
(16) comprising administering the first formulation of the pharmaceutical kit according to any one of (1) to (13) above to the cerebral cortical motor area of a patient with corticospinal tract disorder. A method for reconstructing the corticospinal tract.
(17) The method according to (16) above, further comprising transplanting the second formulation of the pharmaceutical kit to or near the damaged site of the cerebral cortex of the patient.
(18) The method according to (16) or (17) above, wherein the corticospinal tract disorder is caused by head injury or cerebrovascular accident.
(19) The method according to any one of (14) to (18) above, wherein the patient is human.
(20) A vector expressably comprising an axonal outgrowth-inducing protein, a nucleic acid encoding said protein, or a DNA encoding said protein for use in remodeling damaged neural pathways.
(21) Use of an axonal outgrowth-inducing protein, a nucleic acid encoding the protein, or a vector expressing the DNA encoding the protein for the production of an agent for reconstructing damaged neural pathways.

The present invention provides a method for promoting axonal outgrowth of transplanted cells, which enables reconstruction of long-distance neural pathways such as the corticospinal tract, and a kit for use in the method.

This figure is an immunohistochemical staining image showing that L1CAM-FLAG is expressed along the corticospinal tract and nerve axons from the graft extend into the spinal cord. Figure 1A shows the results of internal capsules, the upper panel is the L1CAM expression vector (mL1cam-AAV) injection group, the lower panel is the vehicle injection group (PBS (-), negative control), and from the left L1CAM signal (white ) and FLAG signal (red) double staining signal (left panel), EGFP signal (middle panel, green), L1CAM (white), FLAG (red), and EGFP (green) triple staining signal (right panel). represent each. In the L1CAM expression vector-injected group, the EGFP-positive axons basically merged with the L1CAM-FLAG double-positive axons. FIG. 1B is the results of the spinal cord contralateral to the internal capsule of FIG. 1A, showing the L1CAM (white), FLAG (red), and EGFP (green) triple staining signals. The upper panel shows the results of the L1CAM expression vector-injected group, and the lower panel shows the results of the vehicle-injected group (PBS(-)). In the L1CAM expression vector-injected group, the EGFP-positive axons basically merged with the L1CAM-FLAG double-positive axons. Scale bar represents 20 μm. This figure shows the corticospinal tract, i.e., the ipsilateral internal capsule, in the L1CAM expression vector-injected group (n = 8) and the mCherry expression vector-injected group (negative control group) (n = 7) (Fig. 2A). , ipsilateral cerebral peduncle (Fig. 2B), and contralateral spinal cord (Fig. 2C). ). The Mann-Whitney test was used for the significance test. The figure shows the L1CAM expression vector (pAAV[Exp]-CMV>mL1cam[NM_008478.3]/FLAG) (Fig. 3A), mCherry expression vector (pAAV[Exp]-CMV>mCherry:WPRE) (Fig. 3B) and axis The structures of the expression cassettes inserted into the cord elongation factors (specifically L1CAM, Ntn1, Sema3a, Sema3c) (Fig. 3C) are shown. In the figure, mL1CAM-FLAG is the DNA encoding mouse L1CAM with a FLAG tag added to the C-terminus, mCherry is the DNA encoding the fluorescent protein mCherry, and WPRE is the woodchuck hepatitis virus posttranscriptional regulatory element. , ITR represents AAV-derived inverted terminal repeat, CMV represents cytomegalovirus promoter, and BGHpA represents bovine growth hormone polyadenylation signal. This figure shows that the number of graft-derived axons on the CST in the L1CAM group was significantly higher than in the control group. The number of GFP ⁺ neurites in the CST (ipsilateral internal capsule, ipsilateral zonules, contralateral spinal cord) was quantitatively analyzed. In the group into which the L1CAM expression vector was injected, the number of axons from the graft in each site of the host's corticospinal tract, internal capsule, zonules, and spinal cord was significantly higher than in the control (mCherry) group. There was no significant difference in the number of axons in other axon guidance molecule groups. A Kruscal-Wallis test was performed. n=7 for control and Netrin1 groups, n=8 for Sema3A, Sema3C and L1CAM groups. Results are shown as mean ± SEM. The upper diagram shows a schematic diagram of the method of preparing the construct used in Example 3 and introducing it into HEK cells. The figure below shows a schematic diagram showing the method of the in vitro assay in Example 3. HEK-293 (PB-L1Cam/Flag) cells were seeded, and doxycycline was added to the medium to not induce expression of the Tet-On gene ("L1CAM ^- " in the figure) ("L1CAM ⁺ " in the figure). ”) was prepared. After the cells formed a confluent monolayer, cortical neurons from embryonic day 14 of EGFP transgenic mice were harvested and seeded onto cultured HEK cells as described above. As a negative control, anti-L1CAM mAb 5G3, known to inhibit the same intermolecular binding of L1CAM, was added to the medium at 1:200 ("+5G3" in the figure). This figure shows the results of Western blotting. Western blotting of L1CAM, FLAG, and β-actin (loading control) in wild-type HEK-293 cells (HEK cells) and HEK-293 cells expressing L1CAM/FLAG (HEK-L1). Lane 1 is HEK cells without doxycycline (DOX). Lane 2 is HEK cells added with DOX. Lane 3 is HEK-L1 without DOX. Lane 4 is HEK-L1 with DOX added. L1CAM was detected only in HEK-L1 cells supplemented with doxycycline (DOX), and was not detected in wild-type HEK cells or HEK-L1 cells without DOX. This figure shows representative images of GFP ⁺ neurites in HEK-L1 with and without DOX (left 2 panels) and with 5G3 added (right 2 panels), respectively. In vitro, L1CAM ⁺ cells were shown to promote neurite outgrowth through allogeneic binding. Scale bar is 20 μm. This figure shows the results of quantitative analysis of temporal changes in neurite length of primary neurons on HEK-L1. The experiment was repeated four times with four times the number of each group. *p < 0.05, **p < 0.01, ***p < 0.001, repeated measure two-way ANOVA with Tukey's multiple comparisons test. Although there was no difference between the two groups at the start of observation, 48 hours after the start of observation, the length of nerve fibers in the presence of DOX became significantly longer than the length of nerve fibers in the absence of DOX. There was no significant difference over time (it is believed that the effect of L1CAM peaked out over time). In the 5G3-administered group, the nerve fiber length was significantly shortened compared to the non-administered group, regardless of the presence or absence of DOX, when observed 48 hours later. This figure is an electron micrograph of a host brain implanted with a graft. (A) L1CAM (25 nm gold colloid; indicated by an arrow) and FLAG (10 nm gold colloid; indicated by an arrowhead) are recognized on the myelin sheath of the host brain. (B) Graft-derived axons stained with DAB run between host brain axons. Graft-derived axons run outside the myelin sheath of the axons of the host brain. Scale bars are 500 nm (A) or 1 μm (B). This figure shows immunostaining of cerebral organoids 39 days after differentiation. Expression of L1CAM is observed at a site corresponding to the cortical plate (Ctip2-positive, Pax6-negative) at the developmental stage. Scale bar is 20 μm.

The present invention will now be described in more detail.
1. Pharmaceutical kit The present invention regenerates damaged neural pathways, comprising a first preparation containing, as an active ingredient, an axon outgrowth-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing the DNA encoding the protein. A pharmaceutical kit is provided for construction. The pharmaceutical kit of the present invention may comprise a first formulation, and in one aspect, the pharmaceutical kit comprises an axon outgrowth-inducing protein, a nucleic acid encoding the protein, or a vector containing a DNA encoding the protein so that it can be expressed. As an active ingredient, it is provided as a restructuring agent for damaged neural pathways.

As used herein, "neural pathway" (also referred to as "neural circuit") refers to neural pathways of the central and peripheral nervous systems, including both motor and sensory pathways, and narrowly defined as projection It can also be said to be a pathway formed by axons of neurons. Projection neurons refer to neurons that extend their axons not only within the neuronal population to which they belong (neuronal nucleus, cerebral cortical area, etc.) but also far away, and are responsible for information transmission between different regions.

The pathways of the central nervous system include the pathways of the central nervous system from the cerebral cortex to the spinal cord (including the corticospinal pathway), as well as the neural pathways within the cranial nerves and spinal nerves. In this specification, neural pathways other than the corticospinal tract are sometimes referred to as "other neural pathways."

