WO2022213975A1 - Compounds targeting y220c mutant of p53 - Google Patents

Compounds targeting y220c mutant of p53 Download PDF

Info

Publication number
WO2022213975A1
WO2022213975A1 PCT/CN2022/085296 CN2022085296W WO2022213975A1 WO 2022213975 A1 WO2022213975 A1 WO 2022213975A1 CN 2022085296 W CN2022085296 W CN 2022085296W WO 2022213975 A1 WO2022213975 A1 WO 2022213975A1
Authority
WO
WIPO (PCT)
Prior art keywords
membered
alkyl
heteroaryl
cycloalkyl
aryl
Prior art date
Application number
PCT/CN2022/085296
Other languages
French (fr)
Inventor
Sujing LI
Amin LI
Qian Zheng
Chaojie DANG
Xinrui FAN
Wei LONG
Yanping Wang
Original Assignee
Jacobio Pharmaceuticals Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jacobio Pharmaceuticals Co., Ltd. filed Critical Jacobio Pharmaceuticals Co., Ltd.
Publication of WO2022213975A1 publication Critical patent/WO2022213975A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/06—Peri-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/06—Peri-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D498/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D498/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D498/06—Peri-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/06—Peri-condensed systems

Definitions

  • the present invention relates to compounds that target p53 Y220C, pharmaceutical compositions comprising the compounds and the use thereof.
  • the p53 protein referred to as the “guardian of the human genome” is a tetrameric transcription factor that prevents mutation to the genome by regulating the expression of a subgroup of target genes. Although biologically active as a homotetramer, each p53 monomer is comprised of 393 amino acids, and is divided into five key regulatory domains: the transactivation domain (TAD) , proline-rich region (PR) , the DNA binding domain (DBD) , the oligomerization domain (OD) , and the C-terminus.
  • TAD transactivation domain
  • PR proline-rich region
  • DBD DNA binding domain
  • OD oligomerization domain
  • C-terminus the C-terminus
  • the p53 protein Under normal conditions, the p53 protein has a "cancer suppressor" effect but p53 is unstable, with a half-life ranging from 5 to 30 minutes. Activation of p53 initiates pathways involved in apoptosis, DNA repair, cell cycle arrest, anti-angiogenesis, and senescence in order to avoid propagation of damaged cells. P53 activation occurs via a complicated regulatory network composed of three key steps: (1) p53 stabilization by phosphorylation, (2) DNA binding, and (3) target gene activation.
  • Mutations in p53 located in the DNA binding domain of the protein or periphery of the DNA-binding surface result in aberrant protein folding required for DNA recognition and binding. Mutations in p53 can occur, for example, at amino acids Vall43, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, and Arg282.
  • P53 mutations that can abrogate the activity of p53 include, for example, R175H, Y220C, G245S, R248Q, R248W, R273H, and R282H.
  • p53 mutations can either distort the structure of the DNA-binding site or thermodynamically destabilize the folded protein at body temperature. Wild-type function of p53 mutants can be recovered by binding of the p53 mutant to a compound that can shift the folding-unfolding equilibrium towards the folded state, thereby reducing the rate of unfolding and destabilization.
  • the p53 Y220C mutation is associated with many cancers, including breast cancer, non-small cell lung cancer, colorectal cancer, pancreatic cancer, and ovarian cancer.
  • the present invention provided compounds that target p53 Y220C mutant.
