WO2022216101A1 - Novel indolizine derivative, and composition for preventing or treating fibrosis, comprising same - Google Patents

Novel indolizine derivative, and composition for preventing or treating fibrosis, comprising same Download PDF

Info

Publication number
WO2022216101A1
WO2022216101A1 PCT/KR2022/005084 KR2022005084W WO2022216101A1 WO 2022216101 A1 WO2022216101 A1 WO 2022216101A1 KR 2022005084 W KR2022005084 W KR 2022005084W WO 2022216101 A1 WO2022216101 A1 WO 2022216101A1
Authority
WO
WIPO (PCT)
Prior art keywords
fibrosis
composition
loxl2
present
alkyl
Prior art date
Application number
PCT/KR2022/005084
Other languages
French (fr)
Korean (ko)
Inventor
이재면
김익연
동승명
한균희
이철호
심두희
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2022216101A1 publication Critical patent/WO2022216101A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/30—Other Organic compounds

Definitions

  • the present invention relates to a novel LoxL2 inhibitor, an indolizine derivative compound, and a pharmaceutical composition comprising the same for preventing or treating fibrosis, specifically pulmonary fibrosis or liver fibrosis.
  • Pulmonary fibrosis refers to a disease in which the alveoli are transformed into hard fibrous cells due to excessive accumulation of fibrous connective tissue in the lung tissue, which prevents air circulation and leads to respiratory difficulties. Pulmonary fibrosis can be caused by various causes such as smoking, fine dust, viral infection, and radiation exposure. lose In particular, in the case of idiopathic pulmonary fibrosis (IPF), the cause or mechanism of its occurrence is unclear, and it occurs more frequently in the elderly, resulting in a high mortality rate.
  • IPF idiopathic pulmonary fibrosis
  • Currently available drugs include Boehringer Ingelheim's nintedanib and Roche's pirfenidone, but neither of these drugs can be used for all IPF patients due to severe side effects. Available only with limited availability (Carlos et al., 2016; Li et al., 2017).
  • LoxL2 (Lysyl oxidase like 2) is a protein with oxidase activity, and several recent studies have reported that the expression of LoxL2 protein is increased at the site of pulmonary fibrosis (Aumiller et al., 2017). Subsequently, experimental results have been reported that pulmonary fibrosis can be treated or delayed by regulating the expression of LoxL2. In IPF patients, the degree of disease progression was investigated by treatment with an antibody that inhibits LoxL2. No effect was found (Espindola et al., 2019).
  • the present inventors specifically inhibit the activity of the LoxL2 (Lysyl oxidase like protein 2) protein involved in tissue fibrosis by promoting collagen cross-linking and extracellular matrix formation, thereby effectively blocking the progression of fibrosis.
  • LoxL2 LoxL2
  • the indolizine derivative represented by Formula 1 inhibits its activity through specific binding to LoxL2, reduces the production and contraction of collagen in the tissue, and significantly inhibits the inflammatory response, resulting in multifaceted antifibrosis It was found that the effect was exhibited, and the present invention was completed.
  • an object of the present invention is to provide a composition for preventing or treating fibrosis or inflammatory disease.
  • Another object of the present invention is to provide a composition for inhibiting the synthesis or accumulation of collagen.
  • the present invention provides a composition for preventing or treating fibrosis or inflammatory disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
  • R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
  • the present inventors specifically inhibit the activity of the LoxL2 (Lysyl oxidase like protein 2) protein involved in tissue fibrosis by promoting collagen cross-linking and extracellular matrix formation, thereby effectively blocking the progression of fibrosis.
  • LoxL2 LoxL2
  • the indolizine derivative represented by Formula 1 inhibits its activity through specific binding to LoxL2, reduces the production and contraction of collagen in the tissue, and significantly inhibits the inflammatory response, resulting in multifaceted antifibrosis was found to be effective.
  • alkyl refers to a straight-chain or branched saturated hydrocarbon group, and includes, for example, methyl, ethyl, propyl, isopropyl, and the like.
  • C 1 -C 3 alkyl refers to an alkyl group having an alkyl unit having 1 to 3 carbon atoms, and when C 1 -C 3 alkyl is substituted, the carbon number of the substituent is not included.
  • a 1 and A 2 are hydrogen.
  • R 2 is C 1 alkyl.
  • the compound of formula 1 wherein A 1 and A 2 are hydrogen and R 2 is C 1 alkyl(methyl) is “6-amino-5-(4-methoxybenzoyl)indolizine-7-carbonitrile”, and the present inventors have extensively As a result of searching for an inhibitor for LoxL2 using a library of candidate compounds, the compound (named “#765” in the Example) showing a remarkably excellent LoxL2 inhibitory activity was discovered.
  • Fibrosis refers to a pathological condition in which an excessive fibrous connective tissue is formed in an organ or tissue and the normal structure and function of the tissue are impaired. Fibrosis is a chronic and progressive disease in which tissues are hardened or scarred due to the excessive accumulation of the extracellular matrix (ECM), mainly composed of collagen fibers, through the complex interaction of cells, extracellular matrix, cytokines and growth factors. It develops, accompanied by an increase in the proliferation rate and a decrease in the death rate of fibroblasts. Therefore, in order to eliminate the pathogenesis of fibrosis, the proliferation of fibroblasts, the synthesis of collagen, the contraction of collagen and the formation of cross-links should be blocked.
  • ECM extracellular matrix
  • the fibrosis that can be prevented or treated with the composition of the present invention is pulmonary fibrosis, liver fibrosis, renal fibrosis, pancreatic fibrosis, mediastinum fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive mass fibrosis, renal fibrosis. It is selected from the group consisting of sexual systemic fibrosis, scleroderma, systemic sclerosis, neurofibromatosis and myocardial fibrosis.
  • the fibrosis is pulmonary fibrosis or liver fibrosis.
  • the term “inflammatory disease” refers to a disease in which an inflammatory response such as infiltration of inflammatory cytokines or inflammatory cells is excessively activated as a response to tissue damage or infection by a pathogen.
  • an inflammatory response such as infiltration of inflammatory cytokines or inflammatory cells is excessively activated as a response to tissue damage or infection by a pathogen.
  • the composition of the present invention significantly reduces the number of inflammatory sites and inflammatory cells in the tissue, thereby effectively improving the inflammatory response.
  • the composition of the present invention can be usefully used as a therapeutic composition for various inflammatory diseases not accompanied by fibrosis as well as blocking the progression of fibrosis by inhibiting the inflammatory response as a pre-stage of fibrosis.
  • the inflammatory disease that can be prevented or treated with the composition of the present invention is selected from the group consisting of pneumonia, chronic obstructive pulmonary disease, idiopathic fibroalveolitis, lung abscess, hepatitis and cirrhosis.
  • prevention refers to inhibiting the occurrence of a disease or disease in a subject who has never been diagnosed as having a disease or disease, but is likely to be afflicted with the disease or disease.
  • the term “treatment” refers to (a) inhibiting the development of a disease, disorder or condition; (b) alleviation of the disease, condition or condition; or (c) eliminating the disease, condition or symptom.
  • the composition of the present invention When the composition of the present invention is administered to a subject, it inhibits the activity of LoxL2, which is a key mediator for tumor development, proliferation, and metastasis, thereby inhibiting, eliminating, or alleviating the development and progression of malignant tumors. Therefore, the composition of the present invention may be a therapeutic composition for a tumor itself, or may be administered with other pharmacological components and applied as a therapeutic adjuvant for a tumor. Accordingly, as used herein, the term “treatment” or “therapeutic agent” includes the meaning of “therapeutic adjuvant” or “therapeutic adjuvant”.
  • administering refers to direct administration of a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body.
  • the term “therapeutically effective amount” refers to the content of the composition in which the pharmacological component in the composition is sufficient to provide a therapeutic or prophylactic effect to an individual to whom the pharmaceutical composition of the present invention is to be administered. prophylactically effective amount”.
  • the term “subject” includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons or rhesus monkeys. Specifically, the subject of the present invention is a human.
  • the term "pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, trifluoroacetic acid, citric acid, methane sulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like.
  • Salts derived from suitable bases may include alkali metals such as sodium, alkaline earth metals such as magnesium, and ammonium and the like.
  • the pharmaceutical composition of the present invention when prepared as a pharmaceutical composition, includes a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components.
  • a lubricant e.g., a talc, a kaolin, a kaolin, a kaolin, a kaolin, kaolin, kaolin, kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, a talct, a talct, a talct, a talct, a sorbitol, mannitol, mannitol
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and specifically may be administered orally, intravenously, subcutaneously or intraperitoneally.
  • a suitable dosage of the pharmaceutical composition of the present invention is variously prescribed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity of the patient. can be A preferred dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg/kg for adults.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, syrup, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.
  • the composition of the present invention inhibits the activity of LoxL2 (Lysyl oxidase like 2).
  • the term “inhibition of activity” means to cause a decrease in the activity or expression of a target protein, that is, the LoxL2 enzyme, whereby the activity or expression of LoxL2 becomes undetectable or exists at an insignificant level, as well as , LoxL2 enzyme expression level or LoxL2 enzyme expression level to such an extent that the biological function of LoxL2 as an oxidase enzyme is significantly inhibited, so that the progression of fibrosis due to collagen cross-linking and excessive formation of extracellular matrix and worsening of symptoms due to this are measurably improved It means that the intrinsic function of the enzyme in vivo is reduced.
  • it may refer to a state in which the activity or expression level is reduced by 20% or more, more specifically, a state in which the activity or expression is reduced by more than 40%, more specifically, a state in which the activity or expression level is reduced by more than 60% compared to the control.
  • the present invention provides a functional food composition for preventing or improving fibrosis or inflammatory disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
  • the term "food-acceptable salt” refers to a salt in a form that can be used in a food composition among salts in which cations and anions bind by electrostatic attraction, and specific examples thereof include the above-mentioned “pharmaceutically acceptable salts”. salts that are”.
  • the present invention provides a functional food composition for inhibiting the synthesis, contraction or accumulation of collagen comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
  • R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
  • composition of the present invention when prepared as a food composition, it may include not only the compound of the present invention as an active ingredient, but also carbohydrates, seasonings and flavoring agents that are commonly added during food production.
  • carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol, but are not limited thereto.
  • flavoring agent natural flavoring agents (taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.
  • natural flavoring agents taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the present invention provides a method for preventing or treating fibrosis or inflammatory disease, comprising administering to a subject a composition comprising the above-described compound of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a method for preventing fibrosis or inflammatory disease, comprising administering or applying a composition comprising the above-described compound of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient to a subject. or a method of improvement.
  • the present invention relates to collagen synthesis, contraction or A method of inhibiting accumulation is provided.
  • the present invention provides a novel indolizine derivative compound and a composition for preventing or treating fibrosis or inflammatory disease comprising the same as an active ingredient.
  • the indolizine derivative of the present invention remarkably inhibits the activity of LoxL2 enzyme, which is known as a key mediator for tissue fibrosis, thereby blocking the synthesis and contraction of collagen as well as the inflammatory response, which is a pre-stage of fibrosis, thereby an effective therapeutic agent for various fibrotic diseases. It can be usefully used as a composition.
  • FIG. 1A is a graph showing that #765 inhibits the enzymatic activity of LoxL2 protein in a concentration-dependent manner.
  • Figure 1b shows the results of confirming the binding of #765 and LoxL2 protein through a DART (Drug affinity responsive target stability) experiment.
  • FIG. 2 is a diagram showing that collagen contraction is inhibited in #765-treated fibroblasts.
  • FIG. 3 is a diagram showing a decrease in collagen content in #765-treated fibroblasts.
  • FIG. 4 is a diagram showing the results of confirming the degree of suppression of lung fibrosis symptoms through the administration of #765 in mice through immunohistochemical analysis.
  • FIG. 5 is an ELISA (FIG. 5A), PCR (FIG. 5B) and immune tissue confirming that the level of LoxL2 expression is increased in the lung tissue of the fibrotic animal, and the increased level of LoxL2 is decreased in the group treated with #765 (FIG. 5A), PCR (FIG. 5B) and immune tissue Analysis results using chemistry (Fig. 5c) are shown respectively.
  • FIG. 6 is a CT photograph of the process of pulmonary fibrosis induced in an animal model of pulmonary fibrosis treated with bleomycin, showing that the pulmonary fibrosis phenomenon was significantly suppressed in the group treated with #765.
  • FIG. 7 is a diagram showing the expression patterns of fibrosis and LoxL2-related genes PDGFR, VEGF and ⁇ -SMA when #765 is treated in an animal model of pulmonary fibrosis induction.
  • FIG. 8 is a diagram showing that the pulmonary fibrosis phenomenon is suppressed by treatment of #765 in mice induced by lung fibrosis through overexpression of TGF- ⁇ .
  • FIG. 9 is a diagram showing that the progression of fibrosis in the liver is significantly inhibited when #765 is treated in mice induced by liver fibrosis through intravascular injection of ConA.
  • TGF- ⁇ , TGF- ⁇ , FGF, LoxL2 and ⁇ -SMA which are fibrosis-related genes, in a mouse with induced liver fibrosis.
  • Example 2 Inhibition of enzyme activity of LoxL2 protein according to the concentration of #765
  • the purpose of this study was to determine whether the enzyme activity of LoxL2 was inhibited by #765 using a diagnostic reagent for measuring the enzyme activity of LoxL2.
  • LoxL2 protein R&D, 2639-AO
  • compound #765 was added at concentrations of 100, 10, 1 and 0.1 mM, respectively.
  • DMSO was used as the solvent, and 0.291 mg of #765 was dissolved in 100 ⁇ l of DMSO to make a 10 mM stock solution and used after dilution.
  • DMSO did not affect the enzyme activity by adding a well in which only DMSO was added to a solvent in which LoxL2 was dissolved.
  • BAPN ⁇ -aminopropionitrile
  • an organic compound well known as a pan-Lox inhibitor was used as a positive control.
  • the degree of inhibition of H 2 O 2 generated by LoxL2 was measured using Lysyl oxidase activity assay kit (ab112139, Abcam) from Abcam. As shown in FIG. 1 , it was confirmed that #765 inhibited the enzyme activity of LoxL2 in a concentration-dependent manner ( FIG. 1 ).
  • Collagen contraction experiment was performed in mouse lung fibroblasts (Fig. ) and human fibroblast-derived MRC5 cells (Fig. 2b) were used respectively.
  • #765 was divided into a treated group and a non-treated group, and 4 x 10 5 cells were seeded together with collagen. After the collagen was hardened, 1 mM, 0.1 mM and 0.01 mM of #765 was added by concentration, respectively, and 1 ng of TGF- ⁇ 1 was added thereon, followed by culturing for two days to induce collagen contraction.
  • #765 was added to the cell culture medium by concentration, and then NIH3T3 cells, mouse fibroblasts, were cultured in the medium. . 1 x 10 6 NIH3T3 cells were plated in 6-wells, and one day later, 1 ng of TGF- ⁇ 1 and 10 uM, 1 ⁇ M and 0.1 M of #765 compound were added to each well and the same concentration of BAPN as a positive control. added. After culturing fibroblasts for 6 days, the amount of collagen newly synthesized by the reaction of TGF- ⁇ 1 in each cell was measured by sircol assay. As a result of confirming using mouse fibroblast NIH3T3 and human fibroblast MRC5 cells, it was confirmed that the collagen content was reduced when #765 was treated. It was confirmed that this was not the case.
  • Example 6 Pulmonary fibrosis inhibition effect by #765 in an animal model of pulmonary fibrosis induction
  • Pulmonary fibrosis was induced by tracheal intubation with bleomycin at 0.05 U/mouse using C57BL/6 male mice.
  • a drug for intra-body injection a prescribed dose of drug was added to peanut oil and sonicated at room temperature for 30 minutes. At this time, care was taken not to lower the temperature inside the sonicator because the drug should be well dissolved when the temperature inside the ultrasonicator was room temperature or higher.
  • 100 ⁇ l of the drug was administered orally 5 times a week, divided into three groups administered 1 mg/kg, 10 mg/kg, and 30 mg/kg from the day before the administration of bleomycin.
  • BAL bronchoalveolar lavage
  • LoxL2 expression in the lung tissue was confirmed by immunohistochemistry using an anti-LoxL2 antibody (santa cruz biotechnology, inc. 1:100). As shown in FIG. 5c , the result obtained by staining LoxL2 in brown was obtained. As a result, it was confirmed that LoxL2 expression was strongly shown in mice administered with bleomycin (0 mg), and LoxL2 expression decreased as the amount of the administered drug increased in the group administered with #765. Through the above three experiments, it was found that #765 had the effect of reducing LoxL2 in a dose-dependent manner in mice.
  • Example 8 Progression of lung fibrosis by bleomycin treatment
  • Fibrosis consists of two stages: the inflammatory stage and the fibrotic stage.
  • pulmonary fibrosis is induced by bleomycin administration.
  • the mice were subjected to respiratory anesthesia once a week, and the progress of fibrosis was observed using micro CT for animals (NFR Polaris-G90, NanoFocusRay, Korea).
  • FIG. 6 in the group treated with #765, it was found that the white fibrosis area was not generated from the beginning or was at a low level.
  • compound #765 of the present invention is expected to simultaneously exert two effects of anti-inflammatory and anti-fibrosis in a model of induced pulmonary fibrosis in animals.
  • Example 9 Changes in expression of fibrosis and LoxL2-related genes by #765 treatment in lung fibrosis induction animal model
  • Primer sequences used in PCR target gene primer sequence TGF-b1 CAG CTG TAC ATT GAC TTC C CAC GTA GTA CAC GTA GGG CA PDGFR- ⁇ CAT CAT GAG GGA CTC AAA CT- GAT GGC ATT GTA GAA CTG GT a-SMA GTG ACT ACT GCC GAG CGT G ATA GGT GGT TTC GTG GAT GC FGF2 CGA CCC ACA CGT CAA ACT AC CAG CTC TTA GCA GAC ATT GGA A VEGF CAC TGG ACC CTG GCT TTA CT GGT GAT GTT GCT CTC TGA CG
  • TGF- ⁇ transgenic mice In the case of Dox (Doxycycline)-induced TGF- ⁇ transgenic (TG) mice, when Dox was treated, TGF- ⁇ was overexpressed in the club cells present in the lungs, causing fibrosis in the lung tissue. After dissolving 0.5 mg/ml of Dox in drinking water, sucrose was dissolved to 5% so that the mice could freely drink it for 4 weeks, thereby increasing the TGF- ⁇ signal in the lungs to induce pulmonary fibrosis. Lung fibrosis was induced by providing drinking water containing Dox while administering #765 orally for 1 month to the transgenic mice group that was administered the drug at the same time.
  • the lung lavage was obtained and centrifuged to separate the cells, and then the number of inflammatory cells that had migrated to the lungs was measured and classified (FIG. 8a). Lung lavage fluid and lung tissue were separated, and the amount of collagen present in each was measured through a sircol assay (FIG. 8b). To determine the increase in the inflammation site and the increase in the amount of collagen present in the lung tissue, using a slide made by cutting the paraffin-embedded lung tissue, collagen was stained through Mason's Trichrome staining. As shown in FIG. 8c , it can be seen that the nucleus is stained in purple, the cytosol is red, and the collagen is blue.
  • the fibrosis inhibitory effect of the #765 drug was shown at a dose concentration of 10 mg/kg, but in the case of TGF- ⁇ TG mice, a significant fibrosis inhibitory effect was shown even at a dose concentration of 1 mg/kg. .
  • Example 11 Verification of the fibrosis inhibitory efficacy of #765 in the liver fibrosis model
  • ConA (12.5 mg/kg) was administered intravascularly once a week for 6 weeks to induce hepatic fibrosis, and at the same time, The degree of remission of fibrosis was confirmed by daily oral administration.
  • analysis of GOT/GPT/ALP glutamic oxalacetic transaminase/glutamic pyruvate transaminase/alkaline phosphatase, which is an indicator of liver damage, was performed at week 1 (FIG. 9a) and week 6 (FIG. 9b).
  • Primer sequences used for PCR of hepatic fibrosis-related factors target gene primer sequence TGF-a TGC CCA GAT TCC CAC ACT TGG ATC AGC ACA CAG GTG aFGF CGG GGG CCA CTT CTT GAG GA ACC GGG AGG GGC AGA AAC AA LoxL2 CGATGTGGTCAAGATCCAGGT TGGCCTCTACATAGCCCACTT TGF-b1 CAG CTG TAC ATT GAC TTC C CAC GTA GTA CAC GTA GGG CA a-SMA GTG ACT ACT GCC GAG CGT G ATA GGT GGT TTC GTG GAT GC

