WO2022220263A1

WO2022220263A1 - Ergothioneine production method

Info

Publication number: WO2022220263A1
Application number: PCT/JP2022/017698
Authority: WO
Inventors: 進也宮城島; 俊亮廣岡
Original assignee: 大学共同利用機関法人情報・システム研究機構
Priority date: 2021-04-13
Filing date: 2022-04-13
Publication date: 2022-10-20
Also published as: JPWO2022220263A1

Abstract

An ergothioneine production method comprising: (a) a step for culturing an alga belonging to Cyanidiophyceae; (b) a step for collecting the alga belonging to Cyanidiophyceae from the culture liquid after the culture; and (c) a step for extracting ergothioneine from the collected alga belonging to Cyanidiophyceae. A polypeptide usable in the aforesaid production method; a polynucleotide encoding the polypeptide; and a vector and a cell containing the polynucleotide.

Description

Ergothioneine manufacturing method

The present invention relates to a method for producing ergothioneine. It also relates to a polypeptide that can be used to produce ergothioneine, a polynucleotide encoding the polypeptide, and a vector and cell containing the polynucleotide.
This application claims priority based on Japanese Patent Application No. 2021-067865 filed in Japan on April 13, 2021, the contents of which are incorporated herein.

Ergothioneine is a type of sulfur-containing amino acid and is known to exhibit high antioxidant activity. The antioxidant activity of ergothioneine is extremely high, and is said to exhibit 7000 times the antioxidant activity of vitamin E. Ergothioneine has been reported to accumulate in epidermal cells, and is said to be involved in suppression of oxidative stress caused by ultraviolet rays. Moreover, ergothioneine is known to accumulate in the central nervous system, and is suggested to be effective against neurodegenerative diseases.

Animals and plants cannot biosynthesize ergothioneine, and some bacteria and basidiomycetes are known to biosynthesize ergothioneine. In particular, Pleurotus cornucopia, which is a kind of basidiomycetes, is known to have a remarkably high content of ergothioneine (Patent Document 1). As a method for producing ergothioneine, a method of extracting from basidiomycetes such as Tamogitake (Patent Document 1), a method of culturing bacteria such as Mycobacterium (Patent Document 2), and the like are known.

On the other hand, microalgae have a high carbon dioxide fixing capacity compared to land plants and do not compete with agricultural products for growing places. It is also used industrially as a cosmetic material and the like. Spirulina, Chinolino, and the like are known to contain ergothioneine, but the content is not as high as in Basidiomycetes (Non-Patent Document 1).

Japanese Patent No. 6799836 Japanese Patent No. 6263672

The conventional method of producing ergothioneine requires time to cultivate Tamogitake mushrooms, etc., and cannot be said to be efficient. Therefore, there is a need for a new method for producing ergothioneine. If microalgae can be used to produce ergothioneine, it may be possible to produce ergothioneine at low cost.

Therefore, an object of the present invention is to provide a method for producing ergothioneine using microalgae. Another object of the present invention is to provide a polypeptide that can be used to produce ergothioneine, a polynucleotide encoding the polypeptide, and a vector and cell containing the polynucleotide.

The present invention includes the following aspects.
[1] A method for producing ergothioneine, which comprises the step (a) of culturing algae belonging to the class Idycogome.
[2] The method for producing ergothioneine according to [1], further comprising the step (b) of recovering the algae belonging to the class Idycogome from the culture solution after the step (a).
[3] The method for producing ergothioneine according to [2], further comprising a step (c) of extracting ergothioneine from the algae belonging to the class Idycogome collected in the step (b).
[4] The method for producing ergothioneine according to any one of [1] to [3], wherein the alga belonging to the class Idycogome in the step (a) is diploid.
[5] The method for producing ergothioneine according to any one of [1] to [4], wherein the algae belonging to the class Idycogome are genetically modified algae.
[6] The method for producing ergothioneine according to [5], wherein the genetic modification is a genetic modification that increases the amount of ergothioneine produced.
[7] The production of ergothioneine according to [5] or [6], further comprising a step (i) of genetically modifying the haploid algae belonging to the class Idycogome before the step (a). Method.
[8] The method for producing ergothioneine according to [7], further comprising a step (ii) of diploidizing the alga belonging to the class Idycogome between the step (i) and the step (a).
[9] A polypeptide selected from the group consisting of the following (a1) to (c1):
(a1) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6;
(b1) a polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO:6, the polypeptide having histidine methyltransferase activity; and (c1) set forth in SEQ ID NO:6 which has a histidine methyltransferase activity.
[10] A polypeptide selected from the group consisting of (a2) to (c2) below:
(a2) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:8;
(b2) a polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 8, the polypeptide having 5-histidylcysteine sulfoxide synthase activity; and (c2) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6, and having 5-histidylcysteine sulfoxide synthase activity.
[11] A polynucleotide encoding the polypeptide of [9].
[12] A polynucleotide encoding the polypeptide of [10].
[13] A vector comprising at least one polynucleotide selected from the group consisting of the polynucleotide of [11] and the polynucleotide of [12].
[14] A cell containing at least one polynucleotide selected from the group consisting of the polynucleotide of [11] and the polynucleotide of [12].
[15] A method for producing ergothioneine, comprising the step of culturing the cells of [14].

According to the present invention, a method for producing ergothioneine using microalgae is provided. Also provided are polypeptides that can be used to produce ergothioneine, polynucleotides encoding the polypeptides, and vectors and cells containing the polynucleotides.

Molecular phylogenetic tree of algae belonging to the class Idycogome based on the chloroplast ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene. Near each branch, the local bootstrap value by the maximum likelihood method (only 50 or more is described, left) and the posterior probability by Bayesian method (only 0.95 or more is described, right) are shown. The synthetic pathway of ergothioneine in Mycobacterium smegmatis and Neurospora crassa is shown (Borodina et al Nutr Res Rev. 2020 Dec; 33(2):190-217). An example of an LC-MS chromatogram obtained by measuring the ergothioneine content in algae belonging to the class Idycogome is shown. Results for autotrophically cultured Galdieria sulphuraria SAG108.79 (diploid) are shown. Cyanidium sp. An outline of the method for producing a transformant of HKN1 (haploid) is shown. The transformant overexpressed the histidine methyltransferase-like gene (HSM gene) and the 5-histidylcysteine sulfoxide synthase-like gene (HSS gene). Cyanidium sp. HKN1 (haploid) wild strain (WT) and Cyanidium sp. The results of PCR amplification of the NS1 region in the transformant (TF) of HKN1 (haploid) are shown. PCR was performed using the NS1_F and NS1_R primer sets. Cyanidium sp. HKN1 (haploid) wild strain (WT) and Cyanidium sp. The growth polarity of HKN1 (haploid) transformant (TF) is shown. Arrows indicate sampling times for ergothioneine measurements.

[definition]
The term "comprise" means that it may include elements other than the subject element. The term "consist of" means containing no elements other than the subject element. The term "consisting essentially of" means that it does not include constituent elements other than the subject constituent elements in a mode that exhibits a special function (such as a mode that completely loses the effect of the invention). means. As used herein, the word "comprise" includes aspects that "consist of" and aspects that "consist essentially of."

Proteins, peptides, polynucleotides (DNA, RNA), vectors, and cells can be isolated. "Isolated" means separated from the natural state or other components. "Isolated" can be substantially free of other components. "Substantially free of other components" means that the content of other components contained in the isolated component is negligible. The content of other components contained in the isolated component is, for example, 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less. It may be 5% by mass or less, or 0.1% by mass or less. The proteins, peptides, polynucleotides (DNA, RNA), vectors and cells described herein may be isolated proteins, isolated peptides, isolated polynucleotides (isolated DNA, isolated RNA), isolated vectors, and isolated cells.

The term "polynucleotide" refers to a nucleotide polymer in which nucleotides are linked by phosphodiester bonds. A "polynucleotide" may be DNA, RNA, or may be composed of a combination of DNA and RNA. A “polynucleotide” may be a polymer of natural nucleotides, including natural nucleotides and non-natural nucleotides (analogs of natural nucleotides, nucleotides in which at least one of the base, sugar and phosphate moieties is modified). (for example, a phosphorothioate skeleton), etc.), or a polymer of non-natural nucleotides.
As used herein, nucleotide sequences of "polynucleotides" are described in their generally accepted single-letter code unless otherwise specified. Unless otherwise indicated, nucleotide sequences are written 5' to 3'.
As used herein, nucleotide residues that constitute a "polynucleotide" may be simply described as adenine, thymine, cytosine, guanine, uracil, or the like, or their one-letter codes.

The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer of amino acids joined by amide bonds. A "polypeptide", "peptide" or "protein" may be a polymer of naturally occurring amino acids or of naturally occurring and non-natural amino acids (such as chemical analogues, modified derivatives of naturally occurring amino acids). It may also be a polymer of unnatural amino acids.
Amino acid sequences are written in the generally accepted one-letter or three-letter code unless otherwise specified. Unless otherwise specified, amino acid sequences are written from the N-terminal side to the C-terminal side.

"Operably linked" means that a first nucleotide sequence is positioned sufficiently close to a second nucleotide sequence such that the first nucleotide sequence is either in the second nucleotide sequence or under the control of the second nucleotide sequence. It means that it can affect the area. For example, that a gene is operably linked to a promoter means that the gene is linked so as to be expressed under the control of the promoter.

"Expressable state" means that the gene is in a state where it can be transcribed and translated in the cell into which the gene has been introduced.

"Expression vector" means a vector containing a target gene and equipped with a system that enables expression of the target gene in cells into which the vector has been introduced.

"The promoter can function" means that the promoter can express a gene operably linked to the promoter in the cells of interest.

"Gene" refers to a polynucleotide containing at least one open reading frame that encodes a specific protein. A gene may contain both exons and introns.

