WO2022227076A1

WO2022227076A1 - Bioaerosol detection device

Info

Publication number: WO2022227076A1
Application number: PCT/CN2021/091724
Authority: WO
Inventors: 黄荣堂
Original assignee: 奇异平台股份有限公司
Priority date: 2021-04-30
Filing date: 2021-04-30
Publication date: 2022-11-03

Abstract

A bioaerosol detection device, comprising a collection module, a detection module, and a power supply. The collection module comprises an air extraction fan (11), an arc-shaped tapered air passage, a first pump (24), an oil-water container, and a second pump (27); an oil layer and a biological buffer solution (35) are provided in the oil-water container; a filter unit (10) is provided at the air inlet of the air extraction fan (11) to preliminarily filter the air extracted and generate impact force by means of the arc-shaped tapered airway to collect bioaerosols in the air to above the oil layer of the oil-water container; the detection module comprises a sensing chip (14) unit, a signal processing unit, and a microcontroller (17) unit, and these units are electrically connected to each other; at least one detection molecule (53) is attached on the sensing chip (14) unit to detect specific bioaerosols entering the biological buffer solution (35); and the power supply supplies the power required by the collection module and the detection module. The present application also provides a bioaerosol detection method, and is used for addressing incompatibilities between air sampling and liquid-based sensing technology.

Description

A bioaerosol detection device

technical field

The invention relates to the technical field of biological aerosol detection, in particular to a biological aerosol detection device.

Background technique

Several pathogens are known to spread through the air from person to person, including viruses such as influenza, coronaviruses such as SARS, MERS, COVID-19, chicken pox, and rubeola ( measles), Norovirus, or Calicivirus, and bacteria such as tuberculosis, Bordetella whooping cough, and methicillin-resistant Staphylococcus aureus ( such as pneumonia). These airborne pathogens can be spread on solid particles, such as dust and skin flakes, or through aerosol droplets produced by breathing, talking, coughing, sneezing, vomiting, etc.

There are also airborne pathogens that spread from sources other than infected people, such as bacterial and fungal spores (fungi), bacteria in bird droppings, or liquid-based systems such as air conditioners. Flushing toilets has also been found to produce pathogen-laden aerosols. There is a risk of airborne infection when humans are exposed to such pathogens. Additionally, airborne pollen can trigger allergic reactions in some people during certain seasons.

The three most common effective sampling methods for bioaerosols are filters, impactors and impingers. Impingers are liquid collection-based samplers that rely on a 5mL or 20mL working volume, while filters and impingers are dry-collection-based samplers that rely on elution steps to extract the collection from their respective solid supports virus. This elution can result in a large final extracted sample volume, typically several milliliters. If only a small number of viral particles are present in the sampled air volume, these large volumes produce huge dilutions, making these methods unsuitable for low limit of detection (LoD) measurements. Furthermore, the integration and automation of handling and processing of liquid volumes from impactors, filters or impactors to biosensors requires significant system complexity and is not suitable for point-of-care (PoC) applications.

In addition, there are some applications using BioSamplers (SKC Inc.) with a 220V SKC BioLite Sampling Pump (SKC Inc.) for bioaerosol sampling. Briefly, the sampler was connected to an in-line steam trap (SKC Inc.) to protect the pump from moisture, and the pump was allowed to run for 5 minutes to warm up before sampling. The SKC BioSampler was filled with 15 ml sterile phosphate buffered saline (PBS) containing 0.5% (w/v) bovine serum albumin fraction V (BSA) powder and placed 1-1.5 m above the ground. Each sampling pump was run for 30 minutes at a flow rate of 8/l/min, allowing approximately 240 liters of air to be sampled per site. At the end of the sampling period, the pump was turned off, the BioSampler was disconnected, and the sample medium was aseptically transferred from the SKC Bio-Sampler collection container to a sterile 15 ml conical tube. Sent for quantitative polymerase chain reaction (qPCR). All samplers were autoclaved at the end of each sampling day.

There are also systems on the market that include a custom electrostatic precipitation (ESP)-based bioaerosol sampler combined with downstream quantitative polymerase chain reaction (qPCR) analysis. The aerosolized virus was sampled directly into a miniaturized collector with a liquid volume of 150 μL, which constituted a simple and straightforward interface for subsequent bioassays. This method reduces sample dilution by at least an order of magnitude compared to other liquid-based bioaerosol samplers.

Common sampling methods for bioaerosols described above rely on laboratory analysis of captured particles. There are currently no established methods that provide sensitive detection, identification and quantification at the sampling point. However, sensitive and direct detection of airborne pathogens may aid in rapid diagnosis, disease spread and prevention of outbreaks, as well as in cleaning contaminated air when air monitoring is performed near the patient's point-of-care (PoC) or in healthcare and other facilities After installation, immediate bioaerosol control is achieved.

In order to solve the above-mentioned fact that bioaerosol collection is separated from in situ sensing, the in situ sensing device seems to be able to combine the biosensor with the back end of the bioaerosol collector to achieve the detection goal of POC. However, current multifunctional tools such as Lab on a chip (LoC) biosensors are only suitable for liquid samples. In order to have the same diversity of possibilities for the detection and analysis of airborne particles, such as bioaerosols, compatible air sampling and air-liquid interface technologies must be developed. In addition, after sampling, it is possible to connect to a chip that can perform on-site detection immediately, which requires both precision and real-time. To address the incompatibility of air sampling and liquid-based sensing technologies, an interdisciplinary approach is necessary, and the present invention addresses this issue.

SUMMARY OF THE INVENTION

The present invention aims to solve one of the technical problems in the above technologies at least to a certain extent. To this end, one object of the present invention is to propose a bioaerosol detection device that solves the incompatibility problem of air sampling and liquid-based sensing technologies.

The second object of the present invention is to propose a method for bioaerosol detection, which solves the incompatibility problem of air sampling and liquid-based sensing technology.