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Pulmonology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a novel indolizine derivative compound, and a composition for preventing or treating fibrosis or inflammatory diseases, comprising same as an active ingredient. An indolizine derivative of the present invention remarkably inhibits the activity of enzyme LoxL2, which has been known as a key mediator in tissue fibrosis, to block the synthesis and contraction of collagen and an inflammatory reaction, which is a pre-step of fibrosis, and thus can be effectively used as an effective therapeutic composition for various fibrotic diseases.

Description

신규한 인돌라진 유도체 및 이를 포함하는 섬유증의 예방 또는 치료용 조성물Novel indolazine derivative and composition for preventing or treating fibrosis comprising same
본 발명은 신규한 LoxL2 억제제인 인돌리진 유도체 화합물 및 이를 포함하는 섬유증, 구체적으로는 폐섬유증 또는 간섬유증의 예방 또는 치료용 약제학적 조성물에 관한 것이다.The present invention relates to a novel LoxL2 inhibitor, an indolizine derivative compound, and a pharmaceutical composition comprising the same for preventing or treating fibrosis, specifically pulmonary fibrosis or liver fibrosis.
폐섬유증(pulmonary fibrosis)은 폐 조직에 섬유질 결합조직이 과다누적됨으로써 폐포가 딱딱한 섬유세포로 변형되어 공기의 순환이 이루어지지 못하고 호흡 곤란으로 이어지는 질환을 의미한다. 폐섬유증은 흡연, 미세먼지, 바이러스 감염, 방사선 노출 등 다양한 원인으로 발생될 수 있으며, 질환의 특성 상 증상이 발생되고 난 뒤 가역적인 회복이 힘들어 질환의 진행을 억제하거나 지연시키는 치료에 초점이 맞추어진다. 특히, 특발성폐섬유증(idiopathic pulmonary fibrosis, IPF)의 경우 그 발생 기전이나 원인이 불분명하고 고령층에서 많이 발생하여 높은 치사율을 보인다. 현재 사용 가능한 약물로는 베링거잉겔하임의 닌테다닙(nintedanib)과 로슈의 피르페니돈(pirfenidone)이 있으나 두 약물 모두 심한 부작용으로 인해 모든 IPF 환자에게 사용가능하지 않고 환자의 상태에 따라 의사의 판단 하에 제한적으로만 사용 가능하다(Carlos et al., 2016; Li et al., 2017). Pulmonary fibrosis refers to a disease in which the alveoli are transformed into hard fibrous cells due to excessive accumulation of fibrous connective tissue in the lung tissue, which prevents air circulation and leads to respiratory difficulties. Pulmonary fibrosis can be caused by various causes such as smoking, fine dust, viral infection, and radiation exposure. lose In particular, in the case of idiopathic pulmonary fibrosis (IPF), the cause or mechanism of its occurrence is unclear, and it occurs more frequently in the elderly, resulting in a high mortality rate. Currently available drugs include Boehringer Ingelheim's nintedanib and Roche's pirfenidone, but neither of these drugs can be used for all IPF patients due to severe side effects. Available only with limited availability (Carlos et al., 2016; Li et al., 2017).
한편, LoxL2(Lysyl oxidase like 2)는 산화효소 활성을 갖는 단백질로서 최근 몇몇의 연구는 폐섬유화의 발생부위에서 LoxL2 단백질의 발현이 증가함을 보고하였다(Aumiller et al., 2017). 이어서 LoxL2의 발현을 조절함으로써 폐섬유증을 치료하거나 진행을 지연시킬 수 있다는 실험결과들이 보고되고 있고 IPF 환자들을 대상으로 LoxL2를 억제하는 항체를 처리하여 질병의 진행 정도를 조사하였으나, 임상 실험에서는 유의한 효과는 나타나지 않고 있다(Espindola et al., 2019). 그러나 마찬가지로 그 발병 및 진행에 LoxL2가 중요한 매개자가 된다고 알려진 종양의 경우 항-LoxL2 항체의 투여를 통해 종양의 크기가 유의하게 줄어들고 LoxL2와 관련된 콜라겐 수준 역시 현저히 감소함을 확인하였다. 간섬유증의 경우 항-LoxL2 항체를 통해 LoxL2의 활성을 억제하자 병변 부위가 줄어들고 증상이 완화됨이 마우스와 인간에서 확인되었다(Barry-Hamilton et al., 2010). 따라서, LoxL2에 대한 효율적인 억제제는 폐섬유증을 비롯한 다양한 조직에서의 섬유증의 발생 및 진행을 유의하게 저해시킬 수 있다. On the other hand, LoxL2 (Lysyl oxidase like 2) is a protein with oxidase activity, and several recent studies have reported that the expression of LoxL2 protein is increased at the site of pulmonary fibrosis (Aumiller et al., 2017). Subsequently, experimental results have been reported that pulmonary fibrosis can be treated or delayed by regulating the expression of LoxL2. In IPF patients, the degree of disease progression was investigated by treatment with an antibody that inhibits LoxL2. No effect was found (Espindola et al., 2019). However, similarly, in the case of a tumor known to be an important mediator of LoxL2 in its onset and progression, the size of the tumor was significantly reduced through administration of an anti-LoxL2 antibody, and it was confirmed that the LoxL2-related collagen level was also significantly reduced. In the case of liver fibrosis, inhibition of LoxL2 activity through an anti-LoxL2 antibody reduced the lesion site and alleviated symptoms in mice and humans (Barry-Hamilton et al., 2010). Thus, efficient inhibitors of LoxL2 can significantly inhibit the development and progression of fibrosis in various tissues, including pulmonary fibrosis.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Numerous papers and patent documents are referenced throughout this specification and citations thereof are indicated. The disclosure contents of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.
본 발명자들은 콜라겐의 가교 결합과 세포외 기질의 형성을 촉진함으로써 조직의 섬유화에 관여하는 LoxL2 (Lysyl oxidase like protein 2) 단백질의 활성을 특이적으로 억제하고 이를 통해 섬유화의 진행을 효율적으로 차단하는 우수한 항섬유화 조성물을 개발하기 위하여 예의 연구 노력하였다. 그 결과, 상기 화학식 1로 표시되는 인돌리진(indolizine) 유도체가 LoxL2와의 특이적인 결합을 통해 이의 활성을 저해하고, 조직 내 콜라겐의 생성 및 수축을 감소시키며 염증 반응을 유의하게 억제함으로써 다각적인 항섬유화 효능을 발휘한다는 사실을 발견하여, 본 발명을 완성하게 되었다.The present inventors specifically inhibit the activity of the LoxL2 (Lysyl oxidase like protein 2) protein involved in tissue fibrosis by promoting collagen cross-linking and extracellular matrix formation, thereby effectively blocking the progression of fibrosis. In order to develop an anti-fibrotic composition, intensive research efforts were made. As a result, the indolizine derivative represented by Formula 1 inhibits its activity through specific binding to LoxL2, reduces the production and contraction of collagen in the tissue, and significantly inhibits the inflammatory response, resulting in multifaceted antifibrosis It was found that the effect was exhibited, and the present invention was completed.
따라서 본 발명의 목적은 섬유증 또는 염증성 질환의 예방 또는 치료용 조성물을 제공하는 데 있다.Accordingly, an object of the present invention is to provide a composition for preventing or treating fibrosis or inflammatory disease.
본 발명의 다른 목적은 콜라겐의 합성 또는 축적 억제용 조성물을 제공하는 데 있다.Another object of the present invention is to provide a composition for inhibiting the synthesis or accumulation of collagen.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.
본 발명의 일 양태에 따르면, 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 섬유증 또는 염증성 질환의 예방 또는 치료용 조성물을 제공한다:According to one aspect of the present invention, the present invention provides a composition for preventing or treating fibrosis or inflammatory disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
화학식 1 Formula 1
Figure PCTKR2022005084-appb-img-000001
Figure PCTKR2022005084-appb-img-000001
상기 화학식에서 R1은 NA1A2 (A1 및 A2는 각각 독립적으로 수소 또는 C1-C3 알킬이다)이고 R2는 수소 또는 C1-C3 알킬이다. In the above formula, R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
본 발명자들은 콜라겐의 가교 결합과 세포외 기질의 형성을 촉진함으로써 조직의 섬유화에 관여하는 LoxL2 (Lysyl oxidase like protein 2) 단백질의 활성을 특이적으로 억제하고 이를 통해 섬유화의 진행을 효율적으로 차단하는 우수한 항섬유화 조성물을 개발하기 위하여 예의 연구 노력하였다. 그 결과, 상기 화학식 1로 표시되는 인돌리진(indolizine) 유도체가 LoxL2와의 특이적인 결합을 통해 이의 활성을 저해하고, 조직 내 콜라겐의 생성 및 수축을 감소시키며 염증 반응을 유의하게 억제함으로써 다각적인 항섬유화 효능을 발휘한다는 사실을 발견하였다. The present inventors specifically inhibit the activity of the LoxL2 (Lysyl oxidase like protein 2) protein involved in tissue fibrosis by promoting collagen cross-linking and extracellular matrix formation, thereby effectively blocking the progression of fibrosis. In order to develop an anti-fibrotic composition, intensive research efforts were made. As a result, the indolizine derivative represented by Formula 1 inhibits its activity through specific binding to LoxL2, reduces the production and contraction of collagen in the tissue, and significantly inhibits the inflammatory response, resulting in multifaceted antifibrosis was found to be effective.
본 명세서에서 용어“알킬”은 직쇄 또는 분쇄의 포화 탄화수소기를 의미하며, 예를 들어, 메틸, 에틸, 프로필, 이소프로필 등을 포함한다. C1-C3 알킬은 탄소수 1 내지 3의 알킬 유니트를 가지는 알킬기를 의미하며, C1-C3 알킬이 치환된 경우 치환체의 탄소수는 포함되지 않은 것이다. As used herein, the term “alkyl” refers to a straight-chain or branched saturated hydrocarbon group, and includes, for example, methyl, ethyl, propyl, isopropyl, and the like. C 1 -C 3 alkyl refers to an alkyl group having an alkyl unit having 1 to 3 carbon atoms, and when C 1 -C 3 alkyl is substituted, the carbon number of the substituent is not included.
본 발명의 구체적인 구현예에 따르면, 상기 A1 및 A2는 수소이다.According to a specific embodiment of the present invention, A 1 and A 2 are hydrogen.
본 발명의 구체적인 구현예에 따르면, 상기 R2는 C1 알킬이다.According to a specific embodiment of the present invention, R 2 is C 1 alkyl.
A1 및 A2가 수소이고 R2가 C1 알킬(메틸)인 화학식 1 화합물은 “6-아미노-5-(4-메톡시벤조일)인돌리진-7-카보니트릴”로써, 본 발명자들은 방대한 후보 화합물 라이브러리를 이용하여 LoxL2에 대한 억제제를 탐색한 결과, 현저히 우수한 LoxL2 억제 활성을 보이는 상기 화합물(실시예에서는“#765”로 명명함)을 발굴하였다.The compound of formula 1 wherein A 1 and A 2 are hydrogen and R 2 is C 1 alkyl(methyl) is “6-amino-5-(4-methoxybenzoyl)indolizine-7-carbonitrile”, and the present inventors have extensively As a result of searching for an inhibitor for LoxL2 using a library of candidate compounds, the compound (named “#765” in the Example) showing a remarkably excellent LoxL2 inhibitory activity was discovered.
본 명세서에서 용어 “섬유증(fibrosis)”은 기관이나 조직 내 과도한 섬유성 연결조직이 형성되어 조직의 정상적인 구조와 기능이 손상되는 병적 상태를 의미한다. 섬유증은 콜라겐 섬유를 주성분으로 하는 세포외 기질(ECM)의 과잉 축적으로 조직이 경화되거나 반흔이 형성되는 만성적 및 진행성 질환인데, 이는 복잡한 세포, 세포외 기질, 사이토카인 및 성장 인자의 상호 작용을 통해 발달하며, 섬유아세포의 증식률 증가 및 사멸률 감소를 수반한다. 따라서, 섬유증의 병인(pathogenesis)을 제거하기 위해서는 섬유아세포의 증식, 콜라겐의 합성, 콜라겐의 수축 및 가교 형성이 차단되어야 한다. As used herein, the term “fibrosis” refers to a pathological condition in which an excessive fibrous connective tissue is formed in an organ or tissue and the normal structure and function of the tissue are impaired. Fibrosis is a chronic and progressive disease in which tissues are hardened or scarred due to the excessive accumulation of the extracellular matrix (ECM), mainly composed of collagen fibers, through the complex interaction of cells, extracellular matrix, cytokines and growth factors. It develops, accompanied by an increase in the proliferation rate and a decrease in the death rate of fibroblasts. Therefore, in order to eliminate the pathogenesis of fibrosis, the proliferation of fibroblasts, the synthesis of collagen, the contraction of collagen and the formation of cross-links should be blocked.
