WO2022219353A1 - Inhibiteurs d'expansion somatique - Google Patents

Inhibiteurs d'expansion somatique Download PDF

Info

Publication number
WO2022219353A1
WO2022219353A1 PCT/GB2022/050953 GB2022050953W WO2022219353A1 WO 2022219353 A1 WO2022219353 A1 WO 2022219353A1 GB 2022050953 W GB2022050953 W GB 2022050953W WO 2022219353 A1 WO2022219353 A1 WO 2022219353A1
Authority
WO
WIPO (PCT)
Prior art keywords
fan1
mlh1
inhibitor
composition
vector
Prior art date
Application number
PCT/GB2022/050953
Other languages
English (en)
Inventor
Sarah Tabrizi
Gabriel BALMUS
Robert GOOLD
Original Assignee
Cambridge Enterprise Limited
Ucl Business Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB2105484.6A external-priority patent/GB2605845A/en
Priority claimed from GBGB2110949.1A external-priority patent/GB202110949D0/en
Application filed by Cambridge Enterprise Limited, Ucl Business Ltd filed Critical Cambridge Enterprise Limited
Publication of WO2022219353A1 publication Critical patent/WO2022219353A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/03—Peptides having up to 20 amino acids in an undefined or only partially defined sequence; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Definitions

  • This invention relates to somatic expansion inhibitors, to methods of producing the same and to therapeutic applications thereof. More specifically, the invention relates to MLH1 inhibitors and FAN1 derived nucleases for treating, preventing or delaying the onset of repeat expansion diseases.
  • Repeat expansion diseases are caused by the somatic expansion of sequence repeats, e.g. trinucleotide repeats. Faster somatic expansion rates correlate with earlier age at onset and faster and more severe disease progression.
  • sequence repeats e.g. trinucleotide repeats.
  • FXS Fragile X Syndrome
  • DM1 and DM2 myotonic dystrophy
  • FRDA Friedreich's ataxia
  • CAG repeat is a monogenic neurodegenerative condition arising due to inheritance of >36 CAG trinucleotide repeats in exon 1 of the huntingtin ( HTT) gene.
  • HTT huntingtin
  • Expansion of CAG repeats occurs in selected somatic and meiotic tissues, but the neurodegeneration is primarily due to loss of neurons in the striatum and cortex.
  • the expanded CAG repeat may be pathogenic through several mechanisms, including at the protein level through translation into a longer, more toxic polyglutamine tract; at the RNA level through RAN translation or RNA secondary structure, and at the DNA level through an effect on transcription and DNA repair activity.
  • GWAS genome-wide association studies
  • FAN1 DNA repair gene
  • MMR Fanconi anaemia pathway
  • TWAS transcriptome-wide association studies
  • FAN1 DNA repair genes including FAN1 have been shown to underlie a common genetic mechanism modulating somatic expansion in various polyglutamine diseases, and FAN1 knockout has been shown to increase the rate of somatic expansion in the CGG repeat in FXS.
  • FAN1 inhibits somatic expansion by two distinct functions: (1) by sequestering MLH1 thereby preventing MLH1 interacting with MSH3; and (2) by promoting accurate DNA repair via its nuclease activity.
  • increasing or replicating these FAN1 functions significantly inhibits somatic expansion thereby providing a new and unexpected therapeutic strategy for treating, preventing or delaying the onset of repeat expansion diseases.
  • the invention provides a composition for use in treating, preventing or delaying the onset of a repeat expansion disease in a subject, wherein the composition comprises an MLH1 inhibitor and/or a FAN1 derived nuclease.
  • the repeat expansion disease is selected from myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and frontotemporal dementia caused by somatic expansion in the C90RF72 gene, Huntington's disease, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS/FXTAS), Fragile X Syndrome, dentatorubral- pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and Unverricht-Lundborg myoclonic epilepsy (EPM1).
  • the repeat expansion disease is Huntington's Disease.
  • the repeat expansion disease is selected from myo
  • the composition comprises an MLH1 inhibitor.
  • the MLH1 inhibitor is selected from a small molecule, a peptide, a cyclic peptide, an aptamer, or a peptidomimetic.
  • the MLH1 inhibitor is a cyclic peptide.
  • the MLH1 inhibitor comprises an MLHl-binding fragment of FAN1.
  • the MLH1 inhibitor is a peptide comprising the amino acid sequence SPYF (SEQ ID NO: 3).
  • the MLH1 inhibitor comprises a peptide having at least 70% sequence identity to residues 120-140 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide having at least 70% sequence identity to residues 73-165, residues 73-190, residues 73-349, residues 1-165, residues 1-190, and/or residues 1-349 of SEQ ID NO: 2.
  • the MLH1 inhibitor binds directly to MLH1, optionally wherein the MLH1 inhibitor binds directly to the S2 site of MLH1.
  • the MLH1 inhibitor promotes MLH1 binding to FAN1.
  • the MLH1 inhibitor comprises a kinase, and wherein the kinase promotes MLH1 binding to FAN1 by phosphorylating the FAN1 SPYF motif.
  • the MLH1 inhibitor comprises a phosphatase, and wherein the phosphatase promotes MLH1 binding to FAN1 by dephosphorylating the FAN1 SPYF motif
  • the MLH1 inhibitor promotes and/or stabilises MLH1 binding to FAN1.
  • the MLH1 inhibitor comprises a kinase inhibitor.
  • the kinase inhibitor promotes and/or stabilises MLH1 binding to FAN1 by inhibiting phosphorylation of the FAN1 SPYF motif.
  • the kinase inhibitor is a cyclin-dependent kinase inhibitor.
  • the kinase inhibitor is selected from a cyclin-dependent kinase 5 inhibitor, a cyclin- dependent kinase 1 inhibitor and a cyclin-dependent kinase 2 inhibitor.
  • the kinase inhibitor is a proline directed kinase inhibitor. In one embodiment, the kinase inhibitor is a tyrosine kinase inhibitor. In one embodiment, the MLH1 inhibitor stabilises MLH1 binding to FAN1, or a fragment thereof. In one embodiment, the MLH1 inhibitor is an allosteric stabiliser of the FAN1-MLH1 interaction. In one embodiment, the MLH1 inhibitor is a direct stabiliser of the FAN1-MLH1 interaction.
  • the composition comprises a FAN1 derived nuclease.
  • the nuclease does not bind MLH1. In one embodiment, the nuclease comprises at least 70% sequence identity to residues 893-1008 of SEQ ID NO: 2. In one embodiment, the nuclease comprises at least 70% sequence identity to SEQ ID NO: 2. In one embodiment, the nuclease does not comprise an SPYF domain.
  • the invention also provides a vector for use in treating, preventing or delaying the onset of a repeat expansion disease in a subject, wherein the vector comprises a nucleic acid sequence encoding an MLH1 inhibitor and/or a nucleic acid sequence encoding a FAN1 derived nuclease.
  • the repeat expansion disease is selected from myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and frontotemporal dementia caused by somatic expansion in the C90RF72 gene, Huntington's disease, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS/FXTAS), Fragile X Syndrome, dentatorubral- pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and Unverricht-Lundborg myoclonic epilepsy (EPM1).
  • the repeat expansion disease is Huntington's Disease.
  • the repeat expansion disease is Fragile X Syndrome.
  • the vector comprises a nucleic acid sequence encoding an MLH1 inhibitor of the invention. In one embodiment, the vector comprises a nucleic acid sequence encoding a FAN1 derived nuclease of the invention. In one embodiment, the vector comprises a nucleic acid sequence encoding an MLH1 inhibitor of the invention and a nucleic acid sequence encoding a FAN1 derived nuclease of the invention.
  • the vector is selected from an adeno-associated virus (AAV) vector, a HIV-based lentivirus vector, equine immunodeficiency virus (EIV) vector, a feline immunodeficiency virus (FIV) vector, and a herpes simplex virus vector.
  • AAV adeno-associated virus
  • EIV equine immunodeficiency virus
  • FV feline immunodeficiency virus
  • the vector is an AAV vector.
  • the composition or the vector is formulated for delivery to the striatum and/or the cortex of the subject.
  • the composition or the vector comprises a targeting ligand.
  • the targeting ligand facilitates uptake of the composition and/or the vector through the blood brain barrier.
  • the targeting ligand comprises a compound that facilitates delivery to and/or uptake by neurons.
  • the invention also provides a method of treating or preventing a repeat expansion disease in a subject comprising administering to the subject the composition of the invention or the vector of the invention.
  • the invention also provides a method of identifying MLH1 inhibitors comprising: (a) culturing cells expressing MLH1 and MSH3 in the presence of an agent; (b) purifying MLH1 and proteins bound thereto; (c) determining the level of MSH3 that is bound to MLH1; and (d) comparing the level of MLHl-bound MSH3 to a control level.
  • control level is the level of MLHl-bound MSH3 in the absence of the agent and a reduced level of MLHl-bound MSH3 in the presence of the agent indicates that the agent is an MLH1 inhibitor.
  • control level is the level of MLHl-bound MSH3 in the absence of the agent and the same or higher level of MLHl-bound MSH3 in the presence of the agent indicates that the agent is not an MLH1 inhibitor.
  • A Co-immunoprecipitation (co-IP) extracts from human HD induced pluripotent stem cells (iPSCs) showing FAN1 interacts with MutLa components MLH1 and PMS2. Note MSH3 is absent from anti- FAN1 IP fraction.
  • B Co-IP extracts from human HD lymphoblasts confirming FAN1 interacts with MLH1.
  • C Pull down assays using GFP-Trap beads in U20S cells showing FAN1 interacts with MutL components (MLH1 and PMS2, PMS1 or MLH3) but not MutS components (MSH3 and MSH3; and MSH2 and MSH6) or proliferating cell nuclear antigen (PCNA).
  • PCNA proliferating cell nuclear antigen
  • FAN1 7 cells act as a negative control, demonstrating specificity of the pulldown.
  • E Schematic illustrating FAN1 constructs cloned into U20S system. Locations of UBZ-null (C44A/C47A) and nuclease-null (D960A) mutations are also outlined.
  • UBZ Ubiquitin- binding zinc- finger domain
  • SAP SAF-A/B, Acinus and PIAS domain
  • TPR tetratricopeptide repeat domain
  • VRR_NUC virus-type replication-repair nuclease domain.
  • E Schematic illustrating FAN1 constructs with mutations at conserved SPYF residues which were cloned into U20S system. Nuclease-null mutation (D960A) is also outlined.
  • UBZ Ubiquitin-binding zinc-finger domain
  • SAP SAF-A/B, Acinus and PIAS domain
  • TPR tetratricopeptide repeat domain
  • VRR_NUC virus-type replication-repair nuclease domain.
  • MMC viability curves in U20S cells expressing FAN1 SPYF mutants (mean ⁇ SD). Note viability is only reduced in FAN1 7 line (See also: Figure 5F).