  • the compounds are represented by formula (I)
  • Each is independently a single bond or a double bond
  • X 5 , X 6 is independently selected from CR 13 or N;
  • X 1 , X 2 , X 3 and X 4 is a carbon atom connect to R 2 ;
  • At least one of X 5 and X 6 is N;
  • R 1 is H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15 , -S (O) R 15 , -S (O) 2 R 15 , nitro, nitroso, cyano, amino, carboxyl, -C (O) OR 15 , -NR 16 R 17 , aryl, heteroaryl or heterocyclyl; wherein said alkyl, cycloalkyl, alkoxyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 18 ;
  • R 2 is alkyl, cycloalkyl, -NR 19 R 20 , -C 1-6 alkylNR 19 R 20 , haloalkyl, halogen, hydroxyl, alkoxyl, -C (O) NR 19 R 20 , aryl, heteroaryl or heterocyclyl; wherein said alkyl, alkoxyl, cycloalkyl, aryl, heteroaryl and heterocyclyl is optionally substituted by one or more R 21 ;
  • R 3 is independently H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl;
  • R 4 is aryl, heteroaryl, each of which is optionally substituted by one or more R 22 ;
  • each R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 , and R 13 is independently H, alkyl, halogen, haloalkyl, cycloalkyl, hydroxyl, nitro, amino or alkoxyl;
  • Y is (C (R 15 ) 2 ) m ;
  • n 0, 1, 2, 3;
  • each R 15 is independently H, hydroxyl, alkyl, cycloalkyl or halogen
  • R 18 is halogen, cycloalkyl, alkyl, nitro, cyano, alkoxyl or hydroxyl;
  • each R 21 , R 22 , R 24 , R 25 is independently selected from H, alkyl, alkenyl, alkynyl, cycloalkyl, alkoxyl, hydroxyl, amino, alkylamino-, nitro, carboxyl, cyano, halogen, -C (O) OR 28 , -C (O) NR 29 R 30 , -C 1-3 alkylC (O) NR 29 R 30 , -C (O) C 1-3 alkylNR 29 R 30 , -S (O) 2 R 28 , -S (O) R 28 , -S (O) 2 NR 29 R 30 , -P (O) R 29 R 30 , aryl, heteroaryl or heterocyclyl, wherein aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of halogen, hydroxyl, amino, alkyl or alkoxyl;
  • each R 26 , R 27 , R 28 , R 29 , R 30 is independently selected from H, hydroxyl, alkyl, hydroxylalkyl, alkoxyl, amino, aminoalkyl, cycloalkyl or halogen;
  • R 29 and R 30 along with the N or P atom form a 3-to 6-membered ring which is optionally substituted by one or more substituents independently selected from -C 1-6 alkyl.
  • the invention provided a pharmaceutical composition, comprising a therapeutically effective amount of compound of formula (I) , a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the disease or condition is cancer selected from ovarian cancer, breast cancer or lung cancer.
  • Also provided herein is a method for preventing or treating a disease or condition, comprising administering to a subject a compound of formula (I) or a pharmaceutical composition in an amount effective for treating the disease or condition, wherein the disease or condition is selected from ovarian cancer, breast cancer or lung cancer.
  • the present invention provides compounds and methods for restoring wild-type function of p53 mutant.
  • the compounds of the present invention can bind to p53 mutant and restore its ability to bind DNA.
  • the restoration of activity of the p53 mutant can allow for the activation of downstream effectors of p53 leading to inhibition of cancer progression.
  • the Y220C mutant is a temperature sensitive mutant, which binds to DNA at lower temperature and is denatured at body temperature.
  • a compound of the invention can selectively bind to the p53 Y220Cs and stabilize the Y220C mutant to reduce the likelihood of denaturation of the protein at body temperature.
  • X 5 , X 6 is independently selected from CR 13 or N;
  • X 7 is CR 14 or NR 14 ; wherein at least one of X 1 , X 2 , X 3 and X 4 is a carbon atom connect to R 2 ; at least one of X 5 and X 6 is N;
  • R 1 is H, alkyl, cyclol,
  • the compound is of the formula
  • the compound is of the formula
  • the compound is of the formula
  • the compound is of the formula
  • the compound is of the formula
  • R 1 is H, C 1-6 alkyl, halo C 1-6 alkyl, cycloalkyl, C 1-6 alkoxyl, C 6-12 aryl, heterocyclyl or 5-to 12-membered heteroaryl, wherein C 1-6 alkyl, cycloalkyl, C 1-6 alkoxyl, C 6-12 aryl, heterocyclyl or 5-to 12-membered heteroaryl is optionally substituted by one or more R 18 , R 18 is halogen, cycloalkyl, alkyl, nitro, cyano, alkoxyl or hydroxyl.
  • R 1 is C 1-6 alkyl, halo C 1-6 alkyl, cycloalkyl, C 1-6 alkoxyl, C 6-12 aryl or 5-to 12-membered heteroaryl, said C 1-6 alkyl is substituted by cycloalkyl or cyano.
  • R 1 is selected from the group consisting of
  • R 2 is alkyl, cycloalkyl, -NR 19 R 20 , -C 1-6 alkylNR 19 R 20 , -C (O) NR 19 R 20 , or heterocyclyl.
  • each R 19 , R 20 is independently H, C 1-6 alkyl, C 3-6 cycloalkyl, haloC 1-6 alkyl, halogen, hydroxyl, C 1-6 alkoxyl, -SR 15 , -S (O) R 15 , -S (O) 2 R 15 , carboxyl, -C (O) OR 15 , C 6-12 aryl, 5-to 12-membered heteroaryl or 5-to 12-membered heterocyclyl.