In order to achieve the above purpose, one aspect of the embodiments of the present invention provides a bioaerosol detection device, including:

Collection module, the collection module includes a suction fan, an arc-shaped tapered air passage, a first pump, an oil-water container, and a second pump; the oil-water container is provided with an oil layer and a biological buffer; the air inlet of the suction fan is provided with a filter unit , to preliminarily filter the inhaled air, and generate impact force through the arc-shaped tapered airway to collect the bio-aerosol in the air above the oil layer of the oil-water container, so that the bio-aerosol is adsorbed on the surface of the oil layer, and then periodically passes through the first The pump hits the pressure air on the surface of the oil layer to turn the oil layer. During the inversion process, the bioaerosol to be tested is turned under the oil layer and enters the biological buffer;

a detection module, the detection module includes a sensing chip unit, a signal processing unit, and a microcontroller unit, and each unit is electrically connected; at least one detection molecule is fixed on the sensing chip unit to detect a specific biological aerosol entering the biological buffer;

Power supply, the power supply the power required by the collection module and the detection module;

The bioaerosol to be tested entering the biological buffer solution is designed with a circulating flow channel and driven by the second pump, so that the biological buffer solution and the bioaerosol to be tested under the oil layer will circulate through the sensing chip unit. The bioaerosol to be tested is effectively contacted with the detection molecules to achieve capture and detection.

According to a bioaerosol detection device according to an embodiment of the present invention, the bioaerosol to be tested entering the biological buffer solution is designed with a circulating flow channel and driven by the second pump, so that the biological buffer solution under the oil layer and the waiting The bioaerosols to be measured will circulate through the sensor chip unit, so that the bioaerosols to be measured can effectively contact aptamers or antibodies to achieve capture and detection, thereby solving the incompatibility between air sampling and liquid-based sensing technologies.

In addition, the bioaerosol detection device proposed according to the above embodiments of the present invention may also have the following additional technical features:

Further, the bioaerosol includes at least one of viruses, germs, fungi, and pollen.

Further, the detection module includes a wireless communication module or a display unit.

Further, the redox ions contained in the biological buffer are selected from red blood salt, yellow blood salt, ruthenium hexaammine, and enzymes.

Further, the probe molecules are selected from aptamers, antibodies or carbohydrate molecules.

Further, nanomaterials used for aptamers or antibodies for capturing the target are added on the sensing chip, and the nanomaterials are selected from nanomagnetic beads, nanogold, carbon tubes, graphene, ZnO, and these nanomaterials are further combined with thionine or Prussian blue.

Further, the detection method of the sensing chip unit is an optical method selected from surface plasmon method, colorimetric method, chemiluminescence method, fluorescence method, surface enhanced Raman scattering method and interference method.

Further, the detection method of the sensing chip unit is an electrical method. When the binding between the target and the antibody or aptamer causes or changes an electrical signal, the concentration of the target can be detected. device method, field effect transistor method, nanopore.

Further, the signal processing unit of the electrical method is mainly selected from amperometric method, square wave voltammetry, differential pulse wave voltammetry, chronoamperometry, intermittent pulse amperometric method, fast scanning cyclic voltammetry, electrochemical impedance spectroscopy, Field-effect enzyme assays or combinations thereof.

In order to achieve the above purpose, a second aspect of the embodiments of the present invention provides a method for detecting biological aerosols, using the above-mentioned biological aerosol detecting device, including the following steps:

Step 1, filter, remove the non-target biological aerosol from the air to be tested;

Step 2, air extraction, and the ambient air is sucked into the device by an air intake fan;

Step 3, capturing and collecting, impacting the bioaerosol into the oil film/biological buffer in the device, so that the bioaerosol adheres to the oil film, or passes through the oil film and directly enters the biological buffer;

Step 4: The biological aerosol is converted into a hydrosol, and the tapered airway of the detection device is used to generate an impact force, or the first pump blows the aerosol captured above the oil film and flips the oil film into the biological buffer to become a hydrosol;

Step 5: Concentrating mass transfer, using the design of the circulating flow channel, all the hydrosols in the biological buffer flow to the sensing chip and the detection molecules on the chip are captured and combined;

The sixth step, detection, utilizes the detection molecules on the sensing chip to capture and bind, and the resulting signal changes to detect the concentration of the target bioaerosol.

Description of drawings

1 is a functional block diagram of a bioaerosol detection module according to an embodiment of the present invention;

2A is a schematic diagram of the internal structure of a bioaerosol detection device according to an embodiment of the present invention;

2B is a schematic three-dimensional structure diagram of a bioaerosol detection device according to an embodiment of the present invention;

FIG. 3 is a schematic diagram of the air flow directions of the air intake and the air outlet of the bioaerosol detection device according to an embodiment of the present invention;

4A is a configuration diagram of an intake fan, a first pump, and a second pump of a bioaerosol detection device according to an embodiment of the present invention;

4B is a 1/4 sectional view of FIG. 4A of the bioaerosol detection device according to an embodiment of the present invention;

4C is a schematic diagram of the flow direction of the first pump actuation of the bioaerosol detection device according to an embodiment of the present invention;

5A is a schematic diagram of the flow direction of the second pump actuation water flow of the bioaerosol detection device according to an embodiment of the present invention;

5B is a schematic diagram of the flow direction of the second pump actuation water flow of the bioaerosol detection device according to an embodiment of the present invention;

5C is a schematic diagram of the distribution of the bioaerosol to be measured when the second pump of the bioaerosol detection device according to the embodiment of the present invention is not actuated;

5D is a schematic diagram of the distribution of the bioaerosol to be detected in the second pumping action of the bioaerosol detection device according to the embodiment of the present invention;

6 is a schematic structural diagram of a sensing chip of a bioaerosol detection device according to an embodiment of the present invention;

7 is a schematic diagram of a field-effect enzyme sensing platform of an embodiment of a bioaerosol detection device according to an embodiment of the present invention;

FIG. 8 is a schematic structural diagram of a field-effect enzyme sensing chip of an embodiment of a bioaerosol detection device according to an embodiment of the present invention.