The corticospinal tract has originating cells in the motor area of the cerebral cortex, passes through the internal capsule, passes through the cerebral peduncle on the ventral side of the midbrain, penetrates the pontine nucleus, and passes through the ventral side of the medulla oblongata to the chiasm pyramidale to the spinal cord. Nerve pathway that enters and descends the spinal cord and connects to motor neurons in the anterior horn of the spinal cord. It is one of the main neural circuits that control voluntary movements such as voluntarily moving limbs, sending movement commands from the cerebral cortex to the spinal cord.

In general, motor paralysis occurs when the corticospinal tract is damaged, and many patients suffer from its sequelae. There are high hopes for a therapeutic method that reconstructs the damaged corticospinal tract by cell transplantation and improves paralysis, but it has not yet been applied clinically.

Cranial nerves include the nerves that connect the brain and organs such as the head, face, eyes, nose, muscles, and ears, as well as the vagus nerve that innervates the thoracoabdominal internal organs.

Spinal nerves are nerves that connect the spinal cord to the rest of the body and are functionally sensory (or afferent) nerves (including somatosensory and visceral sensory nerves) and motor (or efferent) nerves (including somatomotor nerves, which innervate skeletal muscles, and visceral motor nerves, which innervate blood vessels and muscles of internal organs).

Axons have a fibrous structure extending from the nerve cell body and are responsible for the output of nerve cell signals. Axons extending from the cerebral cortex cross at the cones in the lower medulla oblongata below the brain and extend to the contralateral side of the spinal cord, so that cortical neurons on one side control the movements of the limbs on the opposite side.

As used herein, "disorder of neural pathway" means "any one or more of reduction, degeneration, or disappearance of the number of axons that make up the neural pathway occurs, and information transmission via the pathway is significantly reduced. means “the state of In addition, "regeneration of (damaged) neural pathways" means that one or more of an increase in the number of axons that make up a neural pathway or regeneration occurs, and information transmission through the pathway is restored. It means that it will be in a state where it can be expected.

Factors that cause "disorders of neural pathways" include cerebrovascular disorders (e.g., stroke (cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage), etc.), brain injuries (e.g., cerebral contusion, cerebral laceration, etc.), spinal cord injuries ( motor and sensory disturbances distal to the injured spinal cord), neurodegenerative diseases (e.g., multiple sclerosis, epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Creutzfeldt-Jakob disease, etc.), ophthalmic diseases (glaucoma, etc.), and the like.

As used herein, "impaired neural pathway" refers to a neural pathway that has been damaged due to the above factors.

In order to reconstruct damaged neural pathways, the present invention enables expression of an axonal outgrowth-inducing agent, specifically an axonal outgrowth-inducing protein, a nucleic acid encoding the protein, or a DNA encoding the protein. A first formulation containing a vector containing the vector as an active ingredient is administered to a patient with a neural pathway disorder (also referred to as a "subject") at or near the lesion site (typically, administered before transplantation of the second formulation). to do).

In adult mouse brain injury models, transplanted cell-derived axons reaching the spinal cord were significantly observed when fetal mouse brains were transplanted into mouse brains, and a tendency toward improvement in motor performance was also observed (Non-Patent Document 1). Furthermore, the present inventors have demonstrated that transplantation of mouse frontal cortex-derived neurons into the rat brain and rehabilitation promotes axonal outgrowth of the transplanted neurons in a rat brain injury model. It has been reported (T. Shimogawa et al., npj Regenerative Medicine: 2019; Therapeutic effects of combined cell transplantation and locomotor training intrarats with brain injury). Since the pharmaceutical kit of the present invention can reconstruct neural pathways that have been damaged by axonal outgrowth, it is expected that voluntary movement disorders caused by impaired neural pathways will be improved by rehabilitation, if necessary, in combination. can. Therefore, the pharmaceutical kit of the present invention can be used as a therapeutic agent for voluntary movement disorders caused by disorders of neural pathways.

1.1. First Formulation In the present specification, "axonal outgrowth-inducing protein" refers to a protein that exerts the effect of inducing axonal outgrowth on nerve cells, includes an axonal guidance factor, and is an attractive axonal guidance factor (simply " attraction factor"), repulsive axonal guidance factor (also simply referred to as "repulsion factor"), or both.

"Guidance" of axonal outgrowth involves "attraction," "repulsion," or a combination thereof, to precisely direct axons to desired target sites in neural pathways such as the corticospinal tract. It is known that the involvement of both attracting and repelling factors is necessary for elongation (Takuro Toshima et al., Biophysics 51(5), 214-217, 2011).

Information is transmitted between neurons via synapses, which are constructed by axons and dendrites. To form an accurate information transmission network, that is, a neural network, axons extend in various ways. under good control. A typical example is axonal guidance by an axonal guidance factor.

Axonal guidance factors are defined as molecules that exist region-specifically within developing tissues to provide spatial information to growth cones and guide the growth cones to the correct target cells. Axonal guidance factors present in vivo are roughly classified into four modes of action. There are contact factors that are expressed in the extracellular matrix and cell membrane and act in short distances through contact, diffusible factors that are secreted and act in long distances due to concentration gradients, and attraction factors and repulsion factors for each of them. . In vivo, these four types of axonal guidance factors are thought to guide axons to their correct targets (ET Stoeckli, Development 2018 145: dev151415 doi: 10.1242/ dev.151415). Also in this context, it is hypothesized that the axonal guidance factor or its mRNA expressed in the neuronal cell body, as well as the miRNAs involved in regulating the expression of the axonal guidance factor, are transported via axons to the growth cone. (ET Stoeckli, supra) is not well understood.

There are various molecular types of axonal guidance factors. Factors that exhibit repulsive action include the semaphorin family, ephrin family, and slit family. Factors that exhibit attractive action include netrin, semaphorin 3C, and brain. A brain-derived neurotrophic factor and the like are known. Specific receptor families exist on the growth cone for individual axonal guidance factors, and expression of the receptors on the plasma membrane defines growth cone sensitivity to axonal guidance factors. Furthermore, growth cones are known to have a mechanism that switches responsiveness to the same axonal guidance factor depending on location and time.

The above axonal guidance factor can be suitably used as the axonal outgrowth-inducing protein according to the present invention.

In addition, some proteins (cell adhesion molecules) that are expressed on the membrane of nerve cells and contribute to cell adhesion are known to have the effect of inducing axonal growth in nerve cells. A typical example is L1CAM. Axonal outgrowth-inducing proteins according to the present invention can also include other neuronal cell adhesion molecules (eg, NrCAM, axonin, etc.) that exert the above effects.

Thus, non-limiting examples of axonal outgrowth-inducing proteins include L1CAM, Netrin family (eg, Netrin-1, Netrin-3, Netrin-4, etc.), Semaphorin family (eg, Sema3A, Sema3B, Sema3C, Sema6, etc.), ephrin family (e.g., EphA, EPHB, etc.), slit family (e.g., Slit2, etc.), morphogens (e.g., hedgehog, Wnt, TGF-β, bone morphogenetic protein (BMP) , etc.), neurotrophic factors (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin-3 (NT-3), neurotrophin-4/5 (NT-4/5), etc.) preferably L1CAM, or a combination of L1CAM and at least one other axonal guidance factor selected from the group consisting of netrin family, semaphorin family, ephrin family, slit, morphogen and neurotrophic factor is.

L1CAM (L1 cell adhesion molecule) is an axonal glycoprotein belonging to the immunoglobulin superfamily, and its nucleotide sequence/amino acid sequence in humans is, for example, in GenBank of NCBI (USA) with accession numbers NM_000425/NP_000416, NM_024003/ NP_076493, NM_001143963/NP_001137435, NM_001278116/NP_001265045, and in mouse, for example, NM_008478/NP_032504, NM_001374694/NP_001361623. L1CAM is also known as CAML1, CD171, HSAS, HSAS1, MASA, MIC5, N-CAM-L1, N-CAML1, NCAM-L1, S10, SPG1. The nucleotide and amino acid sequences of human L1CAM are shown, for example, as SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and the nucleotide and amino acid sequences of mouse L1CAM are shown as SEQ ID NO: 3 and SEQ ID NO: 4, respectively, in the sequence listing below. Alternatively, it is a sequence having 85% or more, 90% or more, or 95% or more sequence identity with the above sequence as long as it has an axon guidance effect.