  • R 15 is H, alkyl, cycloalkyl or halogen.
  • R 19 is H
  • R 20 is alkyl, cycloalkyl or each of which is optionally substituted by one or more R 23 ;; wherein X is CH or N; Z is CR 23 , NH, O, N-CH 3 or S (O) 2 .
  • R 23 is -NR 26 R 27 , C 1-6 alkyl, haloC 1-6 alkyl, halogen, hydroxyl, nitro, carboxyl, -C (O) C 1-3 alkylNR 26 R 27 or -C (O) NR 26 R 27 , said C 1-6 alkyl is substituted by one or more substituents selected from the group consisting of alkyl, alkoxyl, hydroxyl, amino and halogen; R 26 , R 27 is independently selected from H, alkyl, amino, cycloalkyl or halogen.
  • R 19 , R 20 together with N atom they are bound form a 5-or 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 25 .
  • R 2 is selected from the group consisting of
  • R 3 is H.
  • R 4 is C 6-12 aryl or 5-to 12-membered heteroaryl. Wherein said C 6-12 aryl or 5-to 12-membered heteroaryl is optionally substituted by one or more R 22 .
  • R 22 is C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 alkoxyl, hydroxyl, amino, nitro, carboxyl, cyano, halogen, -C (O) OR 28 , -C (O) NR 29 R 30 , -S (O) 2 R 28 , -S (O) R 28 or -S (O) 2 NR 29 R 30 .
  • R 22 is C 1-6 alkyl, C 1-6 alkoxyl, halogen, -S (O) 2 R 28 or -C (O) NR 29 R 30 .
  • R 28 , R 29 , R 30 is independently selected from H, alkyl, amino, cycloalkyl or halogen.
  • R 3 is selected from the group consisting of
  • Non-limiting examples of compounds of Formula (I) of the present invention include the following compounds in table A.
  • the compound of Formula (I) is represented by formula (II) :
  • R 3 is selected from the group consisting of H, -hydroxyl, -halogen, -nitro, -cyano, -C 1-6 alkyl, -C 1-6 alkoxyl, halo C 1-6 alkyl-and -cycloalkyl;
  • R 14 is selected from the group consisting of -C 1-6 alkyl, halo C 1-6 alkyl-and -cycloalkyl, each of which is optionally substituted by –cyano, C 1-6 alkoxyl or –cycloalkyl;
  • R 2 is selected from the group consisting of -NR 19 R 20 , -C 1-6 alkylNR 19 R 20 , -C (O) NR 19 R 20 , aminoacyl-and aminoC 1-6 alkoxyl-.
  • R 19 and R 20 is independently selected from the group consisting of H, -C 1-6 alkyl, aminoC 1-6 alkyl-, 3-to 6-membered cycloalkyl, 3-to 6-membered heterocycle, aryl, heteroaryl, or arylC 1-3 alkyl-, wherein said C 1-6 alkyl, aminoC 1-6 alkyl-, 3-to 6-membered cycloalkyl, 3-to 6-membered heterocycle, aryl, heteroaryl or arylC 1-3 alkyl-is independently optionally substituted by one or more R 21 ;
  • R 19 and R 20 along with the N atom to which they are attached, form a 3-to 6-membered saturated or unsaturated ring which is optionally substituted by one or more R 21
  • R 21 is independently selected from the group consisting of -hydroxyl, -C 1-6 alkyl, -cyano, -C (O) NR’R”, C 1-6 alkylcarbonyl-, -C 1-3 alkylC (O) NR’R”, -C (O) C 1-3 alkylNR’R”, -C 1-6 alkylOH, C 1-3 alkylsulfonyl-, C 1-3 alkylamino-and heterocycyl, wherein said C 1-3 alkylamino-and heterocycyl is optionally substituted by one or more of hydroxyl or -amino;
  • R’ or R is independently selected from H or -C 1-3 alkyl
  • A is an aryl or heteroaryl, said aryl or heteroaryl is optionally substituted by one or more R 22 ;
  • R 22 and are at both ends of a bond
  • R 22 is selected from H, halogen, -C 1-3 alkyl, -C 1-3 alkoxyl, -cyano;
  • R 29 and R 30 is independently selected from the group consisting of -hydroxyl, -cycloalkyl, -C 1-6 alkyl, aminoC 1-3 alkyl-, -amino, -C 1-6 alkoxyl and hydroxyC 1-6 alkyl-;
  • R 29 and R 30 along with the P atom form a 3-to 6-membered ring which is optionally substituted by one or more substituents independently selected from -C 1-6 alkyl.