  • G Input and GFP-Trap pull down fractions from U20S cell extracts expressing FAN1 SPYF mutants with quantification (H) showing reduced MLHl-binding with mutation of SPYF motif relative to WT construct.
  • FIG. 5 Identified crosslinks between FAN1, MLH1, PMS2, FANCD2 and FANCI. The crosslink map was generated using xiVIEW. Lines show interprotein crosslinks and intraprotein crosslinks are shown by arrows. (Related to Figure ID, Table 1).
  • B GFP live cell imaging of U20S cells expressing the indicated FAN1-GFP fusion constructs with quantification (C, D).
  • I 6TG viability curves in U20S cells expressing FAN1 deletion constructs (mean ⁇ SD) with quantification (J).
  • Repeat length for both alleles are plotted for U20S cells of the given genotypes. Each point represents an allele, and genomic loci are labelled, including tetranucleotide (D8S321, D20S82, D9S242, MYCL1, D20S85), dinucleotide (D2S123, D5S346, D17S250, D18S64, D18S69) and stable control pentanucleotide (Penta C and Penta D; data not shown) loci. Those showing microsatellite instability (MSI) are circled. MLFI1 and MSFI3 knockout induces repeat contraction or expansion at tetranucleotide and dinucleotide loci, including D20S85, MYCL1, D20S82, D9S242 and D17S250.
  • MSI microsatellite instability
  • FAN1 s126D mutant exhibits reduced interaction with MLFI1 relative to FAN1 WT .
  • Figure 9 The SPYF and MIM box domains regulate MLH1 binding and ICL repair acitvity of FAN1.
  • (G) Expansion rate of the HTT exon 1 118 CAG repeat introduced into U20S cells complemented with the indicated FANl constructs.
  • FAN1 and MLH1 the inventors examined the interaction of these genetic modifiers, and their role in somatic expansion in the context of HD as a model repeat expansion disease.
  • the inventors also made the surprising discovery that the nuclease domain of FAN1 contributes to its protective effects.
  • FAN1 N-terminal deletion constructs lacking the SPYF motif fail to stabilise the CAG repeat (i.e. prevent somatic expansion); FANl 1 120 accelerates repeat expansion to the same rate as FANl 7 , whereas longer constructs containing the SPYF motif, including FAN1 1 165 , FANl 73 165 , FANl 73 190 , FANl 1 190 , FANl 73 349 , or FANl 1 349 , slow the expansion rate significantly. Consistent with this, deleting residues 120-140 (FAN1 M20 140 ) from the FANl 1 349 construct reduces stabilisation activity. SPYF mutations reduce FAN1-MLH1 binding and accelerate repeat expansion.
  • FAN1-MLH1 binding and CAG stabilisation activity correlate closely, indicating they are mechanistically linked.
  • the homology between the FANl SPYF and MSH3 MIP-box support the inventors' hypothesis that FANl competes with MSH3 for MLH1 binding.
  • a MIP-box is found in several MLH1 interaction partners, including MSH3, EXOl and NTG2, and it has been shown to interact with the C-terminal S2 site of MLH1, a region comprising several conserved residues.
  • the crosslinking results presented herein show that interactions between the FAN1 SPYF motif and MLFI1 are clustered at the unstructured central domain of MLFI1 and include crosslinks consistent with an interaction near the S2 site.
  • FAN1 binding would therefore sterically inhibit MLFU's interaction with MSFI3 and modulate MutS (MSFI2 and MSFI3) driven MMR activity.
  • the close association between FAN1, MLFI1 and PMS2 demonstrates that FAN1 interacts functionally with the MutLa (MLFI1 and PMS2) complex.
  • MLFI1 or MSFI3 knockout prevents CAG repeat expansion, showing the absolute requirement of MutS -driven MMR for CAG repeat expansion.
  • FAN1 competes with MSFI3 for MLFI1 binding, thereby preventing MMR-driven somatic expansion.
  • MLFI1 7 U20S cells are resistant to 6TG and show instability at an EMAST locus in the genome indicating these cells have dysregulated MMR.
  • cells overexpressing FAN1 with an active SPYF domain showed significantly increased resistance to 6TG, as compared to FAN1 7 cells. These cells did not show alterations at EMAST loci which likely reflects the partial inhibition of MMR activity and the relatively short time course of the assay.
  • FAN1 constructs lacking an active SPYF motif did not protect against 6TG toxicity, showing that MLFIl-binding underlies FANl's regulation of MMR activity.
  • FAN1 may be modulating both MutSa (MSFI2 and MSFI6) and MutS -driven MMR activity.
  • the inventors have demonstrated that FAN1 sequesters MLFI1 and prevents interaction with MSFI3.
  • MSFI2 and MSFI6 in anti-FANl IP fractions confirms earlier reports that these proteins do not directly interact and suggests that a similar mechanism may operate to regulate MutSa-MLFIl interactions.
  • MMR interactions with the FA- pathway and FAN1 itself have been reported previously but direct inhibition of MMR, mediated by MLFI1 sequestration, has not. It is evident from experiments in mouse models that FAN1 and MLFI1 interact genetically and play a crucial role in regulating somatic expansion, likely by modulating MMR activity.
  • FAN1 A role of FAN1 in protecting against somatic instability has previously been shown to function independently of its nuclease activity. Flowever, the inventors have made the surprising discovery that the FAN1 nuclease domain does contribute to FAN1 repeat stabilisation activity.
  • p.D960A nuclease inactivation has previously been shown not to affect repeat instability, however the inventors believe that overexpression of FAN1 mutants in U20S cells might have masked the subtle contribution of the nuclease domain by sequestering most available MLH1 and shutting down error-prone MMR. In the absence of this dominant activity, for example following SPYF mutation, the stabilisation activity of the nuclease domain can be observed. In this scenario, FANl's nuclease activity could operate downstream of MSH3-mediated recruitment of MLH1, regulating the repair process to reduce errant CAG incorporation, possibly by acting directly on the DNA. This proposal is supported by data showing FAN1 binds directly to CAG repeat DNA.
  • Somatic expansion is the process by which short tandem repeats within a repetitive region of DNA are expanded thereby increasing the length of the repeat regions. Regions of DNA that are susceptible to somatic expansion are said to be somatically unstable. The rate of somatic expansion is tissue-specific and can also vary significantly between individuals.
  • Somatic expansion plays a crucial role in the pathogenesis of repeat expansion diseases because the length of repeat regions is the main determinant of age of disease onset as well as the rate and severity of disease progression.
  • Therapeutically targeting somatic expansion provides the most promising method for not only treating repeat expansion diseases, but also delaying the onset of or preventing disease onset and progression.
  • DNA repair is the major driving force of somatic expansion.
  • MMR driven somatic expansion is thought to require the MutS heterodimer (MSH3-MSH2) which recognises large loops in slipped DNA and recruits MutLa (MLH1-PMS2) which incises the DNA through its endonuclease activity. Thereafter, repair is conducted by a DNA polymerase and ligase 1 (LIG1), and additional repeat units are incorporated.
  • MMR MutS heterodimer
  • MH1-PMS2 MutLa
  • LIG1 DNA polymerase and ligase 1
  • MLH1 is an important part of the MMR MutL endonuclease complex. Reduced expression of MLH1 has been associated with later onset of HD, and studies in mice have shown that MLH1 is required for somatic instability. MLH1 heterodimerizes with PMS2, PMS1 or MLH3 to form the MutLa, MutL or MutLy mismatch repair endonuclease complexes, respectively.
  • Human wild type MLH1 is represented by SEQ ID NO: 1:
  • MSH3 has been identified as a key driver of pathogenesis of various repeat expansion diseases, including HD, DM1, and FXS. MSH3 identifies mispaired bases or DNA loop-outs and initiates MMR. Decreased expression of MSH3 in the cortex has been associated with later onset of HD, while increased expression has been associated with increased somatic expansion and earlier disease onset. MSH3 knockout in HD mice prevents somatic expansion.
  • the rate of somatic expansion can be measured using methods known in the art and described herein.
  • the rate of repeat expansion involves measuring the length of the repeat region over time.
  • FAN1 is an endonuclease and 5' -3' exonuclease which excises aberrant interstrand crosslinks (ICL) that impair transcription and ensures the recovery of stalled replication forks.
  • Human wild type FAN1 is represented by SEQ ID NO: 2:
  • FAN1 has been identified as the most significant genetic modifier of somatic expansion: increased FAN1 expression has been associated with delayed disease onset; and reduced FAN1 expression has been associated with increased rates of somatic expansion. Despite its significance, the functions by which FAN1 inhibits somatic expansion were previously unknown. The inventors have made the surprising discovery that FAN1 inhibits somatic expansion by: (1) inhibiting MLFI1 interaction with MSFI3; and (2) promoting accurate repair via its nuclease activity.
  • 'MLFI1 inhibitor' refers to an agent that reduces, inhibits or prevents interaction between MLFI1 and MSFI3.
  • the MLFI1 inhibitor is a small molecule.
  • the MLFI1 inhibitor is a peptide.
  • the MLFI1 inhibitor is an aptamer.
  • the MLFI1 inhibitor is a peptidomimetic.
  • the MLFI1 inhibitor is a cyclic peptide.
  • MLFI1 inhibitors of the invention mimic or promote the MLFI1 sequestering activity of FAN1.
  • MLFI1 inhibitors compete with MSFI3 for interaction with MLFI1 thereby reducing or inhibiting the formation of the MM R complex and subsequent somatic expansion.
  • MLFI1 inhibitors interact directly with MLFI1.
  • MLFI1 inhibitors interact directly with the C-terminal S2 site of MLFI1.
  • the C-terminal S2 site of MLFI1 is a highly conserved binding site of MLFI1 encompassing several conserved amino acids within the C-terminal sequence of SEQ ID NO: 1.
  • the S2 site is required for MLFI1 interaction with the MLFIl-interacting peptide box (MIP-box) and is known in the art (see e.g. Dherin et al. Mol. Cell. Biol. 2009;29(3):907-918 and Gueneau et al. Nat Struct Mol Biol. 2013;20(4):461-8).
  • the MLFI1 inhibitor interacts with at least one of residues L503, S505, D567, F568, N570, M621, D624, Y625, Y626, E669 and L676 of SEQ ID NO: 1.
  • the MLFI1 inhibitor interacts with at least one of residues S505, F568, M621, D624, Y625, and E669 of SEQ ID NO: 1.
  • the MLH1 inhibitor comprises FAN1 or an MLHl-binding fragment thereof.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain.
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain (SEQ ID NO: 4).
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 120-140 of SEQ ID NO: 2. In one embodiment, the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90% or 95% sequence identity to residues 120-140 of SEQ ID NO: 2. In one embodiment, the MLFI1 inhibitor comprises a peptide comprising residues 120-140 of SEQ ID NO: 2.
