WO2022221421A2 - Aav compositions with high brain expression for treating mucopolysaccharidosis ii - Google Patents

Abstract

Virus compositions are disclosed for treating mucopolysaccharidosis II.

Description

AAV COMPOSITIONS WITH HIGH BRAIN EXPRESSION FOR TREATING MUCOPOLYSACCHARIDOSIS II FIELD OF THE INVENTION [0001] The invention generally relates to virus compositions for treating mucopolysaccharidosis II. BACKGROUND [0002] Mucopolysaccharidosis type II (Hunter Syndrome) is a lysosomal storage disease caused by a deficiency in the lysosomal enzyme iduronate-2-sulfatase (I2S). That deficiency allows glycosaminoglycans to build up in tissues causing a variety of symptoms of varying severity. Depending on the severity, resultant health issues can range from behavioral disturbances, joint stiffness, progressive declines in cardiac and pulmonary function from thickening of the heart and airways, physical abnormalities, to death at an early age. Mucopolysaccharidosis type II is caused by a mutation to the iduronate-2-sulfatase (IDS) gene on the X chromosome. [0003] Recombinant adeno-associated viruses (rAAVs) are widely used as vectors for gene delivery in therapeutic applications because of their ability to transduce both dividing and non- dividing cells, their long-term persistence as episomal DNA in infected cells, and their low immunogenicity. These characteristics make them appealing for applications in therapeutic applications, such as gene therapy. The use of adeno-associated viral (AAV) vectors to express I2S has been proposed for treatment of mucopolysaccharidosis type II but the technology is imperfect. See Fu, et al., 2018, Targeting Root Cause by Systemic scAAV9-hIDS Gene Delivery: Functional Correction and Reversal of Severe MPS II in Mice, Mol Ther Methods Clin Dev., 10: 327–340, the content of which is incorporated herein by reference. In particular, systemic delivery of existing AAV serotypes (e.g., intravenous, intrathecal, intraarterial, intracranial, intraventricular, intracerebroventricular, or subcutaneous) show limited transduction of certain cell types and organs, and non-specific, overlapping tropisms in others. This leads to several complications in gene therapy applications, including but not limited to off-target effects due to transduction of unimpacted organs and cell types (for example, the liver) , and the necessity for a larger viral dosage to achieve sufficient therapeutic levels in the tissue or organ of interest. SUMMARY [0004] Compositions and methods of the invention use recombinant adeno-associated viruses (rAAV) to deliver a viral vector comprising a human iduronate-2-sulfatase (IDS) gene encoding a functional iduronate-2-sulfatase enzyme (I2S). By allowing cells to produce functional I2S, compositions and methods of the invention can be used to treat mucopolysaccharidosis type II. In various embodiments, modified rAAVs are used to improve gene delivery and expression and target the central nervous system (CNS) for gene delivery. In certain embodiments, modified rAAVs of the invention may exhibit increased transduction in the CNS, allowing for systemic delivery thereof with reduced risk of off-target effects. Such modified rAAVs may exhibit specificity engineered into the capsid structure through iterative rounds of selection in non- human primates (NHPs), yielding variants with tropisms having an increased transduction in the CNS, and in some cases, a decreased transduction enrichment in an off-target environment. The rAAVs described herein achieve widespread transduction to the CNS (e.g., CNS cell types or tissues) in a subject upon systemic delivery (e.g., intravenous, intrathecal, intraarterial, intracranial, intraventricular, intracerebroventricular, or subcutaneous). [0005] In various embodiments rAAVs may include one or more promoters, regulatory elements, polyadenylations signals, and/or microRNA signals to improve gene expression in the target cells. [0006] Aspects of the invention may include a recombinant adeno-associated virus (rAAV) comprising a capsid containing an AAV vector comprising a promoter, a human iduronate-2- sulfatase (IDS) sequence comprising SEQ ID NO: 118, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and a polyadenylation signal. The promoter may be a CAG synthetic promoter, a CBh synthetic promoter, or a human synapsin I promoter. [0007] In certain embodiments, the promoter may be a CAG synthetic promoter comprising SEQ ID NO: 119. In some embodiments, the promoter may be a CBh synthetic promoter comprising SEQ ID NO: 120. In certain embodiments, the promoter can be a human synapsin I promoter comprising SEQ ID NO: 121. The WPRE may comprise SEQ ID NO: 122. In various embodiments, the polyadenylation signal may be selected from the group consisting of a human growth hormone polyadenylation signal (hGH PolyA) and a simian virus 40 polyadenylation signal (SV40 PolyA). In some embodiments, the polyadenylation signal can be hGH PolyA comprising SEQ ID NO: 123 or SV40 PolyA comprising SEQ ID NO: 124. [0008] In some embodiments, the rAAV may comprise an AAV capsid protein comprising an amino acid sequence that is at least 98% identical to amino acid 217 to amino acid 736 of SEQ ID NO: 1. In certain embodiments, the rAAV may comprise AAV9. [0009] In some embodiments, the AAV capsid protein may comprise a peptide insertion comprising an amino-acid sequence as provided in Table 1, Figures 2-4 and and/or Formula I. In certain embodiments, the insertion may be at the residues corresponding to amino acids 588-589 of the AAV9 native sequence of SEQ ID NO: 1. [0010] In certain embodiments, modified capsid proteins for delivery of expression vectors as described herein may comprise engineered specificity in their capsid structure developed through iterative rounds of selection in non-human primates (NHPs) to yield variants with tropisms having an increased transduction enrichment in the CNS. [0011] The rAAV may include a capsid comprising an insertion at amino acid positions 588-589 of SEQ ID NO: 1. The rAAV may also include a capsid comprising a substitution at amino acid positions 587-590 of SEQ ID NO: 1 together with an insertion at amino acid positions 588-589 of SEQ ID NO: 1. In preferred embodiments, the capsid may comprise a substitution/insertion at amino acid positions 587-590 comprising AQLNTTKPTDR (SEQ ID NO: 3), AQLNTTKPTGP (SEQ ID NO: 6), AQLNTTKPSPG (SEQ ID NO: 5), AQLNTTKSVMQ (SEQ ID NO: 2), AQLNTTKNVTQ (SEQ ID NO: 18), AQLALPKPIAQ (SEQ ID NO: 116) or AQLNTTKPTTS (SEQ ID NO: 117). [0012] In various embodiments, the capsid may comprise both a substitution at amino acid positions 452-458 as well as a substitution/insertion at amino acid positions 587-590 such as AQLNTTKPTDR (SEQ ID NO: 3), AQLNTTKPTGP (SEQ ID NO: 6), AQLNTTKPSPG (SEQ ID NO: 5), AQLNTTKSVMQ (SEQ ID NO: 2), AQLNTTKNVTQ (SEQ ID NO: 18), AQLALPKPIAQ (SEQ ID NO: 116) or AQLNTTKPTTS (SEQ ID NO: 117). [0013] In various embodiments, the AAV vector may comprise a microRNA signal. The microRNA signal may be miRNA-183 comprising SEQ ID NO: 129. [0014] Aspects of the invention may include methods for treating mucopolysaccharidosis type II in a subject. Such methods may include administering to said subject a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) comprising a capsid containing an AAV vector that may comprise a promoter; a human iduronate-2-sulfatase (IDS) sequence comprising SEQ ID NO: 118; a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); and a polyadenylation signal. [0015] The therapeutically effective amount of the rAAV may be administered systemically (e.g., intracranial, intraventricular, intracerebroventricular, intravenous, intraarterial, intranasal, intrathecal, intracisternae magna administration, or subcutaneously). In preferred embodiments the rAAV is administered intrathecally or intracisternally. BRIEF DESCRIPTION OF THE DRAWINGS [0016] FIG.1 shows an exemplary AAV vector for expression of I2S according to certain embodiments. [0017] FIG.2 shows AAV capsid protein insertion and substitution amino acid sequences encoding the amino acid sequences which were found in the non-human primate CNS after two rounds of evaluation of engineered AAV libraries. [0018] FIG.3 shows AAV capsid protein insertion and substitution amino acid sequences and DNA sequences encoding the amino acid sequences which were found in one non-human primate CNS. [0019] FIG.4 shows AAV capsid protein insertion and substitution amino acid sequences and DNA sequences encoding the amino acid sequences which were found in another non-human primate CNS. [0020] FIG.5 shows dose-dependent and broad AAV variant biodistribution measured in the brain and peripheral tissues 28 days after intravenous injection of 7.5E12, 2.5E13, or 7.5E13 vg/kg of a variant or saline control in 8-to-11-month-old cynomolgus macaques. [0021] FIG.6 shows dose-dependent AAV variant biodistribution measured in the brain and liver 28 days after intracerebroventribular (i.c.v.) injection of 3E7, 3E8, 3E9, 3E10, or 3E11 vg of a variant in 10-11-week-old MPS II mice. [0022] FIG.7 shows dose-dependent correction of I2S enzyme activity measured in the brain and liver after i.c.v. injection of 3E7, 3E8, 3E9, 3E10, or 3E11 vg of a variant in 10-to-11- week-old MPS II mice, with 7-week-old untreated MPS II (KO) and wild-type (WT) mice as comparison. [0023] FIG.8 shows dose-dependent reductions in GAG accumulation measured in the brain and liver after i.c.v. injection of 3E7, 3E8, 3E9, 3E10, or 3E11 vg of a variant in 10-to-11- week-old MPS II mice, with 7-week-old untreated MPS II (KO) and wild-type (WT) mice as comparison. DETAILED DESCRIPTION [0024] Compositions and methods of the invention provide rAAVs for the delivery of vectors encoding human I2S useful in the treatment of mucopolysaccharidosis type II (Hunter syndrome). Genes encoding I2S along with optional combinations of promoters, regulatory elements, polyadenylation signals, and miRNA may be included in modified rAAVs having higher enrichment for transduction in specific cell-types (e.g., cells of the central nervous system such as brain endothelial cells, neurons, and astrocytes). Accordingly, functional I2S can be preferentially expressed in the cells affected by mucopolysaccharidosis type II to alleviate symptoms thereof with diminished off-target effects. [0025] As noted, vectors of the invention may include a human IDS gene expressing human I2S. In certain embodiments, vectors comprise an IDS gene comprising the following nucleotide sequence (SEQ ID NO: 118):