  • the A moiety of the compound of Formula (II) of the present invention is 5 or 6 membered aryl or heteroaryl, which is optionally substituted by one or more R 22 .
  • the compound of Formula (II) of the present invention is selected from compounds in table B shown below.
  • the compound of Formula (I) of the present invention is represented by formula (III) :
  • A is aryl or heteroaryl, each of which is optionally substituted by one or more R 22 ;
  • Z 1 , Z 2 or Z 3 is independently selected from CR’R”, O, S, S (O) 2 or NR’;
  • each R’ or R is independently H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl;
  • R 1 , R 2 , R 3 , R 14 , or Y is defined as that in the formula (I) above.
  • the A moiety of the compound of formula (III) is phenyl.
  • D 1 is CR D , N, or a carbon atom connected to Y 4 ;
  • D 2 is CR D , N, or a carbon atom connected to Y 4 ;
  • ring E is selected from a 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 member heteroaryl; said ring E is optionally substituted with one or more R E ;
  • R’ Y4 at each occurrence is independently selected from halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, oxo, -NO 2 , -N 3 , -OR a4 , -SR a4 , -C (O) R b4 , -C (O) NR c4 R d4 , -C (O) - (C 1-6 alkylene) -NR c4 R d4 , -C (O) OR a4 , -OC (O) R b4 , -OC (O) NR c4 R d4 , -NR c4 R d4 , -NR c4 C (O) R b4 , -NR c4 C (O) OR a4 , -NR c4 C (O) NR c4 R
  • each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , R d2 , R a3 , R b3 , R c3 , R d3 , R a4 , R b4 , R c4 , R d4 , R a5 , R b5 , R c5 , or R d5 is independently selected from -H, -C 1-6 alkyl, -C 1-6 haloalkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 alkoxy, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6 alky
  • n 1 is 0, 1, 2 or 3;
  • n 2 is 0, 1, 2 or 3;
  • n 3 is 0, 1, 2 or 3;
  • n 4 is 0, 1, 2 or 3;
  • n 3 0, 1, 2, 3, 4, 5, or 6;
  • each of heterocycloalkyl, heterocycloalkenyl, and heteroaryl at each occurrence independently contains one or more heteroatoms selected from N, O or S.
  • the moiety of ring A in the compound of formula (IV) is selected from 4 membered cycloalkyl, 4 membered cycloalkenyl, 4 membered heterocycloalkyl, 4 membered heterocycloalkenyl, 5 membered cycloalkyl, 5 membered cycloalkenyl, 5 membered heterocycloalkyl, 5 membered heterocycloalkenyl, 6 membered cycloalkyl, 6 membered cycloalkenyl, 6 membered heterocycloalkyl, 6 membered heterocycloalkenyl, 7 membered cycloalkyl, 7 membered cycloalkenyl, 7 membered heterocycloalkyl, 7 membered heterocycloalkenyl, 8 membered cycloalkyl, 8 membered cycloalkenyl, 8 membered heterocycloalkyl, 8 membered cycloalkyl, 8 membered cyclo
  • the compound of formula (IV) of the present invention is selected from compounds in table D shown below:
  • a pharmaceutical composition containing a therapeutically effective amount of the compound of formula (I) , (II) , (III) or (IV) of the present invention, and a pharmaceutically acceptable carrier, diluent, or excipient.
  • a method for preventing or treating a disease or condition related to p53 mutant comprising administering to a subject a therapeutically effective amount of the above-mentioned compound or pharmaceutical composition of the present invention.
  • C 1-6 alkyl refers to an alkyl group as defined hereinafter having 1 to 6 carbon atoms in total
  • C 3-8 cycloalkyl refers to a cycloalkyl group as defined hereinafter having 3 to 8 carbon atoms in total
  • C 6-12 aryl refers to an aryl group as defined hereinafter having 6 to 12 carbon atoms in total.
  • Carbon atoms that may exist in the substituents of the chemical group are not included in the total number of carbon atoms in the shorthand notation.
  • arylalkyl means that the aryl group is attached to the rest of the molecule via the alkyl group
  • alkoxyl means that the aliphatic group is attached to the rest of the molecule via an oxy group
  • alkyl optionally substituted by one or more halogens means the alkyl group is unsubstituted or substituted by one or more halogens, and that the description includes both substituted alkyl groups and unsubstituted alkyl groups.