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 73-165 of SEQ ID NO: 2. In one embodiment, the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 73-165 of SEQ ID NO: 2. In one embodiment, the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 70% sequence identity to residues 73-165 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 73-165 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising residues 73-165 SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 73-190 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 73-190 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 70% sequence identity to residues 73-190 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 73-190 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising residues 73-190 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 73-349 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 73-349 of SEQ ID NO: 2.
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 70% sequence identity to residues 73-349 of SEQ ID NO: 2.
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 73-349 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising residues 73-349 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 1-140 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-140 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising residues 1-140 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 1-165 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-165 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 70% sequence identity to residues 1-165 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-165 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising residues 1-165 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 1-190 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-190 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 70% sequence identity to residues 1-190 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-190 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising residues 1-190 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and having at least 70% sequence identity to residues 1-349 of SEQ ID NO: 2.
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-349 of SEQ ID NO: 2.
  • the MLFI1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 70% sequence identity to residues 1-349 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising a SPYF domain and a LASKL domain and having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to residues 1-349 of SEQ ID NO: 2. In one embodiment, the MLH1 inhibitor comprises a peptide comprising residues 1-349 of SEQ ID NO: 2.
  • the MLH1 inhibitor comprises a peptide comprising the SPYF domain of SEQ ID NO: 2 and at least 3 contiguous amino acids located at the immediate N-terminus of the SPYF domain and/or the immediate C-terminus of the SPYF domain.
  • an MLH1 inhibitor comprising a peptide comprising the SPYF domain of SEQ ID NO: 2 and at least 3 contiguous amino acids located at the immediate N-terminus of the SPYF domain comprises the following sequence: QKISPYF (SEQ ID NO: 5).
  • An MLH1 inhibitor comprising a peptide comprising the SPYF domain of SEQ ID NO: 2 and at least 3 contiguous amino acids located at the immediate C-terminus of the SPYF domain comprises the following sequence: SPYFKSN (SEQ ID NO: 6).
  • An MLH1 inhibitor comprising a peptide comprising the SPYF domain of SEQ ID NO: 2 and at least 3 contiguous amino acids located at the immediate N- terminus of the SPYF domain and the immediate C-terminus of the SPYF domain comprises the following sequence: QKISPYFKSN (SEQ ID NO: 7).
  • the MLH1 inhibitor comprises a peptide comprising the SPYF domain of SEQ ID NO: 2 and at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 contiguous amino acids located N-terminus and/or C-terminus of the SPYF domain.
  • amino acid residue numbering corresponds to the position of the amino acid(s) within the relevant sequence, when read in the N- to C- direction.
  • the MLH1 inhibitor of the invention competes with MSH3 and FAN1 for interaction with MLH1.
  • FAN1 variants that are unable to bind MLFI1 significantly inhibit somatic expansion via their nuclease activity.
  • the inventors believe that MLFI1 inhibitors that sequester MLFI1 independently of FAN1 advantageously increase the nuclease activity of FAN1.
  • the MLFI1 inhibitor comprises the chemical formula:
  • the MLFI1 inhibitor comprises the chemical formula:
  • the MLFI1 inhibitor of the invention promotes MLFI1 interaction with FAN1 thereby increasing FANl's ability to sequester MLFI1. In turn, this reduces or prevents MLFI1 interaction with MSFI3, thereby reducing or preventing formation of the MutS complex.
  • the MLFI1 inhibitor is a FAN1 activator.
  • a "FAN1 activator" is any compound or agent capable of initiating and/or promoting interaction between FAN1 and MLFI1. In one embodiment, the FAN1 activator upregulates the expression of FAN1.
  • the MLFI1 inhibitor comprises a kinase wherein the kinase phosphorylates the FAN1
  • the kinase phosphorylates the serine residue of the FAN1 SPYF motif. In one embodiment, the kinase is a serine-threonine protein kinase. In one embodiment, the kinase is a cyclin-dependent kinase. In one embodiment, the kinase is the cyclin-dependent kinase 5. In one embodiment, the kinase phosphorylates the tyrosine residue of the FAN1 SPYF motif. In one embodiment, the kinase is a tyrosine protein kinase.
  • the MLFI1 inhibitor comprises a phosphatase wherein the phosphatase dephosphorylates the FAN1 SPYF motif. In one embodiment, the phosphatase dephosphorylates the serine residue of the FAN1 SPYF motif. In one embodiment, the phosphatase is a serine-threonine phosphatase. In one embodiment, the phosphatase dephosphorylates the tyrosine residue of the FAN1 SPYF motif. In one embodiment, the phosphatase is a tyrosine phosphatase. In one embodiment, the phosphatase is a protein phosphatase 1.
  • the MLFI1 inhibitor comprises a kinase inhibitor.
  • the kinase inhibitor is a cyclin-dependent kinase inhibitor.
  • the kinase inhibitor is a cyclin-dependent kinase 5 inhibitor.
  • the kinase inhibitor is a cyclin-dependent kinase 1 inhibitor.
  • the kinase inhibitor is a cyclin-dependent kinase 2 inhibitor.
  • the kinase inhibitor is a proline directed kinase inhibitor.
  • the kinase inhibitor is a tyrosine kinase inhibitor.
  • the kinase inhibitor promotes and/or stabilises the FAN1-MLFI1 interaction.
  • the MLFI1 inhibitor of the invention stabilises the FAN1-MLFI1 interaction.
  • stabilising the FAN1-MLFI1 interaction means reducing or preventing dissociation of MLFI1 from FAN1.
  • Increased stabilisation of the FAN1-MLFI1 interaction reduces the amount of MLFI1 that is available for interaction with MSFI3.
  • Reduced interaction between MLFI1 and MSFI3 advantageously reduces or inhibits somatic expansion.
  • the MLFI1 inhibitor is an allosteric stabiliser of the FAN1-MLFI1 interaction. An allosteric stabiliser binds to either FAN1 or MLFI1 and increases the interaction affinity of the FAN1-MLFI1 interaction.
  • the MLFI1 inhibitor is a direct stabiliser of the FAN1-MLFI1 interaction.
  • a direct stabiliser binds to both FAN1 and MLFI1 to increase the interaction affinity of the interaction.
  • the direct stabiliser binds the interface between MLFI1 and FAN1.
  • the interaction affinity between MLFI1 and FAN1 can be measured using methods known in the art. For example, surface plasmon resonance analysis may be used to measure the dissociation constant (Kd).
  • the MLH1 inhibitor of the invention comprises FAN1 derived nuclease activity.
  • the invention also provides a composition for use in treating, preventing or delaying the onset of a repeat expansion disease in a subject, wherein the composition comprises one or more MLH1 inhibitors as defined above.
  • composition further comprises one or more FAN1 derived nucleases of the invention.
  • small molecules are low molecular weight compounds, typically organic compounds with a maximum molecular weight of 900 Da, allowing for rapid diffusion across cell membranes. In some embodiments, the maximum molecular weight of a small molecule is 500 Da. Methods of producing small molecules are known in the art. Libraries of small molecules can be tested for their ability to reduce, inhibit or prevent MLFI1 interaction with MSFI3 using methods described herein.
  • Cyclic peptides are polypeptide chains that form a cyclic ring structure. Cyclic peptides may by monocyclic, i.e. comprising a single ring structure, or polycyclic, i.e. comprising several ring structures. Cyclic peptides may be naturally occurring or synthetic. Advantageously, cyclic peptides are less susceptible to proteolysis than their linear counterparts. Cyclic peptides may comprise L or D amino acids, or a mix of L and D amino acids. Cyclic peptides may comprise N-methylated amino acids. Cyclic peptides may comprise b-amino acids. Cyclic peptides may be, partially or fully, a peptidomimetic or peptoid. Cyclic peptides may be lipidated and/or PEG-ylated.
  • Aptamers are generally nucleic acid molecules that bind a specific target molecule. Aptamers can be engineered in vitro, are readily produced by chemical synthesis, possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications. These characteristics make aptamers particularly useful in pharmaceutical and therapeutic utilities.
  • "aptamer” refers in general to a single or double stranded oligonucleotide or a mixture of such oligonucleotides, wherein the oligonucleotide or mixture is capable of binding specifically to a target. Other aptamers having equivalent binding characteristics can also be used, such as peptide aptamers.
  • aptamers may comprise oligonucleotides that are at least 5, at least 10 or at least 15 nucleotides in length.
  • Aptamers may comprise sequences that are up to 40, up to 60 or up to 100 or more nucleotides in length.
  • aptamers may be from 5 to 100 nucleotides, from 10 to 40 nucleotides, or from 15 to 40 nucleotides in length. Where possible, aptamers of shorter length are preferred as these will often lead to less interference by other molecules or materials.
  • Aptamers may be generated using routine methods such as the Systematic Evolution of Ligands by Exponential enrichment (SELEX) procedure. SELEX is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules.
  • the SELEX method involves the selection of nucleic acid aptamers and in particular single stranded nucleic acids capable of binding to a desired target, from a collection of oligonucleotides.
  • a collection of single-stranded nucleic acids e.g., DNA, RNA, or variants thereof
  • a target under conditions favourable for binding
  • those nucleic acids which are bound to targets in the mixture are separated from those which do not bind