[0026] The gene may express I2S comprising the following peptide sequence (SEQ ID NO: 130):

[0027] The IDS gene may be in cis with two inverted terminal repeats (ITRs) flanking the IDS gene. Due to the limited packaging capacity of the rAAV (~5kB), in some cases, the IDS gene may be split between two AAV vectors, the first with 3’ splice donor and the second with a 5’ splice acceptor. Upon co-infection of a cell, concatemers form, which are spliced together to express a full-length IDS gene. [0028] In some instances, the vector may comprise a promoter and/or enhancer, for example a constitutive promoter or an inducible or tissue/cell specific promoter. As a non-limiting example, the promoter may be CMV promoter, a CMV-β-Actin-intron-β-Globin hybrid promoter (CAG), CBA promoter, FRDA or FXN promoter, UBC promoter, GUSB promoter, NSE promoter, Synapsin promoter, MeCP2 promoter, GFAP promoter, H1 promoter, U6 promoter, NFL promoter, NFH promoter, SCN8A promoter, or PGK promoter. As a non-limiting example, promoters can be tissue-specific expression elements include, but are not limited to, human elongation factor 1α-subunit (EF1α), immediate-early cytomegalovirus (CMV), chicken β-actin (CBA) and its derivative CAG, the β glucuronidase (GUSB), and ubiquitin C (UBC). The vector may include a tissue-specific expression elements for neurons such as, but not limited to, neuron- specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B- chain (PDGF-β) the synapsin (Syn) the methyl-CpG binding protein 2 (MeCP2) Ca2+/calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), NFL, NFH, np32, PPE, Enk and EAAT2 promoters. The vector may comprise a tissue-specific expression element for astrocytes such as, but not limited to, the glial fibrillary acidic protein (GFAP) and EAAT2 promoters. The vector may comprise tissue-specific expression elements for oligodendrocytes such as, but not limited to, the myelin basic protein (MBP) promoter. [0029] In some embodiments, the promoter is less than 1 kb. The promoter may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800. The promoter may have a length between 200-300, 200- 400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400- 500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800. The promoter may provide expression of the therapeutic gene expression product for a period of time in targeted tissues such as, but not limited to, the central nervous system and peripheral organs (e.g., lung). Expression of the therapeutic gene expression product may be for a period of 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years, or more than 65 years. Expression of the payload may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years or 5-10 years or 10-15 years, or 15-20 years, or 20-25 years, or 25-30 years, or 30-35 years, or 35-40 years, or 40-45 years, or 45-50 years, or 50-55 years, or 55-60 years, or 60-65 years. [0030] Promoters are DNA regions that initiate gene transcription by controlling the binding of RNA polymerase to the vector DNA to begin the process toward expression of the encoded protein. Promoters control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately translated into a functional protein. Thus the promoter region controls when and where in the organism your gene of interest is expressed. Exemplary promoters include CMV, CBh, human synapsin I, EF1a, SV40, PGK1, Ubc, human beta actin, and CAG. In preferred embodiments, the vector comprises a promoter selected from a CAG synthetic promoter, a CBh synthetic promoter, and a human synapsin I promoter. See Miyazaki, J; Takaki, S; Araki, K; Tashiro, F; Tominaga, A; Takatsu, K; Yamamura, K (Jul 15, 1989). "Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5". Gene.79 (2): 269–77; Grey et al., Optimizing Promoters for Recombinant Adeno-Associated Virus-Mediated Gene Expression in the Peripheral and Central Nervous System Using Self-Complementary Vectors, Hum Gene Ther.2011 Sep; 22(9): 1143– 1153; Glover et al., Adenoviral-mediated, High-Level, Cell-Specific Transgene Expression: A SYN1-WPRE Cassette Mediates Increased Transgene Expression With No Loss of Neuron Specificity, Mol Ther.2002 May; 5(5 Pt 1):509-16; the content of each of which is incorporated herein by reference. [0031] In certain embodiments the CAG synthetic promoter may comprise the following nucleotide sequence (SEQ ID NO: 119):

[0033] In certain embodiments, the CBh synthetic promoter may comprise the following nucleotide sequence (SEQ ID NO: 120): cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttcc

[0034] In certain embodiments, the human synapsin I promoter may comprise the following nucleotide sequence (SEQ ID NO: 121): CTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGG

[0035] Expression vectors may comprise optional microRNA-encoding sequence. MicroRNA or miRNA refers to small non-coding RNA molecules (about 22 nucleotides in length) that function in post-transcriptional regulation of gene expression. miRNAs function via base-pairing with complementary sequences within mRNA molecules to effectively disrupt expression of those mRNA molecules. In various embodiments, expression vectors may encode miRNA- 183. Expression vectors may, for example, comprise the following sequence encoding miRNA-183 (SEQ ID NO: 129):

[0036] Various regulatory elements may be included in vectors of the invention including posttranscriptional regulatory elements (PREs) such as those derived from hepatitis B virus (HPRE), woodchuck hepatitis virus (WPRE), human heat shock protein 70 mRNA (Hsp70), the vascular endothelial growth factor (SP163), the tripartite leader sequence of human adenovirus mRNA linked with a major late promoter enhancer (TM), or the first intron of human cytomegalovirus immediate early gene (Intron A). See, Mariati, et ah, 2010, Evaluating posttranscriptional regulatory elements for enhancing transient gene expression levels in CHO K1 and HEK293 cells, Protein Expression and Purification, 69(1):9-15, incorporated herein by reference. Posttranscriptional regulatory elements can help enhance gene expression when included in expression vectors such as those described herein. Particular PREs may exhibit cell- specific and/or gene-specific regulatory enhancement and those factors are considered when selecting a PRE. In preferred embodiments, vectors of the invention may comprise a WPRE which may comprise (SEQ ID NO: 122):

[0037] In various embodiments, vectors of the invention may include a polyadenylation signals or terminator to define the end of the transcriptional unit. The selected terminator or poly(A) signal can impact gene expression. Exemplary poly(A) signals that may be included in expression vectors described herein may be derived from SV40, hGH, BGH, and rbGlob. In preferred embodiments, vectors may include a poly(A) signal selected from Human Growth Hormone Gene Polyadenylation Signal (hGH polyA) and Simian Virus 40 Polyadenylation Signal (SV40 polyA). [0038] In certain embodiments, the hGH PolyA may comprise the following nucleotide sequence (SEQ ID NO: 123):

[0039] The SV40 polyA may comprise the following nucleotide sequence (SEQ ID NO: 124):