본 발명의 구체적인 구현예에 따르면, 본 발명의 조성물로 예방 또는 치료될 수 있는 섬유증은 폐섬유증, 간섬유증, 신장섬유증, 췌장섬유증, 종격섬유증, 골수섬유증, 후복막섬유증, 진행성 종괴성 섬유증, 신원성 전신섬유증, 피부경화증, 전신 경화증, 신경섬유종증 및 심근섬유증으로 구성된 군으로부터 선택된다.According to a specific embodiment of the present invention, the fibrosis that can be prevented or treated with the composition of the present invention is pulmonary fibrosis, liver fibrosis, renal fibrosis, pancreatic fibrosis, mediastinum fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive mass fibrosis, renal fibrosis. It is selected from the group consisting of sexual systemic fibrosis, scleroderma, systemic sclerosis, neurofibromatosis and myocardial fibrosis.
보다 구체적으로는, 상기 섬유증은 폐섬유증 또는 간섬유증이다.More specifically, the fibrosis is pulmonary fibrosis or liver fibrosis.
본 명세서에서 용어“염증성 질환(inflammatory disease)”은 조직의 손상이나 병원균의 감염에 대한 반응으로서 염증성 사이토카인이나 염증 세포의 침투와 같은 염증 반응이 과도하게 활성화되는 질환을 포괄하는 의미이다. 후술하는 실시예에서 보는 바와 같이, 본 발명의 조성물은 조직의 염증 부위 및 염증 세포의 수를 현저히 감소시켜 염증 반응을 효율적으로 개선시킴이 확인되었다. 이에, 본 발명의 조성물은 섬유화의 전단계로서의 염증 반응을 억제하여 섬유화의 진행을 차단함은 물론, 섬유화를 수반하지 않는 다양한 염증성 질환에 대한 치료 조성물로도 유용하게 이용될 수 있다. As used herein, the term “inflammatory disease” refers to a disease in which an inflammatory response such as infiltration of inflammatory cytokines or inflammatory cells is excessively activated as a response to tissue damage or infection by a pathogen. As shown in the Examples to be described later, it was confirmed that the composition of the present invention significantly reduces the number of inflammatory sites and inflammatory cells in the tissue, thereby effectively improving the inflammatory response. Accordingly, the composition of the present invention can be usefully used as a therapeutic composition for various inflammatory diseases not accompanied by fibrosis as well as blocking the progression of fibrosis by inhibiting the inflammatory response as a pre-stage of fibrosis.
본 발명의 구체적인 구현예에 따르면, 본 발명의 조성물로 예방 또는 치료될 수 있는 염증성 질환은 폐렴, 만성폐쇄성폐질환, 특발성섬유성폐포염, 폐농양, 간염 및 간경변으로 구성된 군으로부터 선택된다.According to a specific embodiment of the present invention, the inflammatory disease that can be prevented or treated with the composition of the present invention is selected from the group consisting of pneumonia, chronic obstructive pulmonary disease, idiopathic fibroalveolitis, lung abscess, hepatitis and cirrhosis.
본 명세서에서 용어“예방”은 질환 또는 질병을 보유하고 있다고 진단된 적은 없으나, 이러한 질환 또는 질병에 걸릴 가능성이 있는 대상체에서 질환 또는 질병의 발생을 억제하는 것을 의미한다. As used herein, the term “prevention” refers to inhibiting the occurrence of a disease or disease in a subject who has never been diagnosed as having a disease or disease, but is likely to be afflicted with the disease or disease.
본 명세서에서 용어“치료”는 (a) 질환, 질병 또는 증상의 발전의 억제; (b) 질환, 질병 또는 증상의 경감; 또는 (c) 질환, 질병 또는 증상을 제거하는 것을 의미한다. 본 발명의 조성물을 대상체에 투여하면 종양의 발생, 증식 및 전이에 핵심적인 매개체인 LoxL2의 활성을 억제함으로써, 악성 종양의 발생 및 진행을 억제하거나, 이를 제거하거나 또는 경감시키는 역할을 한다. 따라서 본 발명의 조성물은 그 자체로 종양의 치료 조성물이 될 수도 있고, 혹은 다른 약리성분과 함께 투여되어 종양에 대한 치료 보조제로 적용될 수도 있다. 이에, 본 명세서에서 용어“치료”또는“치료제”는“치료 보조”또는“치료 보조제”의 의미를 포함한다. As used herein, the term “treatment” refers to (a) inhibiting the development of a disease, disorder or condition; (b) alleviation of the disease, condition or condition; or (c) eliminating the disease, condition or symptom. When the composition of the present invention is administered to a subject, it inhibits the activity of LoxL2, which is a key mediator for tumor development, proliferation, and metastasis, thereby inhibiting, eliminating, or alleviating the development and progression of malignant tumors. Therefore, the composition of the present invention may be a therapeutic composition for a tumor itself, or may be administered with other pharmacological components and applied as a therapeutic adjuvant for a tumor. Accordingly, as used herein, the term “treatment” or “therapeutic agent” includes the meaning of “therapeutic adjuvant” or “therapeutic adjuvant”.
본 명세서에서 용어“투여”또는“투여하다”는 본 발명의 조성물의 치료적 유효량을 대상체에 직접적으로 투여함으로써 대상체의 체내에서 동일한 양이 형성되도록 하는 것을 말한다.As used herein, the term “administration” or “administering” refers to direct administration of a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body.
본 발명에서 용어“치료적 유효량”은 본 발명의 약제학적 조성물을 투여하고자 하는 개체에게 조성물 내의 약리성분이 치료적 또는 예방적 효과를 제공하기에 충분한 정도로 함유된 조성물의 함량을 의미하며, 이에“예방적 유효량”을 포함하는 의미이다. In the present invention, the term “therapeutically effective amount” refers to the content of the composition in which the pharmacological component in the composition is sufficient to provide a therapeutic or prophylactic effect to an individual to whom the pharmaceutical composition of the present invention is to be administered. prophylactically effective amount”.
본 명세서에서 용어“대상체”는 제한 없이 인간, 마우스, 랫트, 기니피그, 개, 고양이, 말, 소, 돼지, 원숭이, 침팬지, 비비 또는 붉은 털 원숭이를 포함한다. 구체적으로는, 본 발명의 대상체는 인간이다. As used herein, the term “subject” includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons or rhesus monkeys. Specifically, the subject of the present invention is a human.
본 명세서에서 용어 "약제학적으로 허용되는 염"은 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. 적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 트리플루로초산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 나프탈렌-2-설폰산, 벤젠설폰산 등을 들 수 있다. 적합한 염기로부터 유도된 염은 나트륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있다.As used herein, the term "pharmaceutically acceptable salt" includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. Examples of suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, trifluoroacetic acid, citric acid, methane sulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like. Salts derived from suitable bases may include alkali metals such as sodium, alkaline earth metals such as magnesium, and ammonium and the like.
본 발명의 조성물이 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다.When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산칼슘, 알기네이트, 젤라틴, 규산칼슘, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸셀룰로오스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. it's not going to be The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
본 발명의 약제학적 조성물은 경구 또는 비경구 투여할 수 있으며, 구체적으로는 경구, 정맥, 피하 또는 복강 투여될 수 있다.The pharmaceutical composition of the present invention may be administered orally or parenterally, and specifically may be administered orally, intravenously, subcutaneously or intraperitoneally.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 바람직한 투여량은 성인 기준으로 0.001-100 ㎎/kg 범위 내이다.A suitable dosage of the pharmaceutical composition of the present invention is variously prescribed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity of the patient. can be A preferred dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg/kg for adults.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. or may be prepared by incorporation into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension, syrup, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.
본 발명의 구체적인 구현예에 따르면, 본 발명의 조성물은 LoxL2 (Lysyl oxidase like 2)의 활성을 억제한다.According to a specific embodiment of the present invention, the composition of the present invention inhibits the activity of LoxL2 (Lysyl oxidase like 2).
본 명세서에서 용어“활성의 억제”는 목적 단백질, 즉 LoxL2 효소의 활성 또는 발현의 저하를 야기하는 것을 의미하며, 이에 의해 LoxL2의 활성 또는 발현이 탐지 불가능해지거나 무의미한 수준으로 존재하게 되는 경우 뿐 아니라, LoxL2의 산화 효소로서의 생물학적 기능이 유의하게 저해되어 콜라겐의 가교 결합과 세포외 기질의 과도한 형성으로 인한 섬유화의 진행 및 이로 인한 증상의 악화가 측정 가능한 수준으로 개선될 정도로 LoxL2 효소의 발현량 또는 LoxL2 효소의 생체 내 고유한 기능이 감소하는 것을 의미한다. 구체적으로는 대조군에 비하여 활성 또는 발현량이 20% 이상 감소한 상태, 보다 구체적으로는 40% 이상 감소한 상태, 더욱 구체적으로는 60% 이상 감소한 상태를 의미할 수 있다.As used herein, the term “inhibition of activity” means to cause a decrease in the activity or expression of a target protein, that is, the LoxL2 enzyme, whereby the activity or expression of LoxL2 becomes undetectable or exists at an insignificant level, as well as , LoxL2 enzyme expression level or LoxL2 enzyme expression level to such an extent that the biological function of LoxL2 as an oxidase enzyme is significantly inhibited, so that the progression of fibrosis due to collagen cross-linking and excessive formation of extracellular matrix and worsening of symptoms due to this are measurably improved It means that the intrinsic function of the enzyme in vivo is reduced. Specifically, it may refer to a state in which the activity or expression level is reduced by 20% or more, more specifically, a state in which the activity or expression is reduced by more than 40%, more specifically, a state in which the activity or expression level is reduced by more than 60% compared to the control.
본 발명의 다른 양태에 따르면, 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 섬유증 또는 염증성 질환의 예방 또는 개선용 기능성 식품 조성물을 제공한다:According to another aspect of the present invention, the present invention provides a functional food composition for preventing or improving fibrosis or inflammatory disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
화학식 1 Formula 1
Figure PCTKR2022005084-appb-img-000002
Figure PCTKR2022005084-appb-img-000002
본 발명에서 이용되는 화학식 1 화합물 및 이를 이용하여 예방 또는 개선될 수 있는 섬유증 및 염증성 질환에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.Since the compound of Formula 1 used in the present invention and fibrosis and inflammatory disease that can be prevented or improved by using the same have already been described above, description thereof will be omitted to avoid excessive overlap.
본 명세서에서 용어 "식품학적으로 허용되는 염"은 양이온과 음이온이 정전기적 인력에 의해 결합하는 염 중에서도 식품 조성물에 사용될 수 있는 형태의 염을 의미하며, 그 구체적인 예는 상술한 "약제학적으로 허용되는 염"의 예를 포함한다.As used herein, the term "food-acceptable salt" refers to a salt in a form that can be used in a food composition among salts in which cations and anions bind by electrostatic attraction, and specific examples thereof include the above-mentioned "pharmaceutically acceptable salts". salts that are".
본 발명의 또 다른 양태에 따르면, 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 콜라겐의 합성, 수축 또는 축적 억제용 기능성 식품 조성물을 제공한다:According to another aspect of the present invention, the present invention provides a functional food composition for inhibiting the synthesis, contraction or accumulation of collagen comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
화학식 1 Formula 1
Figure PCTKR2022005084-appb-img-000003
Figure PCTKR2022005084-appb-img-000003
상기 화학식에서 R1은 NA1A2(A1 및 A2는 각각 독립적으로 수소 또는 C1-C3 알킬이다)이고 R2는 수소 또는 C1-C3 알킬이다. In the above formula, R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