  • the nucleic acid-target complexes are dissociated
  • those nucleic acids which had bound to the target are amplified to yield a collection or library which is enriched in nucleic acids having the desired binding activity, and then this series of steps is repeated as necessary to produce a library of nucleic acids (aptamers) having specific binding affinity for the relevant target.
  • Peptidomimetics are compounds which mimic a natural peptide or protein with the ability to interact with the biological target and produce the same biological effect. Peptidomimetics are designed to permit molecular interactions similar to the natural molecular, e.g. the interaction between MLH1 and FAN1. Peptidomimetics may have advantages over peptides in terms of stability and bioavailability associated with a natural peptide. Peptidomimetics can have main- or side-chain modifications of the parent peptide designed for biological function. Examples of classes of peptidomimetics include, but are not limited to, peptoids and b-peptides, as well as peptides incorporating D-amino acids.
  • 'FAN1 derived nuclease' refers to a nuclease that possesses the nuclease activity of wild type FAN1.
  • the FAN1 derived nuclease of the invention comprises the nuclease domain of FAN1.
  • the FAN1 derived nuclease lacks MLH1 binding activity.
  • the FAN1 derived nuclease comprises a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% sequence identity to residues 893-1008 of SEQ ID NO: 2.
  • the FAN1 derived nuclease comprises a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2.
  • the FAN1 derived nuclease comprises a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2 wherein the SPYF domain is mutated.
  • the FAN1 derived nuclease comprises a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2 wherein the SPYF domain has been deleted.
  • the invention also provides a composition for use in treating, preventing or delaying the onset of a repeat expansion disease in a subject, wherein the composition comprises a FAN1 derived nuclease of the invention.
  • the composition further comprises one or more MLFI1 inhibitors of the invention.
  • the invention also provides a vector for use in treating, preventing or delaying the onset of a repeat expansion disease in a subject, wherein the vector comprises a nucleic acid sequence encoding an MLFI1 inhibitor of the invention and/or a FAN1 derived nuclease of the invention.
  • the vector comprises a nucleic acid sequence encoding an MLFI1 inhibitor of the invention. In one embodiment, the vector comprises a nucleic acid sequence encoding FAN1 or an MLFIl-binding fragment thereof. In one embodiment, the vector comprises a nucleic acid sequence encoding a peptide comprising a SPYF domain.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to residues 120-140 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to residues 73-165 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to residues 73-190 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to residues 73-349 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to residues 1-140 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to residues 1-165 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to residues 1-190 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a FAN1 derived nuclease of the invention. In one embodiment, the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% sequence identity to residues 893-1008 of SEQ ID NO: 2.
  • the vector comprises a nucleic acid sequence encoding a peptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2 wherein the SPYF domain is mutated.
  • the vector comprises a nucleic acid sequence encoding an MLFI1 inhibitor of the invention and a nucleic acid sequence encoding a FAN1 derived nuclease of the invention.
  • the vector is formulated for delivery to the striatum and/or the cortex of the subject.
  • the vector comprises a targeting ligand.
  • the targeting ligand facilitates uptake of the vector through the blood brain barrier.
  • the targeting ligand comprises a compound that facilitates delivery to and/or uptake by neurons.
  • the vector comprises an artificial capsid amino acid sequence which enables the viral particle to cross the blood brain barrier.
  • the vector is able to transfect and be expressed in non-dividing cells, e.g. brain cells.
  • the vector is a viral vector.
  • Viral vectors are usually non-replicating or replication- impaired vectors, which means that the viral vector cannot replicate to any significant extent in normal cells (e.g. normal human cells), as measured by conventional means.
  • Non-replicating or replication- impaired vectors may have become so naturally (i.e. they have been isolated as such from nature) or artificially (e.g. by breeding in vitro or by genetic manipulation).
  • the viral vector is incapable of causing a significant infection in an animal subject, typically in a mammalian subject such as a human patient.
  • viral vectors examples include attenuated vaccinia virus vectors such as modified vaccinia Ankara (MVA) and NYVAC, or strains derived therefrom.
  • suitable viral vectors include poxvirus vectors, such as avipox vectors, for example attenuated fowlpox vectors or canarypox vectors (e.g. ALVAC and strains derived therefrom).
  • Alternative viral vectors useful in the present invention include adenoviral vectors (e.g. non-human adenovirus vectors), alphavirus vectors, flavivirus vectors, herpes viral vectors, influenza virus vectors and retroviral vectors.
  • the vector is selected from an adeno-associated virus (AAV) vector, a HIV-based lentivirus, equine immunodeficiency virus (EIV), feline immunodeficiency virus (FIV), and herpes simplex virus.
  • AAV adeno-associated virus
  • EIV equine immunodeficiency virus
  • FV feline immunodeficiency virus
  • herpes simplex virus In one embodiment, the vector is AAV.
  • the vector is an expression vector.
  • Expression vectors are nucleic acid molecules (linear or circular) that comprise one or more polynucleotide sequences encoding a polypeptide(s) of interest, operably linked to additional regulatory elements required for its expression.
  • expression vectors generally include promoter and terminator sequences, and optionally one or more enhancer sequences, polyadenylation signals, and the like.
  • Expression vectors may also include suitable translational regulatory elements, including ribosomal binding sites, and translation initiation and termination sequences. The transcriptional and translational regulatory elements employed in the expression vectors of the invention are functional in the host cell used for expression. Identification of MLH1 inhibitors
  • the invention provides a method of identifying agents that bind directly to MLH1.
  • MLH1 inhibitors may be identified using suitable methods known in the art.
  • the method is used to identify agents that bind directly to the S2 site of MLH1.
  • the method comprises performing immunoprecipitation to identify agents that bind directly to MLH1.
  • the method comprises performing chromatin immunoprecipitation (ChIP) to identify agents that bind directly to MLH1.
  • ChIP chromatin immunoprecipitation
  • the method comprises screening a library of peptides for MLH1 binding activity, optionally wherein peptides are also screened for MLH1 S2 site binding activity.
  • a library of cyclic peptides is screened for MLH1 binding activity.
  • the invention provides a high-throughput screening method for MLH1 binding activity.
  • MLH1 binding activity may be measured by immunoprecipitation, ChIP, or cell binding assays. Suitable immunoprecipitation assays will typically utilise anti-MLHl antibodies.
  • MLH1 binding activity may be measured by pull down assays.
  • MLH1 binding activity may also be measured using affinity chromatography and tagged MLH1, e.g.
  • Cell binding assays may include mammalian two hybrid and protein complementation assays using FAN1 and MLH1 full length or deletion constructs.
  • the invention provides a method of identifying agents that reduce, inhibit or prevent interaction between MLH1 and MSH3.
  • the method comprises: (a) culturing cells expressing MLH1 and MSH3 in the presence of an agent; (b) purifying MLH1 and proteins bound thereto; (c) determining the level of MLHl-bound MSH3; and (d) comparing the level of MLHl-bound MSH3 to a control level.
  • the control level is the level of MLHl-bound MSH3 in the absence of the agent.
  • a reduced level of MLHl-bound MSH3 in the presence of the agent indicates that the agent reduces, inhibits or prevents MLH1 interaction with MSH3 - such an agent is an MLH1 inhibitor as defined herein.
  • the same or higher level of MLHl-bound MSH3 in the presence of the agent indicates that the agent is not an MLH1 inhibitor.
  • the method of the invention may alternatively comprise purifying MSH3 and proteins bound thereto.
  • the cultured cells expressing MLH1 and MSH3 do not express wild type FAN1.
  • the cultured cells express FAN1 that is mutated to prevent MLFI1 interacting with FAN1.
  • the method further comprises determining the level of MLFIl-bound FAN1 and identifying whether the agent inhibits or promotes the FAN1-MLFI1 interaction.
  • An MLFI1 inhibitor typically reduces MSFI3-MLFI1 interaction by at least 10%, as compared to baseline interaction between MSFI3 and MLFI1.
  • the MLFI1 inhibitor reduces interaction between MSFI3 and MLFI1 by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%.
  • reduced MSFI3-MLFI1 interaction is determined by reduced formation of the MutS complex.
  • the interaction between MLFI1 and MSFI3 can be measured using methods known in the art, e.g. by IP.
  • An MLFI1 inhibitor that promotes the FAN1-MLFI1 interaction typically increases the FAN1-MLFI1 interaction by at least 10%, as compared to baseline interaction between FAN1 and MLFI1.
  • the MLFI1 inhibitor stimulates at least a 20% increase in interactions between FAN1 and MLFI1, such as at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
  • the interaction of two proteins encompasses binding of the two proteins.
  • Repeat expansion diseases are a class of genetic diseases caused by somatic expansion of short tandem repeats. Repeat expansion diseases are also known as repeat expansion disorders, trinucleotide repeat disorders, or microsatellite expansion diseases.
  • a repeat expansion disease according to the invention includes, but is not limited to myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and frontotemporal dementia caused by somatic expansion in the C90RF72 gene, Fluntington's disease, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS/FXTAS), Fragile X Syndrome, dentatorubral- pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and Unverricht-Lundborg myoclonic epilepsy (EPM1).
  • myotonic dystrophy DM1 and DM2