Label description

Bioaerosol Detection Device 1 Ambient Air 5

Filter unit 10 Exhaust fan 11

Oil film/biological buffer container 13 Sensing chip 14

Signal reading module 16 Microcontroller 17

Wireless communication module 18 Power supply module 19

First pump 24 Second pump 27

Base 28 Cover 29

Oil Film 33 Biological Buffer 35

Virus 51 Detector molecule 53

Circulating waterway 55 The direction of water flow 57

Working electrode 61 Counter electrode 63

Reference electrode 65 aptamer/enzyme conjugate 71

The first aptamer 711 Enzyme 712

Bacteria or virus72 Second aptamer73

Gating voltage 74 Gating electrode GE75.

Detailed ways

The following describes in detail the embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals refer to the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary, and are intended to explain the present invention and should not be construed as limiting the present invention.

The bioaerosol detection module 1 of the present invention mainly needs to achieve three goals, as shown in FIG. 1 , FIG. 2A , FIG. 2B and FIG. 3 , first, in a general environment, the ambient air 5 that may contain bioaerosols is extracted by The air fan 11 is drawn into the filter unit 10 to purify the bio-aerosol to be tested, and the bio-aerosol to be tested will not be affected by the filtering method on its surface biochemical properties. Second, through the design of the arc-shaped tapered airway, the parameters of the flow rate and pressure are adjusted to generate an impact force to push the bioaerosol in the air into the oil film 33 of the oil film/biological buffer container 13, so that the bioaerosol can be adsorbed On the surface of the oil film 33, and then the pressure wind is periodically hit on the surface of the oil film 33 through the first pump 24, so that the oil film 33 is turned over. 3. The biological aerosol to be tested entering the biological buffer 35 is driven by the second pump 27 through a special flow channel design, so that the biological buffer 35 under the oil film 33 and the biological aerosol to be tested will be Circulating flow through the sensing chip 14 makes the bioaerosol to be tested effectively contact with the specific aptamer or antibody, so as to achieve nearly 100% capture and detection. Wherein, the biological buffer 35 may be Phosphate-buffered saline (Phosphate-buffered saline, PBS).

In this example, the first pump 24 is a small pump, and the second pump is a peristaltic pump.

It should be noted that there are more choices for biological buffers such as PBS, as long as the biological buffer (also known as Good's Buffers) plays an important role in some biochemical reactions that are more sensitive to pH, use this kind of buffer. Chemicals help to regulate and maintain the pH of the reaction environment within the physiological pH range. The source can be taken from Hopax, one of the largest manufacturers of Good's Buffers in the world. Good's Buffers have the following characteristics: pKa value between 6 and 8, good water solubility, non-toxic, not easy to interfere with biochemical reactions, not easy to penetrate cell membranes, good stability to enzymes and hydrolysis, not easy to change with environmental temperature changes , and limited interaction with mineral cations.

2A is a schematic diagram of the internal structure of a bio-aerosol detection device according to an embodiment of the present invention, and FIG. 2B is a schematic diagram of a three-dimensional structure of a bio-aerosol detection device according to an embodiment of the present invention. The bio-aerosol detection device includes a base 28 and an upper cover. 29. The suction fan 11, the first pump 24, the sensing chip 14 and the second pump 27, the suction fan 11, the first pump 24, the sensing chip 14, and the second pump 27 are arranged on the base, The upper cover 29 is covered on the base 28 .

The preferred embodiment of the filter unit 10 is two layers, the first layer is to filter the larger dust particles in the air, and the filter of the large particles is generally visible to the naked eye. For particles, use commercially available filter cotton for the first layer of filtration, and the second layer of filtration to filter fine particles in the air. The test object is a germ, and its size is about 1-2um; or an influenza virus, its size is about 80-120nm, in order to achieve the accuracy of detection, the method is to use a suitable filter device, because the direction of the present invention is to capture the germs in the air Or influenza virus, however, the bacteria or influenza virus may not be accompanied by water droplets in the air, so a dry-to-wet mechanism must be provided on the surface of the chip, so that the bacteria or virus can pass through this mechanism to accelerate the bacteria or influenza virus and infection. To measure the aptamer binding on the surface of the chip, as shown in FIG. 1, the present invention uses an exhaust fan 11 and a filter unit 10, wherein two filter devices can be set in the filter unit 10, the sensor chip 14 and the signal reading module 16 perform biological For aerosol sensing, the microcontroller 17 performs adjustment and control, the wireless communication module 18 has a communication function, and the power supply module 19 supplies power to the exhaust fan 11 , the sensing chip 14 and the signal reading module 16 .

As shown in FIG. 3, FIG. 4A, FIG. 4B and FIG. 4C, the present invention mainly uses the exhaust fan 11 to generate forced convection of the ambient air, so that the ambient air can enter the detection device more efficiently, and the air will contact the designed air duct after entering. The oil film 33, most of the microorganisms or viruses will be attached to the surface of the oil film 33. In order for the microorganisms or viruses on the oil film 33 to pass through the oil film 33 and contact with the PBS 35, a strong positive pressure is required above the oil film 33 to blow down the oil film 33. Turn over, as shown in Figure 4A, Figure 4B, Figure 4C, where the first small pump (small pump) 24 is used to inhale the strong positive pressure from above, so that the oil film 33 can be turned over. The purpose of using the oil film 33 here is to Let the PBS stay in the open space for a long time, and it will not volatilize and reduce its volume, thereby affecting the detection accuracy of the target to be measured. The preferred embodiment of the oil film 33 is various types of mineral oil, salad oil, or other substances that will not kill the target. The oil of the bioaerosol also does not react with PBS or its additives, such as red blood salt/yellow blood salt, or other redox ions (redox), and can be maintained for several months without much volatilization. This innovative method eliminates the need for automatic water supply devices to replenish PBS in the container, maintains the thickness of the oil film/PBS within a fixed volume, and ensures that the concentration of PBS or its additives remains nearly constant. The thickness of the oil film 33 is designed in the range of 0.1mm to 3mm, preferably in the range of 0.5mm-1mm. The thickness of the oil film 33 must be sufficient so that the blow-off oil film 33 can be turned over and quickly (eg, within 0.5 seconds to 5 seconds) to restore the complete coverage of the PBS by the oil film 33 .