"Sequence identity (%)" as used herein is preferably obtained by introducing a gap between the two sequences using a protein or gene search system by known algorithms BLAST or FASTA, or without introducing a gap. can be determined by introducing gaps (SF Altschul et al., Journal of Molecular Biology, 1990; 215:403-410; WR Pearson et al., Proc. Natl. Acad. Sci. USA, 1988;85:2444-2448).

Netrin is a type of axonal guidance factor identified as a secreted protein that is secreted from the floor plate of the spinal cord and attracts the axons of spinal commissural neurons. The amino acid and nucleotide sequences of Netrin-1 (sometimes abbreviated as "Ntn1") are available from GenBank and are registered under accession numbers NM_004822 (human), BC141294, and NM_008744.2 (mouse), for example. or have a sequence identity of 85% or more, 90% or more, or 95% or more with the above sequence as long as it has an axon guidance effect.

The amino acid and nucleotide sequences of Sema3C are available from GenBank and are registered under accession numbers NM_001350120 (human), NM_006379 (human), NM_001350121 (human), NM_013657.5 (mouse), etc., or A sequence having a sequence identity of 85% or more, 90% or more, or 95% or more with the above sequence as long as it has an axon-inducing action.

Furthermore, the nucleic acid encoding the axonal outgrowth-inducing protein is, for example, DNA (e.g., cDNA, etc.) or RNA (e.g., mRNA, etc.) encoding protein such as L1CAM, netrin, semaphorin, slit, ephrin, morphogen, neurotrophic factor, etc. )including. These DNA nucleotide sequences and protein amino acid sequences are available from nucleotide sequence databases such as GenBank (USA), EMBL (Europe), and DDBJ (Japan).

An axonal outgrowth-inducing protein and a nucleic acid encoding an axonal outgrowth-inducing protein can be produced, for example, using genetic recombination technology. Specifically, mRNA is extracted from tissues or cells that express an axonal outgrowth-inducing protein, and cDNA is synthesized to prepare the nucleic acid, and furthermore, a control sequence such as a promoter, and a selection marker gene sequence such as a drug resistance gene. The above protein can be produced by a method including inserting a cassette containing the above nucleic acid (DNA) together with elements such as the above into a vector such as a plasmid, and inserting the cassette into a cell such as an animal cell to transform the cell. Gene recombination technology is described, for example, by M. et al. R. Green and J. Sambrook, Molecular Cloning; A Laboratory Manual, Fourth Ed. (2012) Cold Spring Harbor and available.

Furthermore, the vector containing DNA capable of expressing the axonal outgrowth-inducing protein can be selected from, for example, plasmids, viral vectors and liposomes and used in vivo (for example, those that can be used for gene therapy). can be done.

A plasmid vector can contain elements such as a target gene (or DNA), a promoter, a replication origin, a polyA addition signal, and a selectable marker gene. The plasmid is preferably a DNA plasmid that has been recognized as safe for gene therapy or regenerative medicine and manufactured in compliance with GMP. Plasmids include, for example, plasmids used in the preparation of HGF plasmids for gene therapy (R. Morishita et al., Hypertension 2004; 44(2): 203-209).

Viral vectors include, for example, AAV, adenovirus, retrovirus (eg, MMLV retrovirus, etc.), lentivirus, Sendai virus, etc., preferably AAV. AAV vectors are known to be safe because they are capable of long-term expression of target genes, have low immunogenicity, and are non-pathogenic viruses.

For AAV vectors, for example, a cassette containing a promoter and a target gene (or DNA) is inserted in place of a region containing Rep and Cap (proteins necessary for viral replication and encapsidation) between wild-type ITRs (inverted terminal repeats). can be produced by packaging the resulting replication-deficient genome into virus particles. This production method includes, for example, a step of removing the two genes Rep and Cap between the ITRs and producing a vector plasmid in which the promoter and the gene of interest are inserted in the space, a step of supplying Rep and Cap with a separate plasmid, The E1A, E1B, E2A, VA, and E4 genes are required for adenoviral helper action, of which E1A and E1B are isolated from HEK293 cells (transformed with E1A and E1B), the remaining E2A, E4, and VA are provided as helper plasmids, transfection of HEK293 cells with these three plasmids to produce virus particles with only the target gene between ITRs without Rep and Cap genes (Hirokazu Hirai, DOI: 10.14931/bsd.7632, 2018).

The promoter is preferably a promoter that is functional in nerve cells, and is not limited to, for example, Tet on/off element-containing promoter, ramamycin-inducible promoter, metallothionein promoter, viral promoter (e.g., CMV promoter, RSV promoter, SV40 promoter, etc.), cellular promoters (eg, PGK (phosphoglycerate kinase) promoter, etc.), and the like.

Liposomes are microvesicles consisting of bilayer membranes of amphipathic lipid molecules and are used for drug delivery. Lipid constituents of liposomes can include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, cholesterol, derivatives thereof, mixtures thereof, and the like. Liposomes have structures that contain hydrophilic and hydrophobic moieties so that they are amphiphilic. Said derivatives are those in which two, for example, the same or different fatty acid esters are attached to the glycerol backbone of a glycerophospholipid, where examples of fatty acids are stearic acid, oleic acid, palmitic acid, myristic acid, linoleic acid, etc. . The liposomes may also be PEGylated by attaching polyethylene glycol chains (eg, molecular weight less than 5,000, eg, 3,000 or less, preferably 2,000). Examples of such derivatives include distearoyl phosphatidylcholine (DSPC), palmitoyl phosphatidylcholine (POPC), dioleoyl-sn-glycero-phosphoethanolamine, and the like.

The first formulation contains, in addition to the above active ingredients, a pharmaceutically acceptable carrier (e.g., physiological saline, phosphate-buffered saline, etc.), neurotrophic factors (e.g., BDNF, NGF, etc.), axons Growth or maintenance promoting factors (eg, neurotrophins, transforming growth factors, extracellular matrix components, etc.) and the like can be included.

1.2. Second Formulation The pharmaceutical kit of the present invention can further comprise a second formulation containing a cell population containing nerve cells and/or their progenitor cells.

A cell population containing nerve cells and/or their progenitor cells may contain DNA (e.g., vector, etc.) that encodes at least one axonal outgrowth-inducing protein described above in an expressible manner, or It does not have to contain the DNA.

Preferably, before or after administration of the first preparation, by administering and transplanting a second preparation containing a cell population containing nerve cells and/or their progenitor cells into or near the damaged site of the neural pathway, It can further promote the reconstruction of damaged neural pathways.

Nerve cells and/or their progenitor cells refer to cells that make up the nervous system such as the central (brain, spinal cord) and peripheral. Neural progenitor cells mean undifferentiated cells that have the ability to differentiate into mature nerve cells. Examples of neural progenitor cells used in the present invention include, but are not limited to, cerebral cortical neural progenitor cells, dopaminergic neural progenitor cells, GABAergic neural progenitor cells, motor neuron progenitor cells, retinal ganglion progenitor cells, and the like. .

Differentiation induction into nerve cells and / or their progenitor cells is disclosed in JP-A-2020-202865, JP-A-2019-106895, WO2019/031595, WO2018/074567, JP-A-2018-029585, WO2017/183736, JP-A-2016-198101, JP-A-2013-226159, JP-A-2010-051326, US10,752,883A1, US10,093,897A1, US7,531,354A1, M. Zhang et al. Stem Cell Research & Therapy 2018; 9:67, B. Shekhar Jha et al. , Stem Cell Rev and Rep DOI 10.1007/s12015-014-9541-0, S. F. McComish, M.; A. Caldwell, Phil. Trans. R. Soc. 2018; B373:20170214; V. Grigor'eva et al. , Cytotechnology 2020; 72: 649-663.

Examples of differentiation-inducing factors include bFGF, BMP inhibitors, BMP/SMAD inhibitors, retinoic acid (RA), sonic hedgehog (SHH), Activin, SB431542 (4-[4-(1,3-benzodioxol-5 -yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide)/LDN193189 (4-(6-(4-(piperazin-1-yl)phenyl)pyrazolo[1,5-a] pyrimidin-3-yl)quinoline), and combinations thereof, or miRNAs and the like can be used.

In the following, methods for inducing the differentiation of pluripotent stem cells or somatic stem cells into neural cells and/or neural progenitor cells will be exemplified.