Sequence identity (or homology) between nucleotide or amino acid sequences refers to the matching of two nucleotide or amino acid sequences to the greatest degree of correspondence between the corresponding nucleotides or amino acids, with gaps corresponding to insertions and deletions. It is determined as the percentage of identical nucleotides or amino acids relative to the entire nucleotide or amino acid sequence excluding gaps in the resulting alignment. Sequence identity between nucleotide sequences or amino acid sequences can be determined using various homology search software known in the art. For example, the sequence identity value of a nucleotide sequence can be obtained by calculation based on alignments obtained by the known homology search software BLASTN, and the sequence identity value of an amino acid sequence can be obtained by a known homology search. It can be obtained by calculation based on alignments obtained by software BLASTP.

"Stringent conditions" means conditions under which two polynucleotides with high sequence identity can specifically hybridize. Two polynucleotides with high sequence identity, the sequence identity between the two polynucleotides, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% Above, 98% or more, or 99% or more. Specific examples of stringent conditions include conditions described in Molecular Cloning-A Laboratory Manual Third Edition (Sambrook et al., Cold Spring Harbor Laboratory Press). Stringent conditions include, for example, 6 x SSC (composition of 20 x SSC: 3 M sodium chloride, 0.3 M citric acid solution, pH 7.0), 5 x Denhardt's solution (composition of 100 x Denhardt's solution: 2 mass% bovine serum albumin, 2% ficoll, 2% polyvinylpyrrolidone), 0.5% SDS, 0.1 mg/mL salmon sperm DNA, and 50% formamide at 42-70°C in a hybridization buffer. conditions for several hours to overnight incubation at . Washing buffers used for washing after incubation include, for example, 0.1% by mass SDS-containing 1×SSC solution and 0.1% by mass SDS-containing 0.1×SSC solution.

The term "codon optimization" refers to replacing at least one codon in the original nucleotide sequence with a codon more frequently used in the target species while maintaining the original amino acid sequence. A codon usage table is readily available, for example, in the "Codon Usage Database" (www.kazusa.or.jp/codon/) provided by Kazusa DNA Research Institute. For example, codon usage tables can be used to optimize codons. Computer algorithms are also known for codon-optimizing a particular sequence for expression in a particular animal species. Computer algorithms for codon optimization are available, for example, at Gene Forge (Aptagen; Jacobus, PA).

[Method for producing ergothioneine]
In one embodiment, the present disclosure provides a method of making ergothioneine. The production method of the present embodiment includes the step (a) of culturing algae belonging to the class Idycogome.

<Step (a)>
In step (a), algae belonging to the class Idycogome are cultured.

(Algae belonging to the class Idycogome)
The class Cyanidiphyta is taxonomically classified into the phylum Rhodophyta and the class Cyanidiophyceae. Three genera, Cyanidioschyzon, Cyanidium, and Galdieria, are currently classified in the class Idycogome. In the production method of the present embodiment, any algae belonging to the genus Cyanidioschizon, Cyanidium, and Garderia may be used.

Whether or not an algae belongs to the class Idycogome can be determined, for example, by phylogenetic analysis using the nucleotide sequence of the 18S rRNA gene or the chloroplast rbcL gene. A phylogenetic analysis may be performed by a known method. FIG. 1 is a molecular phylogenetic tree of algae belonging to the class Idycogome based on the chloroplast rbcL gene. In the phylogenetic tree of Fig. 1, algae located in "Galdieria A", "Galdieria B", "Cyanidium (mesophilic)", "Cyanidium", and "Cyanidium G. maxima Galdieria-like Cyanidioschyzon" are algae belonging to the class Idycogome. . Algae used in the production method of the present embodiment may be algae shown in FIG. Alternatively, algae other than the algae shown in FIG. 1 may be algae classified into the class Idycogome by phylogenetic analysis based on the chloroplast rbcL gene.

Algae belonging to the genus Cyanidioschyzon include Cyanidioschyzon merolae.
Algae belonging to the genus Cyanidium include Cyanidium caldarium, Cyanidium sp. is mentioned.
Algae belonging to the genus Galdieria include Galdieria sulphuraria, Galdieria partita, Galdieria daedala, Galdieria maxima and Galdieria phlegrea.

Algae belonging to the class Idyucogome may be isolated from acidic environments such as acidic hot springs, or obtained from culture collections. As culture collections, for example, the National Institute for Environmental Studies Microbial System Preservation Facility (16-2 Onogawa, Tsukuba City, Ibaraki Prefecture, Japan), NITE Biological Resource Center (NRBC; 2-49 Nishihara, Shibuya-ku, Tokyo, Japan) -10), GEORG-AUGUST-UNIVERSITY GOTTINGEN Culture Collection of Algae (SAG), and American Type Culture Collection (ATCC; 10801 University Boulevard Manassas, VA 20110).

Some algae belonging to the class Idycogome have both diploid and haploid cell morphologies. A haploid cell morphology results from meiosis of a diploid cell morphology. The mating of two haploid cells is thought to give rise to a diploid cell.

Whether a cell is a diploid cell or a haploid cell can be determined by confirming the copy number of the same gene locus. If the copy number of the same gene locus is 1, it is determined to be a haploid cell. A next-generation sequencer or the like can also be used to determine whether algae are diploid or haploid. For example, sequence reads of the whole genome are obtained by a next-generation sequencer or the like, and after assembling those sequence reads, the sequence reads are mapped to the sequence obtained by assembling. In diploids, allele-to-allele nucleotide differences are found in various regions on the genome, but in haploids, since only one allele exists, such regions are not found.
Alternatively, cells are stained with a nuclear staining reagent such as DAPI, and compared with cells known to be haploid, cells exhibiting equivalent fluorescence brightness are determined to be haploid, and about twice the fluorescence Cells that exhibit brightness may be determined to be diploid. Alternatively, cells are stained with a nuclear staining reagent such as DAPI, and compared with cells known to be diploid, cells showing equivalent fluorescence brightness are determined to be diploid, about 1/2 times A cell exhibiting a fluorescence intensity of 1 may be determined as a haploid.

In the production method of this embodiment, either haploid cells or diploid cells may be used. Diploid cells tend to have higher ergothioneine content compared to haploid cells. Therefore, it is preferable to use diploid cells from the viewpoint of production efficiency.

Algae belonging to the class Idycogome having both diploid and haploid cell morphologies include, for example, the genera Galderia and Cyanidium.
Specific examples of algae belonging to the genus Galderia include Galdieria sulphuraria (eg, SAG108.79 strain) and Galdieria partita (eg, NBRC 102759 strain).
Specific examples of algae belonging to the genus Cyanidium include, for example, Cyanidium sp. YFU3 strain (FERM BP-22334) (hereinafter referred to as "YFU3 strain") and Cyanidium sp. HKN1 strain. (FERM BP-22333) (hereinafter referred to as "HKN1 strain").

The YFU3 strain is a unicellular red algae isolated from high-temperature acidic water of a hot spring in Yufu City, Oita Prefecture, Japan. The YFU3 strain was deposited on May 30, 2017 with the accession number FERM P-22334 at the National Institute of Technology and Evaluation Patent Organism Depositary Center (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan). was transferred to an international deposit on April 20, 2018 under the accession number FERM BP-22334 (Depositor: Inter-University Research Institute Corporation, Organization for Research and Development of Information and Systems, National Institute of Genetics, Depositor's address: Postal mail 1111 Yata, Mishima City, Shizuoka Prefecture, number 411-8540).
The HKN1 strain is a unicellular red algae isolated from high-temperature acidic water of a hot spring in Hakone-machi, Ashigarashimo-gun, Kanagawa Prefecture, Japan. The HKN1 strain was deposited with the National Institute of Technology and Evaluation Patent Organism Depository on May 30, 2017 under the accession number FERM P-22333, and on April 20, 2018 under the accession number FERM BP-22333. (Depositor: Inter-University Research Institute Corporation, Research and Development Organization of Information and Systems, National Institute of Genetics, Depositor's address: 1111 Yata, Mishima City, Shizuoka Prefecture, 411-8540).

A method of obtaining haploid cells from diploid cells includes a method of culturing diploid cells for a certain period of time. For example, haploid cells can be obtained by culturing diploid cells until they reach the stationary phase and continuing the culture for an arbitrary period of time while in the stationary phase. Examples of the period during which culture is continued in the stationary phase include 2 to 60 days, 3 to 40 days, or 5 to 35 days. The period from the start of culture to stationary phase varies depending on the type of algae and culture conditions. Alternatively, cells may be recovered from the stationary phase culture medium, subcultured, and further cultured for about 1 to 5 days. Haploid cells of algae belonging to the class Idycogome are generally smaller in cell size than diploid cells, and do not have a strong cell wall. Therefore, haploid cells and diploid cells can be distinguished by observation with an optical microscope. Haploid cells can be obtained by collecting and isolating the haploid cells that have emerged in the culture medium using a Pasteur pipette or the like.

Methods for obtaining diploid cells from haploid cells include a method of mixing and culturing two or more types of haploid cells. The two or more types of haploid cells are preferably algae cells of the same type, more preferably haploid cells derived from the same strain. For example, haploid cells derived from the same strain may be divided into two and the separately cultured mixtures may be mixed. By mixing and culturing two types of haploid cells, it is believed that the two cells will fuse to give rise to diploid cells. The culture period is not particularly limited, and the culture may be continued until diploid cells appear. The culture period includes, for example, 1 to 4 weeks. Alternatively, algal cells may be transferred from the stationary phase culture solution and cultured for another 3 to 10 days. Alternatively, by culturing the haploid cells under stress conditions for a long period of time, the haploid cells can self-diploidize to obtain diploid cells. Diploid cells resulting from self-diploidization of haploid cells are believed to have properties similar to diploid cells resulting from the joining of two haploid cells. As described above, diploid cells have a larger cell size and a stronger cell wall than haploid cells. Therefore, haploid cells and diploid cells can be distinguished by observation with an optical microscope. Diploid cells can be obtained by collecting and isolating the diploid cells that have appeared in the culture medium using a Pasteur pipette or the like.