Most pathogens such as viruses or germs that are harmful to humans or animals are hydrophilic, so they are collected on the oil film 33 and blown onto the oil film 33, causing the oil film 33 to turn over and let the pathogens contact PBS, and the pathogens will enter hydrophilically. In PBS, the effect of effectively collecting airborne pathogens into PBS can be achieved.

In some embodiments, the first pump (small pump) has a strong positive pressure to intake air from above, so that the oil film 33 can be turned over, which is also directly replaced by a suction fan. The method is that the suction fan can be large During a period of time, it works at a slow speed to collect aerosols on the oil film 33, and another period of time works at a high speed to generate a strong positive pressure and at the same time, the oil film 33 is turned over.

Since the relative concentration of harmful biological aerosols in the air is not high, the traditional detection methods, the three most common effective sampling methods are filtration, impactor and impactor, which increase the chance of collection and fix it once collected, In the present invention, the oil film 33 is used for collection, and the oil film 33 has an adsorption effect on the target, but at the same time, it may also adsorb the impurities passing through the first filter. Therefore, when these targets and impurities are turned over into the PBS under the oil film 33, and the target bioaerosol is turned over to the PBS, the second pump 27 is used to add a closed-loop circulating water circuit 55, as shown in Figure 4A, Figure 4B, As shown in FIG. 4C and FIG. 5A and FIG. 5B, the target bioaerosol is continuously circulated in the water flow direction 57, and each time it flows through the sensing chip 14, there is a chance to be detected by aptamers, antibodies, or sugar molecules on the working electrode. Molecules 53 capture, as shown in Figure 5C and Figure 5D, the flow rate is adjusted properly, PBS can flow, but the target bioaerosol that has been bound to probe molecules such as specific aptamers or antibodies will not be detached. In this way, basically, the target bioaerosol in the PBS will eventually bind specifically to the aptamer on the working electrode. Therefore, the concentration of the target bioaerosol in the PBS can be quantitatively obtained by reading the signal of the circuit.

More specifically, as shown in Fig. 5C, the target bioaerosol such as virus 51 is very small, and because of the movement mode of diffusion, it is a random action, and it is difficult to have a chance to move to the vicinity of the detection molecule 53 of the working electrode, and interact with the detection molecule. The combination of 53, that is, concentrated mass transfer is a necessary means to improve the sensitivity of detection. As shown in Figure 5D, a small circulating flow rate is given to the solution, so that the movement of virus 51 becomes a directional movement, especially in the vertical direction. Working electrode, and let the flow rate be very small, or flow for a period of time, and stand still for a period of time, giving a chance for stable combination, and also perform signal measurement and processing at the same time.

The present invention therefore does not require the usual sampling methods of bioaerosols described above and must rely on laboratory analysis of captured particles. The present invention can effectively achieve sensitive detection, identification and quantification directly to the sampling point.

For the embodiment of the measurement of the sensing chip 24, various common measurement methods can be selected, such as optical (Optical) including surface plasmon resonance (SPR), colorimetric (colorimetric) method, chemiluminescence method (chemiluminescence, CL), fluorescence (fluorescence), surface-enhanced Raman scattering (surface-enhanced Raman scattering, SERS) and interference (interferometry).

The embodiment of the sensing chip measurement 24 can also use an electrical method. When the binding between the target and the antibody or aptamer causes or changes the electrical signal, the concentration of the target can be detected. According to its detection mechanism, it can be divided into electrical method, piezoelectric transducer method, or field effect transistor (FET) method. Nanopores can also be used, (see Niedzwiecki, D.J., Iyer, R., Borer, P.N., and Movileanu, L. (2013). Sampling a biomarker of the human immunodeficiency virus across a synthetic nanopore. ACS Nano 7, 3341–3350.), wherein the signal processing unit described in the electrical method is mainly selected from electrochemical sensing circuits, amperometric methods, square wave voltammetry (SWV), differential pulse voltammetry (Differential Pulse Voltammetry) , DPV), chronoamperometry (chronoamperometry), intermittent pulse amperometry (intermittent pulse amperometry, IPA), fast-scan cyclic voltammogram (fast-scan cyclic voltammogram, FSCV), electrochemical impedance spectroscopy (Electrochemical Impedance Spectrum, EIS) ) or a combination thereof.

For the above-mentioned type of sensing chip 14, some embodiments may modify the sensing chip 14 by adding nanomaterials to support aptamers or antibodies for capturing the target, and some nanomaterials are also involved in signal conversion. Increase the sensitivity of the sensor. These nanomaterials include nanomagnetic beads, nanogold, carbon tubes, graphene, ZnO, etc. These nanomaterials were further combined with thionine (THI) or Prussian Blue (PB) to enhance the redox reaction during electrochemical detection.

The present invention is particularly illustrated by using an example of Electrochemical Impedance Spectrum (EIS), the sensing chip 14 can be made of a gold working electrode, the solution PBS is added with red blood salt/yellow blood salt 5mM or other redox ions, such as six Ammonium ruthenium(II)/(III) (Hexaammineruthenium(II)/(III)), can prolong the use and storage time. The Faraday current measurement method is used to ensure that its sensitivity can reach the limit of detection (LOD) of the order of 0.1pg/mL or better.

In some embodiments, electrochemical impedance spectroscopy (EIS) can also be used, but a Faraday measurement method is used, that is, the gold electrodes are formed into a comb-like interdigitated structure, and the spacing between the positive and negative electrodes is 10-50 microns. Then the concentration of bacteria and viruses is proportional to the impedance change.