ES cells, which are one of the pluripotent stem cells, are embryo-derived stem cells derived from the inner cell mass of a blastocyst, which is a post-morula embryo, at the 8-cell stage of a fertilized egg, and constitute an adult. It has the ability to differentiate into any cell that can do so, so-called pluripotency, and the ability to proliferate through self-renewal. ES cells were discovered in mice in 1981 (MJ Evans and MH Kaufman, Nature 1981; 292: 154-156), and thereafter ES cell lines were established in primates such as humans and monkeys. (JA Thomson et al., Science 1998; 282: 1145-1147; JA Thomson et al., Proc. Natl. Acad. Sci. USA 1995; 92: 7844-7848; Thomson et al., Biol. Reprod. 1996;55:254-259; JA Thomson and VS Marshall, Curr. Top.

Another pluripotent stem cell, induced pluripotent stem cells (iPS cells), can be generated by introducing specific reprogramming factors into somatic cells in the form of DNA or protein, much like ES cells. characteristics, such as pluripotency and self-renewal proliferation ability (K. Takahashi and S. Yamanaka, Cell 2006; 126: 663-676; K. Takahashi et al., Cell 2007; 131: 861-872; J. Yu et al., Science 207; 318: 1917-1920; M. Nakagawa et al., Nat. Biotechnol.

Reprogramming factors are, for example, genes that are specifically expressed in ES cells, their gene products or non-coding RNAs (e.g., miRNA, etc.), genes that play an important role in maintaining undifferentiated ES cells, Gene products or non-coding RNA (eg, miRNA, etc.), or low-molecular-weight compounds. Examples of initialization factors include Oct3/4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERAs, ECAT15-2, Tcl1 , beta-catenin, Lin28b, Sall1, Sall4, Esrrb, Nr5a2, Tbx3, etc., and these reprogramming factors may be used alone or in combination.初期化因子の組み合わせとしては、ＷＯ２００７／０６９６６６、ＷＯ２００８／１１８８２０、ＷＯ２００９／００７８５２、ＷＯ２００９／０３２１９４、ＷＯ２００９／０５８４１３、ＷＯ２００９／０５７８３１、ＷＯ２００９／０７５１１９、ＷＯ２００９／０７９００７、ＷＯ２００９／０９１６５９、ＷＯ２００９／１０１０８４、ＷＯ２００９／１０１４０７、ＷＯ２００９／１０２９８３、ＷＯ２００９／１１４９４９、ＷＯ２００９／１１７４３９、ＷＯ２００９／１２６２５０、ＷＯ２００９／１２６２５１、ＷＯ２００９／１２６６５５、ＷＯ２００９／１５７５９３、ＷＯ２０１０／００９０１５、ＷＯ２０１０／０３３９０６、ＷＯ２０１０／０３３９２０、ＷＯ２０１０／０４２８００、ＷＯ２０１０／０５０６２６、 WO2010/056831, WO2010/068955, WO2010/098419, WO2010/102267, WO2010/111409, WO2010/111422, WO2010/115050, WO2010/124290, WO2010/147395, WO2010/147395 Huangfu et al. , Nat. Biotechnol. 2008;26:795-797; Shi et al. , Cell Stem Cell 2008; 2:525-528; Eminli et al. , Stem Cells 2008;26:2467-2474; Huangfu et al. , Nat Biotechnol. 2008;26:1269-1275; Shi et al. , Cell Stem Cell 2008;3:568-574; Zhao et al. , Cell Stem Cell 2008;3:475-479; Marson, Cell Stem Cell 2008;3:132-135; Feng et al. , Nat Cell Biol. 2009; 11:197-203, R. L. Judson et al. , Nat.　Biotech. 2009;27:459-461, C.I. A. Lyssiotis et al. , Proc Natl Acad Sci USA. 2009; 106:8912-8917, JB Kim et al. , Nature 2009;461:649-643, J. Am. K. Ichida et al. , Cell Stem Cell 2009;5:491-503, J. Am. C. Heng et al. , Cell Stem Cell 2010; 6:167-74, J. Am. Han et al. Nature 2010;463:1096-100; Mali et al. , Stem Cells 2010; 28: 713-720 and the like.

Another example of stem cells capable of differentiating into nerve cells and/or their neural progenitor cells is somatic stem cells, including neural stem cells and mesenchymal stem cells.

The method for obtaining, for example, cerebral cortical neurons and/or their neural progenitor cells, which are the active ingredients of the second formulation, is not particularly limited, but can be exemplified by the method by the present applicant (WO2016/167372).

This method includes the following steps.
(i) suspension culture of the pluripotent stem cells in a medium containing a TGFβ inhibitor, bFGF, a Wnt inhibitor and a BMP inhibitor for at least 3 days;
(ii) suspension culture of the cells obtained in step (i) above for at least 6 days in a medium containing a Wnt inhibitor and a BMP inhibitor;
(iii) further culturing the cells obtained in step (ii) above, and
(iv) extracting cells positive for at least one marker protein selected from the group consisting of CD231, PCDH17 and CDH8;

The TGFβ inhibitor is, for example, SB431542, A-83-01 (3-(6-methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-carbothioamide), etc. be.

The above Wnt inhibitors are, for example, PORCN inhibitors, C59, LGK-974, and the like.

The above BMP inhibitor is, for example, LDN193189.

The medium may further contain serum or a serum substitute. The medium in step (i) above can further contain a ROCK inhibitor (eg, Y-27632 (T. Ishizaki et al., Mol. Pharmacol. 2000; 57: 976-983)).

　Cerebral cortex neural progenitor cells are known to be characterized by the expression of specific cell markers such as Pax6, Ctip2, Emx1 and Fezf, or by miRNAs (eg, JP-A-2020-202865).

The cerebral cortical neurons and/or their neural progenitor cells obtained by the above method are preferably cells expressing Ctip2, for example, neurons in the motor cortex of the cerebral cortex (eg, Ctip2 ⁺ CoupTF1 ⁻ ).

The nerve cells and/or neural progenitor cells of the present invention, such as cerebral cortical nerve cells and/or neural progenitor cells thereof produced in the present invention, may be used as purified cell populations or cells containing other cell types. It may be produced as a population, and for example, preferably 60% or more, 70% or more, 80% or more, or 90% or more can be included in the produced cell population.

As another example of nerve cells/neural progenitor cells, a method for inducing the differentiation of pluripotent stem cells into dopaminergic progenitor cells includes, for example: (ii) culturing the cells obtained in step (i) above in a medium containing a reagent selected from the group consisting of FGF8 and GSK3β inhibitors, and (ii) culturing cells containing neurotrophic factors; A method of inducing the differentiation of dopaminergic neural progenitor cells by a step of floating culture in a liquid, and the like (WO2015/034012).

Neurotrophic factors include, for example, NGF, BDNF, NT-3, NT-4/5, Neurotrophin 6 (NT-6), bFGF, acidic FGF, FGF-5, epidermal growth factor (EGF), hepatocyte growth factor ( HGF), Insulin, Insulin Like Growth Factor 1 (IGF1), Insulin Like Growth Factor 2 (IGF2), Glia cell line-derived Neurotrophic Factor (GDNF), TGF-b2, TGF-b3, Interleukin 6 Ciliary Neurotrophic Factor (CNTF) and LIF. Preferred neurotrophic factors are GDNF and/or BDNF.

Analysis of the induction of nerve cells and their progenitor cells can be performed, for example, by gene expression of nestin, PAX6, SO1X, OTX2.

Dopaminergic neural progenitor cells are, for example, floor plate cells that have the ability to differentiate into mesencephalic dopaminergic neurons, neuroectodermal cells characterized by expression markers such as the intermediate filament protein Nestin, and the like. Mature mesencephalic dopaminergic neurons are characterized in vitro by the expression of specific cell markers such as tyrosine hydroxylase (TH), FOXA2, and Nurr1, or by miRNAs (for example, JP-A-2020-202865). It has been known.

As yet another example of nerve cells/neural progenitor cells, retinal ganglion cells and their progenitor cells are shown below for differentiation induction from pluripotent stem cells (e.g., iPS cells or ES cells) (e.g., Table 2016/ 021709).

This method creates retinal ganglion cells and their progenitor cells via the creation of retinal progenitor cells. Specifically, iPS cells are cultured in a retinal differentiation medium (containing Wnt signal inhibitors and Rock inhibitors), further cultured in FBS-containing medium, and medium containing Wnt signal activator and Shh signal activator. Retinal ganglion cells and their progenitor cells can be generated by methods including culturing in retinoic acid and retinal maturation medium containing retinoic acid and N2 supplements, and culturing in BDNF-containing medium. Induction of retinal ganglion cells can be confirmed by the expression of markers such as Brn3b, Math5, Sncg, Islet1 and Tuj1.