본 발명에서 이용되는 화학식 1 화합물에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.Since the compound of Formula 1 used in the present invention has already been described above, description thereof will be omitted to avoid excessive overlap.
본 발명의 조성물이 식품 조성물로 제조되는 경우, 유효성분으로서 본 발명의 화합물 뿐 만 아니라, 식품 제조 시에 통상적으로 첨가되는 탄수화물, 조미제 및 향미제를 포함할 수 있다. 탄수화물의 예는 포도당, 과당 등의 단당류; 말토스, 수크로스 등의 이당류 및 덱스트린, 사이클로덱스트 린 등과 같은 다당류 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜을 포함하나 이에 제한되는 것은 아니다. 향미제로서 천연 향미제[타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등]) 및 합성 향미제(사카린, 아스 파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제로 제조되는 경우에는 본 발명의 유효성분인 #765 화합물 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 두충 추출액, 대추 추출액, 감초 추출액 등을 추가로 포함시킬 수 있다.When the composition of the present invention is prepared as a food composition, it may include not only the compound of the present invention as an active ingredient, but also carbohydrates, seasonings and flavoring agents that are commonly added during food production. Examples of carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol, but are not limited thereto. As the flavoring agent, natural flavoring agents (taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink, citric acid, high fructose, sugar, glucose, acetic acid, malic acid, fruit juice, licorice root extract, jujube extract, licorice extract, etc. are added in addition to the #765 compound, which is the active ingredient of the present invention. can be included as
본 발명의 또 다른 양태에 따르면, 본 발명은 전술한 본 발명의 화합물 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 조성물을 대상체에 투여하는 단계를 포함하는 섬유증 또는 염증성 질환의 예방 또는 치료 방법을 제공한다.According to another aspect of the present invention, the present invention provides a method for preventing or treating fibrosis or inflammatory disease, comprising administering to a subject a composition comprising the above-described compound of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient. provide a way
본 발명의 또 다른 양태에 따르면, 본 발명은 전술한 본 발명의 화합물 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 조성물을 대상체에 투여 또는 적용하는 단계를 포함하는 섬유증 또는 염증성 질환의 예방 또는 개선 방법을 제공한다.According to another aspect of the present invention, the present invention provides a method for preventing fibrosis or inflammatory disease, comprising administering or applying a composition comprising the above-described compound of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient to a subject. or a method of improvement.
본 발명의 또 다른 양태에 따르면, 본 발명은 전술한 본 발명의 화합물 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 조성물을 대상체에 투여 또는 적용하는 단계를 포함하는 콜라겐의 합성, 수축 또는 축적 억제 방법을 제공한다.According to another aspect of the present invention, the present invention relates to collagen synthesis, contraction or A method of inhibiting accumulation is provided.
본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:
(a) 본 발명은 신규한 인돌리진 유도체 화합물 및 이를 유효성분으로 포함하는 섬유증 또는 염증성 질환의 예방 또는 치료용 조성물을 제공한다.(a) The present invention provides a novel indolizine derivative compound and a composition for preventing or treating fibrosis or inflammatory disease comprising the same as an active ingredient.
(b) 본 발명의 인돌리진 유도체는 조직의 섬유화에 핵심적인 매개체로 알려진 LoxL2 효소의 활성을 현저히 억제함으로써 콜라겐의 합성 및 수축은 물론 섬유화의 전단계인 염증 반응을 차단함으로써 다양한 섬유증 질환에 대한 효율적인 치료제 조성물로 유용하게 이용될 수 있다.(b) The indolizine derivative of the present invention remarkably inhibits the activity of LoxL2 enzyme, which is known as a key mediator for tissue fibrosis, thereby blocking the synthesis and contraction of collagen as well as the inflammatory response, which is a pre-stage of fibrosis, thereby an effective therapeutic agent for various fibrotic diseases. It can be usefully used as a composition.
도 1a은 #765이 농도 의존적으로 LoxL2 단백질의 효소 활성을 억제함을 보여주는 그래프이다. 도 1b는 #765와 LoxL2 단백질의 결합 여부를 DART (Drug affinity responsive target stability) 실험을 통해 확인한 결과를 보여준다. 1A is a graph showing that #765 inhibits the enzymatic activity of LoxL2 protein in a concentration-dependent manner. Figure 1b shows the results of confirming the binding of #765 and LoxL2 protein through a DART (Drug affinity responsive target stability) experiment.
도 2는 #765를 처리한 섬유세포에서 콜라겐 수축이 저해됨을 보여주는 그림이다.2 is a diagram showing that collagen contraction is inhibited in #765-treated fibroblasts.
도 3은 #765를 처리한 섬유세포에서 콜라겐 함량이 감소함을 보여주는 그림이다.3 is a diagram showing a decrease in collagen content in #765-treated fibroblasts.
도 4는 마우스에서 #765의 투여를 통해 폐섬유화 증상이 억제되는 정도를 면역조직화학 분석을 통해 확인한 결과를 보여주는 그림이다. 4 is a diagram showing the results of confirming the degree of suppression of lung fibrosis symptoms through the administration of #765 in mice through immunohistochemical analysis.
도 5는 섬유화가 진행된 동물의 폐조직에서 LoxL2의 발현 수준이 증가하며, #765를 처리한 군에서는 증가된 LoxL2의 수준이 감소하는 것을 확인한 ELISA(도 5a), PCR(도 5b) 및 면역조직화학(도 5c)을 이용한 분석 결과를 각각 나타낸다. 5 is an ELISA (FIG. 5A), PCR (FIG. 5B) and immune tissue confirming that the level of LoxL2 expression is increased in the lung tissue of the fibrotic animal, and the increased level of LoxL2 is decreased in the group treated with #765 (FIG. 5A), PCR (FIG. 5B) and immune tissue Analysis results using chemistry (Fig. 5c) are shown respectively.
도 6은 블레오마이신(bleomycin)을 처리한 폐섬유증 동물모델에서 폐섬유화가 유발되는 진행 과정을 CT로 촬영한 사진으로, #765를 처리한 군에서는 폐섬유화 현상이 유의하게 억제됨을 보여주고 있다. 6 is a CT photograph of the process of pulmonary fibrosis induced in an animal model of pulmonary fibrosis treated with bleomycin, showing that the pulmonary fibrosis phenomenon was significantly suppressed in the group treated with #765.
도 7은 폐섬유화 유발 동물모델에서 #765를 처리하였을 때 섬유화 및 LoxL2 관련 유전자인 PDGFR, VEGF 및 α-SMA의 발현 양상을 보여주는 그림이다. 7 is a diagram showing the expression patterns of fibrosis and LoxL2-related genes PDGFR, VEGF and α-SMA when #765 is treated in an animal model of pulmonary fibrosis induction.
도 8는 TGF-β의 과발현을 통해 폐섬유화가 유발된 마우스에 #765를 처리함으로써 폐섬유화 현상이 억제됨을 보여주는 그림이다. 8 is a diagram showing that the pulmonary fibrosis phenomenon is suppressed by treatment of #765 in mice induced by lung fibrosis through overexpression of TGF-β.
도 9는 ConA의 혈관주사를 통해 간섬유화가 유도한 마우스에 #765를 처리할 경우 간에서의 섬유화 진행이 유의하게 억제됨을 보여주는 그림이다. 9 is a diagram showing that the progression of fibrosis in the liver is significantly inhibited when #765 is treated in mice induced by liver fibrosis through intravascular injection of ConA.
도 10은 간섬유화가 유도된 마우스에서 섬유화 관련 유전자인 TGF-α, TGF-β, FGF, LoxL2 및 α-SMA의 mRNA 발현 수준을 확인한 결과이다. 10 is a result of confirming the mRNA expression levels of TGF-α, TGF-β, FGF, LoxL2 and α-SMA, which are fibrosis-related genes, in a mouse with induced liver fibrosis.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예Example
실시예 1: 화합물 #765의 합성Example 1: Synthesis of compound #765
1-(2-(4-메톡시페닐)-2-옥소에틸)-1H-피롤-2-카브알데하이드(전구체)의 합성Synthesis of 1-(2-(4-methoxyphenyl)-2-oxoethyl)-1H-pyrrole-2-carbaldehyde (precursor)
피롤-2-카복스알데하이드(300 mg, 3.155 mmol)를 CH3CN(10 ㎖)에 녹이고, K2CO3(654 mg, 1.5 당량) 및 2-브로모-4′-메톡시아세토페논(867.1 mg, 1.2 당량)을 넣은 뒤 상온에서 저어주었다. 24시간 동안 저어준 후, 반응 혼합액을 감압 농축하고, 에틸아세테이트(18 ㎖)로 희석한 다음 H2O(18 ㎖)로 세척하였다. 에틸아세테이트(18 ㎖)를 사용하여 수층을 다시 한 번 추출하였다. MgSO4로 유기물 층을 건조시키고, 감압 농축하였다. 얻은 잔사물을 혼합 용매(헥산 : 에틸아세테이트 : 디클로로메탄 = 30 : 1 : 2 또는 10 : 1 : 2)로 마쇄(trituration)하여 정제함으로써 목적 화합물(629.3 mg, 82%)을 수득하였다.Dissolve pyrrole-2-carboxaldehyde (300 mg, 3.155 mmol) in CH 3 CN (10 mL), K 2 CO 3 (654 mg, 1.5 equiv) and 2-bromo-4′-methoxyacetophenone ( 867.1 mg, 1.2 equivalents) was added and stirred at room temperature. After stirring for 24 hours, the reaction mixture was concentrated under reduced pressure, diluted with ethyl acetate (18 mL), and washed with H 2 O (18 mL). The aqueous layer was extracted once again using ethyl acetate (18 mL). The organic layer was dried over MgSO 4 and concentrated under reduced pressure. The obtained residue was purified by trituration with a mixed solvent (hexane : ethyl acetate : dichloromethane = 30 : 1 : 2 or 10 : 1 : 2) to obtain the target compound (629.3 mg, 82%).
Figure PCTKR2022005084-appb-img-000004
Figure PCTKR2022005084-appb-img-000004
6-아미노-5-(4-메톡시벤조일)인돌리진-7-카보니트릴(#765)의 합성Synthesis of 6-amino-5-(4-methoxybenzoyl)indolizine-7-carbonitrile (#765)
화합물 e (56 mg, 0.23 mmol)를 EtOH 2 ㎖에 녹이고, 피페리디늄 아세테이트(17 mg, 0.5 당량)와 말로노나이트릴(화합물 C; 22.8 mg, 1.5 당량)을 넣은 뒤, 120℃에서 24시간 동안 반응시켰다. 반응 종결 후 반응물을 감압농축 하여 얻은 잔사물을 실리카 겔 컬럼 크로마토그래피(헥산 : 에틸 아세테이트 : 디클로로메테인 = 10 : 1 : 2)로 정제하여 목적 화합물을 수득하였다.Compound e (56 mg, 0.23 mmol) was dissolved in 2 ml of EtOH, and piperidinium acetate (17 mg, 0.5 equiv) and malononitrile (compound C; 22.8 mg, 1.5 equiv) were added thereto, followed by 24 at 120°C. reacted for hours. After completion of the reaction, the residue obtained by concentrating the reaction product under reduced pressure was purified by silica gel column chromatography (hexane : ethyl acetate : dichloromethane = 10 : 1 : 2) to obtain the target compound.
화학식 #765 Chemical Formula #765
Figure PCTKR2022005084-appb-img-000005
Figure PCTKR2022005084-appb-img-000005
오렌지색 고형물, mp: 131.4~132.2℃ (64.3 mg, 96%); 1H NMR (400 MHz, CDCl3) δ 7.83 (s, 1H), 7.54 (d, J = 8.4 Hz, 2H), 7.01 (s, 1H), 6.89 (d, J = 8.8 Hz, 2H), 6.72 (d, J = 4.0 Hz, 1H), 6.53 (dd, J = 2.4, 3.8 Hz,1H), 5.83 (s, 2H), 3.87 (s, 3H); 13C NMR (100 MHz, CDCl3) δ 188.5, 163.5, 139.3, 131.0, 130.8, 130.1, 128.4, 122.6, 116.7, 114.5, 114.4, 113.5, 108.2, 93.8, 55.6; HRMS (ESI-QTOF) calcd for C17H13N3O 2292.1081 ([M+H]+), found 292.1076. orange solid, mp: 131.4-132.2° C. (64.3 mg, 96%); 1 H NMR (400 MHz, CDCl 3 ) δ 7.83 (s, 1H), 7.54 (d, J = 8.4 Hz, 2H), 7.01 (s, 1H), 6.89 (d, J = 8.8 Hz, 2H), 6.72 (d, J = 4.0 Hz, 1H), 6.53 (dd, J = 2.4, 3.8 Hz, 1H), 5.83 (s, 2H), 3.87 (s, 3H); 13 C NMR (100 MHz, CDCl 3 ) δ 188.5, 163.5, 139.3, 131.0, 130.8, 130.1, 128.4, 122.6, 116.7, 114.5, 114.4, 113.5, 108.2, 93.8, 55.6; HRMS (ESI-QTOF) calcd for C 17 H 13 N 3 O 2292.1081 ([M+H] + ), found 292.1076.
실시예 2: #765의 농도에 따른 LoxL2 단백질의 효소활성 억제효과Example 2: Inhibition of enzyme activity of LoxL2 protein according to the concentration of #765