In some embodiments, the aptamer/enzyme combination 71 is first coated on the area other than the electrodes of the replaceable sensor chip 14 . To use, insert the sensing chip 14 into the PBS of the device of the present invention, so that the aptamer/enzyme conjugate 71 is dissolved in PBS, so that the first aptamer 711 in the conjugate 71 can interact with the aptamer captured in the PBS. The germs or viruses 72 are specifically bound, and at the same time, these germs or viruses 72 with the binding bodies 71 will also be close to the sensing chip 14 due to the circulating water flow, and thus bind to the second aptamer 73 immobilized on the working electrode WE on the chip. , and there may be more aptamer/enzyme conjugates 71 that will combine with the bacteria or viruses captured by the second aptamer 73 on the chip working electrode WE to form a sandwich. The enzyme 712 in the aptamer/enzyme combination 71 is selected from oxidoreductases such as horseradish peroxidase (Horseradish peroxidase, HRP), and the aptamer/enzyme (aptamer-biotin-streptavidin-HRP) is formed through a coupling procedure.

The detection platform is based on Field Effect Enzymatic Detection (FEED) technology. The method uses an immunoassay platform to directly detect bacteria or viruses in samples without culture enrichment. FIG. 7 is a schematic diagram of a field-effect enzyme detection platform according to an embodiment of the present invention. The gate voltage 74 induces an electric field at the solution-enzyme-electrode interface to reduce the tunneling barrier for electrons. Therefore, the tunneling current between the electrodes and the HRP, the signal current, is amplified by the gate voltage 74 . The platform provides ultra-sensitive quantitative detection of viruses and bacteria due to signal amplification, which can directly detect viruses or bacteria in bioaerosols in extremely low-concentration samples without sample processing.

On the original three-electrode (WE-CE-RE) sensing chip 14 , the second aptamer 73 is first fixed to the working electrode WE. For the production of Gating electrode GE 75, for example, use thick copper foil tape to spray insulating paint, or enameled copper wire, etc., to make a U shape, as shown in Figure 8, one end is welded with gold fingers, and the other end is free. This method is suitable for detecting bacteria and viruses. The assay is based on the amplification of the horseradish peroxidase (HRP) reduction peak current, and the peak height is measured by drawing a baseline and judged by the cyclic voltammogram (CV).

As far as the structure of droplet-infected viruses and bacteria is concerned, the related proteins may appear in the host infected by the virus or bacteria, and may appear in the droplets of the host, so an all-in-one sensor is used. , which can increase the sensitivity and accuracy of the sensing. For example, for coronaviruses, such as SARS, SARS-COV-2, MERS, etc., the proteins of its viral structure include Spike glycoprotein, Envelope protein, TransMembrane glycoprotein, nuclear Capsid protein (Nucleocapsid protein), etc. Therefore, fixed detection molecules can be implanted on the working electrode of the all-in-one sensor chip, and selected from Spike glycoprotein (Spike glycoprotein), Envelope protein (Envelope protein), Transmembrane glycoprotein (TransMembrane glycoprotein), nucleocapsid protein (Nucleocapsid protein), antibodies or aptamers, or nucleotide molecules against ssRNA. Among them, for example, the antibody against Spike glycoprotein can be one of IgA, IgM, and IgG, or both of IgG and IgM, or both of IgA and IgG, or three of IgA, IgM, and IgG.

The device of the present invention can estimate the concentration Ct of the air target bioaerosol

Ct=(M/V)/E

Among them, E=CR1 X CR2 X CR3 bioaerosol sensing system capture and collection efficiency,

The calculation of capture rate Capture Ratio includes: 1. Air impurity filtration capture rate CR1; 2. Capture rate CR2 of impact oil film 33 and inverted oil film 33 entering PBS; 3. Circulating flow or PWM disturbance, capture rate CR3; target collection quality M=CxVpbs (ng); PBS volume Vpbs (mL); the sensing chip 14 senses the target concentration C (ng/mL); the collected gas volume V=QxT; the pump flow Q (L/min) ; Pumping time T (min).

After the present invention detects pathogens, the steps of replacing relevant consumables are as follows:

Remove the filter paper in front of the exhaust fan;

remove the sensing chip 14;

Remove modules such as PBS reservoir, PBS/oil film, etc.

Disinfection: Wipe or spray the remaining modules and equipment with alcohol, or use ultraviolet light to irradiate to kill residual pathogens. For the pathogen-killing effect of ultraviolet light, refer to "Far-UVC light: A new tool to control the spread of airborne-mediated microbial diseases” Scientific RePortS|(2018)8:2752|DOI:10.1038/s41598-018-21058-w

Replace the new PBS storage tank, PBS/oil film and other modules,

Replace the sensor chip 14 with a new one.

Install a new filter paper in front of the extraction fan.

Example 1 - Detection of Influenza Virus

Many respiratory viruses in humans originate from animals. For example, there are now eight paramyxoviruses, four coronaviruses, and four orthomxoviruses that cause recurrent human epidemics, but were once limited to other hosts. Over the past decade, several members of the same virus family have jumped the species barrier from animals to humans. Fortunately, these viruses have not yet established in humans because they lack the ability to transmit continuously from person to person. However, multiple outbreaks have shown our lack of understanding of how the virus can spread. In part because of the relatively high zoonotic and epidemic frequency of influenza viruses, the influenza research community has begun to investigate the viral genes and biology that drive viral transmission through aerosols or mammalian respiratory droplets. We summarize recent findings on the genetic and phenotypic characteristics required for airborne transmission of zoonotic influenza viruses of subtypes H5, H7, and H9, and influenza viruses of subtypes H1, H2, and H3.

Influenza detection is mainly based on Hemoglutin antigen, so H1-H16 Aptamer can be used to make sensor chip 14. Basically, as long as each H-type antigen is made separately, or six-in-one, as long as three types are produced, it can be covered All influenza virus species and variant combinations. As shown in FIG. 6, it is a two-in-one sensing chip, including two working electrodes 61, two counter electrodes 63, sharing a reference electrode 65, and setting aptamers for two different H-type antigens, such as for H1, and H3 Subtype influenza virus; or a three-in-one sensor chip with aptamers of three different H-type antigens, such as H1, H2 and H3 subtype influenza viruses; or H5, H7 and H9 subtype zoonotic influenza viruses . Or in the four-in-one sensor chip H1, H3, H5, H9; or in the six-in-one sensor chip, set six different H-type antigen aptamers, such as H1, H2 and H3 subtype influenza virus, H5, Zoonotic influenza viruses of subtypes H7 and H9.