The algae belonging to the class Idycogome are not limited to those isolated from the natural world, and may be those in which mutations have occurred in natural algae belonging to the class Idycogome. Mutations may be naturally occurring or artificially occurring. A method for artificially generating mutation is not particularly limited, and a known method can be used. Methods for artificially generating mutations include, for example, ultraviolet irradiation, radiation irradiation, chemical treatment with nitrous acid, etc.; genetic engineering methods such as gene introduction and genome editing;

Algae belonging to the class Idycogome may be genetically modified algae. Haploid cells are amenable to genetic modification because they have only one set of genomes. Therefore, when algae belonging to the class Idycogome have both a diploid cell morphology and a haploid cell morphology, genetic modification is preferably performed in haploid cells.

The type of genetic modification is not particularly limited, but includes, for example, genetic modification that increases the amount of ergothioneine produced. Genetic modifications that increase the amount of ergothioneine produced include, for example, genetic modifications that increase the expression levels of enzymes involved in the biosynthesis of ergothioneine, and genetic modifications that suppress the expression of enzymes involved in the degradation of ergothioneine.

Figure 2 shows the biosynthetic pathway of ergothioneine reported in Mycobacterium smegmatis, a Gram-positive bacterium, and Neurospora crassa, a type of filamentous fungus (Borodina et al Nutr Res Rev. 2020 Dec;33(2):190 -217). In Mycobacterium smegmatis, the enzymes EgtD, EgtB, EgtC, and EgtE convert histidine to trimethylhistidine (hercynin), γ-glutamylhercinylcysteine sulfoxide, and hercinylcysteine sulfoxide (5-histidylcysteine sulfoxide). , ergothioneine is synthesized. In Neurospora crassa, ergothioneine is synthesized from histidine via trimethylhistidine and hercinylcysteine sulfoxide. In Neurospora crassa, an enzyme (Egt-1) that synthesizes hercynylcysteine sulfoxide from histidine has been reported, but an enzyme that synthesizes ergothioneine from hercynylcysteine sulfoxide has not been reported.

Since algae belonging to the class Idycogome are eukaryotes, they are considered to have an ergothioneine biosynthetic pathway similar to that of Neurospora crassa. Neurospora crassa Egt-1 (eg, NCBI Reference Sequence: XM — 951231.3: SEQ ID NO: 18) has a domain with methyltransferase activity and a domain with 5-histidylcysteine sulfoxide synthase activity. A domain having methyltransferase activity (methyltransferase domain) catalyzes a reaction to synthesize trimethylhistidine by adding a methyl group to histidine using S-adenosylmethionine (SAM) as a methyl group donor. A domain with 5-histidylcysteine sulfoxide synthase activity (5-histidylcysteine sulfoxide synthase domain) adds cysteine to trimethylhistidine in the presence of iron (Fe(II)) and oxygen (O ₂ ). catalyzes the synthesis of hercinylcysteine sulfoxide.

Therefore, the enzymes involved in the biosynthesis of ergothioneine include Egt-1 of Neurospora crassa; the methyltransferase domain of Egt-1; the 5-histidylcysteine sulfoxide synthase domain of Egt-1; 30% or more, 35% or more, or 40% or more) and has methyltransferase activity and 5-histidylcysteine sulfoxide synthase activity; , 30% or more, 35% or more, or 40% or more) and has methyltransferase activity; , 35% or more, or 40% or more) and 5-histidylcysteine sulfoxide synthase activity.
Hereinafter, Egt-1 of Neurospora crassa, the methyltransferase domain of Egt-1, and the 5-histidylcysteine sulfoxide synthase domain of Egt-1 are collectively referred to as "Egt-1 etc.".
Hereinafter, a protein having high homology with Egt-1 of Neurospora crassa and having methyltransferase activity and 5-histidylcysteine sulfoxide synthase activity; having high homology with the methyltransferase domain of Egt-1, and proteins with methyltransferase activity; and proteins with high homology to the 5-histidylcysteine sulfoxide synthase domain of Egt-1 and having 5-histidylcysteine sulfoxide synthase activity are collectively referred to as "Egt-1 It is called "like enzyme".

As a genetic modification that increases the expression level of enzymes involved in the biosynthesis of ergothioneine, a polynucleotide containing a coding sequence (CDS) for Egt-1 or the like or an Egt-1-like enzyme is added to the class Ideucogome in an expressible state. Examples include genetic modification introduced into the algae belonging to it. When algae belonging to the class Idycogome endogenously have an Egt-1-like enzyme, genetic modification that increases the amount of ergothioneine produced includes genetic modification that increases the expression level of the Egt-1-like enzyme. mentioned. Genetic modifications that increase the expression level of the Egt-1-like enzyme include, for example, an Egt-1-like enzyme gene functionally linked to a promoter with high expression activity (e.g., a polyglycol containing the Egt-1-like enzyme CDS). replacement of the promoter of the Egt-1-like enzyme gene with a strong expression promoter; disruption or suppression of the expression suppressor gene of the Egt-1-like enzyme gene; introduction of the expression promoter gene of the Egt-1-like enzyme gene introduction or promotion of expression, and the like.

Egt-1-like enzymes of algae belonging to the class Egt-1 can be identified based on homology with amino acid sequences such as Egt-1. For example, using a homology search program such as BLAST, the amino acid sequence of Egt-1 or the like is used as a query sequence, and a homology search is performed on the amino acid sequences of proteins expressed by algae belonging to the class Idycogome. As a result, proteins having high homology (eg, 30% or more, 35% or more, or 40% or more) with the amino acid sequence of Egt-1 can be identified as Egt-1-like enzymes.

For example, C.I. Egt-1-like enzymes in merolae include a protein having the amino acid sequence set forth in SEQ ID NO:2 (CMM184C) and a protein having the amino acid sequence set forth in SEQ ID NO:4 (CMR147C). The protein of SEQ ID NO:2 is highly homologous to the methyltransferase domain of Egt-1. Therefore, it is considered to have histidine-specific methyltransferase activity. The protein of SEQ ID NO:4 is highly homologous to the 5-histidylcysteine sulfoxide synthase domain of Egt-1. Therefore, it is considered to have 5-histidylcysteine sulfoxide synthase activity. The coding sequence (CDS) for the protein of SEQ ID NO:2 is shown in SEQ ID NO:1. The genomic gene sequence of the protein of SEQ ID NO: 2 is identical to the CDS sequence as it has no introns. The coding sequence (CDS) for the protein of SEQ ID NO:4 is shown in SEQ ID NO:3. The genomic gene sequence of the protein of SEQ ID NO: 4 is identical to the CDS sequence as it has no introns.

For example, Egt-1-like enzymes in the HKN1 strain include a protein having the amino acid sequence set forth in SEQ ID NO:6 and a protein having the amino acid sequence set forth in SEQ ID NO:8. The protein of SEQ ID NO:6 is highly homologous to the methyltransferase domain of Egt-1. Therefore, it is considered to have histidine-specific methyltransferase activity. The protein of SEQ ID NO:8 is highly homologous to the 5-histidylcysteine sulfoxide synthase domain of Egt-1. Therefore, it is considered to have 5-histidylcysteine sulfoxide synthase activity. The coding sequence (CDS) for the protein of SEQ ID NO:6 is shown in SEQ ID NO:5. The genomic gene sequence of the protein of SEQ ID NO: 6 is the same as the CDS as it has no introns. The coding sequence (CDS) for the protein of SEQ ID NO:8 is shown in SEQ ID NO:7. The genomic gene sequence of the protein of SEQ ID NO:8 is the same as the CDS as it has no introns.

For example, G.I. Egt-1-like enzymes in sulphuraria include a protein having the amino acid sequence set forth in SEQ ID NO: 11 (NCBI Reference Sequence: XP_005703833.1) and a protein having the amino acid sequence set forth in SEQ ID NO: 14 (NCBI Reference Sequence: XP_005706200. 1) can be mentioned. The protein of SEQ ID NO: 11 is highly homologous to the methyltransferase domain of Egt-1. Therefore, it is considered to have histidine-specific methyltransferase activity. The protein of SEQ ID NO: 14 is highly homologous to the 5-histidylcysteine sulfoxide synthase domain of Egt-1. Therefore, it is considered to have 5-histidylcysteine sulfoxide synthase activity. The genomic gene sequence and coding sequence (CDS) for the protein of SEQ ID NO:11 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively. The genomic gene sequence and coding sequence (CDS) for the protein of SEQ ID NO:14 are shown in SEQ ID NO:12 and SEQ ID NO:13, respectively.

Hereinafter, a protein highly homologous to the methyltransferase domain of Egt-1 is also referred to as a "histidine methyltransferase-like protein", and a gene encoding a "histidine methyltransferase-like protein" is referred to as a "histidine methyltransferase-like gene". A protein that is highly homologous to the 5-histidylcysteine sulfoxide synthase domain of Egt-1 is called a "histidylcysteine sulfoxide synthase-like protein", and a gene encoding a "histidylcysteine sulfoxide synthase-like protein" is called "histidylcysteine sulfoxide synthase-like protein". It is also called "dylcysteine sulfoxide synthase-like gene".

When genetically modifying algae belonging to the class Idycogome to increase the production of ergothioneine, it is preferable to introduce one or both of a histidine methyltransferase-like gene and a histidylcysteine sulfoxide synthase-like gene. More preferably, both a transferase-like gene and a histidylcysteine sulfoxide synthase-like gene are introduced.

When a gene is introduced into algae belonging to the class Idycogome, the introduced gene is introduced into cells in an expressible state. A transgene is introduced into a cell after being operably linked to, for example, a promoter that can function in the target cell. The promoter may be the promoter of the transgene or the promoter of another gene. When the promoter of another gene is used, the promoter of the gene whose expression level is high in the cell to be introduced is preferable. Examples of such promoters include APCC promoter, CPCC promoter, Catalase promoter, EF1α promoter and the like.
C. The merolae APCC (CMO250C) promoter (eg, -600 to -1; "-1" indicates the nucleotide immediately preceding the initiation codon) is shown in SEQ ID NO:15. C. The merolae CPCC (CMP166C) promoter is shown in SEQ ID NO:16. C. The merolae Catalase (CMI050C) promoter is shown in SEQ ID NO:17. These C.I. The promoter of merolae can also be used in algae belonging to other subclasses.
The HKN1 strain APCC promoter is shown in SEQ ID NO:19. The CPCC promoter of HKN1 strain is shown in SEQ ID NO:21. The EF1α promoter of HKN1 strain is shown in SEQ ID NO:20. These HKN1 strain promoters can also be used in other algae belonging to the class Idycogome.