  • Substitute or “substituted” refers to the H attached to carbon may be substituted, or the H attached to heteroatom may be substituted, said heteroatom including but not limited to N, O or S.
  • stereoisomer refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures.
  • the present invention contemplates various stereoisomers and mixtures thereof.
  • tautomer refers to an isomer resulted from a proton shift from one atom of a molecule to another atom of the same molecule. All tautomeric forms of the compound of formula I of the present invention are include within the scope of the present invention.
  • alkenyl of the compound in the present application includes both E-and Z-geometric isomers.
  • isotopes of any particular atom or element as specified are contemplated within the scope of the compounds of the invention and their uses.
  • Isotopes include those atoms having the same atomic number but different mass numbers.
  • Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine and iodine, such as 2H, 3H, 11C, 13C, 14C, 13N, 15N, 15O, 17O, 18O, 32P, 33P, 35S, 18F, 36Cl, 123I or 125I.
  • isotopes of hydrogen include deuterium and tritium.
  • the isotopes of hydrogen can be denoted as 1H (hydrogen) , 2H (deuterium) and 3H (tritium) . They are also commonly denoted as D for deuterium and T for tritium.
  • CD3 denotes a methyl group wherein all of the hydrogen atoms are deuterium.
  • Isotopes of carbon include 13C and 14C. Isotopically labeled compounds of the present disclosure are equivalent to those unlabeled, for example, deuterated compounds of the present disclosure are equivalent to those non-deuterated.
  • Isotopically-labeled compounds of the invention can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein, using an appropriate isotopically-labeled reagent in place of the non-labeled reagent.
  • amino refers to the -NH2 group.
  • cyano refers to the -CN group.
  • nitro refers to the -NO2 group.
  • halogen as used herein, unless otherwise indicated, means fluoro, chloro, bromo or iodo.
  • the preferred halogen groups include -F, -Cl and -Br.
  • alkyl as used herein, unless otherwise indicated, includes saturated monovalent hydrocarbon radicals having straight or branched.
  • alkyl radicals include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, 3- (2-methyl) butyl, 2-pentyl, 2-methylbutyl, neopentyl, n-hexyl, 2-hexyl and 2-methylpentyl.
  • C 1-6 as in C 1-6 alkyl is defined to identify the group as having 1, 2, 3, 4, 5 or 6 carbon atoms in a linear or branched arrangement.
  • alkenyl means a straight or branch-chained hydrocarbon radical containing one or more double bonds and typically from 2 to 20 carbon atoms in length.
  • C 2-6 alkenyl contains from 2 to 6 carbon atoms.
  • Alkenyl group include, but are not limited to, for example, ethenyl, propenyl, butenyl, 2-methyl-2-buten-1-yl, hepetenyl, octenyl and the like.
  • alkynyl contains a straight or branch-chained hydrocarbon radical containing one or more triple bonds and typically from 2 to 20 carbon atoms in length.
  • C 2-6 alkynyl contains from 2 to 6 carbon atoms.
  • Representative alkynyl groups include, but are not limited to, for example, ethynyl, 1-propynyl, 1-butynyl, heptynyl, octynyl and the like.
  • alkoxyl radicals are oxygen ethers formed from the previously described alkyl groups.
  • heteroaryl represents an aromatic ring system containing carbon (s) and at least one heteroatom.
  • Heteroaryl may be monocyclic or polycyclic, substituted or unsubstituted.
  • a monocyclic heteroaryl group may have 1 to 4 heteroatoms in the ring, while a polycyclic heteroaryl may contain 1 to 10 hetero atoms.
  • a polycyclic heteroaryl ring may contain fused, spiro or bridged ring junction, for example, bycyclic heteroaryl is a polycyclic heteroaryl.
  • Bicyclic heteroaryl rings may contain from 8 to 12 member atoms.
  • Monocyclic heteroaryl rings may contain from 5 to 8 member atoms (cabons and heteroatoms) .
  • heteroaryl groups include, but are not limited to thienyl, furanyl, imidazolyl, isoxazolyl, oxazolyl, pyrazolyl, pyrrolyl, thiazolyl, thiadiazolyl, triazolyl, pyridyl, pyridazinyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, benzofuranyl, benzothienyl, benzisoxazolyl, benzoxazolyl, benzopyrazolyl, benzothiazolyl, benzothiadiazolyl, benzotriazolyl adeninyl, quinolinyl or isoquinolinyl.