The working electrode of the sensing chip 14 was electrochemically treated by cycling the gold working electrode between -0.2 and +1.2 V at 0.1 V/s in 0.5 M H ₂ SO ₄ until reproducible cyclic volts were obtained. Antu. Then 0.5 μM of the thiolated aptamer probe with an oligoethylene glycol spacer (HS-(CH ₂ CH ₂ O) 18 was added to 100 μL of phosphate buffered saline (PBS: 10 mM phosphate buffered saline, 5 mM MgCl ₂ ) 18 -GGACCAGTTGTCTTTCGGTCTCTACCCCAGCCCGT), pH 7.4, incubated at 95°C for 10 minutes, then cooled to room temperature. Then, the HS-A20S solution was mixed with 1 μL of tris-(2-carboxyethyl)phosphine hydrochloride (TCEP) stock solution (100 mM). The mixture was kept for 1 hour to reduce the dithiol bonds. The clean gold electrodes were then immersed in the above solution and kept at room temperature for 12 hours. The electrodes were rinsed with PBS and immersed in aqueous MCH (1 mM) for 4 h. The functionalized electrodes were rinsed thoroughly with PBS 3 times before use.

All electrochemical measurements were performed at room temperature on an EIS signal readout circuit using an aptamer-modified gold electrode as the working electrode (WE), the Ag/AgCl reference electrode (RE), and the gold electrode (CE) as the counter electrode . After incubation of the aptamer-functionalized electrodes with virus samples (H1N1, B and H7N9) in PB solution containing 1M _NaCl /5mM _K3Fe (CN) ₆ /5mM K4Fe(CN) ₆ for 30 min at room temperature , and then collected EIS with 10 mV amplitude in the frequency range from 0.03 Hz to 200 kHz.

Example 2--New coronavirus SARS-CoV-2 immunosensor

Structure of SARS-CoV-2; consists of a spike protein; it includes two regions, S1 and S2, where S1 is used for host cell receptor binding and S2 is used for membrane fusion. Spike proteins are typical targets for neutralization with antibodies and vaccines. SARS-CoV-2 has been reported to infect human respiratory epithelial cells 100-1000 times faster than previous coronavirus strains and by interacting with the human ACE2 receptor.

Nucleocapsid protein is the most abundant protein in SARS-CoV-2. The N protein is a highly immunogenic phosphoprotein that rarely changes. The N protein of SARS-CoV-2 is often used as a marker in diagnostic assays.

While IgG antibodies can confirm persistent, even past infection, IgA antibodies have been described as an early marker of acute respiratory infection. In a recent study (Okba et al., doi: 10.1101/2020.03.18.20038059; March 2020), the added value of specific IgA detection for the early diagnosis of acute SARS-CoV-2 infection was demonstrated. Good sensitivity and specificity of ELISA have also been demonstrated. The antigens (IgA and IgG) used in the SARS-CoV-2 ELISA, the Spike protein S1 domain, are more serologically detectable for SARS-CoV-2 antibodies than for the more conserved N- or full-length S protein. specificity.

A self-assembled monolayer (SAM) of MHDA was formed by soaking the gold electrode (Au) in an ethanol solution containing 1 mM 16 MHDA for 24 h. After SAM formation, the Au/MHDA electrodes were treated for 20 min at room temperature in a mixture of 5 mM EDC, 15 mM NHS and PBS solutions to activate the carboxylic acid groups of MHDA. Subsequently, the antibody IgG and IgM of COVID-19 were covalently immobilized on the Au/MHA electrode by incubating the modified electrode in 0.1 M PBS solution (pH 7.4) containing 100 μg/mL stock solution at 37 °C for about 1 h. superior.

All electrochemical measurements were performed at room temperature on an EIS signal readout circuit using an aptamer-modified gold electrode as the working electrode (WE), the Ag/AgCl reference electrode (RE), and the gold electrode (CE) as the counter electrode . The COVID-19 antibody IgG and IgM modified working electrode and virus or its S protein or N protein were placed in PB solution containing 1M NaCl/5mM K ₃ Fe(CN) ₆ /5mM K ₄ Fe(CN) ₆ After 10 min incubation at room temperature, EIS were then collected at 10 mV amplitude in the frequency range from 0.03 Hz to 200 kHz.

Example 3--New coronavirus SARS-CoV-2 aptamer sensor

A 51-nt3 hairpin aptamer for CoV2-RBD-1C (5'-CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA-3'). The Kd value of this aptamer for RBD was 5.8 ± 0.8 nM.

67-nt hairpin structure of CoV2-RBD-4C (5'

- ATCCAGAGTGACGCAGCATTTCATCGGGTCCAAAAGGGGCTGCTCGGGATTGCGGATATGGACACGT-3'). The Kd value of this aptamer for RBD was 19.9 ± 2.6 nM.

This example uses NG-THI-AuNPs nanocomposite to modify the working electrode. The synthesis process of NG-THI-AuNPs nanocomposite is as follows: a total of 2 mg of NG is mixed with 2 mL of ultrapure water in a round bottom flask, and then sonicated for 30 minutes to form a stable NG solution. After that, 2 mL of THI solution (2 mg/mL) was added to the above flask, followed by vigorous stirring for 24 h. THI molecules will be non-covalently bound to the NG surface due to the π-π stacking interaction between the benzene rings. Unintegrated THI molecules were removed by centrifugation and washing several times to obtain NG-THI nanocomposites. The synthesized nanocomposites were then dispersed in 2 mL of water. Then 10 mL of AuNPs solution with a diameter of about 15 nm was added to the above dispersion and stirred overnight to promote the complete integration of AuNPs with the amino groups of NG. AuNPs were prepared according to the literature (Guo and Wang, 2007). Finally, after washing and centrifugation, NG-THI-AuNPs nanocomposites were obtained and stored at 4 °C for further use.