A transgene may be introduced into a cell, for example, in the form of an expression vector. In addition to transgenes and promoters, expression vectors contain regulatory sequences (enhancers, poly-A addition signals, terminators, 3'UTR, etc.) and/or marker genes (drug resistance genes, fluorescent protein genes, auxotrophic genes, etc.). ). Terminators and 3'UTRs include, for example, terminator and 3'UTR of β-tubulin, terminator and 3'UTR of α-tubulin, and terminator and 3'UTR of ubiquitin. The type of expression vector is not particularly limited, and commonly used expression vectors can be appropriately selected and used. Vectors may be linear or circular, and may be non-viral vectors such as plasmids, viral vectors (eg retroviral vectors such as lentiviral vectors), or transposon-based vectors.

　Among the algae belonging to the class Idyucogome, C. merolae is an alga capable of self-cloning (Fujiwara et al., PLoS One. 2013 Sep 5;8(9):e73608). "Self-cloning" means that the nucleic acid to be introduced into a cell is (1) a nucleic acid from an organism belonging to the same taxonomic species as the organism from which the cell is derived, and (2) an organism from which the cell is derived under natural conditions. transgenic technology that uses only the nucleic acids of organisms belonging to species that exchange nucleic acids with the taxonomic species to which they belong. Transformants produced by self-cloning are excluded from the scope of living modified organisms under the Cartagena Protocol, and therefore can be cultivated in the field. Therefore, genetic modification may be performed by self-cloning.

　C. A method for self-cloning in merolae is not particularly limited, but a method using the URA5.3 gene (CMK046C) as a selection marker can be mentioned. C. merolae, the uracil auxotrophic mutant C. merolae strain M4 (Minoda et al., Plant Cell Physiol. 2004 Jun;45(6):667-71.) exists. C. The merolae M4 strain has a mutation in the URA5.3 gene and cannot synthesize uracil. Therefore, C.I. The merolae M4 strain cannot grow on a medium that does not contain uracil. Therefore, C.I. Self-cloning can be performed by using the merolae M4 strain as the parent strain and using the wild-type URA5.3 gene as the selection marker. More specifically, C.I. In the URA5.3 gene set of wild strains (eg strain 10D) of C. merolae, ligate any set of genes of C. merolae; Introduce into the merolae M4 strain. Thereafter, cells into which any gene set has been introduced can be obtained by culturing in a medium that does not contain uracil. In the above, the “gene set” means a combination of any promoter, ORF of the target gene, and any 3′UTR. The 3'UTR is not particularly limited, and may be the 3'UTR of the target gene or the 3'UTR of another gene. Commonly used 3'UTRs include the 3'UTR of β-tubulin, the 3'UTR of α-tubulin, and the 3'UTR of ubiquitin. Selectable markers are not limited to the URA5.3 gene, but may be genes associated with other auxotrophy.

When genetic modification is performed using the auxotrophy-related gene as a selection marker as described above, by knocking out the auxotrophy-related gene introduced into algae cells, the same auxotrophy-related gene is used as a selection marker again. As such, genetic modification can be performed. That is, multiple self-cloning is possible. A knockout method for the auxotrophic gene introduced as a selection marker is not particularly limited, and a known knockout technique may be used. Knockout techniques include, for example, homologous recombination, gene editing techniques, and the like.
For example, C.I. In C. merolae, the URA5.3 gene (CMK046C) was used as a selectable marker. Self-cloning can be performed using the merolae M4 strain as the parent strain. Since non-transformed cells cannot grow in a uracil-free medium, transformants can be selected by culturing transformed cells in a uracil-free medium. Furthermore, when performing self-cloning, the URA5.3 gene is knocked out by a known knockout technique such as homologous recombination. For example, the introduced URA5.3 gene may be entirely deleted, the URA5.3 gene may be partially deleted, or a point mutation may be introduced into the URA5.3 gene. URA5.3 gene knockout strains can be selected by culturing in a medium containing uracil and 5-fluorotinic acid (5-FOA). This is because in strains that normally express the URA5.3 gene, the gene product of the URA5.3 gene converts 5-FOA to the toxic 5-fluorouracil. Using the URA5.3 knockout strain thus obtained as a parent strain, self-cloning can be performed again using the URA5.3 gene as a selection marker. By repeating similar operations, self-cloning can be performed a desired number of times.

The method for introducing genes into algae belonging to the class Idycogome is not particularly limited, and known methods can be used. Nucleic acid introduction methods include, for example, polyethylene glycol (PEG) method, lipofection method, microinjection method, DEAE dextran method, gene gun method, electroporation method, calcium phosphate method and the like.

When introducing genes into algae belonging to the class Idycogome, the introduced nucleic acid may be inserted into any of the nuclear genome, the chloroplast genome, and the mitochondrial genome. When inserting the introduced nucleic acid into the genome, it may be inserted into the genome at a specific position, or may be inserted into the genome at random.
Homologous recombination, genome editing and the like are examples of methods for inserting the nucleic acid to be introduced into a specific position of the genome. For example, C.I. Since the entire genome sequence of merolae has been completed (Matsuzaki M et al., Nature. 2004 Apr 8;428(6983):653-7.), the introduced nucleic acid is inserted at the desired position on the genome. It is possible. C. The insertion position of the transgene in merolae is not particularly limited, but includes, for example, the region between CMD184C and CMD185C. Examples of transgene insertion sites in algae belonging to the genus Cyanidium include the NS1 region (for example, the NSI region of HKN1 strain (SEQ ID NO: 29)).

(Culturing of algae belonging to the class Idycogome)
The method for culturing algae belonging to the class Idycogome is not particularly limited, and can be cultured by a known method. Algae belonging to the class Idyucogome can be cultured, for example, using a medium for microalgae culture. The medium for culturing microalgae is not particularly limited, but an inorganic salt medium containing a nitrogen source, a phosphorus source, trace elements (zinc, boron, cobalt, copper, manganese, molybdenum, iron, etc.) and the like is exemplified. For example, nitrogen sources include ammonium salts, nitrates, nitrites and the like, and phosphorus sources include phosphates and the like. Such media include, for example, 2× Allen medium (Allen MB. Arch. Microbiol. 1959 32: 270-277.), M-Allen medium (Minoda A et al. Plant Cell Physiol. 2004 45: 667-71 .), MA2 medium (Ohnuma M et al. Plant Cell Physiol. 2008 Jan;49(1):117-20.), modified M-Allen medium and the like. A medium is preferably a liquid medium.

Algae belonging to the class Idyucogome can grow autotrophically under light irradiation, and can also grow heterotrophically by assimilating a carbon source. Therefore, the medium may contain organic matter as a carbon source. Carbon sources include, for example, monosaccharides such as glucose, fructose and galactose; disaccharides such as sucrose, lactose and maltose; polysaccharides such as starch; peptides such as peptone, tryptone and casamino acids.
As the carbon source, glucose is preferable from the viewpoint of the growth efficiency of algae belonging to the class Idycogome. When glucose is used as the carbon source, the glucose concentration in the medium is, for example, 0.01 to 10 M, 0.01 to 5 M, 0.01 to 3 M, 0.01 to 1 M, 0.01 to 0.5 M, 0.05 to 10M, 0.05 to 5M, 0.05 to 3M, 0.05 to 1M, or 0.05 to 0.5M.

Algae belonging to the class Idycogome tend to produce more ergothioneine under salt stress conditions. Therefore, the medium may contain sodium chloride. When the medium contains sodium chloride, the sodium chloride concentration in the medium is, for example, 0.1-10 M, 0.1-5 M, 0.1-3 M, 0.1-1 M, 0.1-0 .5M, 0.3-10M, 0.3-5M, 0.3-3M, 0.3-1M, or 0.3-0.8M.

Ergothioneine has high antioxidant activity and is thought to contribute to the reduction of oxidative stress. Therefore, ergothioneine production may increase under conditions of oxidative stress. Therefore, the medium may contain substances that induce oxidative stress. Substances that induce oxidative stress include, for example, substances that induce osmotic stress such as salts, and peroxides.

Cultivating algae belonging to the class Idycogome under stress conditions tends to increase the production of nutritional components including ergothioneine. Accordingly, in one embodiment, the present invention also provides a method for increasing the nutrient content of algae belonging to the class Idyunicogome, comprising culturing the algae belonging to the class Idyunicogome under stress conditions. Examples of the nutritional component include ergothioneine. Examples of the stress conditions include salt stress, oxidative stress, and the like. Salt stress conditions include, for example, culture in the presence of sodium chloride at concentrations such as those described above. Oxidative stress conditions include culture in the presence of oxidative stress inducers as described above.
In one embodiment, the present invention also provides algae belonging to the class Idycogome, cultured under stress conditions. Algae belonging to the class Idycogome that have been cultured under stress conditions tend to have an increased content of nutritional components, including ergothioneine, compared to those cultured under non-stress conditions. Examples of stress conditions include those similar to those described above.

The medium may contain precursors of ergothioneine in the biosynthetic pathway of ergothioneine. By containing an ergothioneine precursor in the medium, an increase in the amount of ergothioneine produced by algae belonging to the class Idycogome can be expected. Precursors of ergothioneine include methionine, histidine, trimethylhistidine, and hercinylcysteine sulfoxide.

The medium may contain substances that inhibit the metabolism of ergothioneine. Accumulation of ergothioneine can be expected when the medium contains a substance that inhibits the metabolism of ergothioneine. Ergothioneine can be consumed due to scavenging of reactive oxygen species if they are present. Therefore, the medium may contain antioxidants as other substances capable of scavenging reactive oxygen species. Antioxidants include, for example, ascorbic acid (vitamin C), tocopherols (vitamin E), polyphenols, flavonoids, glutathione, astaxanthin and the like.