  • heterocyclyl refers to a stable 3-to 18-membered non-aromatic ring group comprising 1 to 6 heteroatoms selected from the group consisting of nitrogen, oxygen and sulphur. Unless indicated otherwise specifically in the specification, the heterocyclyl group may be a monocyclic, bicyclic, tricyclic or polycyclic ring system, which may include fused or bridged ring systems.
  • heterocyclyl is preferably a stable 3-to 12-membered non-aromatic monocyclic or bicyclic ring group comprising 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulphur, more preferably a stable 3-to 8-membered non-aromatic monocyclic ring group comprising 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulphur.
  • the nitrogen, carbon or sulphur atom in the heterocyclyl group may be optionally oxidized; the nitrogen atom may be optionally quatemized; and the heterocyclyl group may be partially or fully saturated.
  • the heterocyclyl group may be attached to the rest of the molecule by a single bond via a carbon atom or a heteroatom. In a heterocyclyl group containing fused rings, one or more rings may be aryl or heteroaryl.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts. Accordingly, pharmaceutical compositions containing the compounds of the present invention as the active ingredient as well as methods of preparing the instant compounds are also part of the present invention. Furthermore, some of the crystalline forms for the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e., hydrates) or common organic solvents and such solvates are also intended to be encompassed within the scope of this invention.
  • the present invention includes any possible solvates and polymorphic forms.
  • a type of a solvent that forms the solvate is not particularly limited so long as the solvent is pharmacologically acceptable.
  • water, ethanol, propanol, acetone or the like can be used.
  • pharmaceutically acceptable salts refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids.
  • the compound of the present invention is acidic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic bases, including inorganic bases and organic bases.
  • the compound of the present invention is basic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Since the compounds are intended for pharmaceutical use they are preferably provided in substantially pure form, for example at least 60%pure, more suitably at least 75%pure, especially at least 98%pure (%are on a weight for weight basis) .
  • compositions of the present invention comprise a compound (or a pharmaceutically acceptable salt thereof) as an active ingredient, a pharmaceutically acceptable carrier and optionally other therapeutic ingredients or adjuvants.
  • the compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered.
  • the pharmaceutical compositions may be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
  • the compounds or a prodrug or a metabolite or pharmaceutically acceptable salts thereof, of this invention can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques.
  • the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g. oral or parenteral (including intravenous) .
  • the pharmaceutical compositions of the present invention can be presented as discrete units suitable for oral administration such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient.
  • compositions can be presented as a powder, as granules, as a solution, as a suspension in an aqueous liquid, as a non-aqueous liquid, as an oil-in-water emulsion or as a water-in-oil liquid emulsion.
  • the compound or a pharmaceutically acceptable salt thereof may also be administered by controlled release means and/or delivery devices.
  • the compositions may be prepared by any of the methods of pharmacy. In general, such methods include a step of bringing into association the active ingredient with the carrier that constitutes one or more necessary ingredients.
  • the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped into the desired presentation.
  • compositions of this invention may include a pharmaceutically acceptable carrier and a compound or a pharmaceutically acceptable salt.
  • the compounds or pharmaceutically acceptable salts thereof, can also be included in pharmaceutical compositions in combination with one or more other therapeutically active compounds.
  • a tablet containing the composition of this invention may be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants.
  • Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
  • Each tablet preferably contains from about 0.05mg to about 5g of the active ingredient and each cachet or capsule preferably containing from about 0.05mg to about 5g of the active ingredient.
  • a formulation intended for the oral administration to humans may contain from about 0.5mg to about 5g of active agent, compounded with an appropriate and convenient amount of carrier material which may vary from about 0.05 to about 95 percent of the total composition.
  • Unit dosage forms will generally contain between from about 0.0lmg to about 2g of the active ingredient, typically 0.01mg, 0.02mg, 1mg, 2mg, 3mg, 4mg, 5mg, 6mg, 7mg, 8mg, 9mg, 10mg, 25mg, 50mg, l00mg, 200mg, 300mg, 400mg, 500mg, 600mg, 800mg or l000mg.
  • compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions.
  • the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions.
  • the final injectable form must be sterile and must be effectively fluid for easy syringability.
  • the pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol) , vegetable oils, and suitable mixtures thereof.
  • compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder or the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations may be prepared, utilizing a compound of this invention or a pharmaceutically acceptable salt thereof, via conventional processing methods. As an example, a cream or ointment is prepared by admixing hydrophilic material and water, together with about 0.05wt%to about 10wt%of the compound, to produce a cream or ointment having a desired consistency.