A method for producing retinal ganglion cells and their progenitor cells is also described, for example, in Japanese Patent Publication No. 2017-532954.

2. A method for reconstructing a damaged neural pathway A method is provided for reconstructing a neural pathway that has been modified.

The first formulation of the pharmaceutical kit is described in section 1.1. As explained in

Neural pathway disorders are disorders caused by nerve damage in the central nervous system and peripheral nervous system (e.g. trauma, rupture, ischemia, hemolysis, neurodegeneration, etc.), for example, cerebrovascular disorders (e.g., stroke ( cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage, etc.), brain injury (e.g., cerebral contusion, cerebral laceration, etc.), spinal cord injury (impairment of movement and perception distal to the injured spinal cord), neurodegenerative disease (eg, multiple sclerosis, epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Creutzfeldt-Jakob disease, etc.), eye diseases (glaucoma, etc.). Diseases such as the above cerebrovascular disorders, brain injuries, and neurodegenerative diseases are disorders related to the cerebrum (including cerebral cortical disorders), and often cause severe functional disorders such as movement, language, and memory. In addition, the above ophthalmic diseases tend to develop severe visual impairment.

In the above method, the first preparation is administered to the patient at or near the lesion site. In such disorders, loss of nerve cells often occurs due to nerve damage. is denatured and partially remains. Viable neurons are believed to induce neuronal cell proliferation and axonal outgrowth by the first formulation, thereby remodeling the damaged neural pathways (corticospinal or other neural pathways).

In this regard, the present invention also provides, according to an embodiment, a cortex damaged in a patient having a corticospinal tract disorder, comprising administering the first formulation of the pharmaceutical kit to the cerebral cortex, particularly the motor cortex, of the patient. A method for reconstructing the spinal tract is also provided.

Corticospinal tract disorders include paralysis of motor function due to blockage of the corticospinal tract when the motor cortex is impaired, for example, by the above-mentioned cerebrovascular disease or head injury (or brain injury). Therefore, the first formulation can be administered to or near the damaged site of the damaged motor cortex.

The dose of the first preparation is not particularly limited as long as it is an amount capable of inducing axonal outgrowth (that is, an effective amount). .

In the above method, preferably, the second formulation of the pharmaceutical kit may be implanted at or near the site of injury in the patient in order to support growth or proliferation of nerve cells at the site of injury.

The above second formulation is the above 1.2. and contains a cell population containing neurons and/or their progenitor cells, or a cell population containing cerebral cortical neurons and/or their progenitor cells as an active ingredient. The production of these cells or cell populations is described above.

The number of nerve cells or cerebral cortical nerve cells and/or their progenitor cells necessary for the transplantation is not particularly limited as long as the graft can engraft after administration, but is, for example, 1×10 ⁵ or more, 1×10 ⁶ . 1×10 ⁷ or more, 1×10 ⁸ or more, 1×10 ⁹ or more, etc., and may be adjusted appropriately according to the severity, age, weight, sex, etc. of the patient.

The second formulation may be administered before administration of the first formulation, simultaneously with administration of the first formulation, or after administration of the first formulation. As a preferred embodiment, the second formulation may be administered after administration of the first formulation, more preferably 1 to 60 days after administration of the first formulation, more preferably 5 to 30 days, still more preferably 7 days. It may be administered ˜20 days later, most preferably 10-14 days later.

The first formulation or the cells are suspended in a carrier (or excipient) such as physiological saline or phosphate-buffered saline (PBS) and placed at or near the patient's nerve pathway lesion site, for example, at the patient's skull. It can be administered by injection or the like through a drilled hole. Transplantation of cerebral cortical neurons is described, for example, in P. et al. Piccini et al. , Nature Neuroscience, 2, 1137, 1999; R. Freed et al. , N Engl J Med. ; 344:710-9, 2001 and the like.
In the case of injection, it can be administered directly into the patient's brain, spinal cord, or periphery at or near (or around) the site of injury using an appropriate device such as a syringe, cannula, or catheter.

"Patients" as used herein are mammals, for example, primates including humans, rodents, ornamental animals, pet animals, etc., preferably humans.

The present invention will be described in more detail by the following examples, but the scope of the present invention is not limited by the examples. The terms used in the examples are explained below.
(i) mL1CAM-FLAG
The term refers to the murine L1CAM protein or nucleic acid encoding it with a C-terminal FLAG tag.
(ii) pAAV[Exp]-CMV>mL1cam[NM_008478.3]/FLAG
This term refers to AAV packaged with a construct encoding mL1CAM-FLAG (FIG. 3A) under the control of the CMV promoter. It may also be abbreviated as mL1cam-AAV and referred to as an L1CAM expression vector.
(iii) pAAV[Exp]-CMV>mNtn1[NM_008744.2]:T2A:mCherry:WPRE
The term refers to an AAV plasmid containing nucleic acid encoding the mNtn1 protein and nucleic acid encoding the mCherry protein under the control of the CMV promoter. The sequence encoding the T2A peptide causes mNtn1 protein and mCherry protein to be expressed as separate proteins. WPRE stands for woodchuck hepatitis virus posttranscriptional regulatory element. AAV9-packaged product of this plasmid is abbreviated as rAAV9-Ntn1-mCherry.
(iv) pAAV[Exp]-CMV>mSema3a[NM_001243072.1]:T2A:mCherry:WPRE
The term refers to an AAV vector comprising nucleic acid encoding the mSema3a protein and nucleic acid encoding the mCherry protein under the control of the CMV promoter. The sequence encoding the T2A peptide causes it to be expressed as a separate protein from the mSema3a and mCherry proteins. AAV9-packaged product of this plasmid is abbreviated as rAAV9-Sema3a-mCherry.
(v) pAAV[Exp]-CMV>mSema3c[NM_013657.5]:T2A:mCherry:WPRE
The term refers to an AAV plasmid containing nucleic acid encoding the mSema3c protein and nucleic acid encoding the mCherry protein under the control of the CMV promoter. The sequence encoding the T2A peptide causes it to be expressed as a separate protein from the mSema3c and mCherry proteins. AAV9-packaged product of this plasmid is abbreviated as rAAV9-Sema3c-mCherry.

[Example 1]
<Axon elongation from a graft in the cerebral cortex overexpressing L1CAM to the spinal cord>
1. Experiments and Methods <Animals>
All animal experiments in the study were approved by the Laboratory Animal Committee of the Kyoto University Animal Research Facility (Kyoto, Japan) and were performed in accordance with the Kyoto University Animal Care Regulations. This study sought to minimize the number of animals used and morbidity.

Sixteen 13-week-old male mice (C57BL/6NCrSlc) were used as transplant recipients, and graft tissue was obtained from 15 fetal mice derived from two EGFP-transgenic mice (C57BL/6-Tg[CAG-EGFP]). Obtained. All mice were purchased from Shimizu Experimental Materials (Kyoto, Japan).
Mice were group-housed with a 12-hour light-dark cycle and had free access to food and water.

<Vector>
A construct encoding mL1CAM-FLAG under the control of the CMV promoter (Fig. 3A) was generated and packaged into AAV9 to construct pAAV[Exp]-CMV>mL1cam[NM_008478.3]/FLAG (Fig. 3A). Vector Builder). The ID of this vector is VB190707-1042dgs, which can be used to obtain detailed information about the vector from VectorBuilder.com.
As a control vector, pAAV[Exp]-CMV>mCherry:WPRE was constructed in the same manner as described above (Vector Builder). The ID of this vector is VB190114-1227see.

<Vector injection>
Recipient mice were anesthetized by intraperitoneal injection of a mixture of medetomidine hydrochloride (0.75 mg/kg), midazolam (4 mg/kg) and butorphanol (5 mg/kg), and stereotaxic. to hold the head in a horizontal position. A midline scalp incision is made and the superior rostral forelimb area (RFA) of the motor cortex (1.0 mm anterior and 1.0 mm lateral from the apex) and the superior caudal forelimb area (CFA) of the motor cortex (apical apex). Two small fenestrations were made in the skull at 0.5 mm posterior and 1.8 mm lateral from the head using a drill (Minitor, Tokyo). Then, 0.3 μl of mL1cam-AAV solution (1.0×10 ^{13 copies/ml) (n=8), mCherry-AAV solution (1.0×10 13} ^copies /ml) (n=8) as a negative control , or an equal volume of vehicle (PBS(−)) (n=8), was injected into the above RFA and CFA at a depth of 1.0 mm and 0.5 mm, respectively, in sterile 33-gauge microsyringes (Ito Seisakusho , Shizuoka).