The pH of the medium should be within the range in which algae belonging to the class Idyucogome can grow. The pH of the medium can be, for example, pH 1-6, or pH 1-5. When culturing algae belonging to the class Idyucogome outdoors, it is preferable to culture them under highly acidic conditions in order to prevent the growth of other organisms. In this case, the pH of the medium can be, for example, pH 1-3.

The culture temperature should be within a range where algae belonging to the class Idyucogome can grow. The culture temperature is, for example, 15 to 50°C. The culture temperature is preferably 20 to 50° C., more preferably 30 to 50° C., since the algae belonging to the class Idycogome grow well. When culturing algae belonging to the class Idyucogome outdoors, it is preferable to culture them at a high temperature in order to prevent the growth of other organisms. In this case, the culture temperature can be, for example, 35-50°C.

_CO2 conditions may be within a range where algae belonging to the class Idyucogome can grow. CO ₂ concentrations include, for example, 0.04 to 5%. The CO ₂ concentration is preferably 0.04 to 3% because the growth of algae belonging to the class Idyucogome is favorable. The _CO2 condition may be atmospheric _CO2 concentration. Among the microalgae belonging to the class Idycogome, the genus Garderia has high tolerance to high _CO2 concentrations and can grow even at 100% _CO2 . Therefore, when the alga belonging to the class Idycogome belongs to the genus Garderia, the CO ₂ concentration may be 100%.

The culture may be static culture, aerobic culture, or shaking culture. In the case of aerobic culture, aeration conditions include, for example, 1 to 4 L air/min or 1 to 3 L air/min. In the case of shaking culture, the shaking speed is, for example, 100 to 200 rpm.

Algae belonging to the class Idyucogome may be grown autotrophically or heterotrophically. For autotrophic growth, algae belonging to the class Idycogome are cultured under light irradiation. For autotrophic growth, the light intensity is, for example, 5 to 2000 μmol/m ² s. The light intensity is preferably from 5 to 1500 μmol/m ² s because the growth of algae belonging to the class Idyucogome is favorable. When algae belonging to the class Idyucogome are cultured outdoors, they may be cultured under sunlight. When cultured indoors, the culture may be performed under continuous light, or a light-dark cycle (10L:14D, etc.) may be provided.

When algae belonging to the class Idyucogome are grown heterotrophically, they may be cultured in a medium containing an organic carbon source. The light condition may be under light irradiation or under darkness. When cultured in a medium containing an organic carbon source under light irradiation, algae belonging to the class Idyucogome undergo both autotrophic growth by photosynthesis and heterotrophic growth by assimilation of carbon sources. When cultured in the dark using a medium containing an organic carbon source, algae belonging to the class Idyucogome grow only heterotrophically by assimilation of the carbon source. When cultured under light irradiation using a medium containing no organic carbon source (inorganic salt medium), algae belonging to the class Idycogome grow only autotrophically by photosynthesis.
Hereinafter, culture under light irradiation in an organic carbon source-free medium (inorganic salt medium) is referred to as "autotrophic culture". Culture under light irradiation in a medium containing an organic carbon source is called "mixed nutrition culture". Culturing in the dark using a medium containing an organic carbon source is called "heterotrophic culture."

When algae belonging to the class Idyucogome are autotrophic cultured, the intracellular content of ergothioneine is higher than in mixed and heterotrophic cultures. Therefore, from the viewpoint of intracellular content of ergothioneine, autotrophic culture is preferable.
When algae belonging to the class Idycogome are subjected to mixed nutrition culture or heterotrophic culture, the growth rate is faster than that of autotrophic culture. Therefore, even if the intracellular content of ergothioneine is taken into account, the same amount of ergothioneine as in autotrophic culture can be obtained more quickly. Therefore, from the viewpoint of production time, mixed nutrition culture or heterotrophic culture is preferable.

Algae belonging to the class Idycogome may be pre-cultured before main culture for producing ergothioneine. The culture conditions for the pre-culture may be the same as those for the main culture, or may be different. The pre-culture can be, for example, an autotrophic culture. In this case, for example, the light condition can be 5-1000 μmol/m ² s, the CO ₂ condition can be 1-5%, and the temperature condition can be 30-50°C. Pre-culture may be performed by static culture.

Algae belonging to the class Idyucogome may be cultured until they reach the stationary phase, or the culture may be terminated at the growth phase. Since the ergothioneine content is higher in cells in the stationary phase than in cells in the growing phase, algae belonging to the class Idycogome are preferably cultured until they reach the stationary phase.

<Optional process>
The manufacturing method of the present embodiment may include optional steps in addition to the step (a). As an optional step, for example, a step (b) of recovering algae belonging to the class Idecogome from the culture solution after the culture in step (a), and extracting ergothioneine from the algae belonging to the class Idecogome collected in step (b). The step (c) of performing is mentioned. In addition, before the step (a), the step (i) of genetically modifying the haploid algae belonging to the class Idyucogome, and the step (ii) of making the algae belonging to the class Idyuteicogome diploid. .

(Step (b))
Step (b) is a step of recovering algae belonging to the class Idycogome from the culture solution after culturing in step (a).

A method for recovering algae belonging to the class Idycogome from the culture medium is not particularly limited, and a known method can be used. Methods for collecting algal cells include, for example, a method of collecting by centrifugation, a method of collecting by filtration, and the like.
When algal cells are collected by centrifugation, centrifugation conditions include, for example, 1000-5000×g or 2000-4000×g. The centrifugation time may be appropriately set according to the amount of the culture medium. Examples of centrifugation time include 5 to 60 minutes, 5 to 30 minutes, or 5 to 20 minutes.
When algal cells are collected by filtration, a filter with a pore size smaller than that of algal cells belonging to the class Idycogome may be used. For example, a 0.45 μm filter or the like can be used.

(Step (c))
Step (c) is a step of extracting ergothioneine from the algae belonging to the class Idycogome collected in step (b).

The method for extracting ergothioneine from algae belonging to the class Idycogome is not particularly limited. Methods for extracting ergothioneine include, for example, solvent extraction. Solvent extraction can be carried out, for example, by adding an extraction solvent to algae belonging to the class Idynocogoma, mixing them, and then removing cell residues of the algae belonging to the class Idycogome. The extraction solvent is not particularly limited as long as it dissolves ergothioneine. Examples of extraction solvents include organic solvents such as methanol, ethanol, isopropanol, and acetone; water-containing organic solvents obtained by mixing these organic solvents with water; and water (eg, hot water). Among them, methanol is preferable as the extraction solvent. Solvent extraction may be performed after freeze-drying algal cells belonging to the class Idycogome. Extraction efficiency is improved by subjecting the freeze-dried cells to solvent extraction.

After adding an extraction solvent to algae belonging to the class Ideucogome, a cell disruption treatment may be performed in order to increase the extraction efficiency of ergothioneine. Examples of cell disruption treatment include ultrasonic treatment and heat treatment. After the ergothioneine extraction treatment, cell debris of algae belonging to the class Idycogome may be removed. Methods for removing cell debris include, for example, centrifugation and filter filtration.

The extract may be further purified for ergothioneine. Purification treatments include, for example, salting out, dialysis, recrystallization, reprecipitation, solvent extraction, adsorption, concentration, filtration, gel filtration, ultrafiltration, various types of chromatography (thin layer chromatography, column chromatography, ion exchange chromatography, chromatography, high-performance liquid chromatography, adsorption chromatography, etc.), but are not limited to these. Ergothioneine may be purified by appropriately combining these methods.

(Step (i))
Step (i) is a step of genetically modifying haploid algae belonging to the class Idycogome. Step (i) can be performed before step (a).

When genetically modifying algae belonging to the class Idycogome, it is preferable to genetically modify haploid cells. Because haploid cells have only one set of genomes, they are easier to genetically modify than diploid cells.
Examples of the method for making algae belonging to the class Idycogome haploid include the method mentioned in the above section "<Step (a)>".
Examples of the method for genetically modifying algae belonging to the class Idycogome include the methods listed in the above section "<Step (a)>". Genetic modification includes, for example, genetic modification that increases the amount of ergothioneine produced.

(Step (ii))
Step (ii) is a step of diploidizing algae belonging to the class Idycogome. Step (ii) can be performed after step (i) and before step (a).

In algae belonging to the class Idycogome, diploid cells tend to produce more ergothioneine than haploid cells. Therefore, when the haploid cells are genetically modified in the step (i), it is preferable to culture algae belonging to the class Idycogome after making them into diploid cells. Examples of the method for making algae belonging to the class Idyucogome diploid include the method mentioned in the above section "<Step (a)>".

According to the production method of the present embodiment, ergothioneine can be obtained by culturing algae belonging to the class Idycogome. Since algae belonging to the class Idyucogome can grow under low-pH and high-temperature conditions where other organisms have difficulty growing, they can be cultivated outdoors in large quantities. In addition, algae belonging to the class Idycogome can increase the cellular content of ergothioneine to the same extent as that of Pleurotus cornucopiae. Therefore, reduction in the production cost of ergothioneine can be expected.

[Polypeptide]
In one embodiment, the present disclosure provides a polypeptide (hereinafter also referred to as "HSM polypeptide") selected from the group consisting of (a1) to (c1) below.
(a1) A polypeptide comprising the amino acid sequence set forth in SEQ ID NO:6.
(b1) A polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 6, and having histidine methyltransferase activity.
(c1) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6 and having histidine methyltransferase activity.

The polypeptide of (a1) is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6 (polypeptide of SEQ ID NO: 6), or an amino acid A polypeptide to which a sequence has been added. The polypeptide of SEQ ID NO: 6 is a polypeptide found as a histidine methyltransferase-like protein from HKN1 strain. The polypeptide of SEQ ID NO: 6, when introduced into the HKN1 strain together with the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 8 (the polypeptide of SEQ ID NO: 8), has the effect of increasing the ergothioneine production of the HKN1 strain. showed that. Therefore, the polypeptide of SEQ ID NO: 6 has histidine methyltransferase activity and is presumed to have activity to catalyze the reaction of methylating histidine to produce trimethylhistidine.