LoxL2의 효소활성 측정 진단시약을 이용하여 #765에 의한 LoxL2의 효소 활성 억제 여부를 확인하고자 하였다. LoxL2 단백질(R&D, 2639-AO) 100 ng을 각 웰에 분주한 뒤, #765 화합물을 100, 10, 1 및 0.1 mM의 농도로 각각 첨가하였다. 용매는 DMSO를 사용하였고 #765 0.291 mg을 DMSO 100μl에 용해시켜 10 mM 농도의 저장액을 만들어 희석하여 사용하였다. 음성 배경(Negative background) 효과를 억제하기 위해 LoxL2를 용해시킨 용매에 DMSO만을 첨가한 웰도 추가함으로써 DMSO가 효소 활성에 영향을 미치지 않음을 확인하였다. 또한 pan-Lox 억제제로 잘 알려진 유기화합물 BAPN(β-아미노프로피오니트릴)을 양성 대조군으로 사용하였다. 효소억제실험은 lysyl oxidase 활성은 Abcam에서 나오는 Lysyl oxidase activity assay kit (ab112139, Abcam)를 사용하여 LoxL2가 생성하는 H2O2의 억제정도를 측정하였다. 도 1에서 보는 바와 같이, #765는 농도 의존적으로 LoxL2의 효소 활성을 억제함을 확인할 수 있었다(도 1).The purpose of this study was to determine whether the enzyme activity of LoxL2 was inhibited by #765 using a diagnostic reagent for measuring the enzyme activity of LoxL2. After 100 ng of LoxL2 protein (R&D, 2639-AO) was dispensed into each well, compound #765 was added at concentrations of 100, 10, 1 and 0.1 mM, respectively. DMSO was used as the solvent, and 0.291 mg of #765 was dissolved in 100 μl of DMSO to make a 10 mM stock solution and used after dilution. In order to suppress the negative background effect, it was confirmed that DMSO did not affect the enzyme activity by adding a well in which only DMSO was added to a solvent in which LoxL2 was dissolved. In addition, BAPN (β-aminopropionitrile), an organic compound well known as a pan-Lox inhibitor, was used as a positive control. In the enzyme inhibition experiment, the degree of inhibition of H 2 O 2 generated by LoxL2 was measured using Lysyl oxidase activity assay kit (ab112139, Abcam) from Abcam. As shown in FIG. 1 , it was confirmed that #765 inhibited the enzyme activity of LoxL2 in a concentration-dependent manner ( FIG. 1 ).
실시예 3: #765와 LoxL2 단백질의 결합 여부 확인 Example 3: Confirmation of binding of #765 and LoxL2 protein
본 발명의 #765가 LoxL2의 효소활성을 억제하는 작용 메커니즘을 확인하기 위하여 LoxL2 단백질과 #765의 결합여부를 DARTS (Drug affinity responsive target stability) 실험을 통하여 확인하였다. 100 ng의 LoxL2 단백질과 #765 화합물 100μM, 10μM 및 1μM을 각각 한 튜브에 넣고 저온에서(9℃) 90분 간 반응시킨 뒤, 1μg의 단백질 분해효소(protease, 5401119001, liberase TM, Sigma-aldrich, St. Louis, MO, USA)를 첨가하여 37℃에서 20분간 추가 반응시켜 #765와 결합하지 않았을 것으로 예상되는 LoxL2 단백질이 상기 효소에 의해서 절단되도록 하였다. 반응 시간이 종료된 뒤, 각 튜브에 SDS 완충액을 첨가하여 추가 반응이 일어나지 않도록 반응을 중지시키고 100℃로 5분 간 끓여주었다. 이렇게 준비된 샘플을 이용하여 웨스턴 블롯팅으로 단백질을 크기별로 분리하여 LoxL2가 잘려진 정도를 확인한 결과를 도 1b에 나타내었으며, 이를 통해 #765와 LoxL2 단백질이 직접적으로 결합하여 단백질의 활성을 억제하는 것을 확인할 수 있었다.In order to confirm the mechanism of action of #765 of the present invention to inhibit the enzymatic activity of LoxL2, the binding between LoxL2 protein and #765 was confirmed through DARTS (Drug affinity responsive target stability) experiment. 100 ng of LoxL2 protein and 100 μM, 10 μM and 1 μM of compound #765 were each put in a tube and reacted at low temperature (9° C.) for 90 minutes, followed by 1 μg of protease (protease, 5401119001, liberase TM, Sigma-aldrich, St. Louis, MO, USA) was added and further reacted at 37° C. for 20 minutes so that LoxL2 protein, which was not expected to bind #765, was cleaved by the enzyme. After the reaction time was over, SDS buffer was added to each tube to stop the reaction so that no further reaction occurred, and it was boiled at 100° C. for 5 minutes. The result of confirming the degree of LoxL2 cleavage by separating proteins by size by western blotting using the sample thus prepared is shown in FIG. could
실시예 4: #765에 의한 섬유아세포에서의 콜라겐 수축 저해 Example 4: Inhibition of Collagen Contraction in Fibroblasts by #765
섬유세포에서 분비하는 LoxL2에 의해 촉발되는 콜라겐 가교(cross-linking) 작용이 #765의 처리에 의해 억제됨으로써 콜라겐의 수축이 억제될 수 있는지를 확인하기 위하여 콜라겐 수축 실험을 마우스 폐 섬유아세포(도 2a) 및 인간 섬유아세포 유래의 MRC5 세포(도 2b)를 이용하여 각각 진행하였다. #765를 처리한 군과 처리하지 않은 군으로 나누어 4 x 105 세포를 콜라겐과 함께 분주하였다. 콜라겐이 굳은 뒤 #765를 농도별로 1 mM, 0.1 mM 및 0.01 mM을 각각 첨가하고 그 위에 TGF-β1을 1 ng 첨가하여 이틀간 배양함으로써 콜라겐 수축을 유도하였다. #765 화합물을 1 mM 첨가 시 콜라겐 수축이 95% 이상 억제됨을 확인하였으며, 양성 대조군인 BAPN의 경우 #765보다 억제 효과가 낮거나 거의 없음을 확인하였다(도 2c). Collagen contraction experiment was performed in mouse lung fibroblasts (Fig. ) and human fibroblast-derived MRC5 cells (Fig. 2b) were used respectively. #765 was divided into a treated group and a non-treated group, and 4 x 10 5 cells were seeded together with collagen. After the collagen was hardened, 1 mM, 0.1 mM and 0.01 mM of #765 was added by concentration, respectively, and 1 ng of TGF-β1 was added thereon, followed by culturing for two days to induce collagen contraction. When 1 mM of the #765 compound was added, it was confirmed that collagen contraction was inhibited by more than 95%, and in the case of BAPN, a positive control, it was confirmed that the inhibitory effect was lower or little than that of #765 ( FIG. 2c ).
실시예 5: #765에 의한 섬유아세포에서의 콜라겐 함량 감소 Example 5: Reduction of Collagen Content in Fibroblasts by #765
#765가 콜라겐 가교 형성을 억제할 뿐 아니라 섬유아세포에서 형성되는 콜라겐의 양에 영향을 끼치는지 확인하기 위해 #765를 세포 배양배지에 농도별로 첨가한 뒤 배지에서 마우스 섬유아세포인 NIH3T3 세포를 배양하였다. 1 x 106의 NIH3T3 세포를 6-웰에 플레이팅하고 하루 뒤 각 웰에 1 ng의 TGF-β1과 10 uM, 1 μM 및 0.1 M의 #765 화합물을 첨가하고 양성 대조군으로 같은 농도의 BAPN을 첨가하였다. 섬유아세포는 6일간 배양 후 각 세포 내에서 TGF-β1의 반응에 의하여 새로 합성된 콜라겐 양을 sircol 어세이로 측정하였다. 마우스 섬유아세포인 NIH3T3와 인간 섬유아세포인 MRC5 세포를 사용하여 확인한 결과 #765를 처리할 경우 콜라겐 함량이 줄어드는 것을 확인할 수 있었고, BAPN의 경우 높은 농도에서 #765보다 콜라겐 합성을 억제하지만, 낮은 농도에서는 그렇지 못하는 것을 확인하였다. To check whether #765 not only inhibits collagen crosslinking but also affects the amount of collagen formed in fibroblasts, #765 was added to the cell culture medium by concentration, and then NIH3T3 cells, mouse fibroblasts, were cultured in the medium. . 1 x 10 6 NIH3T3 cells were plated in 6-wells, and one day later, 1 ng of TGF-β1 and 10 uM, 1 μM and 0.1 M of #765 compound were added to each well and the same concentration of BAPN as a positive control. added. After culturing fibroblasts for 6 days, the amount of collagen newly synthesized by the reaction of TGF-β1 in each cell was measured by sircol assay. As a result of confirming using mouse fibroblast NIH3T3 and human fibroblast MRC5 cells, it was confirmed that the collagen content was reduced when #765 was treated. It was confirmed that this was not the case.
실시예 6. 폐섬유화 유도 동물 모델에서 #765에 의한 폐섬유화 억제 효과Example 6. Pulmonary fibrosis inhibition effect by #765 in an animal model of pulmonary fibrosis induction
C57BL/6 수컷 마우스를 이용하여 0.05 U/mouse로 블레오마이신을 기관삽관으로 투여하여 폐섬유화를 유발하였다. 체내 주입용 약물의 경우 피넛 오일에 지정된 용량의 약물을 넣어 실온에서 30분간 초음파 처리하였다. 이때 초음파 처리기 내부의 온도가 실온 혹은 그 이상이어야 약물이 잘 용해되므로 내부의 온도가 내려가지 않도록 주의하였다. 약물을 투여한 그룹의 경우 블레오마이신을 투여하기 하루 전부터 1 mg/kg, 10 mg/kg와 30 mg/kg의 농도의 약물을 투여하는 세 그룹으로 나누어 100 ㎕씩 구강으로 주 5회 투여하였다. 폐섬유화를 유발한 뒤 14일째 되는 날 각각의 마우스에서 기관지폐포 세척(bronchoalveolar lavage (BAL) washing)을 하여 염증세포의 수를 측정하고, 폐를 적출하여 폐섬유화 정도를 조직화학염색을 통해 확인하였다. 폐섬유화를 유도한 그룹의 경우 체중 손실이 많이 일어나고 BAL fluid에 모여든 염증 세포의 수가 많고 다양하였으나, #765를 투여한 그룹의 경우 체중 손실의 정도가 덜했으며 염증세포의 침윤도 적게 관찰되었다. 특히, 10 mg/kg 이상의 #765를 투여한 그룹에서는 염증의 정도가 현저히 줄어드는 효과를 보였다(도 4a 및 4b). 또한 폐섬유화가 유발된 그룹은 콜라겐이 증가한 반면 #765를 투여한 그룹은 섬유화 진행이 경미하거나 거의 없는 것으로 나타났고 염증부위도 더 적음을 확인하였다(도 4c). 이들 결과를 통해 #765 화합물이 인 비보에서도 폐섬유화를 유의하게 억제할 수 있음을 확인할 수 있었다. Pulmonary fibrosis was induced by tracheal intubation with bleomycin at 0.05 U/mouse using C57BL/6 male mice. In the case of a drug for intra-body injection, a prescribed dose of drug was added to peanut oil and sonicated at room temperature for 30 minutes. At this time, care was taken not to lower the temperature inside the sonicator because the drug should be well dissolved when the temperature inside the ultrasonicator was room temperature or higher. In the case of the drug-administered group, 100 μl of the drug was administered orally 5 times a week, divided into three groups administered 1 mg/kg, 10 mg/kg, and 30 mg/kg from the day before the administration of bleomycin. On the 14th day after inducing pulmonary fibrosis, bronchoalveolar lavage (BAL) washing was performed in each mouse to measure the number of inflammatory cells, and the lungs were excised and the degree of pulmonary fibrosis was confirmed through histochemical staining. . In the group inducing pulmonary fibrosis, weight loss occurred a lot and the number of inflammatory cells gathered in the BAL fluid was large and varied. In particular, in the group administered with #765 of 10 mg/kg or more, the degree of inflammation was significantly reduced ( FIGS. 4a and 4b ). In addition, the group induced with pulmonary fibrosis showed an increase in collagen, whereas the group administered with #765 showed mild or almost no fibrosis progression and fewer inflammatory sites (Fig. 4c). Through these results, it was confirmed that compound #765 could significantly inhibit lung fibrosis even in vivo .
실시예 7: 폐섬유화 유도 동물모델에서 #765 처리에 의한 LoxL2 수준 변화Example 7: Changes in LoxL2 Levels by Treatment of #765 in Lung Fibrosis Induction Animal Model
인간 폐섬유증에서는 증상이 심할수록 분비성 LoxL2의 수준이 증가하므로, 본 발명자들은 폐섬유화가 진행된 동물모델에서 #765의 투여가 폐조직에서 LoxL2의 수준에 영향을 끼치는지 확인하고자 하였다. 마우스 폐에서 LoxL2의 수준을 ELISA(도 5a), PCR(도 5b)을 이용하여 확인한 결과, 폐섬유화가 진행된 마우스의 경우 폐의 LoxL2 수준이 높게 나타나는 반면, #765를 투여한 그룹에서 LoxL2 수준이 증가하지 않음을 확인하였다. 폐조직은 포름알데하이드로 고정 후 파라핀에 담궈 굳힌 후 두게 0.5 um로 자른 뒤 슬라이드에 옮겼다. 조직을 올린 슬라이드는 이후 파라핀을 제거하고 항-LoxL2 항체(santa cruz biotechnology, inc. 1:100)를 사용하여 폐조직에서 LoxL2의 발현 정도를 면역조직화학법으로 확인하였다. 도 5c에서 보는 바와 같이 LoxL2가 갈색으로 염색된 결과를 얻을 수 있었다. 그 결과 블레오마이신을 투여한 마우스(0 mg)에서 LoxL2의 발현이 강하게 나타나고 있었고 #765를 투여한 그룹에서는 투여한 약물의 양이 늘어날수록 LoxL2의 발현이 줄어드는 것을 확인하였다. 위 세 가지 실험을 통해 #765가 마우스에서 LoxL2를 용량 의존적으로 감소시키는 효과를 보이는 것으로 나타났다.In human pulmonary fibrosis, since the level of secreted LoxL2 increases as the symptoms become more severe, the present inventors tried to confirm whether administration of #765 affects the level of LoxL2 in lung tissue in an animal model with advanced pulmonary fibrosis. As a result of confirming the level of LoxL2 in the mouse lung using ELISA (Fig. 5a) and PCR (Fig. 5b), in the case of mice with advanced pulmonary fibrosis, the LoxL2 level in the lung was high, whereas in the group administered with #765, the LoxL2 level was It was confirmed that there was no increase. Lung tissue was fixed with formaldehyde, immersed in paraffin to harden, and then cut into 0.5 μm thick and transferred to a slide. After removing the paraffin from the tissue-mounted slide, the level of LoxL2 expression in the lung tissue was confirmed by immunohistochemistry using an anti-LoxL2 antibody (santa cruz biotechnology, inc. 1:100). As shown in FIG. 5c , the result obtained by staining LoxL2 in brown was obtained. As a result, it was confirmed that LoxL2 expression was strongly shown in mice administered with bleomycin (0 mg), and LoxL2 expression decreased as the amount of the administered drug increased in the group administered with #765. Through the above three experiments, it was found that #765 had the effect of reducing LoxL2 in a dose-dependent manner in mice.