[0040] An exemplary expression vector 101 of the invention is shown in FIG.1. Such expression vectors 101 may be delivered in an rAAV construct as described below. In preferred embodiments, a vector may comprise a promoter 103 followed by cDNA 105 encoding the protein to be expressed (e.g., IDS encoding I2S). The cDNA 105 may be followed by an optional miRNA signal 107 such as miRNA-183. A posttranscriptional regulatory element 109 such as WPRE can then be included followed by a poly(A) 111 or other terminator such as SV40 or hGH poly(A). The order of the components in FIG.1 is preferred although, in certain embodiments, the miRNA signal 107 may be omitted such that the PRE 109 follows the cDNA 105. The individual components may follow directly in order or may be linked together by additional sequences. [0041] In certain embodiments, vectors of the invention may be included in rAAVs or modified rAAVs as described in PCT/2019/052969, WO/2020/028751, or U.S. Pat. Pub. Nos. 2020/0165576, 2019/0292230, or 2017/0166926, the content of each of which is incorporated herein by reference. Vectors may be delivered using various modified adeno-associated (AAV) virus capsid compositions useful for integrating a transgene into a target cell or environment (e.g., a cell-type or tissue) in a subject when they are administered systemically (e.g., intracranial, intraventricular, intracerebroventricular, intravenous, intraarterial, intranasal, intrathecal, intracisternae magna administration, or subcutaneously) to the subject. The modified AAV capsid proteins of the present disclosure may comprise at least one insertion or substitution of an amino acid in a corresponding parental AAV capsid protein that confers a desired tropism such as an increased transgene transduction. [0042] In one aspect the disclosure provides rAAVs with high expression levels in the CNS. [0043] In one aspect, the disclosure provides rAAVs with a peptide insertion comprising or consisting of an amino-acid sequence set forth in any one of Table 1, Figures 2-4 and and/or Formula I, as defined below in greater detail. [0044] Some aspects disclosed herein provide AAV capsids comprising an AAV capsid protein comprising an insertion sequence of Formula I X¹-X²-X³-N-T-T-X⁴-X⁵-X⁶-X⁷-X⁸ (I) (SEQ ID NO: 111) wherein X¹ is an amino acid selected from A, E, Q, T and V; X² is an amino acid selected from Q, I, M, A, P, and V; X³ is an amino acid selected from L, S, Q, M and T; X⁴ is an amino acid selected from K and R; X⁵ is an amino acid selected from P, I, N, A, Q, H, I, V, S and L; X⁶ is an amino acid selected from T, I, V, A, Q, S, L, M, G, H and R; X⁷ is an amino acid selected from A, D, N, S, T, M, P, Q, E, G, V, I and W; and X⁸ is an amino acid selected from Q, G, F, A, S, D, E, M, P, R, T and Y. [0045] In some embodiments, the AAV capsid protein comprises an amino acid sequence of formula I wherein X¹ is A and X² is Q. [0046] In some embodiments, the AAV capsid protein comprises an amino acid sequence of formula I wherein X³ is L. [0047] In some embodiments, the AAV capsid protein comprises an amino acid sequence of formula I wherein X³ is N. [0048] In some embodiments, the AAV capsid protein comprises an amino acid sequence of formula I wherein X⁴ is K. [0049] In some embodiments, the AAV capsid protein comprises an amino acid sequence of formula I wherein X⁵ is P or S. [0050] In some embodiments, the AAV capsid protein comprises an amino acid sequence of formula I wherein X⁶ is V or T. [0051] In some embodiments, the insertion sequence as described in Table 1, is selected from AQLNTTKSVMQ (SEQ ID NO: 2), AQLNTTKPTDR (SEQ ID NO: 3), AQLNTTKPTVG (SEQ ID NO 4) AQLNTTKPSPG (SEQ ID NO 5) AQLNTTKPTGP

listed in Table 1. TABLE 1. Sequence SEQ ID Sequence SEQ ID NO NO

[0053] In some aspects, the insertion amino acid sequence is at least 71.4% identical to the amino acid sequence provided in Table 1, Figures 2-4 and and/or Formula I. In some aspects, the insertion amino acid sequence is at least 86.7% identical to the amino acid sequence provided in Table 1, Figures 2-4 and and/or Formula I. [0054] Recombinant adeno-associated virus (rAAV) mediated gene delivery leverages the AAV mechanism of viral transduction for nuclear expression of an episomal heterologous nucleic acid (e.g., a transgene, therapeutic nucleic acid). Upon delivery to a host in vivo environment, a rAAV will (1) bind or attach to cellular surface receptors on the target cell, (2) endocytose, (3) traffic to the nucleus, (4) uncoat the virus to release the encapsidated heterologous nucleic acid , (5) convert of the heterologous nucleic acid from single-stranded to double-stranded DNA as a template for transcription in the nucleus, and (6) transcribe of the episomal heterologous nucleic acid in the nucleus of the host cell (“transduction”). rAAVs engineered to have an increased transduction enrichment (transcription of the episomal heterologous nucleic acid in the host cell) are desirable for gene therapy applications. [0055] An rAAV comprises an AAV capsid that can be engineered to encapsidate a heterologous nucleic acid (e.g., therapeutic nucleic acid, gene editing machinery). The AAV capsid is made up of three AAV capsid protein monomers, VP1, VP2, and VP3. Sixty copies of these three VP proteins interact in a 1:1:10 ratio to form the viral capsid. VP1 covers the whole of VP2 protein in addition to a ~137 amino acid N-terminal region (VP1u), VP2 covers the whole of VP3 in addition to ~65 amino acid N-terminal region (VP1/2 common region). The three capsid proteins share a conserved amino acid sequence of VP3, which in some cases is the region beginning at amino acid position 138 (e.g., AA139-736). [0056] While not wishing to be bound by theory, it is understood that a parent AAV capsid sequence comprises a VP1 region. In certain embodiments, a parent AAV capsid sequence comprises a VP1, VP2 and/or VP3 region, or any combination thereof. A parent VP1 sequence may be considered synonymous with a parent AAV capsid sequence. [0057] The AAV VP3 structure contains highly conserved regions that are common to all serotypes, a core eight-stranded β-barrel motif (βB-βI) and a small α-helix (αA). The loop regions inserted between the β-strands consist of the distinctive HI loop between β-strands H and I, the DE loop between β-strands D and E, and nine variable regions (VRs), which form the top of the loops. These VRs, such as the AA588 loop, are found on the capsid surface and can be associated with specific functional roles in the AAV life cycle including receptor binding, transduction and antigenic specificity. [0058] Disclosed herein are AAV capsids comprising AAV capsid proteins with a substitution/insertion at the 588 loop that confer a desired tropism characterized by a higher enrichment for transduction in specific cell-types, including for e.g., CNS, brain cell types (e.g., brain endothelial cells, neurons, astrocytes). In particular, the AAV capsid proteins disclosed herein enable rAAV-mediated transduction of a heterologous nucleic acid (e.g., transgene) in the CNS of a subject. The AAV capsids of the present disclosure, or the AAV capsid proteins, may be formulated as a pharmaceutical composition. In addition, the AAV capsids or the AAV capsid proteins can be isolated and purified to be used for a variety of applications. [0059] Disclosed herein are recombinant AAV (rAAV) capsids which comprise AAV capsid proteins that are engineered with a modified capsid protein (e.g., VP1, VP2, VP3). In some embodiments, the rAAV capsid proteins of the present disclosure are generated using the methods disclosed herein. In some embodiments, the AAV capsid proteins are used in the methods of delivering a therapeutic nucleic acid (e.g., a transgene) to a subject. In some instances, the rAAV capsid proteins have desired AAV tropisms rendering them particularly suitable for certain therapeutic applications, e.g., the treatment of a disease or disorder in a subject such as those disclosed herein. [0060] The rAAV capsid proteins are engineered for optimized expression in the CNS, for example the brain, of a subject upon systemic administration of the rAAV to the subject, such as those insertions provided in Table 1, Figures 2-4 and and/or Formula I. The rAAV capsid proteins provided in Table 1, Figures 2-4 and and/or Formula I are engineered to have tropisms that eliminate the need for intracranial injection, while also achieving widespread and efficient transduction of an encapsidated transgene. In particular, the tropisms comprise at least one of an increased enrichment (e.g., of viral transduction) in the CNS of a subject, as compared to a reference AAV. [0061] The engineered AAV capsid proteins described herein have, in some cases, an insertion of an amino acid that is heterologous to the parental AAV capsid protein at the amino acid position in the 588 loop. In some embodiments, the amino acid is not endogenous to the parental AAV capsid protein at the amino acid position of the insertion. The amino acid may be a naturally occurring amino acid in the same or equivalent amino acid position as the insertion of the substitution in a different AAV capsid protein. [0062] Also disclosed herein are rAAVs with engineered capsid proteins that are optimized for targeting specific organ or tissue within a subject. In a non-limiting example, the rAAVs of the present embodiment, have increased transduction in the CNS. [0063] Generally, the insertion comprises a five-, six-, or seven-amino acid sequence (5-mer, 6- mer, or 7-mer, respectively) that is inserted or substituted at the 588 loop in a parental AAV capsid protein. Aspects provided herein provide amino acid insertions comprising seven amino acid polymer (7-mer) inserted at AA588-589, and may additionally include a substitution of one or two amino acids at amino acid positions flanking the 7-mer sequence (e.g., AA587-588 and/or AA589-590) to produce an eleven amino acid polymer (11-mer) at the 588 loop of a parental AAV capsid protein. The 7-mers described herein were advantageously generated using polymerase chain reaction (PCR) with degenerate primers, where each of the seven amino acids is encoded by a deoxyribose nucleic acid (DNA) sequence N-N-K. “N” is any of the four DNA nucleotides and K is guanine (G) or thymine (T). This method of generating random 7-mer amino acid sequences enables 1.28 billion possible combinations at the protein level. [0064] Peptide insertion sequences of the disclosure include sequences that have been modified in any way and for any reason, for example, to: (1) reduce susceptibility to proteolysis, (2) alter binding affinities, and (3) confer or modify other physicochemical or functional properties. For example, single or multiple amino acid substitutions (e.g., equivalent, conservative or non- conservative substitutions, deletions or additions) may be made in a sequence. [0065] As used herein, “reference sequence” is a defined sequence used as a basis for sequence comparison. The reference sequence can be a nucleic acid sequence. A reference sequence may be a subset or the entirety of a specified sequence. For example, a reference sequence may be a segment of a full-length cDNA or of a genomic DNA sequence, or the complete cDNA or complete genomic DNA sequence, or a domain of a polypeptide sequence. [0066] As used herein, “comparison window” refers to a contiguous and specified segment of a nucleic acid or an amino acid sequence, wherein the nucleic acid/amino acid sequence can be compared to a reference sequence and wherein the portion of the nucleic acid/amino acid sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The comparison window can vary for nucleic acid and polypeptide sequences. Generally, for nucleic acids, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100 or more nucleotides. For amino acid sequences, the comparison window is at least about 10 amino acids, and can optionally be 15, 20, 30, 40, 50, 100 or more amino acids. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the nucleic acid or amino acid sequence, a gap penalty is typically introduced and is subtracted from the number of matches. [0067] “Percent Identity” is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see: Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. [0068] The terms “substantial identity” and “substantially identical” indicate that a polypeptide or nucleic acid comprises a sequence with between 55-100% sequence identity to a reference sequence, with at least 55% sequence identity, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99% sequence identity or any percentage of value within the range of 55-100% sequence identity relative to the reference sequence. The percent sequence identity may occur over a specified comparison window. Optimal alignment may be ascertained or conducted using the homology alignment algorithm of Needleman and Wunsch, supra. [0069] For example, the insertion sequences may include, but are not limited to, sequences that are not exactly the same as the sequences disclosed herein, but which have, in addition to the substitutions explicitly described for various sequences listed herein, additional substitutions of amino acid residues which substantially do not impair the activity or properties of the sequences described herein, such as those predicted by homology software e.g. BLOSUM62 matrices. [0070] Recombinant AAVs (rAAVs) were generated, each with a unique 7-mer at the 588 loop and each encapsidating a reporter gene that, when administered systemically in NHPs, enabled the selective amplification and recovery of sequences that effectively transduced the reporter gene in a target in vivo environment of the transgenic animal.7-mers that were found to be positively enriched in the target in vivo environment (e.g., central nervous system, liver) are provided herein. A subset of the rAAVs with desired expression profiles were tested individually in vivo to determine exact systemic expression (e.g., transduction enrichment). rAAVs from this subset exhibiting a desired tropism comprising increased viral transduction, and in some cases transduction enrichment, are considered to be uniquely suited for targeted rAAV-mediated transgene delivery useful for a wide variety of purposes (e.g., therapeutic, diagnostic, scientific discovery). [0071] The rAAV particles with the insertion sequences described herein have an increased transduction enrichment in the CNS. In some instances, the increased transduction enrichment comprises a 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold increase, or more. In some instances, the increased transduction enrichment is at least 1-fold. In some instances, the increased transduction enrichment is at least 2-fold. In some instances, the increased transduction enrichment is at least 4-fold. [0072] The rAAV particles with the insertion sequences described herein have an increased expression enrichment or specificity in a target in vivo environment (e.g., tissue or cell type). The increased specificity is correlated with increased viral genomes or an increased expression in the target in vivo environment, which in some cases is represented with expression values provided herein in FIGs.2-4. [0073] The reference AAV may have a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or variants thereof. [0074] The rAAV capsid proteins of the present disclosure comprise an insertion of an amino acid in an amino acid sequence of an AAV capsid protein. The AAV capsid, from which an engineered AAV capsid protein of the present disclosure is produced, is referred to as a “parental” AAV capsid. In some cases, the parental AAV has a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. The complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively; the AAV-9 genome is provided in Gao et al., J. Virol., 78: 6381- 6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004); portions of the AAV-12 genome are provided in Genbank Accession No. DQ813647; portions of the AAV-13 genome are provided in Genbank Accession No. EU285562. [0075] In some cases, the parental AAV is derived from an AAV with a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. The AAV capsid protein that is “derived” from another may be a variant AAV capsid protein. A variant may include, for example, a heterologous amino acid in an amino acid sequence of the AAV capsid protein. The heterologous amino acid may be non-naturally occurring in the AAV capsid protein. The heterologous amino acid may be naturally occurring in a different AAV capsid protein. In some instances, the parental AAV capsid is described in US Pat Publication 2020/0165576 and U.S. Pat. App. Ser. No. 62/832,826 and PCT/US20/20778; the content of each of which is incorporated herein.