<Collection and transplantation of cerebral cortical tissue>
Transplantation was performed one week after injection of the vector or vehicle. Cerebral cortical tissue was harvested from E14.5 EGFP transgenic mice (fetuses), transferred to HBSS (Gibco, USA) and kept on ice until transplantation. The tissue is aspirated and a sterile 22-gauge needle (Hamilton®, USA) was used to transplant 0.3 μl each.

<Immunostaining>
Twelve weeks after transplantation, the mice were deeply anesthetized by intraperitoneal injection of pentobarbital (50 mg/kg) and transcardially perfused with 4% formaldehyde (PFA) (Wako Pure Chemical Industries, Osaka). Brains and spinal cords were post-fixed with PFA overnight, transferred to PBS containing 30% sucrose and stored at 4°C. Thereafter, the brain and spinal cord were placed in O.D. C. T. It was embedded in a compound (Sakura Fine Tech Japan, Tokyo) and sectioned with a thickness of 35 μm using a cryostat (CM-3050; Leica Biosystems, USA).

The sections were permeabilized with a PBS solution containing 0.3% Triton X-100 (Sigma-Aldrich, USA) (room temperature, 45 minutes), and then placed in a PBS solution containing 2% skimmed milk powder (BD Biosciences, USA). Blocking treatment (room temperature, 30 minutes) was followed by primary antibody treatment (4°C, overnight) and secondary antibody treatment (2 hours at room temperature with secondary antibodies conjugated with Alexa488, 594 and 647, respectively). rice field. The primary antibodies include rabbit anti-EGFP antibody (1:1000, #598; Institute of Medical and Biological Sciences, Nagoya, Japan), mouse anti-FLAG M2 antibody (1:1000, #F1804; Sigma-Aldrich), rabbit anti- mCherry antibody (1:500, #ab167453; abcam, UK) and rat anti-L1CAM antibody (1:1000, #MAB5674; R&D Systems, USA) were conjugated with Alexa488, 594 and 647 as secondary antibodies, respectively. Secondary antibodies were used. Nuclear staining was performed with 4',6-diamidino-2-phenylindole (DAPI).

A confocal laser microscope (LSM700, Carl Zeiss, USA; Yokogawa Electric Corporation, Ishikawa) was used to visualize the signals of the secondary antibody and DAPI. Maximum intensity projection (MIP) images of EGFP/DAPI were created using CellPathfinder software (Yokogawa) and analyzed with Fiji software (J. Schindelin et al., Nat Methods, 2012;9(7):676). -682) were used to convert to tiled figures. Nine sections per mouse were used for analysis. The number of axons derived from anti-EGFP antibody-labeled grafts was manually counted in sagittal sections and the average number of axons was recorded.

<Statistical analysis>
Statistical analysis was performed using PRISM9 (GraphPad software). Significant difference between two groups was determined by Mann-Whitney test. Differences were considered statistically significant if the probability value (p) was <0.05. Data are expressed as mean±standard error (SEM).

2. Results FIG. 1 shows immunostained images of sections of the internal capsule (FIG. 1A) and its contralateral spinal cord (FIG. 1B) obtained in the transplantation experiment using PBS(-) as a negative control. In the inclusions, no FLAG-positive (red) axons were observed in the negative control group, and very few EGFP-positive (green) axons (ie, transplanted cell-derived axons) were observed. In contrast, in the L1CAM expression vector-injected group, many EGFP-positive (green) axons were observed, and they basically merged with the L1CAM/FLAG double-positive (red and white intermediate color) axons. (Fig. 1A right panel).

Furthermore, in the contralateral spinal cord, no EGFP-positive (green) axons were observed in the control group, but multiple EGFP-positive (green) axons were observed in the L1CAM expression vector-injected group. It merged with the axons of the double-positive (intermediate color between red and white).

From these results, in the control group, very few of the neurons derived from the transplanted cells were able to extend axons within the internal capsule, but in the L1CAM-expressing vector-injected group, the axons extended beyond the internal capsule to the spinal cord. It was found that there were a large number of transplanted cell-derived neurons that had been transfected, and their axons nestled with recipient axons expressing L1CAM.

Figure 2 shows the results of quantitative analysis of the number of EGFP-positive nerve axons in the ipsilateral internal capsule, ipsilateral cerebral peduncle, and contralateral spinal cord in the L1CAM-expressing vector-injected group and the control group.

From FIG. 2, in the L1CAM-expressing vector-injected group, the number of graft-derived nerve axons in the internal capsule, the cerebral peduncle, and the spinal cord, which are key points in the corticospinal tract, was significant and significant compared to the control group. It was shown that there were many In particular, it was surprising that many axonal outgrowths into the spinal cord were observed, which was almost non-existent in the control group.

Therefore, overexpression of L1CAM in the brain of the recipient prior to cell transplantation significantly promotes axonal outgrowth from neurons derived from the transplanted cells and is shown to enable access to the spinal cord. rice field.

[Example 2]
<Axon extension from a graft in the cerebral cortex overexpressing an axon guidance molecule other than L1CAM to the spinal cord>
Next, the effects on axon elongation when overexpressing axon guidance molecules other than L1CAM were examined.
1. Experiments and Methods <Animals>
The same animals as in Example 1 were used.

<Vector>
Adeno-associated virus (AAV) vector, pAAV[Exp]-CMV>mL1cam[NM_008478.3]/FLAG (Vector ID: VB190707-1042dgs), pAAV[Exp] used for overexpression of axon guidance molecules in this example -CMV>mNtn1[NM_008744.2]:T2A:mCherry:WPRE (Vector ID: VB190108-1270grn), pAAV[Exp]-CMV>mSema3a[NM_001243072.1]:T2A:mCherry:WPRE (Vector ID: 0VB121p-00128 ), pAAV[Exp]-CMV>mSema3c[NM_013657.5]:T2A:mCherry:WPRE (Vector ID: VB190108-1273msn) and pAAV[Exp]-CMV>mCherry:WPRE (Vector ID: VB190114-1227see) Built by VectorBuilder and packaged in AAV9 (rAAV9-L1cam/FLAG, rAAV9-Ntn1-mCherry, rAAV9-Sema3A-mCherry, rAAV9-Sema3C-mCherry, rAAV9-mCherry). The vector ID is Vectorbuilder. com to find more information about Vector.

<Vector injection>
Mice were anesthetized by intraperitoneal injection of a mixture of medetomidine hydrochloride (0.75 mg/kg), midazolam (4 mg/kg), and butorphanol (5 mg/kg), and placed in a stereotaxic instrument so that their heads were horizontal. Fixed. A midline scalp incision was made and the rostral forelimb area (RFA) of the motor cortex (1.0 mm anterior to bregma, 1.0 mm lateral) and the caudal forelimb area (CFA) of the motor cortex (0.5 mm posterior to bregma, lateral 1.8 mm) were drilled with a drill (Minitor Co., Ltd., Tokyo, Japan). Then, 0.3 μl of rAAV vector solution (1.0×10 ¹³ genome copies/ml) or PBS was injected into RFA and CFA with 1.0 mm and 0.0 mm using a 33-gauge sterile microsyringe (Ito Seisakusho, Shizuoka, Japan). Implanted at a depth of 5 mm.

<Transplant>
Transplantation was performed on the same day or 1 week and 2 weeks after vector or PBS injection. Cortical tissue from E14.5 EGFP transgenic mice was harvested, transferred to HBSS (Gibco, Gaithersburg, MD, USA) and stored on ice until transplantation. Tissues were aspirated and implanted (0.3 μl/site) into RFA and CFA (described above) at depths of 1.0 mm and 0.5 mm using sterile 22-gauge needles (Hamilton Company, Reno NV, USA). ).

<Statistical analysis>
Statistical analysis was performed using PRISM 9 (GraphPad Software). For comparisons with in vivo experiments, the significance of differences was determined by the Kruscal-Wallis test (unpaired, nonparametric). Differences were considered statistically significant if the probability value was <0.05. Data are presented as mean±standard error of the mean (SEM).