During the preparation of the SARS-CoV-2 virus

aptamer sensing chip

14, 10 μLNG-THI-AuNPs nanocomposites were coated on the corresponding working electrodes. Place the modified device in a 50°C oven for half an hour. Then, 10 μL of 2019-nCoV aptamer was dropped onto the surface of the NG-THI-AuNPs modified electrode, and then the unbound aptamer was removed with 1 mL of LTE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4). The concentration of SARS-CoV-2 aptamer was optimized to 28 μg/mL. Since the aptamers have been modified with sulfhydryl groups at the 5' end, this facilitates their binding to AuNPs via Au-S bonds. Next, block any non-specific binding sites with 10 μL of 1 mM MCH solution. After 1 hour incubation at room temperature, the modified aptamer sensor chip was washed 3 times with 1 mL of TE buffer. The prepared aptamer sensing chip can be loaded into the bioaerosol detection device of the present invention when used, and connected to the reading circuit module, using DPV to measure the concentration of SARS-CoV-2 virus in the PB solution, and inversely calculate The concentration of SARS-CoV-2 virus in the air.

Example 4 - SARS virus sensor.

For aptamers specific for the nucleocapsid protein of SARS virus, please refer to Korean Patent KR20120139512, or Cho, S.J., Woo, H.M., Kim, K.S., Oh, J.W., and Jeong, Y.J. (2011) .Novel system for detecting SARS coronavirus nucleocapsid protein using an ssDNA aptamer.J.Biosci.Bioeng.112,535–540. Two proposed DNA aptamers, the first

GCAATGGTACGGTACTTCCGGATGCGGAAACTGGCTAATTGGTGAGGCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTTTGCTAA,

the second

GCAATGGTACGGTACTTCCCCGTAGATCGAGGGAGCGCATTAAGGTATACGCCCTTCCCATCTTCAAAAGTGCACGCTACTTTGCTAA

In order to allow the aptamer to be easily immobilized on the gold surface of the working electrode, the 5' end was modified with a thiol on the 6-position carbon linker,

5'-HS–(CH ₂ ) ₆ -GCAATGGTACGGTACTTCCGGATGCGGAAACTGGCTAATTGGTGAGGCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTTTGCTAA-(CH ₂ ) ₂ -3'

5'-HS–(CH ₂ ) ₆ -GCAATGGTACGGTACTTCCCCGTAGATCGAGGGAGCGCATTAAGGTATACGCCCTTCCCATCTTCAAAAGTGCACGCTACTTTGCTAA-(CH ₂ ) ₂ -3'

The fabrication of the sensing chip and the EIS measurement can refer to Example 1.

Example 5 - Detection of Norovirus

Norovirus, or Calicivirus, is the most common cause of viral gastroenteritis, also known as winter vomiting sickness. The annual outbreak keeps hundreds of staff and tens of thousands of patients out of work for days and shuts down entire wards in hospitals in developed countries around the world.

Norovirus (Norovirus), capsid protein (Capsid protein) is shown below

5'-HS–(CH ₂ ) ₆ -GTCTGTAGTAGGGAGGATGGTCCGGGGCCCCGAGACGACGTTATCAGGC-3'

This example uses PB-PEDOT-AuNPs nanocomposite to modify the working electrode. The synthesis procedure of PB-PEDOT-AuNPs nanocomposite is as follows. PB-PEDOT nanocomposite is synthesized by oxidative polymerization of EDOT in the presence of Fe3+ ions . The PB-PEDOT nanocomposite has a core-shell structure, which can significantly improve the stability and conductivity of PB. Briefly, 50 μL of EDOT was first dissolved in 5 mL of ethanolic solution and then transferred to 25 mL of 0.1 M HCl to form a stable solution. Meanwhile, 13.2 mg of K ₃ [Fe(CN)6] and 10.8 mg of FeCl ₃ ·6H ₂ O were added to 10 mL of 0.1 M HCl solution, followed by sonication for 30 min. The two solutions obtained were mixed together with vigorous stirring. As the reaction progressed, the color of the mixture gradually changed to dark blue, indicating the formation of PB-PEDOT nanocomposites. After centrifugation and washing, the mixture was dried in an oven. Finally, 10 mL of AuNPs solution was added to 2 mL of PB-PEDOT suspension (1 mg/mL) and stirred overnight to form PB-PEDOT-AuNPs nanocomposites.

During the fabrication of the composite aptamer sensing chip, 10 μ LPB-PEDOT-AuNPs nanocomposites were coated on the corresponding working electrodes. Place the modified device in a 50°C oven for half an hour. Then another 10 μL of Norovirus (Norovirus), capsid protein aptamer was introduced on the PB-PEDOT-AuNPs modified electrode, followed by 1 mL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4) to remove unbound aptamer. The concentration of norovirus capsid protein aptamer was optimized to 47 μg/mL. Since the aptamers have been modified with sulfhydryl groups at the 5' end, this facilitates their binding to AuNPs via Au-S bonds. Next, block any non-specific binding sites with 10 μL of 1 mM MCH solution. After 1 hour incubation at room temperature, the modified aptamer sensor chips were washed 3 times with 1 mL of TE buffer. The prepared aptamer sensing chip can be loaded into the bioaerosol detection device of the present invention when used, and connected to the reading circuit module, using DPV to measure the concentration of SARS-CoV-2 virus in the PB solution, and inversely calculate The concentration of SARS-CoV-2 virus in the air.

For aircraft or any confined space, how to ensure that the ventilation system can quickly take away viruses or germs, it is indeed necessary to have a virus catcher for sensing feedback. However, whether there is nucleocapsid protein or the virus itself in the air needs to be detected. At least it can be determined that the nucleocapsid protein is not infectious. But it can help determine whether the air is infected by a virus. By extension, in fact, all infectious pathogens, in addition to detecting the number of pathogens themselves, proteins in various parts of the pathogen may be produced in the host's body in the blood, nasal cavity, throat, lungs, etc.

An embodiment of the present invention also provides a method for detecting biological aerosols, using the above-mentioned biological aerosol detecting device, including the following steps:

Step 6: Detecting, using the detection molecules on the sensing chip to capture and combine, and the resulting signal changes to detect the concentration of the target biological aerosol.