[0076] In some instances, the parental AAV is AAV9. In some instances, the amino acid sequence of the AAV9 capsid protein comprises SEQ ID NO: 1. The amino acid sequence of AAV9 VPl capsid protein (>tr|Q6JC40|Q6JC40_9VIRU Capsid protein VPl OS=Adeno- associated virus 9 OX=235455 GN=cap PE=1 SV=1) is provided in SEQ ID NO: 1

Q Q Q Q

In some instances, the parental AAV capsid protein sequence is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to SEQ ID NO: 1.

[0077] AAV capsid proteins from native AAV serotypes, such as AAV9, with tropisms including the liver activate the innate immune response, which is come cases causes a severe inflammatory response in a subject, which can lead to multi -organ failure. By improving transduction enrichment of a native AAV serotype for a target in vivo tissue (e.g., brain) and decreasing the specificity of the AAV capsid protein to the liver, the rAAV particles of the present disclosure reduce the immunogenic properties of AAV-mediated transgene delivery and prevent activation of the innate immune response. [0078] In some instances, the parental AAV is AAV9. In some instances, the amino acid sequence of the AAV9 capsid protein comprises SEQ ID NO: 1. In some instances, the parental AAV capsid protein sequence is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to SEQ ID NO: 1, or part of SEQ ID NO: 1. In some instances, the parental AAV capsid protein comprises the entire VPl region provided in SEQ ID NO: 1 (e.g., amino acids 1-736). In some instances, the parental AAV capsid protein comprises amino acids 217-736 in SEQ ID NO: 1, which is the common region found in VPl, VP2 and VP3 AAV9 capsid proteins. In some instances, the AAV capsid protein comprises amino acids 64- 736 in SEQ ID NO: 1, which is the common region found in VPl and VP2. The parental AAV capsid protein sequence may comprise amino acids selected from 1-736, 10-736, 20-736, 30-736, 40-736, 50-736, 60-736, 70-736, 80-736, 90-736, 100-736, 110-736, 120-736, 130-736, 140-736, 150-736, 160-736, 170-736, 180-736, 190-736, 200-736, 210-736, 220-736, 230-736, 240-736, 250-736, 260-736, 270-736, 280-736, 290-736, 300-736, 310-736, 320-736, 330-736, 340-736, 350-736, 360-736, 370-736, 380-736, 390-736, 400-736, 410-736, 420-736, 430-736, 440-736, and 450-736, from SEQ ID NO: 1. [0079] The rAAV capsid proteins described herein may be isolated and purified. The AAV may be isolated and purified by methods standard in the art such as by column chromatography, iodixanol gradients or cesium chloride gradients. Methods for purifying AAV from helper virus are known in the art and may include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); U.S. Patent No.6,566,118 and WO 98/09657. [0080] The rAAV capsid protein can be conjugated to a nanoparticle, a second molecule, or a viral capsid protein. In some cases, the nanoparticle or viral capsid protein would encapsidate the therapeutic nucleic acid described herein. In some instances, the second molecule is a therapeutic agent, e.g., a small molecule, antibody, antigen-binding fragment, peptide, or protein, such as those described herein. [0081] Disclosed herein are AAV capsid proteins with an insertion of at least one amino acid at an amino acid position described above in a parental AAV capsid protein that confers an increased enrichment for the CNS in a subject, even when delivered systemically. One of the many advantages of the AAV capsid proteins described herein is their ability to target tissue and cells within the CNS. The tissue can be the brain or the spinal cord. [0082] Non-limiting examples of CNS cells include a neuron and a glial cell. Glial cells can be selected from an oligodendrocyte, an ependymal cell, an astrocyte and a microglia. [0083] The in vivo environment can be a tissue. The tissue can be the brain, or the spinal cord. The tissue can be a region of an organ, for example, the cerebrum, the cerebellum, the brainstem, the cortex, the striatum, the thalamus, the lateral ventricles, the putamen, the hypothalamus, the medulla, the pons, the hippocampus, the amygdala, the motor cortex, or a combination thereof. [0084] Disclosed herein are AAV capsid proteins with at least one amino acid insertion in a parental AAV capsid protein. The insertion can be of at least five, six, or seven amino acids, or more. In some instances, the amino acids are contiguous. In some instances, the amino acids are not contiguous. [0085] In some instances, the insertion is of at least five amino acids provided in any one of the sequences provided in any one of Table 1, Figures 2-4 and and/or Formula I. In some instances, the insertion is of at least six amino acids provided in any one of Table 1, Figures 2-4 and and/or Formula I. In some instances, the insertion is of at least seven amino acids provided in any one of Table 1, Figures 2-4 and and/or Formula I. In some instances, a substitution/insertion is of at least nine amino acids provided in any one of the sequences provided in any one of Table 1, Figures 2-4 and and/or Formula I. [0086] In some instances, the AAV capsid protein comprises an insertion of at least or about five, six, or seven amino acids of an amino acid sequence of Table 1, Figures 2-4 and and/or Formula I at an amino acid position 588-589 in a parental AAV9 capsid protein (SEQ ID NO: 1). In some cases, the AAV capsid protein has an increased enrichment for viral transduction in brain cortex [0087] The rAAV capsid proteins of the present disclosure may also have a substitution of an amino acid sequence at amino acid position 452- 458 in a parental AAV9 capsid protein, or variant thereof, as described in WO2020068990. In some embodiments, the substitution of the amino acid sequence comprises KDNTPGR (SEQ ID NO: 125) at amino acid position 452- 458 in the parental AAV9 capsid protein. In some embodiments, the substitution of the amino acid sequence comprises DGAATKN (SEQ ID NO: 126) at amino acid position 452- 458 in the parental AAV9 capsid protein [0088] The AAV capsids and AAV capsid proteins disclosed herein, in some embodiments, are isolated. In some instances, the AAV capsids and AAV capsid proteins disclosed herein are isolated and purified. In addition, the AAV capsids and AAV capsid proteins disclosed herein, either isolated and purified, or not, may be formulated into a pharmaceutical formulation, which in some cases, further comprises a pharmaceutically acceptable carrier. [0089] Disclosed herein are insertions of an amino acid sequence in an AAV capsid protein. Where the sequence numbering designation “588-589” is noted for AAV9, for example AAV VP1, the invention also includes insertions in similar locations in the other AAV serotypes. As used herein, “AA588-589” indicates that the insertion of the amino acid (or amino acid sequence) is immediately after an amino acid (AA) at position 588 and immediately before an AA at position 589 within an amino acid sequence of a parental AAV VP capsid protein (VP1 numbering). Amino acids 587-591 include a motif comprising “AQAQA” as set forth in SEQ ID NO: 1. Exemplary AAV capsid protein sequences are provided in Table 2. For example, AQLNTTKPTDR (SEQ ID NO: 3) is inserted at AA588-589 in an AAV9 capsid amino acid sequence, and provides variant A (SEQ ID NO: 66). It is envisioned that the sequences disclosed herein (Table 1, Figures 2-4 and and/or Formula I) may be inserted at AA588-589 in an amino acid sequence of a parental AAV9 capsid protein or at AA587-590 (replacing amino acids AA587-590), a variant thereof, or equivalent amino acid position of a parental AAV of a different serotype (e.g., AAV1, AAV2, AAV3, and the like). In any AAV capsid protein sequence disclosed herein, the amino acid at position 449 may be R or K.