실시예 8: 블레오마이신 처리에 의한 폐섬유화 진행 과정Example 8: Progression of lung fibrosis by bleomycin treatment
섬유화는 염증 단계와 섬유화 단계의 두 단계로 이루어진다. 본 발명의 화합물을 투여한 마우스에서 폐섬유화가 억제되는 현상이 염증 반응의 억제에 따른 것인지 혹은 섬유화 억제와 무관하게 염증 반응은 영향을 받지 않는지 여부를 확인하기 위하여, 블레오마이신 투여로 폐섬유화가 유도된 마우스는 매주 1회 호흡 마취하여 동물용 micro CT (NFR Polaris-G90, NanoFocusRay, 대한민국)를 이용하여 섬유화진행과정을 관찰하였다. 그 결과, 도 6에서 보는 바와 같이 #765를 처리한 그룹에서는 흰색으로 보이는 섬유화 부위가 처음부터 생성되지 않거나 적게 보이는 수준임을 알 수 있었다. 따라서 블레오마이신을 통해 인위적으로 섬유화를 유도한 동물모델에 #765를 투여할 경우 초기 염증 반응을 억제하여 섬유화를 저해하는 것임을 알 수 있었다. 이에, 본 발명의 #765 화합물은 동물에서 폐섬유화를 유도한 모델에서 항염증 및 항섬유화의 두 가지 효과를 동시에 발휘할 것으로 기대한다.Fibrosis consists of two stages: the inflammatory stage and the fibrotic stage. In order to determine whether the suppression of pulmonary fibrosis in mice administered with the compound of the present invention is due to the inhibition of the inflammatory response or whether the inflammatory response is not affected regardless of the inhibition of fibrosis, pulmonary fibrosis is induced by bleomycin administration. The mice were subjected to respiratory anesthesia once a week, and the progress of fibrosis was observed using micro CT for animals (NFR Polaris-G90, NanoFocusRay, Korea). As a result, as shown in FIG. 6 , in the group treated with #765, it was found that the white fibrosis area was not generated from the beginning or was at a low level. Therefore, it was found that when #765 was administered to an animal model artificially induced by bleomycin, fibrosis was inhibited by suppressing the initial inflammatory response. Accordingly, compound #765 of the present invention is expected to simultaneously exert two effects of anti-inflammatory and anti-fibrosis in a model of induced pulmonary fibrosis in animals.
실시예 9: 폐섬유화 유도 동물모델에서 #765 처리에 의한 섬유화 및 LoxL2 관련 유전자의 발현 변화Example 9: Changes in expression of fibrosis and LoxL2-related genes by #765 treatment in lung fibrosis induction animal model
섬유화의 진행과 함께 발현이 증가하는 TGF-β1이 #765를 처리한 그룹에서 분비가 억제됨을 ELISA (R&D system, Minneapolis, MN, USA) 실험으로 확인하였고, mRNA의 발현이 감소되었음을 PCR로 재확인하였다. 또한, 다른 섬유화 관련 유전자(PDGFR, VEGF, α-SMA) 역시 블레오마이신 처리에 의해 증가하였으나, 하기 표 1의 프라이머를 이용한 PCR 수행 결과 #765를 처리한 그룹에서는 이들 유전자가 증가하지 않음을 확인하였다(도 7). 이에 본 발명의 #765가 조직 내 섬유화를 전반적, 다각적으로 억제하고 있음을 확인하였다. It was confirmed by ELISA (R&D system, Minneapolis, MN, USA) experiment that TGF-β1, whose expression increased with the progress of fibrosis, was inhibited in the #765-treated group, and that mRNA expression was reduced by PCR. . In addition, other fibrosis-related genes (PDGFR, VEGF, α-SMA) were also increased by bleomycin treatment, but as a result of PCR using the primers in Table 1 below, it was confirmed that these genes did not increase in the group treated with #765. (Fig. 7). Accordingly, it was confirmed that #765 of the present invention inhibited fibrosis in tissues in general and various ways.
PCR에 사용된 프라이머 서열Primer sequences used in PCR
타겟 유전자target gene 프라이머 서열primer sequence
TGF-b1TGF-b1 CAG CTG TAC ATT GAC TTC CCAG CTG TAC ATT GAC TTC C
CAC GTA GTA CAC GTA GGG CA CAC GTA GTA CAC GTA GGG CA
PDGFR-βPDGFR-β CAT CAT GAG GGA CTC AAA CT-CAT CAT GAG GGA CTC AAA CT-
GAT GGC ATT GTA GAA CTG GTGAT GGC ATT GTA GAA CTG GT
a-SMAa-SMA GTG ACT ACT GCC GAG CGT GGTG ACT ACT GCC GAG CGT G
ATA GGT GGT TTC GTG GAT GCATA GGT GGT TTC GTG GAT GC
FGF2FGF2 CGA CCC ACA CGT CAA ACT ACCGA CCC ACA CGT CAA ACT AC
CAG CTC TTA GCA GAC ATT GGA ACAG CTC TTA GCA GAC ATT GGA A
VEGFVEGF CAC TGG ACC CTG GCT TTA CTCAC TGG ACC CTG GCT TTA CT
GGT GAT GTT GCT CTC TGA CGGGT GAT GTT GCT CTC TGA CG
실시예 10: TGF-β 형질전환 마우스에서 #765의 섬유화억제 효능Example 10: Fibrogenesis inhibitory efficacy of #765 in TGF-β transgenic mice
Dox(Doxycycline)-유도 TGF-β 형질전환(transgenic, TG) 마우스의 경우, Dox를 처리할 경우 폐에 존재하는 club cell에서 TGF-β가 과발현하여 폐조직에서 섬유화 현상이 유발하도록 만든 마우스다. Dox 0.5 mg/ml을 식수에 용해시킨 뒤 수크로스를 5%가 되도록 녹여 4주간 마우스가 자유롭게 음용할 수 있도록 하여 폐내에 TGF-β 신호를 증가시켜 폐섬유화를 유도하였다. 동시에 약물 투여하는 형질전환 마우스군에는 #765를 1개월간 구강 투여하면서 Dox가 들어있는 식수를 제공하여 폐섬유화를 유도하였다. 폐세척액을 얻어 원심분리하여 세포들을 분리한 뒤 폐로 이동해 온 염증 세포의 수를 측정하여 구분하였다(도 8a). 폐세척액과 폐조직을 분리하여 각각에 존재하는 콜라겐의 양을 sircol 어세이를 통해 측정하였다(도 8b). 염증 부위의 증가 및 폐조직에 존재하는 콜라겐 부위의 증가 정도는 파라핀에 포매한 폐조직을 잘라만든 슬라이드를 이용하여 메이슨 트리크롬 염색을 통해 콜라겐을 염색하였다. 도 8c에서 보는 바와 같이, 핵은 보라색, 사이토졸은 붉은색, 콜라겐은 파랑색으로 염색된 것을 확인 할 수 있다. 각각의 결과, Dox만 처리한 실험군에서 섬유화가 잘 유도되어 있는 것을 확인하였고, Dox와 #765를 함께 처리한 실험군에서는 섬유화가 현저히 억제됨을 확인하였으며 염증세포의 침습 또한 현저히 감소하고 있고 콜라겐 생성도 줄어들어 있음을 확인하였다. 또한 독시사이클린으로 유도하는 TGF-b1의 분비가 #765를 처리한 그룹에서 줄어들고 있는 것도 확인하여 #765가 TGF-b1이 유발하는 섬유화를 억제할 수 있는 것을 확인하였다. 더욱이 블레오마이신으로 유도된 섬유증 모델의 경우 #765약물의 투여 농도가 10 mg/kg 에서 섬유화 억제효과가 나타났으나, TGF-β TG 마우스의 경우 투여농도 1 mg/kg 에서도 확연한 섬유화 억제 효과가 나타났다. In the case of Dox (Doxycycline)-induced TGF-β transgenic (TG) mice, when Dox was treated, TGF-β was overexpressed in the club cells present in the lungs, causing fibrosis in the lung tissue. After dissolving 0.5 mg/ml of Dox in drinking water, sucrose was dissolved to 5% so that the mice could freely drink it for 4 weeks, thereby increasing the TGF-β signal in the lungs to induce pulmonary fibrosis. Lung fibrosis was induced by providing drinking water containing Dox while administering #765 orally for 1 month to the transgenic mice group that was administered the drug at the same time. The lung lavage was obtained and centrifuged to separate the cells, and then the number of inflammatory cells that had migrated to the lungs was measured and classified (FIG. 8a). Lung lavage fluid and lung tissue were separated, and the amount of collagen present in each was measured through a sircol assay (FIG. 8b). To determine the increase in the inflammation site and the increase in the amount of collagen present in the lung tissue, using a slide made by cutting the paraffin-embedded lung tissue, collagen was stained through Mason's Trichrome staining. As shown in FIG. 8c , it can be seen that the nucleus is stained in purple, the cytosol is red, and the collagen is blue. As a result, it was confirmed that fibrosis was well induced in the experimental group treated with only Dox, and it was confirmed that fibrosis was significantly suppressed in the experimental group treated with Dox and #765. Invasion of inflammatory cells was also significantly reduced and collagen production was reduced. confirmed that there is. Also, it was confirmed that the secretion of doxycycline-induced TGF-b1 was decreased in the group treated with #765, confirming that #765 could inhibit TGF-b1 induced fibrosis. Moreover, in the case of the bleomycin-induced fibrosis model, the fibrosis inhibitory effect of the #765 drug was shown at a dose concentration of 10 mg/kg, but in the case of TGF-β TG mice, a significant fibrosis inhibitory effect was shown even at a dose concentration of 1 mg/kg. .
실시예 11: 간섬유화 모델에서의 #765의 섬유화 억제 효능 검증Example 11: Verification of the fibrosis inhibitory efficacy of #765 in the liver fibrosis model
폐섬유화 뿐만 아니라 간섬유화증 동물모델에서도 #765가 항섬유화 효과를 가지는지를 검증하기 위해 ConA (12.5 mg/kg)를 주 1회씩 6주간 혈관 주사하여 간섬유화증을 유발하고 동시에 분량의 #765를 매일 경구 투여하여 섬유화증의 완화정도를 확인 하였다. 마우스에서 conA로 간 섬유화를 유발한 뒤 1주차(도 9a)와 6주차(도 9b)에 간 손상의 지표인 GOT/GPT/ALP (glutamic oxalacetic transaminase/glutamic pyruvate transaminase/alkaline phosphatase) 분석을 수행하였다.(Cho JJ et al. GASTROENTEROLOGY 118:1169-1178(2000); Kiminori K et al. Inter. Immunol. 11(9):1419-1500(1999)) 그 결과, 10 mg/kg 및 30 mg/kg의 #765를 투여한 그룹에서 간 염증 수치가 유의하게 감소하였다. 또한 약물을 투여한 그룹이 미투여 그룹에 비해 섬유화 된 영역이 적게 나타나 섬유화의 정도가 훨씬 덜함을 알 수 있었다(도 9c). 나아가 간 섬유화증과 관련된 단백질들의 발현 여부를 하기 표 2의 프라이머를 이용하여 PCR 분석을 통해 확인한 결과 TGF-α, TGF-β, FGF, LoxL2, α-SMA의 발현 수준이 약물을 처리한 그룹에서 증가하지 않는 것을 확인하였다(도 10). 따라서 본 발명의 #765 화합물이 폐조직에서 섬유화 현상을 억제한 것과 같이 간 조직에서도 염증 및 섬유화의 개선에 유의한 효과를 보이는 것으로 나타났다. In order to verify whether #765 has antifibrotic effects in animal models of hepatic fibrosis as well as lung fibrosis, ConA (12.5 mg/kg) was administered intravascularly once a week for 6 weeks to induce hepatic fibrosis, and at the same time, The degree of remission of fibrosis was confirmed by daily oral administration. After inducing liver fibrosis with conA in mice, analysis of GOT/GPT/ALP (glutamic oxalacetic transaminase/glutamic pyruvate transaminase/alkaline phosphatase), which is an indicator of liver damage, was performed at week 1 (FIG. 9a) and week 6 (FIG. 9b). (Cho JJ et al. GASTROENTEROLOGY 118:1169-1178 (2000); Kiminori K et al. Inter. Immunol . 11(9):1419-1500 (1999)) As a result, 10 mg/kg and 30 mg/kg The level of liver inflammation was significantly reduced in the group administered with #765. In addition, it was found that the group to which the drug was administered showed less fibrotic areas than the untreated group, indicating that the degree of fibrosis was much lower (FIG. 9c). Furthermore, as a result of confirming the expression of proteins related to liver fibrosis through PCR analysis using the primers in Table 2 below, the expression levels of TGF-α, TGF-β, FGF, LoxL2, and α-SMA were found in the drug-treated group. It was confirmed that there was no increase (Fig. 10). Therefore, it was shown that the compound #765 of the present invention had a significant effect on the improvement of inflammation and fibrosis in liver tissue as well as inhibiting fibrosis in lung tissue.
간섬유증 관련 인자들의 PCR에 사용된 프라이머 서열Primer sequences used for PCR of hepatic fibrosis-related factors
타겟 유전자target gene 프라이머 서열primer sequence
TGF-aTGF-a TGC CCA GAT TCC CAC ACTTGC CCA GAT TCC CAC ACT
TGG ATC AGC ACA CAG GTGTGG ATC AGC ACA CAG GTG
aFGFaFGF CGG GGG CCA CTT CTT GAG GACGG GGG CCA CTT CTT GAG GA
ACC GGG AGG GGC AGA AAC AAACC GGG AGG GGC AGA AAC AA
LoxL2LoxL2 CGATGTGGTCAAGATCCAGGTCGATGTGGTCAAGATCCAGGT
TGGCCTCTACATAGCCCACTTTGGCCTCTACATAGCCCACTT
TGF-b1TGF-b1 CAG CTG TAC ATT GAC TTC CCAG CTG TAC ATT GAC TTC C
CAC GTA GTA CAC GTA GGG CA CAC GTA GTA CAC GTA GGG CA
a-SMAa-SMA GTG ACT ACT GCC GAG CGT GGTG ACT ACT GCC GAG CGT G
ATA GGT GGT TTC GTG GAT GCATA GGT GGT TTC GTG GAT GC
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (9)