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of a repeat expansion disease in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of a repeat expansion disease in a subject, the method comprising administering to the subject an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of a repeat expansion disease in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of a repeat expansion disease in a subject.
  • Fluntington's disease is a monogenic neurodegenerative condition arising due to inheritance of >36 CAG trinucleotide repeats in exon 1 of the huntingtin (HTT) gene.
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of Huntington's disease in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of Huntington's disease in a subject, the method comprising administering to the subject an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of Huntington's disease in a subject.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of Huntington's disease in a subject.
  • Fragile X Syndrome is a neurodevelopmental disorder caused by repeat expansion of the CGG triplet repeat within the FMR1 (fragile X mental retardation 1) gene on the X chromosome.
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of Fragile X Syndrome in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of Fragile X Syndrome in a subject, the method comprising administering to the subject an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of Fragile X Syndrome in a subject.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of Fragile X Syndrome in a subject.
  • Several repeat expansion diseases involve the somatic expansion of CAG trinucleotides.
  • polyglutamine diseases include Huntington's disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA) and the spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17.
  • HD Huntington's disease
  • DRPLA dentatorubral-pallidoluysian atrophy
  • SBMA spinal and bulbar muscular atrophy
  • SCAs spinocerebellar ataxias
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of a polyglutamine disease in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of a polyglutamine disease in a subject, the method comprising administering to the subject an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of a polyglutamine disease in a subject.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of a polyglutamine disease in a subject.
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of dentatorubral-pallidoluysian atrophy (DRPLA) in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of DRPLA in a subject, the method comprising administering to the subject an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of DRPLA in a subject.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of DRPLA in a subject.
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of spinal and bulbar muscular atrophy (SBMA) in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of SBMA in a subject, the method comprising administering to the subject an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of SBMA in a subject.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of SBMA in a subject.
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of a spinocerebellar ataxia (SCA) selected from SCA1, SCA2, SCA3, SCA6, SCA7 and SCA17 in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of a spinocerebellar ataxia (SCA) selected from SCA1, SCA2, SCA3, SCA6, SCA7 and SCA17 in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of a spinocerebellar ataxia (SCA) selected from SCA1, SCA2, SCA3, SCA6, SCA7 and SCA17 in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of a spinocerebellar ataxia (SCA) selected from SCA1, SCA2, SCA3, SCA6, SCA7 and SCA17 in a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of myotonic dystrophy (DM1 and DM2) in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of myotonic dystrophy (DM1 and DM2) in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of myotonic dystrophy (DM1 and DM2) in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of myotonic dystrophy (DM1 and DM2) in a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of amyotrophic lateral sclerosis and/or frontotemporal dementia caused by somatic expansion in the C90RF72 gene in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of amyotrophic lateral sclerosis and/or frontotemporal dementia caused by somatic expansion in the C90RF72 gene in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of amyotrophic lateral sclerosis and/or frontotemporal dementia caused by somatic expansion in the C90RF72 gene in a subject.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of amyotrophic lateral sclerosis and/or frontotemporal dementia caused by somatic expansion in the C90RF72 gene in a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of Friedreich's ataxia (FRDA) in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of FRDA in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of FRDA in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of FRDA in a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of Fragile X Tremor Ataxia Syndrome (FXS/FXTAS) in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of Fragile X Tremor Ataxia Syndrome (FXS/FXTAS) in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of Fragile X Tremor Ataxia Syndrome (FXS/FXTAS) in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of Fragile X Tremor Ataxia Syndrome (FXS/FXTAS) in a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in treating, preventing or delaying the onset of Unverricht-Lundborg myoclonic epilepsy (EPM1) in a subject.
  • the invention also provides a method of treating, preventing or delaying the onset of EPM1 in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the treatment or prevention of or to delay the onset of EPM1 in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for treating, preventing or delaying the onset of EPM1 in a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is for use in a method of reducing or inhibiting somatic expansion in a subject.
  • the invention also provides a method of reducing or inhibiting somatic expansion in a subject, the method comprising administering to the subject an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention in the reduction, inhibition or prevention of somatic expansion in a subject.
  • the invention also provides use of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention for the manufacture of a medicament for reducing or inhibiting somatic expansion in a subject.
  • the rate of somatic expansion is reduced.
  • somatic expansion is prevented.
  • the rate of somatic expansion can be measured using methods known in the art.
  • the therapeutic use or method of the invention may comprise administering a therapeutically effective amount of an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention, either alone or in combination with other therapeutic agents, to a subject.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention may be administered before, simultaneously with, or after the administration of the one or more additional therapeutic agent(s) or treatment(s).
  • the therapeutic use or method of the invention may comprise administering a therapeutically effective amount of an MLFI1 inhibitor of the invention in combination with a different MLFI1 inhibitor of the invention to a subject.
  • the first MLFI1 inhibitor may be administered before, simultaneously with, or after the administration of the second MLFI1 inhibitor.
  • the therapeutic use or method of the invention may comprise administering a therapeutically effective amount of a FAN1 derived nuclease of the invention with a different FAN1 derived nuclease of the invention to a subject.
  • the first FAN1 derived nuclease may be administered before, simultaneously with, or after the administration of the second FAN1 derived nuclease.
  • the therapeutic use or method of the invention may comprise administering a therapeutically effective amount of an MLFI1 inhibitor of the invention in combination with a therapeutically effective amount of a FAN1 derived nuclease of the invention to a subject.
  • the MLFI1 inhibitor may be administered before, simultaneously with, or after the administration of the FAN1 derived nuclease of the invention.
  • treatment or “treating” embraces therapeutic measures. Treatment of a repeat expansion disease can be characterised by a reduced rate of somatic expansion and/or delayed onset of disease and/or disease symptoms.
  • treating may refer to inhibiting a repeat expansion disease, disorder or condition, i.e. arresting the development thereof; and/or relieving a repeat expansion disease, disorder or condition, i.e. causing regression of the disease, disorder and/or condition.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention may also be used as a preventative therapy.
  • the term “preventing” includes preventing the onset and/or the progression of a repeat expansion disease, and/or symptoms associated with a repeat expansion disease.
  • the term “preventing” includes preventing a repeat expansion disease, disorder or condition from occurring in a subject that may be predisposed to the repeat expansion disease, disorder and/or condition but has not yet been diagnosed as having the repeat expansion disease, disorder and/or condition.
  • delaying the onset of means increasing the time to onset of the repeat expansion disease or of one or more symptoms of the repeat expansion disease. For example, onset can be said to be delayed when the time to manifestation of one or more symptoms of a repeat expansion disease takes at least 5% longer than would be expected in the absence of treatment with an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention, e.g. an increase in time of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%.
  • an MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention can delay the onset, reduce the severity, or ameliorate one or more symptoms of a repeat expansion disease.
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention can prolong the life span of a subject beyond that expected in the absence of such treatment.
  • the term "subject” refers to an animal or any living organism including, but not limited to, members of the human, primate, equine, porcine, bovine, murine, rattus, canine and feline specie.
  • the subject is a mammal.
  • the subject is a human.
  • the term "patient” may be used interchangeably with “subject” and "human”.
  • the subject may have been diagnosed with a repeat expansion disease using known clinical methods.
  • the subject may be identified based on the presence of a genetic and/or biochemical marker of a repeat expansion disease.
  • the subject may be identified as being at risk of a repeat expansion disease based on the presence of genetic markers, e.g. the length of inherited repeat regions.
  • the subject may be asymptomatic.