[0090] An AAV vector can comprise a viral genome comprising a nucleic acid encoding the recombinant AAV (rAAV) capsid protein described herein. The viral genome can comprise a Replication (Rep) gene encoding a Rep protein, and Capsid (Cap) gene encoding an AAP protein in the first open reading frame (ORF1) or a Cap protein in the second open reading frame (ORF2). The Rep protein is selected from Rep78, Rep68, Rep52, and Rep40. In some instances, the Cap gene is modified encoding a modified AAV capsid protein described herein. A wild-type Cap gene encodes three proteins, VP1, VP2, and VP3. In some cases, VP1 is modified. In some cases, VP2 is modified. In some cases, VP3 is modified. In some cases, all three VP1-VP3 are modified. The AAV vector can comprise nucleic acids encoding wild-type Rep78, Rep68, Rep52, Rep40 and AAP proteins. [0091] In some instances, the AAV9 VP1 gene provided in SEQ ID NO: 71, is modified to include any one of SEQ ID NOS: 72-110 as found in Table 3. The AAV vector described herein may be used to produce a variant AAV capsid by the methods described herein. The nucleic acid sequence of the AAV9 VP1 (AAV9 >AY530579.1 Adeno-associated virus 9 isolate hu.14 capsid protein VP1 (cap) gene, complete cds) gene is provided below (SEQ ID NO: 71):