The length of the amino acid sequence added to the N-terminus or C-terminus of the polypeptide of SEQ ID NO: 6 is not particularly limited. Examples of amino acid sequences to be added include amino acid sequences of peptide tags (FLAG tag, HA tag, 6×His tag, Myc tag, etc.), amino acid sequences of other proteins, and the like. The size of the polypeptide of (a1) is not particularly limited, but may be, for example, about 426 to 5000 amino acids long. The size of the polypeptide of (a1) is 4000 amino acids or less, 3000 amino acids or less, 2000 amino acids or less, 1000 amino acids or less, 800 amino acids or less, 700 amino acids or less, 600 amino acids or less, or 500 amino acids. Hereafter, 450 amino acids or less in length are mentioned.

The polypeptide of (b1) is a polypeptide consisting of an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 6, or at either or both of the N-terminus and C-terminus of the polypeptide , is a polypeptide to which an amino acid sequence has been added. The amino acid sequence to be added includes those similar to (a1) above. The size of the polypeptide of (b1) includes those similar to those of the polypeptide of (a1).

Amino acid mutations may be deletions, substitutions, additions, insertions, or combinations thereof. The number of mutated amino acids is not particularly limited as long as the resulting polypeptide has histidine methyltransferase activity. The number of amino acids to be mutated is, for example, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 or 2 are included.

The types and positions of amino acids to be mutated are not particularly limited. When the mutation is an amino acid substitution, it includes, for example, substitution with an amino acid having a side chain similar to that of the original amino acid. Such substitutions include conservative substitutions. Conservative substitutions are amino acid substitutions that have little effect on the function of the polypeptide. Amino acids include, for example, acidic amino acids (aspartic acid and glutamic acid), basic amino acids (lysine, arginine, histidine), neutral amino acids (amino acids having hydrocarbon chains (glycine, alanine, valine, leucine, isoleucine/proline), amino acids with hydroxy groups (serine/threonine), amino acids containing sulfur (cysteine/methionine), amino acids with amide groups (asparagine/glutamine), amino acids with imino groups (proline), aromatic groups amino acids (phenylalanine, tyrosine, tryptophan)), etc. Conservative substitutions include substitutions within these groups.

The polypeptide of (c1) is a polypeptide consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6, or at either or both of the N-terminus and C-terminus of the polypeptide , is a polypeptide to which an amino acid sequence has been added. The amino acid sequence to be added includes those similar to (a1) above. The size of the polypeptide of (c1) includes those similar to those of the polypeptide of (a1).

The sequence identity is not particularly limited as long as it is 80% or more. Sequence identities include 85% or greater, 90% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, or 99% or greater.

The polypeptides (b1) and (c1) have histidine transferase activity. Whether or not a polypeptide has histidine transferase activity can be confirmed by a known method. Such methods include, for example, incubating histidine and an appropriate methyl donor (such as S-adenosylmethionine (SAM)) in the presence of the polypeptide and confirming the production of trimethylhistidine.

In one embodiment, the present disclosure provides a polypeptide (hereinafter also referred to as "HSS polypeptide") selected from the group consisting of (a2) to (c2) below.
(a2) A polypeptide comprising the amino acid sequence set forth in SEQ ID NO:8.
(b2) A polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO:8, wherein the polypeptide has 5-histidylcysteine sulfoxide synthase activity.
(c2) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 8 and having 5-histidylcysteine sulfoxide synthase activity.

The polypeptide of (a2) is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 8 (polypeptide of SEQ ID NO: 8), or an amino acid A polypeptide to which a sequence has been added. The polypeptide of SEQ ID NO: 8 is a polypeptide found as a histidylcysteine sulfoxide synthase-like protein from HKN1 strain. When the polypeptide of SEQ ID NO: 8 was introduced into the HKN1 strain together with the polypeptide of SEQ ID NO: 6, it exhibited the effect of increasing the ergothioneine production of the HKN1 strain. Therefore, the polypeptide of SEQ ID NO: 8 has 5-histidylcysteine sulfoxide synthase activity and is presumed to have activity to catalyze the reaction of trimethylhistidine to 5-histidylcysteine sulfoxide (hercinylcysteine sulfoxide). be done.

The length of the amino acid sequence added to the N-terminus or C-terminus of the polypeptide of SEQ ID NO: 8 is not particularly limited. Examples of amino acid sequences to be added include amino acid sequences of peptide tags (FLAG tag, HA tag, 6×His tag, Myc tag, etc.), amino acid sequences of other proteins, and the like. The size of the polypeptide of (a2) is not particularly limited, but may be, for example, about 595 to 5000 amino acids long. The size of the polypeptide of (a2) is 4000 amino acids or less, 3000 amino acids or less, 2000 amino acids or less, 1000 amino acids or less, 800 amino acids or less, 700 amino acids or less, 650 amino acids or less, or 600 amino acids. These include:

The polypeptide of (b2) is a polypeptide consisting of an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 8, or at either or both of the N-terminus and C-terminus of the polypeptide , is a polypeptide to which an amino acid sequence has been added. The amino acid sequence to be added includes those similar to (a2) above. The size of the polypeptide of (b2) includes those similar to those of the polypeptide of (a2).

Amino acid mutations may be deletions, substitutions, additions, insertions, or combinations thereof. The number of amino acids to be mutated is not particularly limited as long as the resulting polypeptide has 5-histidylcysteine sulfoxide synthase activity. The number of amino acids to be mutated is, for example, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 or 2 are included.
The types and positions of amino acids to be mutated are not particularly limited. Types of amino acid substitution include those similar to those described above.

The polypeptide of (c2) is a polypeptide consisting of an amino acid sequence having a sequence identity of 80% or more with the amino acid sequence set forth in SEQ ID NO: 8, or at either or both of the N-terminus and C-terminus of the polypeptide , is a polypeptide to which an amino acid sequence has been added. The amino acid sequence to be added includes those similar to (a2) above. The size of the polypeptide of (c2) includes those similar to those of the polypeptide of (a2).

The polypeptides (b2) and (c2) have 5-histidylcysteine sulfoxide synthase activity. Whether or not a polypeptide has 5-histidylcysteine sulfoxide synthase activity can be confirmed by known methods. Such methods include, for example, incubating trimethylhistidine and cysteine in the presence of the polypeptide and confirming the production of 5-histidylcysteine sulfoxide (hercinylcysteine sulfoxide).

HSM polypeptides and HSS polypeptides can be used to produce ergothioneine from histidine.

[Polynucleotide]
In one embodiment, the present disclosure provides polynucleotides encoding HSM polypeptides (hereinafter also referred to as "HSM polynucleotides").

Specific examples of HSM polynucleotides include (d1) to (g1) below.
(d1) A polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:5.
(e1) A polynucleotide comprising a nucleotide sequence in which one or more nucleotides are mutated in the polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:5, and which encodes a polypeptide having histidine transferase activity.
(f1) A polynucleotide comprising a nucleotide sequence having 80% or more sequence identity with a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 5, which encodes a polypeptide having histidine transferase activity.
(g1) A polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:5 and that encodes a polypeptide having histidine transferase activity.

The polynucleotide (d1) is a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 5 (polynucleotide of SEQ ID NO: 5), or at either or both of the 5' end and 3' end of the polynucleotide of SEQ ID NO: 5 , is a polynucleotide to which a nucleotide sequence has been added. The polynucleotide of SEQ ID NO:5 is a polynucleotide that encodes the polypeptide of SEQ ID NO:6. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide of SEQ ID NO:6.

The polynucleotide of (e1) is either a polynucleotide consisting of a nucleotide sequence in which one or more nucleotides are mutated in the nucleotide sequence set forth in SEQ ID NO: 5, or the 5' end and 3' end of the polynucleotide, or Both are polynucleotides with added nucleotide sequences. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide.

Nucleotide mutations may be deletions, substitutions, additions, insertions, or combinations thereof. The number of mutated nucleotides is not particularly limited as long as the polypeptide encoded by the resulting polynucleotide has histidine methyltransferase activity. The number of nucleotides to be mutated is, for example, 1 to 300, 1 to 200, 1 to 150, 1 to 120, 1 to 100, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 or 2.

The polynucleotide (f1) is a polynucleotide consisting of a nucleotide sequence having a sequence identity of 80% or more with the nucleotide sequence set forth in SEQ ID NO: 5, or any of the 5' end and 3' end of the polynucleotide, or Both are polynucleotides with added nucleotide sequences. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide.

In one embodiment, the present disclosure provides polynucleotides encoding HSS polypeptides (hereinafter also referred to as "HSS polynucleotides").

Specific examples of HSS polynucleotides include (d2) to (g2) below.
(d2) a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:7;
(e2) A polynucleotide comprising a nucleotide sequence in which one or more nucleotides are mutated in the polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7, the polypeptide having 5-histidylcysteine sulfoxide synthase activity A polynucleotide encoding a
(f1) A polynucleotide comprising a nucleotide sequence having 80% or more sequence identity with a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7, wherein the polypeptide has 5-histidylcysteine sulfoxide synthase activity encoding polynucleotide.
(g1) A polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7 and that encodes a polypeptide having 5-histidylcysteine sulfoxide synthase activity.

The polynucleotide (d2) is a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7 (polynucleotide of SEQ ID NO: 7), or at either or both of the 5' end and 3' end of the polynucleotide of SEQ ID NO: 7 , is a polynucleotide to which a nucleotide sequence has been added. The polynucleotide of SEQ ID NO:7 is a polynucleotide that encodes the polypeptide of SEQ ID NO:8. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide of SEQ ID NO:8.

The polynucleotide of (e2) is either a polynucleotide consisting of a nucleotide sequence in which one or more nucleotides are mutated in the nucleotide sequence set forth in SEQ ID NO: 7, or the 5' end and 3' end of the polynucleotide, or Both are polynucleotides with added nucleotide sequences. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide.