  • a genetic marker may comprise a threshold number of repeats in a repeat region of a gene associated with the repeat expansion disease. FID is typically diagnosed by identifying the number of CAG repeats in the HTT gene. In one embodiment, the subject has >35 CAG repeats. In one embodiment, the subject has >39 CAG repeats.
  • compositions comprising an MLFI1 inhibitor, FAN1 derived nuclease and/or vector of the invention are for use as a medicament.
  • compositions comprising an MLFI1 inhibitor, FAN1 derived nuclease and/or vector of the invention are for use in treating, preventing or delaying the onset of a somatic expansion disease.
  • compositions comprising an MLFI1 inhibitor, FAN1 derived nuclease and/or vector of the invention are for use in delaying the onset of a somatic expansion disease.
  • An MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention may be formulated for delivery to the striatum and/or the cortex of the subject.
  • An MLFI1 inhibitor and/or FAN1 derived nuclease of the invention may be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake into the cell, cytoplasm and/or nucleus.
  • the targeting ligand may comprise a compound that recognises a cell, tissue or organ specific element facilitating cellular uptake and/or a compound that facilitates uptake into cells.
  • the targeting ligand may facilitate intracellular release of the agent of the invention from vesicles, e.g. endosomes or lysosomes.
  • the targeting ligand may comprise compounds that facilitate uptake of the agent of the invention into the brain through the blood brain barrier.
  • the targeting ligand may comprise compounds that facilitate uptake of the agent of the invention into the striatum and/
  • the invention provides a composition for use in treating, preventing or delaying the onset of a somatic expansion disease wherein the composition comprises a vector, MLH1 inhibitor and/or FAN1 derived nuclease of the invention.
  • the composition of the invention may be combined or administered in addition to a carrier, diluent and/or excipient. Alternatively or in addition the composition of the invention may further be combined with one or more of a salt, excipient, diluent, and/or immunoregulatory agent.
  • the carrier is a pharmaceutically-acceptable carrier.
  • pharmaceutically acceptable carriers include water, saline, and phosphate-buffered saline.
  • the composition may be in lyophilized form, in which case it may include a stabilizer, such as BSA.
  • BSA stabilizer
  • buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 6.5 and 7.5).
  • composition may be formulated as a neutral or salt form.
  • Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
  • Administration of an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention is generally by conventional routes e.g. intravenous, subcutaneous, intraperitoneal, or mucosal routes.
  • the administration may be by parenteral injection, for example, a subcutaneous, intradermal or intramuscular injection.
  • formulations comprising an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention may be particularly suited to administration intravenously, intramuscularly, intradermally, or subcutaneously.
  • Administration of small molecule MLH1 inhibitors and/or FAN1 derived nucleases of the invention may be by injection, such as intravenously, intramuscularly, intradermally, or subcutaneously, or by oral administration (small molecules with molecular weight of less than 500 Da typically exhibiting oral bioavailability).
  • an MLH1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention may be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may alternatively be prepared.
  • An MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition of the invention may be encapsulated or embedded in a delivery vehicle.
  • the delivery vehicle is a liposome, a lysosome, a microcapsule, or a nanoparticle.
  • Oral formulations may include normally employed excipients such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
  • a "therapeutically effective amount” means an amount of MLFI1 inhibitor, FAN1 derived nuclease, vector and/or composition effective in treating, preventing or delaying the onset of a repeat expansion disease and thus producing the desired therapeutic or preventative effect in a subject.
  • the dosage ranges for administration of the compounds of the present invention are those which produce the desired therapeutic effect. It will be appreciated that the dosage range required depends on the precise nature of the compound, the route of administration, the nature of the formulation, the age of the subject, the nature, extent or severity of the subject's condition, contraindications, if any, and the judgement of the attending physician. Variations in these dosage levels can be adjusted using standard empirical routines for optimisation. Similarly, the dose of a compound of the invention for use in a method of the invention can be readily determined by one of skill in the art, and is a dose that reduces the rate of somatic expansion. EXAMPLES
  • FAN1 could directly interact with MMR factors at CAG repeats to modulate expansion.
  • iPSCs induced pluripotent stem cells
  • IP Immunoprecipitation
  • the inventors used FID lymphoblastoid (LB) cells carrying more typical, shorter, disease-associated CAG lengths (Figure IB). To exclude antibody-specific artefacts, the inventors also validated this interaction in U20S cells expressing GFP-FAN1 and confirmed that MLFI1, PMS2 and MLFI3 were readily detected in GFP-trap pull-down fractions, whereas MSFI2, MSFI3 and MSFI6 were absent ( Figure 1C).
  • LB FID lymphoblastoid
  • the inventors performed crosslinking immunoprecipitation mass-spectrometry (xIP-MS) experiments using HEK293T cells, expressing Myc-tagged FAN1, and lymphoblastoid cells, expressing endogenous FAN1.
  • the inventors observed interactions between FAN1 and its known FA- complex interactors, FANCD2 and FANCI ( Figure 5A, Table 1).
  • analysis of the aggregated crosslinking data from both experiments showed multiple proximity areas between FAN1, MLH1 and PMS2 ( Figure ID, Table 1).
  • FAN1 intra- protein crosslinks K539-S646 was in the structured region of the protein (4RID) at a distance of 27 A, which is consistent with the maximal distance for the crosslinker used, while all other crosslinks involve unstructured regions with no atomic coordinates present in the Protein Data Bank (PDB).
  • PDB Protein Data Bank
  • FAN1 A73 349 a deletion construct missing most of this N-terminal region but retaining the nuclear localisation signal (NLS; p.ll- 25), the ubiquitin-binding zone (UBZ), SAP, TPR and nuclease domains, did not form a complex with MLFI1 ( Figure IF).
  • NLS nuclear localisation signal
  • UZA ubiquitin-binding zone
  • SAP SAP
  • TPR nuclease domains
  • FAN1 1 349 was present exclusively in the nucleus and formed DNA repair foci, though not as efficiently as the full-length protein as it lacks the DNA-binding SAP domain, and it provided no protection against MMC toxicity ( Figure 1H, 5B,C,E).
  • FAN1 A73 349 formed repair foci and protected against MMC genotoxicity, indicating that this protein was functional in ICL repair and is therefore unlikely to be misfolded ( Figure 1H, 5B,C,E).
  • the MLHl- binding capacity of these constructs likely reflects the protein's biological activity rather than mis- localisation or misfolding.
  • the FAN1 126 SPYF 129 domain mediates MLH1 interaction and confers CAG repeat stabilisation in conjunction with FAN1 nuclease activity
  • the N-terminal region of FANl is largely unstructured and relatively non-conserved. It does, however, contain three highly conserved regions, the first of which consists of a SPYF motif (p.126-129) similar to the MLHl-interacting peptide box (MIP-box) found in many of MLHl's interaction partners (Figure 2D). Considering the similarity to a known MLFIl-binding sequence and the data from the inventors' structure-function analysis, the inventors explored the role of 126 SPYF 129 in the FAN1-MLFI1 interaction.
  • FAN1 regulates MMR activity by competing with MSH3for MLH1 binding
  • FAN1 did not affect PMS2 levels, suggesting it does not interfere with MutLa complexing, but MSFI3 levels were reduced in FAN1 WT relative to FAN1 7 samples ( Figure 4E,F). This indicates that FAN1 competes with MSFI3 for binding to MLFI1.
  • FAN1 7 , FAN1 WT , MLH1 7 and MSH3 7 U20S cell lines were analysed for evidence of microsatellite instability (MSI) over the course of the inventors' CAG repeat expansion assays.
  • MSI microsatellite instability
  • MSH3 7 cells showed MSI at several tetranucleotide (MYCL1, D9S242, D20S82, D20S85) and dinucleotide loci (D8S321), indicating MutS deficiency, but CAG repeat remained stable ( Figure 4B,C, 6). Manipulation of FAN1 did not affect MSI in the time course of the assay ( Figure 6).
  • SPYFK SEQ ID NO: 8
  • T/SPxK/R where x is any (one) amino acid
  • a motif may be recognised and phosphorylated by e.g. CDK1, CDK2 and CDK5.
  • the tyrosine (Y) in the SPYF may be recognised and phosphorylated by tyrosine kinase.
  • E669 site of MLFI1 has previously been reported to interact with other nucleases (EXOl), and so the inventors sought to determine whether this region of MLFI1 plays a role in FAN1 binding. To test this, the inventors generated an inactivating E669A mutant of MLFI1 and discovered that disruption of this site inactivates the interaction between FAN1 and MLFI1. These data indicate that the E669 site of MLFI1 is required for the FAN1-MLFI1 interaction ( Figure 8).
  • a downstream MIM box ( 155 LASKL 159 ) may further contribute to the MLH1 binding site
  • Phosphomimetic S126D FAN1 mutant behaves similarly to the FAN1 y128A/f129A L1SSA/l1S9A mutant in terms of MLH1 binding and ICL repair activity
  • the S126D FAN1 mutant is less effective at stabilising CAG repeat DNA
  • FAN1 directly interacts with MLH1, but not with MSH3 and discovered for the first time that the N-terminal region of FAN1, in particular the 126 SPYF 129 motif, mediates this interaction.
  • the inventors also demonstrated that the N-terminal region of FAN1 protects against repeat expansion by sequestering MLFI1 and preventing formation of the MutS complex.
  • sequestration of MLFI1 inhibits repeat expansion, and that this advantageous effect can be achieved by a peptide comprising the SPFY motif present in the N-terminal region of FAN1.
  • FAN1 nuclease activity contributes to somatic stabilisation.
  • FAN1 inhibits somatic expansion by: (1) sequestering MLH1; and (2) promoting accurate repair via its nuclease activity. Therapeutically increasing or replicating these FAN1 functions significantly inhibits somatic expansion thereby providing a new and unexpected therapeutic strategy for treating, preventing, or delaying the onset of repeat expansion diseases.