DNA Sequence SEQ AA Sequence SEQ ID ID

[0092] In some instances, the 5' ITR and the 3' ITR are derived from an AAV2 serotype. In some instances, the 5' ITR and the 3' ITR are derived from an AAV5 serotype. In some instances, the 5' ITR and the 3' ITR are derived from an AAV9 serotype. [0093] In various embodiments, methods of the invention may include administering to a patient suspected of having mucopolysaccharidosis type II a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) such as those discussed above and containing an expression vector encoding IDS. In some embodiments, delivery of the vector comprises administering to the subject the composition using any one of the routes of administration described herein. [0094] In some embodiments, methods of increasing transduction of an encoded gene in a target in vivo environment comprise delivering a rAAV particle described herein, the rAAV engineered to have an increased transduction enrichment in a target in vivo environment (e.g., tissue or cell type). In some instances, the increased transduction enrichment comprises a 1-fold, 2-fold, 3- fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50- fold or 100-fold increase, or more, relative to a reference AAV. In some instances, the increased transduction enrichment is at least 2-fold. In some instances, the increased transduction enrichment is at least 10-fold. In some instances, the increased transduction enrichment is at least 20-fold. [0095] Methods of delivering a heterologous nucleic acid to a target in vivo environment are also provided comprising delivering the rAAV particle described herein that has been engineered to have an increased expression or specificity in an in vivo environment (e.g., tissue or cell type), as compared to a reference AAV. Methods, in some cases, comprise detecting whether a rAAV possesses more specificity for an in vivo environment, includes measuring a level of gene expression product (e.g., IDS) expressed from the vector encapsidated by the rAAV in a tissue sample obtained from the in vivo environment in a subject. [0096] In some instances, the reference AAV has a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or variants thereof. [0097] Provided herein are methods of delivering a heterologous nucleic acid to a target in vivo environment comprising delivering a composition to the target in vivo environment selected from a CNS in a subject, the composition comprising a rAAV particle with a rAAV capsid protein, the rAAV capsid protein encapsidating a viral vector encoding a heterologous nucleic acid (e.g., therapeutic nucleic acid). In some embodiments, the rAAV particle encapsidating the heterologous nucleic acid comprises a rAAV capsid protein engineered with an increased transduction enrichment when measured in the CNS of the subject, even when administered to the subject systemically. [0098] Methods may comprise delivering a rAAV particle comprising an rAAV capsid protein with increased transduction enrichment when measured in the CNS in the subject. In some embodiments, delivery is systemic. Alternatively, delivery is direct (e.g., into the affected area of the CNS). [0099] The rAAV capsid protein may comprise an insertion of five, six, or seven, amino acids provided in an amino acid sequence provided in any one of Table 1, Figures 2-4 and and/or Formula I, at an amino acid position 588-589 in a parental AAV capsid protein [AAV9 numbering]. The rAAV capsid protein may also comprise an insertion/substitution of nine, ten, or eleven, amino acids provided in an amino acid sequence provided in any one of Table 1, Figures 2-4 and and/or Formula I, at an amino acid position 587-590 in a parental AAV capsid protein. [0100] In some embodiments, a subject is treated with a pharmaceutical composition comprising the rAAV particle and a pharmaceutically acceptable carrier. In some embodiments, the one or more compositions are administered to the subject alone (e.g., stand alone therapy). In some embodiments, the one or more compositions are administered in combination with an additional agent. In some embodiments, the composition is a first-line therapy for the disease or condition. In some embodiments, the composition is a second-line, third-line, or fourth-line therapy, for the disease or condition. [0101] Provided here, are methods of treating a disease or a condition associated with an aberrant expression or activity of a target gene (e.g., IDS) or gene expression product thereof (e.g., I2S), the method comprising modulating the expression or the activity of a target gene or gene expression product in a subject by administering a rAAV encapsidating a heterologous nucleic acid of the present disclosure. In some instances, administration is systemic administration. In some instances, the expression or the activity of the target gene or gene expression product is decreased, relative to that in a normal (non-diseased) individual; and administering the rAAV to the subject is sufficient to increase the expression of the activity of the target gene or gene expression product. [0102] Provided herein are methods of treating mucopolysaccharidosis type II, or a symptom of mucopolysaccharidosis type II, in a subject, comprising: (a) diagnosing a subject with mucopolysaccharidosis type II affecting a target in vivo environment; and (b) treating mucopolysaccharidosis type II by administering to the subject a therapeutically effective amount of a composition disclosed herein (e.g., rAAV particle, AAV vector, pharmaceutical composition), wherein the composition is engineered with an increased enrichment or specificity for the target in vivo environment. [0103] In general, methods disclosed herein comprise administering a therapeutic rAAV composition by systemic administration. In some instances, methods comprise administering a therapeutic rAAV composition by intraperitoneal injection. In some instances, methods comprise administering a therapeutic rAAV composition by intravenous (“i.v.”) administration. It is conceivable that one may also administer therapeutic rAAV compositions disclosed herein by other routes, such as subcutaneous injection, intramuscular injection, intradermal injection, transdermal injection percutaneous administration, intranasal administration, intralymphatic injection, rectal administration intragastric administration, intraocular administration, intracerebroventricular administration, intrathecally, or any other suitable parenteral administration. Routes, dosage, time points, and duration of administrating therapeutics may be adjusted. In some embodiments, administration of therapeutics is prior to, or after, onset of either, or both, acute and chronic symptoms of the disease or condition. [0104] The term “CNS” or “central nervous system” means a tissue selected from brain, thalamus, cortex, putamen, lateral ventricles, medulla, the pons, the amygdala, the motor cortex, caudate, hypothalamus, striatum, ventral midbrain, neocortex, basal ganglia, hippocampus, cerebrum, cerebellum, brain stem, and spinal cord. The brain includes a variety of cortical and subcortical areas, including the frontal, temporal, occipital and parietal lobes. [0105] The term “systemic delivery” is defined as a route of administration of medication or other substance into a circulatory system so that the entire body is affected. Administration can take place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally injection, infusion, or implantation). “Circulatory system” includes both blood or cerebrospinal fluid circulatory systems. Examples of systemic administration for the CNS include intraarterial, intravenous or intrathecal injection. Other examples include administration to the cerebrospinal fluid at any location, in the spine (i.e. but not limited to lumbar) or brain (i.e. but not limited to cisterna magna). The terms “systemic administration” and “systemic delivery” are used interchangeably. [0106] In some embodiments, routes for administration includes administration into the CSF, for example via a intracerebroventricular [ICV], intrathecal cisternal, or intrathecal lumbar route. Particular embodiments result in delivery to neurons and glial cells of the brain. Other routes of delivery to the CNS/brain include, but are not limited to intracranial administration, lateral cerebroventricular administration, intranasal administration, endovascular administration, and intraparenchymal administration. [0107] An effective dose and dosage of pharmaceutical compositions to prevent or treat the disease or condition disclosed herein is defined by an observed beneficial response related to the disease or condition, or symptom of the disease or condition. Beneficial response comprises preventing, alleviating, arresting, or curing the disease or condition, or symptom of the disease or condition. In some embodiments, the beneficial response may be measured by detecting a measurable improvement in the presence, level, or activity, of biomarkers, transcriptomic risk profile, or intestinal microbiome in the subject. An “improvement,” as used herein refers to shift in the presence, level, or activity towards a presence, level, or activity, observed in normal individuals (e.g., individuals who do not suffer from the disease or condition). In instances wherein the therapeutic rAAV composition is not therapeutically effective or is not providing a sufficient alleviation of the disease or condition, or symptom of the disease or condition, then the dosage amount and/or route of administration may be changed, or an additional agent may be administered to the subject, along with the therapeutic rAAV composition. In some embodiments, as a patient is started on a regimen of a therapeutic rAAV composition, the patient is also weaned off (e.g., step-wise decrease in dose) a second treatment regimen. [0108] In some cases, a dose of the pharmaceutical composition may comprise a concentration of infectious particles of at least or about 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴, 10¹⁵, 10¹⁶, or 10¹⁷. In some cases, the concentration of infectious particles is 2x10⁷, 2x10⁸, 2x10⁹, 2x10¹⁰, 2x10¹¹, 2x10¹², 2x10¹³, 2x10¹⁴, 2x10¹⁵, 2x10¹⁶, or 2x10¹⁷. In some cases, the concentration of the infectious particles is 3x10⁷, 3x10⁸, 3x10⁹, 3x10¹⁰, 3x10¹¹, 3x10¹², 3x10¹³, 3x10¹⁴, 3x10¹⁵, 3x10¹⁶, or 3x10¹⁷. In some cases, the concentration of the infectious particles is 4x10⁷, 4x10⁸, 4x10⁹, 4x10¹⁰, 4x10¹¹, 4x10¹², 4x10¹³, 4x10¹⁴, 4x10¹⁵, 4x10¹⁶, or 4x10¹⁷. In some cases, the concentration of the infectious particles is 5x10⁷, 5x10⁸, 5x10⁹, 5x10¹⁰, 5x10¹¹, 5x10¹², 5x10¹³, 5x10¹⁴, 5x10¹⁵, 5x10¹⁶, or 5x10¹⁷. In some cases, the concentration of the infectious particles is 6x10⁷, 6x10⁸, 6x10⁹, 6x10¹⁰, 6x10¹¹, 6x10¹², 6x10¹³, 6x10¹⁴, 6x10¹⁵, 6x10¹⁶, or 6x10¹⁷. In some cases, the concentration of the infectious particles is 7x10⁷, 7x10⁸, 7x10⁹, 7x10¹⁰, 7x10¹¹, 7x10¹², 7x10¹³, 7x10¹⁴, 7x10¹⁵, 7x10¹⁶, or 7x10¹⁷. In some cases, the concentration of the infectious particles is 8x10⁷, 8x10⁸, 8x10⁹, 8x10¹⁰, 8x10¹¹, 8x10¹², 8x10¹³, 8x10¹⁴, 8x10¹⁵, 8x10¹⁶, or 8x10¹⁷. In some cases, the concentration of the infectious particles is 9x10⁷, 9x10⁸, 9x10⁹, 9x10¹⁰, 9x10¹¹, 9x10¹², 9x10¹³, 9x10¹⁴, 9x10¹⁵, 9x10¹⁶, or 9x10¹⁷. [0109] Disclosed herein, in some embodiments are formulations of pharmaceutically-acceptable excipients and carrier solutions suitable for delivery of the rAAV compositions described herein, as well as suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens. In some embodiments, the amount of therapeutic gene expression product in each therapeutically-useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable. In some instances, the rAAV compositions are suitably formulated pharmaceutical compositions disclosed herein, to be delivered either intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, intraperitoneally, by nasal inhalation, or by direct injection to one or more cells, tissues, or organs by direct injection. [0110] In some embodiments, the pharmaceutical forms of the AAV-based viral compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. [0111] In some cases, for administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and the general safety and purity standards as required by FDA Office of Biologics standards. [0112] Disclosed herein are sterile injectable solutions comprising the rAAV compositions disclosed herein, which are prepared by incorporating the rAAV compositions disclosed herein in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof. Injectable solutions may be advantageous for systemic administration, for example by intravenous administration. [0113] Also provided herein are formulations in a neutral or salt form. Pharmaceutically- acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like. [0114] Suitable dose and dosage administrated to a subject is determined by factors including, but not limited to, the particular therapeutic rAAV composition, disease condition and its severity, the identity (e.g., weight, sex, age) of the subject in need of treatment, and can be determined according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, the condition being treated, and the subject or host being treated. [0115] The amount of AAV compositions and time of administration of such compositions will be within the purview of the skilled artisan having benefit of the present teachings. It is likely, however, that the administration of therapeutically-effective amounts of the disclosed compositions may be achieved by a single administration, for example, a single injection of sufficient numbers of infectious particles to provide therapeutic benefit to the patient undergoing such treatment. This is made possible, at least in part, by the fact that certain target cells (e.g., neurons) do not divide, obviating the need for multiple or chronic dosing. [0116] For example, the number of infectious particles administered to a mammal may be on the order of about 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴, or even higher, infectious particles/ml given either as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated. In fact, in certain embodiments, it may be desirable to administer two or more different AAV vector compositions, either alone, or in combination with one or more other therapeutic drugs to achieve the desired effects of a particular therapy regimen. In various embodiments, the daily and unit dosages are altered depending on a number of variables including, but not limited to, the activity of the therapeutic rAAV composition used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner. [0117] The effective dosage ranges may be adjusted based on subject’s response to the treatment. Some routes of administration will require higher concentrations of effective amount of therapeutics than other routes. [0118] In certain embodiments, the daily dosage range and/or the unit dosage amount varies within this range depending