In the description of the present invention, it should be understood that the terms "center", "longitudinal", "lateral", "length", "width", "thickness", "upper", "lower", "front", " Rear", "left", "right", "vertical", "horizontal", "top", "bottom", "inside", "outside", "clockwise", "counterclockwise", etc. The relationship is based on the orientation or positional relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore It should not be construed as a limitation of the present invention.

In addition, the terms "first" and "second" are only used for descriptive purposes, and should not be construed as indicating or implying relative importance or implying the number of indicated technical features. Thus, a feature defined as "first" or "second" may expressly or implicitly include one or more of that feature. In the description of the present invention, "plurality" means two or more, unless otherwise expressly and specifically defined.

In the present invention, unless otherwise expressly specified and limited, the terms "installed", "connected", "connected", "fixed" and other terms should be understood in a broad sense, for example, it may be a fixed connection or a detachable connection , or integrated; it can be a mechanical connection or an electrical connection; it can be a direct connection or an indirect connection through an intermediate medium, and it can be the internal connection of the two elements or the interaction relationship between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific situations.

In the present invention, unless otherwise expressly specified and limited, a first feature "on" or "under" a second feature may include the first and second features in direct contact, or may include the first and second features Not directly but through additional features between them. Also, the first feature being "above", "over" and "above" the second feature includes the first feature being directly above and obliquely above the second feature, or simply means that the first feature is level higher than the second feature. The first feature is "below", "below" and "below" the second feature includes the first feature being directly below and diagonally below the second feature, or simply means that the first feature has a lower level than the second feature.

In the description of this specification, description with reference to the terms "one embodiment," "some embodiments," "example," "specific example," or "some examples", etc., mean specific features described in connection with the embodiment or example , structure, material or feature is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms should not be construed as necessarily referring to the same embodiment or example. Furthermore, the particular features, structures, materials or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, those skilled in the art may combine and combine the different embodiments or examples described in this specification.

Although the embodiments of the present invention have been shown and described above, it should be understood that the above-mentioned embodiments are exemplary and should not be construed as limiting the present invention. Embodiments are subject to variations, modifications, substitutions and variations.

Claims

A biological aerosol detection device, characterized in that, comprising:

Collection module, the collection module includes a suction fan, an arc-shaped tapered air passage, a first pump, an oil-water container, and a second pump; the oil-water container is provided with an oil layer and a biological buffer; the air inlet of the suction fan is provided with a filter unit , to preliminarily filter the inhaled air, and generate impact force through the arc-shaped tapered airway to collect the bio-aerosol in the air above the oil layer of the oil-water container, so that the bio-aerosol is adsorbed on the surface of the oil layer, and then periodically passes through the first The pump hits the pressure air on the surface of the oil layer to turn the oil layer. During the inversion process, the bioaerosol to be tested is turned under the oil layer and enters the biological buffer;

a detection module, the detection module includes a sensing chip unit, a signal processing unit, and a microcontroller unit, and each unit is electrically connected; at least one detection molecule is fixed on the sensing chip unit to detect a specific biological aerosol entering the biological buffer;

Power supply, the power supply the power required by the collection module and the detection module;

The bioaerosol to be tested entering the biological buffer solution is designed with a circulating flow channel and driven by the second pump, so that the biological buffer solution and the bioaerosol to be tested under the oil layer will circulate through the sensing chip unit. The bioaerosol to be tested is effectively contacted with the detection molecules to achieve capture and detection.
The bioaerosol detection device according to claim 1, wherein the bioaerosol comprises at least one of viruses, germs, fungi, and pollen.
The biological aerosol detection device according to claim 1, wherein the detection module comprises a wireless communication module or a display unit.
The bioaerosol detection device according to claim 1, wherein the biological buffer contains redox ions, and the redox ions are selected from the group consisting of red blood salt, yellow blood salt, ruthenium hexaammine, and enzymes.
The bioaerosol detection device according to claim 1, wherein the detection molecules are selected from aptamers, antibodies or sugar molecules.
The bioaerosol detection device according to claim 1, characterized in that: nanomaterials used for aptamers or antibodies for capturing the target are added on the sensing chip, and the nanomaterials are selected from nanomagnetic beads, nanogold, and carbon tubes. , graphene, ZnO, and these nanomaterials are further combined with thionine or Prussian blue.
The bioaerosol detection device according to claim 1, wherein the detection method of the sensing chip unit is an optical method, selected from the group consisting of surface plasmon method, colorimetric method, chemiluminescence method, fluorescence method, surface enhanced pull Mann scattering and interferometry.
The bioaerosol detection device of claim 1, wherein the detection method of the sensing chip unit is an electrical method, and when the binding between the target and the antibody or aptamer causes or changes an electrical signal, the detection can be Measure the concentration of the target.
The bioaerosol detection device of claim 8, wherein the electrical signal processing unit is mainly selected from square wave voltammetry, differential pulse wave voltammetry, chronoamperometry, intermittent pulse amperometry, rapid Scanning cyclic voltammetry, electrochemical impedance spectroscopy, field effect enzymatic detection, or a combination thereof.
A method for bioaerosol detection, using the bioaerosol detection device according to any one of claims 1-9, characterized in that, comprising the following steps:

Step 1, filter, remove the non-target biological aerosol from the air to be tested;

Step 2, air extraction, and the ambient air is sucked into the device by an air intake fan;

Step 3, capturing and collecting, impacting the bioaerosol into the oil film/biological buffer in the device, so that the bioaerosol adheres to the oil film, or passes through the oil film and directly enters the biological buffer;

Step 4: The biological aerosol is converted into a hydrosol, and the tapered airway of the detection device is used to generate an impact force, or the first pump blows the aerosol captured above the oil film and flips the oil film into the biological buffer to become a hydrosol;

Step 5: Concentrating mass transfer, using the design of the circulating flow channel, all the hydrosols in the biological buffer flow to the sensing chip and the detection molecules on the chip are captured and combined;

Step 6: Detecting, using the detection molecules on the sensing chip to capture and combine, and the resulting signal changes to detect the concentration of the target biological aerosol.