  1. 하기 화학식 1로 표시되는 화합물 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 섬유증 또는 염증성 질환의 예방 또는 치료용 조성물:A composition for preventing or treating fibrosis or inflammatory disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
    화학식 1Formula 1
    Figure PCTKR2022005084-appb-img-000006
    Figure PCTKR2022005084-appb-img-000006
    상기 화학식에서 R1은 NA1A2(A1 및 A2는 각각 독립적으로 수소 또는 C1-C3 알킬이다)이고 R2는 수소 또는 C1-C3 알킬이다. In the above formula, R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
  2. 제 1 항에 있어서, 상기 A1 및 A2는 수소인 것을 특징으로 하는 조성물.The composition according to claim 1, wherein A 1 and A 2 are hydrogen.
  3. 제 1 항에 있어서, 상기 R2는 C1 알킬인 것을 특징으로 하는 조성물.The composition of claim 1, wherein R 2 is C 1 alkyl.
  4. 제 1 항에 있어서, 상기 섬유증은 폐섬유증, 간섬유증, 신장섬유증, 췌장섬유증, 종격섬유증, 골수섬유증, 후복막섬유증, 진행성 종괴성 섬유증, 신원성 전신섬유증, 피부경화증, 전신 경화증, 신경섬유종증 및 심근섬유증으로 구성된 군으로부터 선택되는 것을 특징으로 하는 조성물.According to claim 1, wherein the fibrosis is pulmonary fibrosis, hepatic fibrosis, renal fibrosis, pancreatic fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive mass fibrosis, renal systemic fibrosis, scleroderma, systemic sclerosis, neurofibromatosis and A composition selected from the group consisting of myocardial fibrosis.
  5. 제 4 항에 있어서, 상기 섬유증은 폐섬유증 또는 간섬유증인 것을 특징으로 하는 조성물.The composition according to claim 4, wherein the fibrosis is pulmonary fibrosis or liver fibrosis.
  6. 제 1 항에 있어서, 상기 염증성 질환은 폐렴, 만성폐쇄성폐질환, 특발성섬유성폐포염, 폐농양, 간염 및 간경변으로 구성된 군으로부터 선택되는 것을 특징으로 하는 조성물.The composition of claim 1, wherein the inflammatory disease is selected from the group consisting of pneumonia, chronic obstructive pulmonary disease, idiopathic fibroal alveolitis, lung abscess, hepatitis and cirrhosis.
  7. 제 1 항에 있어서, 상기 조성물은 LoxL2(Lysyl oxidase like 2)의 활성을 억제하는 것을 특징으로 하는 조성물.The composition according to claim 1, wherein the composition inhibits the activity of Lysyl oxidase like 2 (LoxL2).
  8. 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 섬유증 또는 염증성 질환의 예방 또는 개선용 기능성 식품 조성물:Functional food composition for the prevention or improvement of fibrosis or inflammatory disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
    화학식 1Formula 1
    Figure PCTKR2022005084-appb-img-000007
    Figure PCTKR2022005084-appb-img-000007
    상기 화학식에서 R1은 NA1A2(A1 및 A2는 각각 독립적으로 수소 또는 C1-C3 알킬이다)이고 R2는 수소 또는 C1-C3 알킬이다. In the above formula, R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
  9. 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 콜라겐의 합성, 수축 또는 축적 억제용 기능성 식품 조성물:A functional food composition for inhibiting the synthesis, contraction or accumulation of collagen comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient:
    화학식 1Formula 1
    Figure PCTKR2022005084-appb-img-000008
    Figure PCTKR2022005084-appb-img-000008
    상기 화학식에서 R1은 NA1A2(A1 및 A2는 각각 독립적으로 수소 또는 C1-C3 알킬이다)이고 R2는 수소 또는 C1-C3 알킬이다. In the above formula, R 1 is NA 1 A 2 (A 1 and A 2 are each independently hydrogen or C 1 -C 3 alkyl) and R 2 is hydrogen or C 1 -C 3 alkyl.
PCT/KR2022/005084 2021-04-09 2022-04-08 Novel indolizine derivative, and composition for preventing or treating fibrosis, comprising same WO2022216101A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210046557A KR102631074B1 (en) 2021-04-09 2021-04-09 Novel Indolizine Derivatives and A Composition for Treating or Preventing Fibrosis Comprising the Same
KR10-2021-0046557 2021-04-09