  • compositions of this invention can be in a form suitable for rectal administration wherein the carrier is a solid. It is preferable that the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by first admixing the composition with the softened or melted carrier (s) followed by chilling and shaping in molds.
  • the pharmaceutical formulations described above may include, as appropriate, one or more additional carrier such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • additional carrier such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • additional carrier such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • additional carrier such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient.
  • dosage levels on the order of from about 0.001mg/kg to about 150mg/kg of body weight per day are useful in the treatment of the above-indicated conditions or alternatively about 0.05mg to about 7g per patient per day.
  • inflammation, cancer, psoriasis, allergy/asthma, disease and conditions of the immune system, disease and conditions of the central nervous system (CNS) may be effectively treated by the administration of from about 0.001 to 50mg of the compound per kilogram of body weight per day or alternatively about 0.05mg to about 3.5g per patient per day.
  • the compound 1 is synthesized according to the scheme below.
  • Step 2 ethyl 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-2-carboxylate.
  • Step 5 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-amine.
  • Step 6 8-bromo-2-iodo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine.
  • Step7 4- ( (3- (8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step8 4- ( (3- (8- ( (1-methylpiperidin-4-yl) amino) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (A-1)
  • Step 7 N- (3-fluoropiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine
  • Step 8 N- (3-fluoro-1-methylpiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-3)
  • Step 1 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine
  • Step 6 Synthesis of 2-iodo-N- (1-methylpiperidin-4-yl) -1- (2, 2, 2-trifluoroethyl) -1H -indol-4-amine.
  • Step 8 Synthesis of dimethyl (4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide.
  • Step 9 Synthesis of dimethyl (4- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide.
  • 6-nitrobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide (2.097 g, 9.197mmol) was dissolved in EtOH (20 mL) , 10%Pd/C (1.00 1g, 9.397mmol) was added. The mixture was stirred under hydrogen atmospheric for 2 days. The catalyst was removed by filtration and the filtrate was concentrated under vacuum to obtain 1.743 g 6-aminobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide as off-white solid.
  • LCMS: m/z 199 [M+1] +
  • Zinc dust (1.338 g, 20.46 mmol ) , 6-aminob enzo [d] isothiazol-3 (2H) -one 1, 1-dioxide (0.496 g, 2.50 mmol) were dissolved in hydrochloric acid (12N, 5 mL) . The mixture was stirred at room temperature for 10 h. Then saturated aqueous sodium hydrogen carbonate solution was added to the mixture until the pH of the solution was 7 ⁇ 8. The mixture was filtered and extracted with ethyl acetate (3 x 80 ml) .
  • 6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (0.177 g, 0.96 mmol) , 3-Bromopropyne (0.241 g, 2.03 mmol) and Cs 2 CO 3 (0.638 g, 1.96 mmol) were dissolved in acetonitrile (2 mL) .
  • the reaction mixture was stirred with an inert at mosphere of nitrogen at 80 oC for 1 h.
  • the reaction was then quenched by the addition of water (10 mL) .
  • the resulting solution was extracted with EA (2 x 30 mL) , the organic layers combined, washed with brine (15 mL) , dried over anhydrous Na 2 SO 4 and concentrated under vacuum.
  • Zinc dust (3.310 g, 50.62 mmol ) was added portionwise to a stirred suspension of 5-aminobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide (1.012 g, 5.11 mmol) in concentrated hydrochloric acid (10mL) .
  • the mixture was stirred at room temperature for 2 h.
  • saturated aqueous sodium hydrogen carbonate solution was added to the mixture until the pH of the solution was 7 ⁇ 8.
  • the mixture was filtered and extracted with ethyl acetate (4 x 100 mL) .
  • cuprous iodide 0.032 g, 168.02 ⁇ mol
  • 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate (0.150 g, 428.24 ⁇ mol)
  • 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.210 g, 877.60 ⁇ mol)
  • bis (triphenylphosphine) palladium (II) chloride 0.074 g, 104.83 ⁇ mol
  • triethylamine 0.107 g, 1.06 mmol
  • N, N-dimethylformamide (20 mL) .
  • Step 2. 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate.
  • Step 3 4- ( (3- (8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step 4 4- ( (3- (8- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-2) .
  • Step 1 2, 3, 4, 5-tetrahydro-1H-benzo [b] azepine.