upon the dosage form employed and the route of administration utilized. EXAMPLES Example 1 - Method of Identifying the Modified Capsid Proteins in African Green Monkeys [0119] Of primary concern for the therapeutic applicability of engineered adeno-associated viruses (AAVs) is how well their transduction profiles translate to human application. While previous engineering efforts have focused on in vitro or in vivo rodent screening platforms due to the ease and flexibility of their use, screening efforts directly in non- human primates (NHPs) are much more likely to identify viruses that translate. African Green Monkeys, an old world NHP were selected for the engineering efforts that supported development of the present invention. Engineering efforts were primarily directed on a region of the AAV9 capsid surface located at amino acid position 588, one of the most exposed loops on the capsid surface that is a variable region between natural AAV serotypes and has a role in receptor binding. Insertion of peptides between positions 588 and 589 has been studied in the past by the present inventors, and others, and has resulted in novel receptor binding (AAV-PHP.B/AAV-PHP.eB binding of Ly6a on rodent brain endothelium to facilitate blood-brain barrier crossing and high transduction of the brain) and drastically altered capsid tropism. A library of viral capsids was created by performing a random 7 amino acid insertion at this site within AAV9 in hopes of achieving a novel tropism toward the NHP CNS. [0120] Plasmids. The first-round viral DNA library was generated by amplification of a section of the AAV9 capsid genome between amino acids 450-599 using NNK degenerate primers (Integrated DNA Technologies, Inc., IDT) to insert seven random amino acids between amino acids 588 and 589 with all possible variations. The resulting library inserts were then introduced into the rAAV-ΔCap-in-rev-RNA plasmid via Gibson assembly as previously described. The resulting capsid DNA library, rAAV-Cap-Cag-GFP11, contained a diversity of ~1.28 billion variants at the amino acid level. The second round viral DNA library was generated similarly to the first round, but instead of NNK degenerate primers inserted at the 588, a synthesized oligo pool (Twist Biosicence) was used to generate only selected variants in a UBC-Cap-DNA and CAG-Cap-DNA construct with CAP. This second-round DNA library contained a diversity from 3000-15000 variants at the amino acid level with 2-6 barcoded replicates for each variant. [0121] The AAV2/9 REP-AAP-ΔCAP plasmid transfected into HEK293T cells to provide the Rep gene for library viral production prevents production of a wild-type AAV9 capsid during viral library production after a plausible recombination event between this plasmid co- transfected with the library plasmids at each stage containing the library inserts. [0122] Viral production. Recombinant AAVs were generated according to established protocols. Briefly, for libraries, immortalized HEK293T cells (ATCC) were quadruple transfected with four vectors using polyethylenimine (PEI). The first vector was the rAAV-Cap- in-cis-Lox library flanked by inverted terminal repeat (ITR) sequences from a parental AAV virus. The second vector was the AAV2/9 REP-AAP-ΔCAP plasmid. The third vector contains nucleic acids encoding helper virus proteins needed for viral assembly and packaging of the heterologous nucleic acid into the modified capsid structure. The fourth is a pUC-18 plasmid included to achieve the right PEI/DNA ratio for optimal transfection enrichment. Only 10 ng of rAAV-Cap-in-cis-Lox library DNA was transfected (per 150 mm plate) to decrease the likelihood of multiple library DNAs entering the same cell. Viral particles are harvested from the cells and media after 60 h post transfection. Virus present in the media is concentrated by precipitation with 8% polyethylene glycol and 500mM sodium chloride and the precipitated virus is added to the lysates prepared from the collected cells. The viruses are purified over iodixanol (Optiprep, Sigma) step gradients (15%, 25%, 40%, and 60%). Viruses are concentrated and formulated in PBS. Virus titers are determined by measuring the number of DNaseI-resistant vector genome copies (VGs) using ddPCR. [0123] Animals. African Green Monkey procedures were approved by the IACUC committee of Virscio, Inc. All African Green Monkeys were screened for neutralizing antibodies and confirmed to have < 1:5 titer. At approximately 7-8 months of age, African Green monkeys were dosed intravenously. Dose formulations were allowed to equilibrate to approximately room temperature for at least 10 minutes, but no more than 60 minutes prior to dosing. Animals were sedated with ketamine (8 mg/kg) and xylazine (1.6 mg/kg). The injection area was shaved and prepped with chlorohexdrine and 70% isopropyl alcohol, surgically scrubbed prior to insertion of the intravenous catheter. Dosing occurred with a single intravenous infusion on Day 0 via saphenous vein administered using a hand-held infusion device at a target rate of 1 mL/minute. General wellbeing was confirmed twice daily by cage side observation beginning one week prior to dosing. At the scheduled sacrifice time, monkeys were sedated with ketamine (8-10 mg/kg IM) and euthanized with sodium pentobarbital (100 mg/kg IV to effect). Upon loss of corneal reflex, a transcardial perfusion (left ventricle) was performed with chilled phosphate buffered saline (PBS) using a peristaltic pump set at a rate of approximately 100 mL/in until the escaping fluid ran clear prior to tissue collection. [0124] DNA/RNA recovery and sequencing for libraries. Round 1 and round 2 viral libraries were injected into African Green Monkeys at a dose of 5x10^{12 -} 1x10¹³ vg/kg animal and rAAV genomes were recovered three weeks post injection. Animals were euthanized and brain (both round 1 and round 2), spinal cord (round 1 and round 2) and liver (round 1 and round 2) were recovered, snap frozen, and placed into long-term storage at -80^oC as well as other peripheral tissues such as heart, spleen, adrenal, kidney, and quad. For round 1, the brain was separated into eleven brain regions, 20mg each, and for round 2, eleven brain regions.20-300mg of each brain section, spinal cord, and liver was homogenized in buffer using the MagMAX DNA ULTRA (A25597) and a Bead Ruptor 96 (OMNI, INC) and viral DNA was isolated according to the manufacturers recommended protocol. Recovered viral DNA was treated with RNase, and purified with a Zymo DNA Clean and Concentrator kit (D4033). Viral genomes were enriched by 25 cycles of PCR amplification with primers flanking the 588-589 insertion site in the capsid genome using 50% of the total extracted viral DNA as a template. After Zymo DNA purification, samples were diluted 1:10 to 1:1000 depending on tissue type and each dilution further amplified around the library variable region with 10 cycles of PCR. Subsequently, samples were further amplified using custom primers with Illumina Indices for 10 more cycles. The amplification products were run on a 2% low-melting point agarose gel (ThermoFisher Scientific, 16520050) for better separation and recovery of the 210 bp band. [0125] For the second round library only, packaged viral library DNA was isolated from the injected viral library by digestion of the viral capsid and purification of the contained ssDNA. These viral genomes were amplified by two PCR amplification steps, like the viral DNA extracted from tissue, to add adapters and indices for Illumina next-generation sequencing, and purified after gel electrophoresis. This viral library DNA, along with the viral DNA extracted from tissue, was sent for deep sequencing using an Illumina NextSeq 2000 system. [0126] NGS data alignment and processing. Raw fastq files from NGS runs were processed with custom-built scripts (Capsida CapSeq Tools). For the first round library, the pipeline to process these datasets involved filtering to remove low-quality reads, utilizing a quality score for each sequence, and eliminating bias from PCR-induced mutations or high GC-content. The filtered dataset was then aligned by a perfect string match algorithm and trimmed to improve the alignment quality. Read counts for each sequence were pulled out and displayed by tissue, at which point all sequences found in the brain were compiled for formation of the second round library. [0127] For the second round library read counts by tissue were similarly tabulated. Then, a read count of 1 was added to each sequence to remove 0 values, all brain regions for each sequence were summed together, and the read sequences for each codon replicate of a given 7-mer amino acid sequence were summed together to give a single value for each peptide insertion. Finally, the data was log10 counts per million (Cpm) normalized. Enrichment values were calculated with normalized cpm of brain vs cpm of virus and converted to log10. Example 2 - Virus compositions for the treatment of mucopolysaccharidosis type II [0128] Selected viral genomes comprising a nucleic acid encoding I2S are designed and packaged into one or more of the rAAVs described above. [0129] The viral genome from ITR to ITR, recited 5’ to 3’, comprises an ITR, a promoter; a human iduronate-2-sulfatase (IDS) sequence; an optional microRNA sequence; a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); a polyadenylation signal, and an ITR. The viral genomes are packaged into one of the capsids described above, purified and formulated in phosphate buffered saline (PBS) with 0.001 % F-68. Example 3 - Characterization of AAV variant biodistribution in cynomolgus macaques [0130] Cynomolgus macaque procedures were approved by the IACUC committee of Envol Biomedical. Cynomolgus macaque were born and raised in Envol Biomedical colonies and housed in family groups under standard conditions. They were fed ad libitum and received enrichment as part of the primate enrichment program for NHPs at Envol Biomedical. For AAV infusions, 8- to 11-month-old animals were screened for endogenous neutralizing antibodies (Nab). None of the animals that were screened showed any detectible blocking reaction at 1:10 dilution of serum. They were then housed for several days and acclimated to a new room before injections. Animals were restrained and doses of the test article (7.5E+12, 2.5E+13, or 7.5E+13 vg/kg of novel variant or saline; n=3 per group) was administered via intravenous infusion for 10 minutes. Activity and behavior were monitored daily over the course of in-life. At the scheduled sacrifice time, monkeys were sedated with ketamine (8-10 mg/kg IM) and euthanized with sodium pentobarbital (100 mg/kg IV to effect). Upon loss of corneal reflex, a transcardial perfusion (left ventricle) was performed with chilled phosphate buffered saline (PBS) using a peristaltic pump set at a rate of approximately 100 mL/in until the escaping fluid ran clear prior to tissue collection. For the listed tissues, tissue was homogenized and DNA isolated similarly to above. The concentration of vector genomes was measured in the brain, spinal cord, dorsal root ganglia, and peripheral tissues. The variant’s vector genome DNA biodistribution was measured in DNA extracted from tissue homogenate using qPCR with primers directed against sequences within the vector genome and host genome and quantified against a standard curve of known sequence copy numbers. Within each treatment group, values were averaged within a brain region, spinal cord level, DRG level, or peripheral tissue. Individual points on the graph indicate biological replicates. See Fig.5. Example 4 - Characterization of AAV variant biodistribution in MPS II mice [0131] The concentration of vector genomes was measured in the brain and liver after intracerebroventricular injection of 3E+7.3E+8, 3E+9, 3E+10, or 3E+11 vg of a variant or saline control in 10-to-11-week-old MPS II model mice, which lack endogenous I2S (n = 4-5 mice per group). Following euthanasia, tissues were harvested and underwent homogenization followed by DNA extraction and purification. The variant’s vector genome DNA biodistribution was measured using qPCR with primers directed against sequences within the vector genome and host genome and quantified against a standard curve of known sequence copy numbers. Within each treatment group, average brain and liver vector genome levels were determined, wherein dose-dependent increased in vector genome copy numbers were observed in both tissues. Bars on the graph represent group mean ± SD. See Fig.6. Example 5 - I2S enzyme activity in MPS II mice [0132] The AAV variant packaging a human IDS cDNA under control of a ubiquitous CAG promoter increased I2S enzyme levels in the brain and liver in a MPS II mouse model lacking endogenous I2S. I2S enzyme activity was measured in the brain and liver after intracerebroventricular injection of 3E+7.3E+8, 3E+9, 3E+10, or 3E+11 vg of a variant or saline control in 10-to-11-week-old MPS II model mice (n = 4-5 mice per group), compared to uninjected 7-week-old WT and MPS II mouse controls (n = 4 per group). I2S enzyme activity was measured from homogenized tissue using a 2-step assay. Brain values were generated by averaging the values from four coronal brain slabs including cortical, subcortical, and cerebellar regions. Liver values were obtained from one liver sample per animal. Bars on the graph represent group mean ± SD. See Fig.7. The left panel displays data from each coronal slab, the middle panel displays these brain data averaged across slabs, and the right panel displays the data from the liver samples. Example 6 - GAG accumulation in MPS II mice [0133] The AAV variant packaging a human IDS cDNA under control of a ubiquitous CAG promoter normalized glycosaminoglycan (GAG) substrate levels in the brain and liver in a MPS II mouse model lacking endogenous I2S that accumulates pathogenic GAGs. GAGs, both heparan and dermatan sulfate, were measured in the brain and liver after i.c.v. injection of 3E+7. 3E+8, 3E+9, 3E+10, or 3E+11 vg of a variant in 10-to-11-week-old MPS II model mice (n = 4-5 per group), compared to uninjected 7-week-old WT and MPS II mouse controls (n = 4 per group). GAGs were measured from homogenized tissue using the Blyscan GAG assay. The left panel displays data from each coronal slab, the middle panel displays these brain data averaged across slabs, and the right panel displays the data from the liver samples. In both brain and liver tissue, GAGs were reduced to or below WT levels. See Fig.8. Incorporation by Reference [0134] References and citations to other documents, such as patents, patent applications, patent publications, journals, books, papers, web contents, have been made throughout this disclosure. All such documents are hereby incorporated herein by reference in their entirety for all purposes. Equivalents [0135] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting on the invention described herein.