  • Table 1 List of the crosslinks identified between FAN1, MLH1, PMS2, FANCD2 and FANCI. (Related to Figure ID and Figure 5A). Peptide sequences pairs involved in crosslinks are listed with the xQuest score and the position of the crosslink in the peptide and the protein.
  • U20S FAN1 7 cells were generated as previously described, featuring FRT sites introduced into the genome, enabling complementation with tetracycline-inducible FAN1 variants when co-transfected with Flp recombinase. This line was kindly gifted by Prof. John Rouse (University of Dundee, Scotland). Introducing a lentiviral HTT exon 1 construct harbouring 118 CAG repeats allows examination of the effects of different FAN1 activities/regions on repeat stability (Goold et al. Hum. Mol. Genet 2019;28:650-661). U20S cells were maintained in DMEM with GlutaMAX, supplemented with 10% FBS and pen-strep. ICL repair assays were performed as described previously (Goold et al. Hum. Mol. Genet 2019;28:650-661). For quantifying GFP-FAN1 foci, cells were imaged using a fluorescent microscope and were considered positive with >5 foci per nucleus.
  • iPSC Induced pluripotent stem cells
  • Essential 8 medium and grown on GeltrexTM basement membrane matrix.
  • Lymphoblastoid cells derived from the TRACK-HD cohort were cultured in RPMI medium supplemented with 15% fetal bovine serum (FBS), 100 U/ml penicillin and 100 pg/ml streptomycin.
  • FBS fetal bovine serum
  • ChIP analysis was performed with the EZ-Magna ChIPTM A Chromatin Immunoprecipitation Kit according to the manufacturer's instructions. Chromatin was fragmented by 15 cycles of 30 s sonication in a Bioruptor apparatus at 4°C. Immunoprecipitation was done overnight at 4°C using anti- MLH1 antibodies (BD Biosciences).
  • DNA from ChIP and input fractions was quantified by SYBR (Thermo, #A25741) qRT-PCR using primers targeting two regions proximal to the CAG repeat (pair 1 forward CCGCTCAGGTTCTGCTTTTA (SEQ ID NO: 111), reverse GCCTT CAT C AGCTTTT CC AG (SEQ ID NO: 112); pair 2 forward CC AG AGCCCCATT CATT G (SEQ ID NO: 113), reverse G CCTT CAT CAG CTTTT CC AG (SEQ ID NO: 114)), and one distal, at the 3' end of HTT (forward TGCCTTTCGAAGTTGATGCA (SEQ ID NO: 115), reverse TGCCACCACG AATTT CACAA (SEQ ID NO: 116)).
  • DNA levels were quantified relative to a genomic DNA standard. Results were expressed as percentage of the DNA levels in U20S FAN1 7 ChIP fractions.
  • Cell extracts were prepared for SDS-polyacrylamide gel electrophoresis (PAGE) as described previously (Goold et al. Nat. Commun 2011;2:281).
  • the antibodies used were a FAN1 sheep polyclonal antibody (Goold et al. Hum. Mol. Genet 2019;28:650-661); MSH3 or MLH1 monoclonal antibodies (BD Biosciences, UK); PCNA and MSH2 (Cell Signaling Technology, Danvers, MA, USA); and PMS2, GAPDH and GFP rabbit polyclonal antibodies (Santa Cruz Biotechnology, Dallas, TX, USA).
  • IP Immunoprecipitation
  • GFP-Trap beads or the FAN1 sheep polyclonal and MSFI3 or MLFI1 monoclonal antibodies and protein G magnetic beads were used to capture protein complexes. Beads were washed 3 times in IP buffer and eluted by heating in SDS sample buffer.
  • FAN1 point mutations were generated by site-directed mutagenesis using the QuickChange XL kit according to the manufacturer's instructions (Agilent, CA, USA). The presence of the DNA base changes was confirmed by sequencing of the genomic DNA isolated from reconstituted cells. Deletion constructs were synthesised by GeneArt (Thermo Fisher) and subcloned into pcDNA5.1 FRT/TO GFP FAN1 using BamHl, EcoRV and Notl restriction sites. CRISPR guide sequences encoded in pX458 vector were used to inactivate the MSH3 and MLH1 genes in U20S cells. Knockout was confirmed by Western blot, sequencing and functional assays.
  • DNA was extracted from samples by the QIAamp DNA Mini kit (Qiagen, #51306) and the HTT locus amplified by PCR (6-FAM-labelled F. primer: AAGGCCTT CG AGTCCCT CAAGT CCTT (SEQ ID NO: 117); R. primer: CGGCTGAGGCAGCAGCGGCTGT (SEQ ID NO: 118)).
  • the PCR product was denatured and analysed by capillary electrophoresis, on an Applied BioscienceTM 3730XL DNA Analyzer (Thermo). Chromatographs were aligned in GeneMapperTM v6. software (Thermo). To calculate modal CAG repeat length and instability index, GeneMapper data was exported and analysed with a custom R script, available at https://caginstability.ml with an inclusion threshold of 20% of modal peak height and manually confirmed.
  • MSI Microsatellite instability
  • DNA from ChIP samples was amplified in parallel by fluorescently labelled PCR at unstable tetranucleotide (D8S321, D20S82, D9S242, MYCL1, D20S85), dinucleotide (D2S123, D5S346, D17S250, D18S64, D18S69), mononucleotide (NR-21, NR-24, BAT-25, BAT-26, MONO-27, NR-27) and stable control pentanucleotide (Penta C and Penta D) loci. Fluorescently labelled fragments were separated by capillary electrophoresis and the repeat length of each allele determined with a custom R script, as above.
  • Lymphoblastoid cells expressing endogenous levels of FAN1, and HEK293T cells transiently overexpressing Myc-FANl, were lysed 10 min on ice using PBS, 1% NP-40, Benzonase and protease inhibitors and centrifuged 5 min at 20,000 g to remove cell debris.
  • Anti-c-Myc magnetic beads were incubated 2 h with HEK cell lysates.
  • a sheep FAN1 antibody (Goold et al. Hum. Mol. Genet 2019;28:650-661) was incubated for 1 h with LB cell lysate and protein G magnetic beads were then added to the mix and incubated for an additional 1 h. Four washing steps were performed using lysis buffer.
  • Crosslinking was done using 1 mM BS3 d0/dl2 for 30 min at 37°C. The reaction was quenched for 20 min at 37°C using ammonium bicarbonate at a final concentration of 100 mM. Prior to digestion, beads were resuspended in a buffer containing 2 M Urea, 100 mM ammonium bicarbonate, 10 mM DTT and denatured for 20 min at room temperature under agitation (1000 rpms) (Makowski et al. Mol. Cell Proteomics 2016;15:854-65).
  • Samples were then alkylated, at room temperature and in the dark, using a final concentration of 50 mM iodoacetamide for 20 min, and diluted with 50 mM ammonium bicarbonate solution to obtain a final concentration of urea below 1 M. Digestion was performed using sequencing grade trypsin overnight at 37°C. Samples were fractionated in 3 fractions using C18-SCX StageTips prepared in-house as previously described (Rappsilber et al. Nat. Protoc 2007:2;1896-1906) with the following concentrations of ammonium acetate: 200 mM, 1 M and 1.5 M. Prior to mass spectrometry analysis, samples were further processed using C18 StageTips.
  • Peptides were then separated using a linear gradient (0.3 pL/min, 35°C; 3-60% solvent B over 90 min) using a BEFI130 C18 nanocolumn (75 pm internal diameter, 400 mm length, 1.7 pm particle size, Waters Corporation).
  • the mass spectrometer was operated in data-dependent acquisition mode using a mass range of 50-2000 Th for both MS and MS/MS scans and scan times of 0.2 s and 0.3 s respectively.
  • the ten most intense precursor ions with a charge state between 3+ and 6+ were selected for fragmentation using the 'mid' collision energy ramp as described in James et al. Anal Chem 2019;91:1808-1814. Dynamic exclusion was used with a 30 second window to prevent repeated selection of peptides.
  • Raw mass spectrometry files were converted to MGF (Mascot Generic Format) using PLGS (v3.0.2) using slow deisotoping algorithm and automatic denoising for both MS and MS/MS data.
  • MGF files were further converted to mzXM L with MSConvert (Chambers et al. Nat. Biotechnol 2012;30:918-20) using 32-bit binary encryption.
  • Crosslinking identification was performed using xQuest/xProphet (Leitner et al. Nat. Protoc 2014;9:120-137). Searches were performed using a database containing the sequences of FAN1, MLFI1, PMS2, FANCD2 and FANC1 using a search tolerance of 20 ppm.
  • the amino acids involved in crosslinking reactions parameter was set to K, S, T, Y and N-terminal amino acid. Up to three missed cleavages were allowed, carbamidomethylation of cysteine was set as a fixed modification and oxidation of methionine was set as a variable modification. Results were validated using xProphet with a 5% FDR.
  • crosslinks Further validation of the crosslinks was performed by extracting the highest-ranking identification from the xProphet xml output, using a modified version of Validate XL (James et al. Anal Chem 2019;91:1808-1814), and only considering crosslinks scoring higher than 20. For these crosslinks, the presence of light and heavy crosslinked doublets in the RAW MS files was confirmed. Automated generation of tables and MGF files was done using an in-house Python script to allow crosslinking map representation using xiVIEW (Mendes et al. Mol. Syst. Biol 2019;15:e8994).
  • a phosphomimetic p.S126D mutation was introduced into the pcDNA5.1 FRT/TO GFP-FAN1 WT plasmid sequence by site directed mutagenesis.
  • the WT and S126D FAN1 plasmids were transiently transfected into FIEK293T cells and 48 h post transfection cell extracts were prepared for immunoprecipitation. Pull down with anti-GFP magnetic beads showed that the phosphomimetic p.S126D FAN1 mutant displayed reduced interaction with MLFI1 relative to the WT form. This suggests that phosphorylation of S126 in the SPYF motif of FAN1 plays a role in regulating FAN1-MLFI1 interactions.
  • a bicistronic vector encoding WT strep MLFI and WT myc FAN1 plasmid separated by a P2A sequence was prepared.
  • the p.E669A mutation was introduced into the MLFI1 sequence by site directed mutagenesis.
  • the MLFI1 E669A mutation has previously been shown to disrupt MLFI1 MIP-box interactions. Plasmids encoding the WT and E669A MLFI1 forms and myc-FANl WT were transiently transfected into FIEK293T cells and 48 h post transfection cell extracts were prepared for immunoprecipitation.
  • FIG. 8 A western blot showing results of co-IP of myc-tagged FAN1 from FIEK293T cells expressing strep-tagged MLFI1 variants and endogenous MLFI1 is shown in Figure 8. Endogenous MLFI1 and strep-tagged MLFI1 WT bind to FAN1 whereas MLFI1 E669A does not. Control experiments using untransfected cells (Con) showed the specificity of the IP procedures. This indicates the SPYF motif acts as a canonical MIP-box.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Psychology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des inhibiteurs d'expansion somatique, des méthodes de production de ceux-ci et des applications thérapeutiques de ceux-ci. Plus précisément, l'invention concerne des inhibiteurs de MLH1 et des nucléases dérivées de FAN1 servant à traiter, à prévenir ou à retarder l'apparition de maladies à expansion de triplets.
PCT/GB2022/050953 2021-04-16 2022-04-14 Inhibiteurs d'expansion somatique WO2022219353A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB2105484.6 2021-04-16
GB2105484.6A GB2605845A (en) 2021-04-16 2021-04-16 Somatic expansion inhibitors
GBGB2110949.1A GB202110949D0 (en) 2021-07-29 2021-07-29 Somatic expansion inhibitors
GB2110949.1 2021-07-29