Publications (1)

Publication Number Publication Date
WO2022216101A1 true WO2022216101A1 (en) 2022-10-13

Family

ID=83546503

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/005084 WO2022216101A1 (en) 2021-04-09 2022-04-08 Novel indolizine derivative, and composition for preventing or treating fibrosis, comprising same

Country Status (2)

Country Link
KR (1) KR102631074B1 (en)
WO (1) WO2022216101A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150028130A (en) * 2013-09-05 2015-03-13 연세대학교 산학협력단 Indolizine derivatives, pharmaceutically acceptable salt thereof, preparation method thereof and pharmaceutical composition containing the same as an active ingredient
KR20160101521A (en) * 2015-02-17 2016-08-25 이화여자대학교 산학협력단 Method for diagnosing of respiratory inflammatory diseases using bacteria-derived extracellular vesicles

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101721029B1 (en) 2014-10-16 2017-03-29 연세대학교 산학협력단 Indolizino[3,2-c]quinoline derivatives, pharmaceutically acceptable salt thereof, preparation method thereof and pharmaceutical composition for treatment of cystic fibrosis containing the same as active ingredient
KR102594441B1 (en) * 2015-03-06 2023-10-25 파마케아, 인크. Fluorinated lysyl oxidase-like 2 inhibitors and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150028130A (en) * 2013-09-05 2015-03-13 연세대학교 산학협력단 Indolizine derivatives, pharmaceutically acceptable salt thereof, preparation method thereof and pharmaceutical composition containing the same as an active ingredient
KR20160101521A (en) * 2015-02-17 2016-08-25 이화여자대학교 산학협력단 Method for diagnosing of respiratory inflammatory diseases using bacteria-derived extracellular vesicles

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HAN DI, XU YONG, PENG WEN-PAN, FENG FANCHAO, WANG ZHICHAO, GU CHENG, ZHOU XIANMEI: "Citrus Alkaline Extracts Inhibit Senescence of A549 Cells to Alleviate Pulmonary Fibrosis via the β-Catenin/P53 Pathway", MEDICAL SCIENCE MONITOR, vol. 27, 1 January 2021 (2021-01-01), pages 1643 - 3750, XP055976448, DOI: 10.12659/MSM.928547 *
KIM DAWON, LEE JEONG HWA, KIM HYE YUN, SHIN JISU, KIM KYEONGHWAN, LEE SEJIN, PARK JINWOO, KIM JINIKYON, KIM YOUNGSOO: "Fluorescent indolizine derivative YI-13 detects amyloid-β monomers, dimers, and plaques in the brain of 5XFAD Alzheimer transgenic mouse model", PLOS ONE, vol. 15, no. 12, pages e0243041, XP055965539, DOI: 10.1371/journal.pone.0243041 *
KIM SUNG JUNE, LEE SUNHEE, KIM IKYON: "Regioselective Functionalization of N-Fused Heteroaromatics via FeCl3-Catalyzed Nucleophilic Addition to Activated N-Heterocycles", SYNTHESIS, GEORG THIEME VERLAG, STUTTGART, DE., vol. 53, no. 05, 1 March 2021 (2021-03-01), STUTTGART, DE. , pages 943 - 953, XP055976451, ISSN: 0039-7881, DOI: 10.1055/s-0040-1705985 *
MOON SEONG-HEE; JUNG YOUNGEUN; KIM SEONG HWAN; KIM IKYON: "Synthesis, characterization and biological evaluation of anti-cancer indolizine derivatives via inhibiting β-catenin activity and activating p53", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, ELSEVIER, AMSTERDAM NL, vol. 26, no. 1, 10 November 2015 (2015-11-10), Amsterdam NL , pages 110 - 113, XP029336544, ISSN: 0960-894X, DOI: 10.1016/j.bmcl.2015.11.021 *

Also Published As

Publication number Publication date
KR20220140268A (en) 2022-10-18
KR102631074B1 (en) 2024-01-30

Similar Documents

Publication Publication Date Title
EP1683788A1 (en) The derivatives of pyridone and the use of them
KR100883461B1 (en) Sugar-substituted 2-azetidinones useful as hypocholesterolemic agents
HU230435B1 (en) Use of substituted azetidinone compounds for treatment of sitosterolemia
AU2018358496B2 (en) Therapeutic agent for liver diseases
US20060223783A1 (en) 3,4-Disubstituted coumarin and quinolone compounds
EP3654987A1 (en) Use of aminoalkylbenzothiazepine derivatives
US20210260018A1 (en) Composition for treating fibrotic diseases, comprising benzhydryl thioacetamide compound as active ingredient
JP2003531856A (en) Phosphate transport inhibitors
JP2814950B2 (en) Hypoglycemic agent
JPS6229566A (en) Novel guanidinomthylbenzoic acid derivative
US20230390309A1 (en) Tetracycline derivatives for treating neurodegenerative or neuroinflammatory diseases
WO2022055285A1 (en) Pharmaceutical composition for killing cancer progenitor cells
WO2022216101A1 (en) Novel indolizine derivative, and composition for preventing or treating fibrosis, comprising same
WO2024147532A1 (en) Composition for prevention, alleviation, or treatment of sepsis
CN107987033B (en) Application of vanillin and isomer thereof in preparation of NA inhibitor
US20070004777A1 (en) Methods for treating or preventing acute myelogenous leukemia
WO2020184884A1 (en) Composition for preventing or treating obesity or lipid-related metabolic disorders
DK169055B1 (en) Use of piperazine derivatives for the preparation of a pharmaceutical composition for the protection of brain cells
CN111247148B (en) Wnt pathway modulators
FR2995605A1 (en) MACROLIDE DERIVATIVES, THEIR PREPARATION AND THEIR THERAPEUTIC APPLICATION.
SK23898A3 (en) Zwitterionic forms of trovafloxacin
WO2018062837A1 (en) Chalcone derivative compound, optical isomer thereof, or pharmaceutically acceptable salt thereof, and pharmaceutical composition comprising same as effective ingredient for preventing or treating disease caused by reduction in mitochondrial oxygen consumption rate
WO2022030879A1 (en) Composition for treating kca3.1 channel-mediated diseases comprising phenylalkyl carbamate compound
DE60308862T2 (en) COMPOUNDS AND COMPOSITIONS FOR THE TREATMENT OF DIABETES AND DISEASES RELATED TO DIABETES
WO2023096313A1 (en) Flavanone derivative compound and medical use thereof for treating or alleviating fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22785010

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22785010

Country of ref document: EP

Kind code of ref document: A1