2. Results FIG. 4 shows the results of quantitative analysis of the number of GFP ⁺ neurites in the CST (ipsilateral internal capsule, ipsilateral cerebral zonules, contralateral spinal cord). Upon forced expression of axon guidance molecules in the corticospinal tract of the host brain, only L1CAM promoted axonal outgrowth from the graft. Next, one week before the transplantation, rAAV vectors into which the netrin1, semaphorin3A, semaphorin3C, L1CAM and mCherry genes were introduced were injected into the motor cortex, respectively. Donor cells were harvested from the frontal cortex of GFP transgenic mice on embryonic day 14 and transplanted. GFP ⁺ axons were significantly increased only in the L1CAM group compared to the control group when counting the number of GFP ⁺ axons in the host's CST (ipsilateral internal capsule, ipsilateral cerebral temporal, contralateral spinal cord). There were many. There was no significant difference in the number of axons between the other axon guidance molecules group and the control group.

At the developmental stage, Sema3A, which acts on axon repulsion, is distributed in the deepest part of the brain cortex, and Sema3C, which acts on attraction, is distributed in a slightly shallower layer (D. Bagnard et al., Development: 5043-5053, 1998 Semaphorins act as attractive and repulsive guidance signals during the development of cortical projects.). In addition to these coordinated expressions, netrin-1 diffuses from the basal ganglia primordium and forms a concentration gradient (C. Metin et al., Development: 5063-5074, 1997; A role for netrin-1 in the guidance of cortical effects.). Since axon guidance is achieved by the complex interaction of these factors, forced expression of at least a single molecule of netrin1, semaphorin3A, and semaphorin3C did not sufficiently exhibit the axon elongation effect. It is speculated that On the other hand, although axonal outgrowth is mediated by a complex interaction of multiple axonal outgrowth factors, forced expression of L1CAM alone in the host's CST induces an axonal guidance effect. What happened was amazing.

[Example 3]
<Co-culture experiment of L1CAM-expressing cells and primary neurons>
In vitro, it was examined whether homogenous binding of L1CAM promotes neurite outgrowth.
1. Experiments and methods <Transfection of HEK-293 cells expressing L1CAM>
A DNA segment encoding L1CAM/FLAG was extracted from pAAV[Exp]-CMV>mL1cam[NM_008478.3]/FLAG (Vector ID: VB190707-1042dgs) with a 15 bp overlapping primer (FOR: tcctaccctcgtaaaacaagttgtgtacaaaagcagg, RE NO: 5 :aactagaaggcacagctacttgtcgtcatcgtctttgtag (SEQ ID NO: 6)). A PiggyBac transposon plasmid (VB201202-1242 kvw) containing TRE3G, TetOn3G, and a puromycin resistance gene (Puro) was linearized by PCR with overlapping primers and the L1cam/FLAG PCR product was subjected to In-Fusion (Clontech, Mountain View, CA, USA). HEK-293 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin.

HEK-293 cells were detached by trypsin in PBS, centrifuged at 200 g for 3 minutes, the supernatant discarded and the pellet resuspended in 1 ml DMEM. After counting the cells, 1×10 ⁶ HEK-293 cells were transferred to a new 1.5 ml reaction tube and centrifuged again under the above conditions. The supernatant was discarded and the pellet resuspended in 100 μl Opti-MEM® I (Gibco). A mixture of 1 μg of PB Tet-On-L1CAM/FLAG plasmid and 1 μg of pCAG-PBase (Transposase) was added to the cell suspension and placed in an electroporation cuvette (2 mm gap, Nepa Gene Co. Ltd., Chiba, Japan). ). Electroporation was performed with the P023 program using a Nucleofector 2b (Lonza, Basel, Switzerland). After 2 days of incubation, 1 μg/ml Puromycin was added for selection. After 5 days of selection, cells were passaged.

<Western blotting>
Wild-type HEK-293 cells and HEK-293 cells expressing L1CAM/FLAG were seeded at 300,000 cells/well and cultured in a 6-well plate. After becoming confluent, the cell culture plate was placed on ice and the cells were washed with ice-cold PBS. After aspirating PBS, ice-cold RIPA buffer (150 mM sodium chloride, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS (sodium dodecyl sulfate), 50 mM Tris (pH 8.0). 0), 1:100 protease inhibitor cocktail, distilled water) (0.5 mL per well) was added. Then, it was transferred to a precooled microtube and allowed to stand at 4°C for 30 minutes. The tubes were then centrifuged at 12,000 rpm for 20 minutes at 4°C. The supernatant was collected and the protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermoscience; REF 23227) and an absorbance microplate reader. Equal amounts of protein (10 μg) were denatured with 2× Laemmili Sample Buffer (Bio-Rad, Hercules, Calif., USA) containing 10% 2-mercaptoethanol at 95° C. for 5 minutes. Samples were then loaded into wells of Any kD Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad). 5 μL of Precision Plus Protein WesternC Protein Standards (Bio-Rad) plus 1 μL of StrepTactin-HRP conjugate (Bio-Rad) was loaded as a marker. Electrophoresis was performed using a running buffer (10% 10×Tris/Glycine/SDS buffer (Bio-Rad) in DW) at 200 V, 0.06 A, 300 W for 30 minutes. Subsequently, using a blotting buffer (8% 10×Tris/Glycine (Bio-Rad), 20% MeOH, distilled water), electroblotting was performed under the conditions of 100 V, 3.00 A, 300 W, 90 minutes, and the gel was Transferred to Immun-Blot PVDF Membrane (Bio-Rad). The membrane was blocked with Tris-buffered saline (TBST) containing 5% skimmed milk and 0.1% Tween-20 for 1 hour at room temperature and treated with a primary antibody (rat anti-L1CAM (1:5000, #MAB5674, R&D Systems), After overnight incubation at 4° C. with mouse anti-β-actin (1:5000, #A2228, Sigma-Aldrich)), horseradish peroxidase-conjugated secondary antibody (anti-rat IgG-HRP (1:10000, #sc -2006, Santa Cruz), anti-mouse IgG-HRP (1:10000, #ab6820, abcam)) for 90 minutes at room temperature. Signals were detected using Pierce ECL Plus Western Blotting Substrate (Thermo Fisher). Images were also acquired with an ImageQuant LAS4000 (Cytiva, Tokyo, Jaoan).

<In vitro assay>
For the in vitro assay, 10,000 HEK-293 (PB-L1Cam/Flag) cells were seeded into each well of collagen (COSMO) coated 96-well plates and incubated at 37°C. Doxycycline (100 ng/mL) was added to the medium to induce expression of the Tet-On gene and maintained throughout the experiment. After the cells formed a confluent monolayer, growth was stopped by adding 100 ng/mL mitomycin followed by incubation at 37° C. for 2 hours. EGFP transgenic mouse cortical nerve cells on day 14 of embryonic development were collected, enzymatically dissociated using Neuron Dissociation Solutions (Fujifilm Wako Pure Chemical Industries, Ltd., Osaka), and 10% FBS (Merck) was added to Neuron. It was suspended in Culture Medium (Fuji Film Wako Pure Chemical Industries, Ltd.). Then, these nerve cells were seeded on the above cultured HEK cells at a density of 10,000 cells/cm ² . As a negative control, anti-L1CAM mAb 5G3, known to inhibit the same intermolecular binding of L1CAM, was added to the medium at 1:200 (Balaian et al., 2000; Wolterink et al., 2010). Images were acquired every 12 hours using an IncuCyte S3 and GFP-positive neurite length was automatically measured using the IncuCyte Neurotrack software. The experiment was repeated 4 times with 4 wells for each group.

2. Results FIG. 6 shows the results of Western blotting. It was confirmed that the target protein L1CAM was expressed in the cells prepared in this example. In addition, FIG. 7 shows the results of the in vitro assay, and FIG. 8 shows the results of quantitative analysis of temporal changes in neurite length of primary neurons on HEK-L1. On day 2 of co-culture, the axons of neurons on HEK cells (DOX) expressing L1CAM elongated longer than those on cells not expressing L1CAM. Addition of the inhibitor 5G3 inhibited axonal outgrowth regardless of L1CAM expression.