Publications (1)

Publication Number Publication Date
WO2022219353A1 true WO2022219353A1 (fr) 2022-10-20

Family

ID=81392975

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2022/050953 WO2022219353A1 (fr) 2021-04-16 2022-04-14 Inhibiteurs d'expansion somatique

Country Status (1)

Country Link
WO (1) WO2022219353A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020117705A1 (fr) * 2018-12-03 2020-06-11 Triplet Therapeutics, Inc. Méthodes pour le traitement de troubles d'expansion de répétitions trinucléotidiques associés à une activité mlh1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020117705A1 (fr) * 2018-12-03 2020-06-11 Triplet Therapeutics, Inc. Méthodes pour le traitement de troubles d'expansion de répétitions trinucléotidiques associés à une activité mlh1

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
CHAMBERS ET AL., NOT. BIOTECHNOL, vol. 30, 2012, pages 918 - 20
DHERIN ET AL., MOL. CELL. BIOL., vol. 29, no. 3, 2009, pages 907 - 918
GOOLD ET AL., HUM. MOL. GENET, vol. 28, 2019, pages 650 - 661
GOOLD ET AL., NOT. COMMUN, vol. 2, 2011, pages 281
GOOLD ROBERT ET AL: "FAN1 controls mismatch repair complex assembly via MLH1 retention to stabilize CAG repeat expansion in Huntington's disease", CELL REPORTS, vol. 36, no. 9, 1 August 2021 (2021-08-01), US, pages 109649, XP055933745, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2021.109649 *
GOOLD ROBERT ET AL: "FAN1 modifies Huntington's disease progression by stabilizing the expanded HTT CAG repeat", HUMAN MOLECULAR GENETICS, vol. 28, no. 4, 24 October 2018 (2018-10-24), GB, pages 650 - 661, XP055934125, ISSN: 0964-6906, DOI: 10.1093/hmg/ddy375 *
GUENEAU ET AL., NAT STRUCT MOL BIOL., vol. 20, no. 4, 2013, pages 461 - 8
JAMES ET AL., ANAL CHEM, vol. 91, 2019, pages 1808 - 1814
LAHUE ROBERT S.: "SPYing on triplet repeat expansions: Insights into FAN1-MLH1 interaction and regulation", CELL REPORTS, vol. 36, no. 11, 1 September 2021 (2021-09-01), US, pages 109736, XP055934109, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2021.109736 *
LEITNER ET AL., NOT. PROTOC, vol. 9, 2014, pages 120 - 137
LOUPE JACOB M ET AL: "Promotion of somatic CAG repeat expansion by Fan1 knock-out in Huntington's disease knock-in mice is blocked by Mlh1 knock-out", HUMAN MOLECULAR GENETICS, vol. 29, no. 18, 2 September 2020 (2020-09-02), GB, pages 3044 - 3053, XP055933986, ISSN: 0964-6906, Retrieved from the Internet <URL:http://academic.oup.com/hmg/article-pdf/29/18/3044/34124868/ddaa196.pdf> DOI: 10.1093/hmg/ddaa196 *
MAKOWSKI ET AL., MOL. CELL PROTEOMICS, vol. 15, 2016, pages 854 - 65
MENDES ET AL., MOL. SYST. BIOL, vol. 15, 2019, pages e8994
PINTO RICARDO MOURO ET AL: "Mismatch Repair Genes Mlh1 and Mlh3 Modify CAG Instability in Huntington's Disease Mice: Genome-Wide and Candidate Approaches", PLOS GENETICS, vol. 9, no. 10, 31 October 2013 (2013-10-31), pages e1003930, XP055934247, DOI: 10.1371/journal.pgen.1003930 *
PINTO RICARDO MOURO ET AL: "Mismatch Repair Genes Mlh1 and Mlh3 Modify CAG Instability in Huntington's Disease Mice: Genome-Wide and Candidate Approaches", PLOS GENETICS, vol. 9, no. 10, 31 October 2013 (2013-10-31), pages e1003930, XP055934375, DOI: 10.1371/journal.pgen.1003930 *
PORRO ANTONIO ET AL: "FAN1-MLH1 interaction affects repair of DNA interstrand cross-links and slipped-CAG/CTG repeats", SCI. ADV, vol. 7, no. 31, 30 July 2021 (2021-07-30), pages 1 - 12, XP055935598, DOI: 10.1126/sciadv.abf7906 *
RAPPSILBER ET AL., NOT. PROTOC, vol. 2, 2007, pages 1896 - 1906
TABRIZI SARAH J ET AL: "Huntington disease: new insights into molecular pathogenesis and therapeutic opportunities", NATURE REVIEWS NEUROLOGY, NATURE PUBLISHING GROUP UK, LONDON, vol. 16, no. 10, 14 August 2020 (2020-08-14), pages 529 - 546, XP037252814, ISSN: 1759-4758, [retrieved on 20200814], DOI: 10.1038/S41582-020-0389-4 *
ZHAO XIAO-NAN ET AL: "FAN1 protects against repeat expansions in a Fragile X mouse model", DNA REPAIR, vol. 69, 1 September 2018 (2018-09-01), NL, pages 1 - 5, XP055934367, ISSN: 1568-7864, DOI: 10.1016/j.dnarep.2018.07.001 *

Similar Documents

Publication Publication Date Title
Mayer et al. Transcriptional profiling of HERV-K (HML-2) in amyotrophic lateral sclerosis and potential implications for expression of HML-2 proteins
Vogt‐Eisele et al. KIBRA (KIdney/BRAin protein) regulates learning and memory and stabilizes Protein kinase Mζ
WO2018009562A1 (fr) Compositions à base de crispr/cas9 et méthodes de traitement de dégénérescences de la rétine
KR102138131B1 (ko) 뇌 종양 동물 모델 및 이의 제조 방법
EP3383496B1 (fr) Oncothérapie ciblée vers le récepteur cellulaire du virus de la vallée seneca (svv)
Goold et al. FAN1 controls mismatch repair complex assembly via MLH1 retention to stabilize CAG repeat expansion in Huntington’s disease
US20230024933A1 (en) Treatment of aberrant fibroblast proliferation
US10329333B2 (en) Controlled gene expression methods
Cresto et al. The C-terminal domain of LRRK2 with the G2019S mutation is sufficient to produce neurodegeneration of dopaminergic neurons in vivo
Boudreault et al. Reovirus μ2 protein modulates host cell alternative splicing by reducing protein levels of U5 snRNP core components
WO2016152352A1 (fr) Biomarqueur spécifique du mélanome et son utilisation
US20170016004A1 (en) DDX5 AND ASSOCIATED NON-CODING RNAs AND MODULATION OF TH17 EFFECTOR FUNCTION
Tawarayama et al. Cyclin-dependent kinase inhibitor 2b mediates excitotoxicity-induced death of retinal ganglion cells
Bai et al. LONP1 targets HMGCS2 to protect mitochondrial function and attenuate chronic kidney disease
Zeballos C et al. Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteins
WO2022219353A1 (fr) Inhibiteurs d&#39;expansion somatique
GB2605845A (en) Somatic expansion inhibitors
US20220251171A1 (en) Apolipoprotein e fragments
CN108341862B (zh) 一种多肽及其应用
US20220305080A1 (en) Compositions and methods utilizing a novel human foxo3 isoform
Ye et al. HSD17B13 liquid–liquid phase separation promotes leukocyte adhesion in chronic liver inflammation
WO2023055893A1 (fr) Régulation génique
WO2024056902A2 (fr) Compositions et méthodes de traitement de maladies neurologiques
WO2022195042A1 (fr) Protéine ayant une fonction de hdgf (facteur de croissance dérivé de l&#39;hépatome) pour une utilisation dans le traitement et la prévention de maladies neurodégénératives
WO2023275376A1 (fr) Méthodes de traitement de la maladie d&#39;alzheimer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22719615

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22719615

Country of ref document: EP

Kind code of ref document: A1