Claims

CLAIMS What is claimed is: 1. A recombinant adeno-associated virus (rAAV) comprising a capsid containing an AAV vector comprising: a promoter; a sequence encoding human iduronate 2-sulfatase (hIDS) and comprising SEQ ID NO: 118; a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); a polyadenylation signal; and an insertion/substitution at amino acid position 587-590 comprising a sequence set forth in any one of Table 1, Figures 2-4 and and/or Formula I.

2. The rAAV of claim 1 wherein the promoter is selected from the group consisting a CAG synthetic promoter, a CBh synthetic promoter, and a human synapsin I promoter.

3. The rAAV of claim 2 wherein the promoter is a CAG synthetic promoter comprising SEQ ID NO: 119.

4. The rAAV of claim 2 wherein the promoter is a CBh synthetic promoter comprising SEQ ID NO: 120.

5. The rAAV of claim 2 wherein the promoter is a human synapsin I promoter comprising SEQ ID NO: 121.

6. The rAAV of claim 1 wherein the WPRE comprises SEQ ID NO: 122.

7. The rAAV of claim 1 wherein the polyadenylation signal is selected from the group consisting of a human growth hormone polyadenylation signal (hGH PolyA) and a simian virus 40 polyadenylation signal (SV40 PolyA).

8. The rAAV of claim 7 wherein the polyadenylation signal is hGH PolyA comprising SEQ ID NO: 123.

9. The rAAV of claim 7 wherein the polyadenylation signal is SV40 PolyA comprising SEQ ID NO: 124.

10. The rAAV of claim 1 wherein the capsid comprises an amino acid sequence at least 98% identical to amino acid 217 to amino acid 736 of SEQ ID NO: 1.

11. The rAAV of claim 1 wherein the insertion/substitution comprises AQLNTTKPTDR (SEQ ID NO: 3), AQLNTTKPTGP (SEQ ID NO: 6), AQLNTTKPSPG (SEQ ID NO: 5), AQLNTTKSVMQ (SEQ ID NO: 2), AQLNTTKNVTQ (SEQ ID NO: 18), AQLALPKPIAQ (SEQ ID NO: 116) or AQLNTTKPTTS (SEQ ID NO: 117).

12. The rAAV of claim 11 wherein the capsid further comprises a substitution at amino acid positions 452-458.

13. The rAAV of claim 1 wherein the AAV vector further comprises a microRNA signal.

14. The rAAV of claim 13 wherein the microRNA signal is miR-183 comprising SEQ ID NO: 129.

15. A method for treating mucopolysaccharidosis type II in a subject, the method comprising administering to said subject a therapeutically effective amount of a recombinant adeno- associated virus (rAAV) comprising a capsid containing an AAV vector comprising: a promoter; a sequence encoding human iduronate 2-sulfatase (hIDS) and comprising SEQ ID NO: 118; a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); a polyadenylation signal; and an insertion at amino acid position 588-589 comprising a sequence set forth in any one of Table 1, Figures 2-4 and and/or Formula I.

16. The method of claim 15 wherein the promoter is selected from the group consisting a CAG synthetic promoter, a CBh synthetic promoter, and a human synapsin I promoter.

17. The method of claim 16 wherein the promoter is a CAG synthetic promoter comprising SEQ ID NO: 119.

18. The method of claim 16 wherein the promoter is a CBh synthetic promoter comprising SEQ ID NO: 120.

19. The method of claim 16 wherein the promoter is a human synapsin I promoter comprising SEQ ID NO: 121.

20. The method of claim 15 wherein the WPRE comprises SEQ ID NO: 122.

21. The method of claim 15 wherein the polyadenylation signal is selected from the group consisting of a human growth hormone polyadenylation signal (hGH PolyA) and a simian virus 40 polyadenylation signal (SV40 PolyA).

22. The method of claim 23 wherein the polyadenylation signal is hGH PolyA comprising SEQ ID NO: 123.

23. The method of claim 21 wherein the polyadenylation signal is SV40 PolyA comprising SEQ ID NO: 124.

24. The method of claim 15 wherein the capsid comprises an amino acid sequence at least 98% identical to amino acid 217 to amino acid 736 of SEQ ID NO: 1.

25. The method of claim 15 wherein the insertion comprises AQLNTTKPTDR (SEQ ID NO: 3), AQLNTTKPTGP (SEQ ID NO: 6), AQLNTTKPSPG (SEQ ID NO: 5), AQLNTTKSVMQ (SEQ ID NO: 2), AQLNTTKNVTQ (SEQ ID NO: 18), AQLALPKPIAQ (SEQ ID NO: 116) or AQLNTTKPTTS (SEQ ID NO: 117).

26. The method of claim 25 wherein the capsid further comprises a substitution at amino acid positions 452-458.

27. The method of claim 15 wherein the AAV vector further comprises a microRNA signal.

28. The method of claim 27 wherein the microRNA signal is miR-183 comprising SEQ ID NO: 129.

29. A recombinant adeno-associated virus (rAAV) comprising a capsid comprising any one of AQLNTTKPTDR (SEQ ID NO: 3), AQLNTTKPTGP (SEQ ID NO: 6), AQLNTTKPSPG (SEQ ID NO: 5), AQLNTTKSVMQ (SEQ ID NO: 2), AQLNTTKNVTQ (SEQ ID NO: 18), AQLALPKPIAQ (SEQ ID NO: 116) or AQLNTTKPTTS (SEQ ID NO: 117) and containing an AAV vector comprising a sequence encoding human iduronate 2-sulfatase (hIDS).

30. The rAAV of claim 29 wherein the sequence encoding hIDS comprises SEQ ID NO: 118;

31. The rAAV of claim 29, wherein the AAV vector further comprises one or more of: a promoter; a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); and a polyadenylation signal.

32. The rAAV of claim 31, wherein the AAV vector further comprises a microRNA signal.

33. The rAAV of claim 32, wherein the microRNA signal is miR-183 comprising SEQ ID NO: 129.

34. The rAAV of claim 31 wherein the promoter is selected from the group consisting a CAG synthetic promoter, a CBh synthetic promoter, and a human synapsin I promoter.

35. The rAAV of claim 34 wherein the promoter is a CAG synthetic promoter comprising SEQ ID NO: 119.

36. The rAAV of claim 34 wherein the promoter is a CBh synthetic promoter comprising SEQ ID NO: 120.

37. The rAAV of claim 34 wherein the promoter is a human synapsin I promoter comprising SEQ ID NO: 121.

38. The rAAV of claim 31 wherein the WPRE comprises SEQ ID NO: 122.

39. The rAAV of claim 31 wherein the polyadenylation signal is selected from the group consisting of a human growth hormone polyadenylation signal (hGH PolyA) and a simian virus 40 polyadenylation signal (SV40 PolyA).

40. The rAAV of claim 39 wherein the polyadenylation signal is hGH PolyA comprising SEQ ID NO: 123.

41. The rAAV of claim 39 wherein the polyadenylation signal is SV40 PolyA comprising SEQ ID NO: 124.

42. The recombinant adeno-associated virus (rAAV) of claim 1, wherein the rAAV has higher enrichment for transduction in cells of the central nervous system (CNS) when compared to other cell types.

43. The rAAV of claim 42, wherein the rAAV has higher enrichment for transduction in cells of the brain when compared to cells of the liver.

44. The method of claim 15, wherein administering to said subject the therapeutically effective amount of a recombinant adeno-associated virus (rAAV) causes increased expression of hIDS brain tissue of the subject.

45. The method of claim 44, wherein the expression of hIDS in the brain tissue of the subject is greater than hIDS expression in liver tissue of the subject.

46. The method of claim 15, wherein administering to said subject the therapeutically effective amount of a recombinant adeno-associated virus (rAAV) causes a decrease in pathogenic glycosaminoglycan levels in the subject.

47. The recombinant adeno-associated virus (rAAV) of claim 29, wherein the rAAV has higher enrichment for transduction in cells of the central nervous system (CNS) when compared to other cell types.

48. The rAAV of claim 47, wherein the rAAV has higher enrichment for transduction in cells of the central nervous system (CNS) when compared to other cell types.

49. The rAAV of claim 29, wherein administering the rAAV to a subject a therapeutically effective amount of the rAAV causes increased expression of hIDS brain tissue of the subject.