Nucleotide mutations may be deletions, substitutions, additions, insertions, or combinations thereof. The number of mutated nucleotides is not particularly limited as long as the polypeptide encoded by the resulting polynucleotide has 5-histidylcysteine sulfoxide synthase activity. The number of nucleotides to be mutated is, for example, 1 to 300, 1 to 200, 1 to 170, 1 to 150, 1 to 120, 1 to 100, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 or 2.

The polynucleotide (f1) is a polynucleotide consisting of a nucleotide sequence having 80% or more sequence identity with the nucleotide sequence set forth in SEQ ID NO: 7, or any of the 5' end and 3' end of the polynucleotide, or Both are polynucleotides with added nucleotide sequences. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide.

In the above, degenerate codons that have a high codon usage frequency in the cells used may be used. For example, codon optimization may be performed depending on the cell species used. Nucleotide mutations may be genetic mutations that do not change the amino acid sequence of the encoded protein (silent mutations).

HSM polynucleotides and HSS polynucleotides can be used to produce cells that produce ergothioneine or cells with improved ergothioneine-producing ability.

[vector]
In one embodiment, the disclosure provides a vector comprising at least one polynucleotide selected from the group consisting of HSM polynucleotides and HSS polynucleotides.

The vector of this embodiment may contain only one of the HSM polynucleotide and the HSS polynucleotide, or may contain both the HSM polynucleotide and the HSS polynucleotide.

A vector may contain other sequences in addition to HSM polynucleotides and/or HSS polynucleotides. Other sequences include those similar to those described above. A vector may be an expression vector. Examples of vectors include the same vectors as those described above.

The HSM polynucleotide and/or HSS polynucleotide may be operably linked to a promoter that can function in the target of introduction. Examples of promoters include those mentioned above. If the vector contains both HSM and HSS polynucleotides, the same promoter and terminator may be used, or different promoters and terminators may be used. From the viewpoint of avoiding unintended homologous recombination, HSM polynucleotides and HSS polynucleotides preferably use different promoters and terminators, respectively.

The vector of the present embodiment can be used for production of cells that produce ergothioneine, or production of cells with improved ergothioneine-producing ability.

[cell]
In one embodiment, the present disclosure provides cells comprising at least one polynucleotide selected from the group consisting of HSM polynucleotides and HSS polynucleotides.

The cells of this embodiment may contain either one of HSM polynucleotides and HSS polynucleotides, or may contain both HSM polynucleotides and HSS polynucleotides. The cells of this embodiment preferably contain both HSM and HSS polynucleotides.

The type of cells is not particularly limited. Examples of cells include, but are not limited to, cells of bacteria (Escherichia coli, Bacillus subtilis, etc.), fungi (yeast, etc.), algae (Idycogome algae, etc.), insects (silkworms, etc.), plants, mammals, and the like. . Cells include, for example, algal cells belonging to the class Idycogome.

The cells of this embodiment can be produced by introducing a vector containing HSM polynucleotides and/or HSS polynucleotides into cells. Methods for introducing vectors include the same methods as described above.

The cells of this embodiment preferably contain HSM polynucleotides and/or HSS polynucleotides in an expressible state. Cells contain HSM and/or HSS polynucleotides in an expressible state such that HSM and/or HSS polypeptides are expressed from these polynucleotides. The expressed HSM and/or HSS polypeptides catalyze the synthesis of ergothioneine from histidine. As a result, the cell becomes able to synthesize ergothioneine. Alternatively, when the cell has ergothioneine-producing ability, the ergothioneine-producing ability is improved.

In one embodiment, the present disclosure provides a method for producing ergothioneine, comprising culturing cells containing at least one polynucleotide selected from the group consisting of HSM polynucleotides and HSS polynucleotides.

The culture method can be appropriately selected according to the cell type. When the cells are algal cells belonging to the class Idycogome, they can be cultured in the same manner as described above. The production method of the present embodiment may further include a step of collecting cells, a step of extracting ergothioneine from cells, and the like.

The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.

Example 1:
[Preparation of medium]
(MA medium)
An M-Allen medium (MA medium) having the composition shown in Table 1 was prepared. Specifically, medium components other than A2 Fe stock were mixed, adjusted to pH 2.0 with sulfuric acid, and then sterilized by autoclaving. After autoclave sterilization, 4 mL of filter-sterilized A2 Fe stock was added to prepare MA medium.
Tables 2 and 3 show the compositions of A2 trace element and A2 Fe stock, respectively.

(MA + 0.1 M glucose medium)
Glucose was added to the MA medium to a final concentration of 0.1 M to prepare an MA+0.1 M glucose medium.

(MA + 0.3M NaCl medium)
NaCl was added to MA medium to a final concentration of 0.3 M to prepare MA+0.3 M NaCl medium.

(MA + 0.6M NaCl medium)
NaCl was added to MA medium to a final concentration of 0.6M to prepare MA+0.6M NaCl medium.

(MA + 0.1 M glucose, 0.6 M NaCl medium)
Glucose and NaCl were added to MA medium to final concentrations of 0.1 M and 0.6 M, respectively, to prepare MA+0.1 M glucose, 0.6 M NaCl medium.

[Culture method]
<Autotrophic culture>
(pre-culture)
Algae belonging to the class Idycogome were statically cultured in a CO ₂ incubator using MA medium.
The culture conditions were a light condition of 60 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and a CO ₂ concentration of 2%.

(main culture)
Using 1 L of MA medium, main culture of algae belonging to the class Idycogome was carried out in a gas phase incubator. After culturing for 2 to 3 weeks, cells were harvested by centrifugation (3,000×g, 10 minutes).
The culture conditions were a light condition of 200 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and an aeration condition of 2 L ambient air/min.

<Mixed nutrient culture>
(pre-culture)
Algae belonging to the class Idycogome were statically cultured in a CO ₂ incubator using MA medium.
The culture conditions were a light condition of 60 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and a CO ₂ concentration of 2%.

(main culture)
Using 1 L of MA + 0.1 M glucose medium, main culture of algae belonging to the class Idycogome was performed in a gas phase incubator. After culturing for 4 days, cells were collected by centrifugation (3,000×g, 10 minutes).
The culture conditions were a light condition of 200 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and an aeration condition of 2 L ambient air/min.

<Heterotrophic culture>
(pre-culture)
Algae belonging to the class Idycogome were statically cultured in a CO ₂ incubator using MA medium.
The culture conditions were a light condition of 60 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and a CO ₂ concentration of 2%.

(main culture)
Using 1 L of MA + 0.1 M glucose medium, main culture of algae belonging to the class Idycogome was performed in a gas phase incubator. After culturing for 4 days, cells were collected by centrifugation (3,000×g, 10 minutes).
The culture conditions were darkness, a temperature condition of 40° C., and an aeration condition of 2 L ambient air/min.

<Autotrophic culture under salt stress conditions>
(pre-culture)
Using MA+0.3M NaCl medium, static culture of algae belonging to the class Idycogome was carried out in a CO ₂ incubator.
The culture conditions were a light condition of 60 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and a CO ₂ concentration of 2%.

(main culture)
Using 1 L of MA+0.6 M NaCl medium, main culture of algae belonging to the class Idycogome was performed in a gas phase incubator. After culturing for 2 to 3 weeks, cells were harvested by centrifugation (3,000×g, 10 minutes).
The culture conditions were a light condition of 200 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and an aeration condition of 2 L ambient air/min.

<Mixed nutrient culture under salt stress conditions>
(pre-culture)
Using MA+0.3M NaCl medium, static culture of algae belonging to the class Idycogome was carried out in a CO ₂ incubator.
The culture conditions were a light condition of 60 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and a CO ₂ concentration of 2%.

(main culture)
Using 1 L of MA+0.1 M glucose, 0.6 M NaCl medium, main culture of algae belonging to the class Idycogome was carried out in a gas phase incubator. After culturing for 4 days, cells were collected by centrifugation (3,000×g, 10 minutes).
The culture conditions were a light condition of 200 μmol/m ² ·s (continuous light), a temperature condition of 40° C., and an aeration condition of 2 L ambient air/min.

[Method for quantifying ergothioneine]
Cells harvested from the culture medium were freeze-dried. 10 mL of methanol was added to 100 mg of lyophilized cells. After performing ultrasonic treatment for 30 minutes, it was filtered with a membrane filter (0.45 μm). The filtrate was used as a measurement sample for liquid chromatography-mass spectrometry (LC-MS). The quantification of ergothioneine was entrusted to the Foundation for Promotion of Materials Science and Technology.

<Measurement conditions>
(liquid chromatography: LC)
Apparatus: Prominence System UFLC (manufactured by Shimadzu Corporation)
Column: ZORBAX Rx-SIL (150 mm × 2.1 mm, 5.0 μm)
Column temperature: 40°C
Mobile phase: 5 mM ammonium acetate + 85% acetonitrile aqueous solution Flow rate: 0.4 mL/min
Injection volume: 5 μL

(Mass spectrometry: MS)
Apparatus: QTRAP4500 (manufactured by AB Sciex)
Ionization method: Electro Spray Ionization (ESI)
Q1/Q3: Ergothioneine 230.1/127.0
Ergothioneine-d9 239.1/127.0

[Measurement of ergothioneine content in algae belonging to the class Idycogome]
By the culture method shown in Table 4, each alga belonging to the class Idycogome was cultured, and the cells were collected. The ergothioneine (EGT) content of the collected cells was measured and shown in Table 4 as "EGT amount/wet weight (100 g)". Also, the ergothioneine content per dry weight was calculated by dividing the EGT amount/wet weight (100 g) by the value of (cell dry weight/cell wet weight). This is shown in Table 4 as "EGT amount/dry weight (100 g)".

In Table 4, the description of each alga indicates the following algae.
Cyanidium (2N): Cyanidium sp. HKN1 (diploid)
Cyanidium (N): Cyanidium sp. HKN1 (haploid)
Galdieria (2N): Galdieria sulphuraria SAG108.79 (diploid)
Galdieria (N): Galdieria sulphuraria SAG108.79 (haploid)

In Table 4, "autotrophic culture + salt" indicates autotrophic culture under salt stress conditions. "Mixotrophic culture + salt" indicates a mixed trophic culture under salt stress conditions.