From the above, it was shown that L1CAM exerts an axon elongation effect through at least the same intermolecular bond not only in mice but also in humans, and even in cells other than neurons. That is, the axon elongation phenomenon shown in Example 1 does not depend on the cell type or the animal species from which the cells are derived, and the important point is whether or not the cells express L1CAM. shown. Therefore, not only cells derived from a living body but also cells induced to differentiate from pluripotent stem cells (eg, cerebral nerve/progenitor cells) can similarly be expected to exhibit an axonal elongation effect if they express L1CAM. On the other hand, 5G3 inhibited axonal elongation regardless of the expression of L1CAM, suggesting that a mechanism other than the same intermolecular bond works in promoting axonal elongation by L1CAM.

[Example 4]
<Observation of expression of L1CAM by electron microscope>
To explore the mechanism of the axonal outgrowth effect, we observed the expression of L1CAM in the graft-implanted host brain by electron microscopy.
1. Experiments and Methods Transplantation was performed one week after brain cortical injection of AAV-L1CAM/FLAG. Cerebral cortex tissue was collected from E14.5 EGFP transgenic mice (fetuses), the tissue was sucked up, and the injection site of the vector-injected mouse (1.0 mm and 0.5 mm in the RFA and CFA, respectively). depth) were implanted in 0.3 μl aliquots using a sterile 22-gauge needle (Hamilton, USA). After 3 months, brain specimens were collected, embedded, and frozen to prepare brain sections at 35 μm. Brain sections were washed twice with PBS and incubated for 15 minutes with PBS containing 0.3% H ₂ O ₂ and 0.4% Photo-Flo (Kodak, Rochester, NY, USA). After washing with PBS three times for 10 minutes, sections were blocked with 2% skim milk in PBS (BD Biosciences) for 1 hour at room temperature and treated with rabbit anti-GFP antibody (1:1000, #598, #598, 2% skim milk in PBS). (Medical and Biological Laboratories Company Limited) at 4° C. overnight. After washing 3 times with PBS for 10 minutes, sections were incubated with biotin-conjugated goat anti-rabbit IgG antibody in 2% skimmed milk in PBS for 2 hours at room temperature and washed 3 times with PBS for 10 minutes. Then, avidin-biotin complex (vector laboratories inc, Burlingame, Calif., USA) was used to react at room temperature for 1 hour. After washing three times with PBS for 10 minutes, 0.02% 3,3′-Diaminobenzidine, tetrahydrochloride (DAB-4HCl; DOJINDO, Kumamoto, Japan) and 0.0002% H ₂ O ₂ in 50 mM Tris-HCl, pH 7. .6 for 20 minutes at room temperature. After dehydration, they were embedded in epoxy resin and cut into ultrathin sections with a thickness of 70 nm with an ultramicrotome (EM UC6; Leica Biosystems). After washing with PBS, blocking was performed with 2% skim milk for 5 minutes. Sections were then treated with primary antibodies (rabbit anti-GFP antibody (1:1000, #598, MBL International), rat anti-L1CAM antibody (1:30, #MAB5674, R&D Systems, Inc), mouse anti-FLAG M2 antibody (1:1000, #MAB5674, R&D Systems, Inc). 30, #F1804, Sigma-Aldrich) overnight at 4° C. Sections were washed with PBS (7 times, 1 min each) and treated with secondary antibody (biotin-conjugated goat anti-rabbit IgG antibody (1:1000; #BA-1000, Vector laboratories, Burlingame, Calif., USA), goat anti-rat IgG (25 nm Gold) (1:30; #ab41513, Abcam), goat anti-mouse IgG (10 nm Gold) (1:30, #ab39619, Abcam) for 2 hours at room temperature, then fixed with 2% glutaraldehyde diluted with PBS for 15 minutes, washed with distilled water, stained with uranyl acetate and lead citrate, and subjected to an electron microscope (JEM1400 Flash, JEOL). Ltd., Tokyo, Japan) TEM was performed at the Electron Microscopy Research Department, Center for Anatomy, Graduate School of Medicine, Kyoto University.

2. Results FIG. 9 shows photomicrographs of host brains in which the grafts were implanted. It was shown that L1CAM is expressed on the myelin sheath of the host brain and that the graft-derived axons run outside the myelin sheath of the axons of the host brain.

[Example 5]
<Induction of neurons expressing L1CAM>
Finally, neural cells expressing L1CAM, which are candidates for cells to be transplanted, were induced from human iPS cells.
1. Experiments and Methods S17 was used as a cell line. Human iPS cells (established using Sendai virus vector CytoTune 2.0LG) were maintained in StemFit medium on 6-well plates coated with iMatrix-511 silk. On the day before the cells were transferred to the 96-well plate (day -1), the medium was replaced with StemFit's C-fluid-free medium supplemented with 5 μM SB431542. From the next day (day 0), differentiation was induced until Day 18 by the method described in the literature (Sakaguchi et al, 2019, Stem Cell Reports). On Day 18, transfer the organoids from the 96-well plate to a 90-mm dish and add late differentiation medium (DMEM-F12/GlutaMAX, 1x N2 supplement, 1% CD Lipid Concentrate, 1% Penicilin/Streptomycin, 0.1% Amphotericin B) Shaking culture was performed with an Orbital Shaker under 20% O ₂ conditions at . Medium changes were performed every 3-4 days. On day 39 of differentiation induction, organoids were fixed with 4% paraformaldehyde and evaluated by fluorescent immunostaining.

2. Results FIG. 10 shows the results of immunostaining of cerebral organoids 39 days after differentiation. Expression of L1CAM is observed at a site corresponding to the cortical plate (Ctip2-positive, Pax6-negative) at the developmental stage. Thus, cells expressing L1CAM and also expressing Ctip2 can be suitably used for human therapy.

The present invention makes it possible to reconstruct damaged neural pathways (eg, corticospinal pathway).

This application is based on Japanese Patent Application No. 2021-078918 (filing date: May 7, 2021) filed in Japan, the contents of which are all incorporated herein.

Claims

A pharmaceutical kit for reconstructing damaged neural pathways, comprising a first formulation containing, as an active ingredient, an axonal outgrowth-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing the DNA encoding the protein. .
The pharmaceutical kit according to claim 1, wherein the neural pathway is the corticospinal pathway or other neural pathway.
The pharmaceutical kit according to claim 1 or 2, wherein the first formulation is administered to a patient with a neural pathway disorder at or near the site of the disorder.
The pharmaceutical kit according to any one of claims 1 to 3, further comprising a second preparation containing a cell population containing nerve cells and/or their progenitor cells.
The pharmaceutical kit according to claim 4, wherein the second preparation contains a cell population containing cerebral cortical cells and/or their progenitor cells.
The pharmaceutical kit according to claim 4 or 5, wherein the cell population is derived from pluripotent stem cells or somatic stem cells.
The pharmaceutical kit according to claim 6, wherein the pluripotent stem cells are induced pluripotent stem (iPS) cells or embryonic stem (ES) cells.
At least one of the axon outgrowth-inducing proteins selected from the group consisting of L1CAM, Netrin family, Semaphorin family, Slit family, Ephrin family, morphogens and neurotrophic factors The pharmaceutical kit according to any one of claims 1 to 7, which is an axonal guidance factor.
The pharmaceutical kit according to any one of claims 1 to 7, wherein the axonal outgrowth-inducing protein is L1CAM.
The pharmaceutical kit according to any one of claims 1 to 9, wherein said protein or said nucleic acid is contained in a drug delivery system.
The pharmaceutical kit according to any one of claims 1 to 10, wherein the vector is a viral vector.
The pharmaceutical kit according to claim 11, wherein said viral vector is an adeno-associated virus (AAV) vector.
The first preparation containing an AAV vector containing DNA encoding L1CAM, and the second preparation containing the cell population derived from iPS cells or somatic stem cells, according to any one of claims 4 to 12. medicine kit.
comprising administering the first formulation of the pharmaceutical kit according to any one of claims 1 to 13 to a patient with a neural pathway disorder at or near the site of the disorder, treating a damaged neural pathway in the patient. A way to rebuild.
15. The method of claim 14, further comprising implanting the second formulation of the pharmaceutical kit at or near the lesion site in the patient.
Corticospinal tract impaired in a patient, comprising administering the first formulation of the pharmaceutical kit according to any one of claims 1 to 13 to the corticospinal motor area of a patient with corticospinal tract disorder. A way to rebuild.
17. The method of claim 16, further comprising implanting the second formulation of the pharmaceutical kit into or near the lesion site in the cerebral cortex of the patient.
The method according to claim 16 or 17, wherein the corticospinal tract disorder is a disorder caused by head trauma or cerebrovascular accident.
The method according to any one of claims 14 to 18, wherein the patient is human.