Fig. 3 shows an example of an LC-MS chromatogram measuring the ergothioneine content. FIG. 3 shows the results for autotrophically cultured Galdieria sulphuraria SAG108.79 (diploid).

As shown in Table 4, it was confirmed that all algae contained ergothioneine at high concentrations. Ergothioneine content was higher in diploids than in haploids. In comparison of the culture methods, the content of ergothioneine was higher in the autotrophic culture than in the mixed and heterotrophic cultures. However, the growth rate was faster in the mixed and heterotrophic cultures than in the autotrophic cultures. Therefore, it is considered that the production amount per culture time is higher in mixed nutrition culture and heterotrophic culture than in autotrophic culture.
Also, culture under salt stress conditions (0.3 M NaCl) tended to increase ergothioneine content compared to culture under conditions without salt stress (0 M NaCl). This result suggested that the ergothioneine content was improved by culturing under stress conditions such as salt stress.

Example 2:
[Production of transformants]
Cyanidium sp. A histidine methyltransferase-like gene (HSM gene; SEQ ID NO: 5) and a 5-histidylcysteine sulfoxide synthase-like gene (HSS gene; SEQ ID NO: 7) were introduced into HKN1 (haploid), and the HSM gene and HSS gene were introduced. Overexpressing transformants were generated (see Figure 4). The HSM and HSS genes are derived from Cyanidium sp. A clone from HKN1 was used.

(Preparation of donor DNA)
FIG. 4 shows the construct of the donor DNA. Cyanidium sp. into which the HSS gene and the HSM gene are introduced. A neutral site (NS1) was selected as the genomic region of HKN1 (haploid). Cyanidium sp. Using genomic DNA extracted from HKN1 (haploid) as a template, the following primers (NS1_F, NS1_R; lowercase letters indicate sequences homologous to the vector, uppercase letters indicate the sequence of the NS1 region) were used to extract the NS1 region. A DNA fragment was amplified.

NS1_F: cggtaccggggatcACCATCCAAAGAGCAGGAATGCGG (SEQ ID NO: 27)
NS1_R: cgactctagaggatcATTAGCTCGCTGGTTGAAACCAAACG (SEQ ID NO: 28)

The obtained DNA fragment was cloned into the pUC19 plasmid, and the HSS gene set [P _APCC (SEQ ID NO: 19)-HSS (SEQ ID NO: 7)-T _β-tubulin (SEQ ID NO: 22)], CAT marker set [ _PEF1α (SEQ ID NO: 22)] No.20)-Tp of POP (SEQ ID NO:25)-CAT (SEQ ID NO:26)-T _UBQ (SEQ ID NO:23)], HSM gene set [P _CPCC (SEQ ID NO:21)-HSM (SEQ ID NO:5)-T _{α -tubulin} (SEQ ID NO: 24)] was inserted. The abbreviations are as follows.

P _APCC : Cyanidium sp. APCC promoter of HKN1.
HSS: Cyanidium sp. HSS gene of HKN1.
T _β-tubulin : Cyanidium sp. β-tubulin terminator of HKN1.
_PEF1α : Cyanidium sp. EF1α promoter of HKN1.
Tp of POP: transit peptide (Tp) of plant organelle DNA polymerase (POP)
CAT: chloramphenicol antitransferase gene.
_TUBQ : Cyanidium sp. Ubiquitin terminator of HKN1.
P _CPCC : Cyanidium sp. CPCC promoter of HKN1.
HSM: Cyanidium sp. HSM gene of HKN1.
T _α-tubulin : Cyanidium sp. α-tubulin terminator of HKN1.

Escherichia coli was transformed with the resulting plasmid, allowed to grow, and then the plasmid was extracted. Using the obtained plasmid as a template, PCR amplification was performed using the following primers (puc19_F, puc19_R). The obtained DNA fragment was used as donor DNA.

puc19_F: gctgcaaggcgattaagttgggtaacgccagggttttccc (SEQ ID NO: 32)
puc19_R: ttatgcttccggctcgtatgttgtgtggaattgtgagcgg (SEQ ID NO: 33)

The NS1 region and its upstream and downstream 200 bp sequences are shown in SEQ ID NO: 29. The sequence of the NS1 region used as the 5' homology arm of the donor DNA is shown in SEQ ID NO:30. The sequence of the NS1 region used as the 3' homology arm of the donor DNA is shown in SEQ ID NO:31.

(transformation)
Cyanidium sp. Introduction of DNA into HKN1 (haploid) was performed by the PEG method. Cyanidium sp. HKN1 (haploid) was inoculated into 50 mL of MA medium (pH 2.0) at OD ₇₅₀ =0.5. It was cultured at 42° C. for 4 to 5 days with a light/dark cycle (12 L/12 D) (aerobic culture, 300 mL air/min). The cultured cells were collected and suspended in MA medium (pH 2.0) to OD ₇₅₀ =500 to prepare a cell suspension.

45 μL of donor DNA (˜500 ng/μL; dissolved in distilled water) was added to 67.5 μL of MA2 medium containing 30% (v/v) PEG and stirred. 12.5 μL of the cell suspension was added here and stirred upside down. The suspension after stirring was transferred to 10 mL of modified MA medium (pH 1.2) and cultured for 2 days under the same culture conditions as above. Thereafter, the cells were collected, planted in a modified MA medium containing chloramphenicol (pH 1.0, chloramphenicol 100 μg/mL), and cultured under the same conditions as above. The cultured cells were collected and used as transformants (TF).

Using the genomic DNA extracted from the resulting transformant (TF) and wild strain (WT) as templates, PCR amplification was performed using the above primers (NS1_F, NS1_R). FIG. 5 shows the results of electrophoresis of the PCR amplification products. In the transformant (TF), a larger size DNA fragment was amplified than in the wild strain (WT). The size of this amplified DNA fragment matched the size of the donor DNA. From this result, it was confirmed that the donor DNA was inserted into the NS1 region of the transformant (TF).

[Production of ergothioneine]
Cyanidium sp. HKN1 (haploid) (WT) and Cyanidium sp. A transformant (TF) of HKN1 (haploid) was autotrophically cultured in the same manner as above. After 1 week (proliferation phase) and 3 weeks (stationary phase) from the start of main culture, cells were collected from the culture medium. The ergothioneine content of the recovered cells was measured in the same manner as above. Table 5 shows the results.

The algae described in Table 5 are the following algae.
Cyanidium (N) WT: Cyanidium sp. Wild strain of HKN1 (haploid).
Cyanidium (N) TF: Cyanidium sp. A transformant of HKN1 (haploid).

　In the transformant (TF), the amount of ergothioneine produced was significantly increased compared to the wild type (WT). The ergothioneine content was higher in cells in stationary phase compared to cells in proliferative phase. From this result, it was confirmed that the HSM gene and HSS gene introduced into the transformant (TF) are genes involved in ergothioneine production. The HSM and HSS genes were deduced to be histidine methyltransferase and 5-histidylcysteine sulfoxide synthase genes, respectively, based on their sequence homology with Egt-1.

The growth curve in the main culture is shown in Figure 6. Arrows in FIG. 6 indicate cell sampling times. There was no difference in growth rate between transformant (TF) and wild type (WT). This result indicates that overproduction of ergothioneine does not affect growth rate. As shown in Table 5, ergothioneine content is higher in stationary phase cells. Therefore, it was considered preferable to recover ergothioneine from algal cells after growing them to the stationary phase.

According to the present invention, a method for producing ergothioneine using microalgae is provided. Also provided are polypeptides that can be used to produce ergothioneine, polynucleotides encoding the polypeptides, and vectors and cells containing the polynucleotides.
While the preferred embodiments of the invention have been described and illustrated, it is to be understood that they are intended to be illustrative of the invention and should not be taken as limiting. Additions, omissions, substitutions, and other changes can be made without departing from the spirit or scope of the invention. Accordingly, the present invention should not be viewed as limited by the foregoing description, but only by the scope of the appended claims.

Claims

A method for producing ergothioneine, including the step (a) of culturing algae belonging to the class Idycogome.
The method for producing ergothioneine according to claim 1, further comprising the step (b) of recovering the algae belonging to the class Idycogome from the culture solution after the step (a).
The method for producing ergothioneine according to claim 2, further comprising a step (c) of extracting ergothioneine from the algae belonging to the class Idycogome collected in the step (b).
The method for producing ergothioneine according to any one of claims 1 to 3, wherein the algae belonging to the class Idycogome in the step (a) are diploid.
The method for producing ergothioneine according to any one of claims 1 to 4, wherein the algae belonging to the class Idycogome are genetically modified algae.
The method for producing ergothioneine according to claim 5, wherein the genetic modification is a genetic modification that increases the amount of ergothioneine produced.
The method for producing ergothioneine according to claim 5 or 6, further comprising the step (i) of genetically modifying the haploid algae belonging to the class Idycogome before the step (a).
The method for producing ergothioneine according to claim 7, further comprising a step (ii) of diploidizing the alga belonging to the class Idycogome between the step (i) and the step (a).
Polypeptides selected from the group consisting of the following (a1) to (c1):
(a1) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6;
(b1) a polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO:6, the polypeptide having histidine methyltransferase activity; and (c1) set forth in SEQ ID NO:6 which has a histidine methyltransferase activity.
Polypeptides selected from the group consisting of the following (a2) to (c2):
(a2) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:8;
(b2) a polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 8, the polypeptide having 5-histidylcysteine sulfoxide synthase activity; and (c2) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6, and having 5-histidylcysteine sulfoxide synthase activity.
A polynucleotide encoding the polypeptide according to claim 9.
A polynucleotide encoding the polypeptide according to claim 10.
A vector comprising at least one polynucleotide selected from the group consisting of the polynucleotide according to claim 11 and the polynucleotide according to claim 12.
A cell containing at least one polynucleotide selected from the group consisting of the polynucleotide according to claim 11 and the polynucleotide according to claim 12.
A method for producing ergothioneine, comprising the step of culturing the cells according to claim 14.