  • Step 3 1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one.
  • Step 4 9-bromo-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one.
  • Step 5 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one.
  • Step 6 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl trifluoromethanesulfonate.
  • Step 7 4- ( (3- (9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step 8 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-3)
  • Step5. 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one.
  • Step6 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
  • Step7 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step8 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-4) .
  • Step 2. 7-nitro-2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine.
  • Step4 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-ol.
  • Step5. 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
  • Step7 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine.
  • Step8 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine (D-5) .
  • Step 2 tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
  • Step5. 4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-6) .
  • Step 2. 4-dihydrobenzo [b] [1, 4] oxazepine-5 (2H) -carbaldehyde.
  • N- (2-hydroxyphenyl) formamide (8.09 g, 58.99 mmol) , NaH (7.15 g, 297.94 mmol) , DMF (100 mL) .
  • the mixture was stirred at 120°C.
  • 1, 3-dibromopropane (17.15 g, 84.95 mmol) was added.
  • the reaction was stirred for 2 h at 120°C.
  • the reaction was quenched by water (200 mL) , extracted with EA (3 x 200 mL) .
  • the organic layers was combined and concentrated under vacuum.
  • Step 5 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
  • Step 6 9-bromo-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
  • Step 7 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
  • Step 8 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yltrifluoromethanesulfonate.
  • Step 9 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step 10 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-7) .
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 50-70-90%B (35-65-95min) ; 247 nm; RT: 34.455 -36.854 min; ) .
  • Step 2 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
  • Step3 4- ( (3- (9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step4 4- ( (3- (9-amino-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step5. 4- ( (3- (9- ( (1-methylpiperidin-4-yl) amino) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-8) .
  • Step 1 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indole-9-carbonitrile.
  • Step 2 tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
  • Step 3 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
  • LCMS: m/z 451 [M+1] + .
  • Step 4 tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
  • Step 5 4- ( (3- (9- (aminomethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
  • Step 6 4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-9) .
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 25-50-75%B (2-30-60min) ; 248 nm; RT: 31.110 –34.567 min; ) .
  • HTRF ratio (Signal F665/Signal F620) *1000.
  • %Activation (HTRF ratio Compound treated –HTRF ratio Low control ) / (HTRF ratio High control –HTRF ratio Low control ) *100%) .
  • the data were analyzed either by fitting a 4-parameter logistic model or by Excel to calculate EC 50 values. and the EC 50 was the concentration at 50%Activation on the curve.
  • Example part B of the present invention The p53 (Y220C) EC 50 ( ⁇ M) values of some example compounds in Example part B of the present invention were shown in the following table II.
  • Example part D of the present invention The p53 (Y220C) EC 50 ( ⁇ M) values of some example compounds in Example part D of the present invention were shown in the following table IV.
  • a desired number of cells were seeded into 96 well microplate and cultured in 37°C cell incubator overnight. Compounds dissolved in cell culture medium were added into cell plate and cultured for 6 days. After equilibrium CellTiter-Glo reagent and cells at room temperature for 30 min, equal volume of CellTiter –Glo reagents was added to assay plate and shook for 2 min for cell lysis. The cells were balanced at room temperature for 10 minutes and Luminescence signal was read using Envision. The percent of viability of compounds treated wells were normalized between High control and low control. Wells containing cell culture medium and same percentage DMSO served as Low control. Wells containing cells and same percentage DMSO served as High control.
  • Cell viability (%) (Luminescence readout Compound treated–Luminescence readout Low control) / (Luminescence readout High control –Luminescence readout Low control) *100%. Then the data was analyzed either by fitting a 4-parameter logistic model or by Excel to calculate IC50 values and the IC50 was the concentration at 50%Cell viability on the curve.

Abstract

Provided are compounds of formula (I) which can bind to p53 mutant and restore its ability to bind DNA and activate downstream effects involved in tumor suppression. Also provided are the synthesis processes and use of the compounds.

Description

COMPOUNDS TARGETING Y220C MUTANT OF P53
CROSS REFERENCE TO RELATED APPLICATIONS
The present application claims the benefit of, and priority to, PCT application PCT/CN2021/085870 filed on April 08, 2021; PCT application PCT/CN2021/089287 filed on April 23, 2021; PCT application PCT/CN2021/137124 filed on December 10, 2021; PCT application PCT/CN2021/089311 filed on April 23, 2021; PCT application PCT/CN2021/089317 filed on April 23, 2021; and PCT application PCT/CN2021/136450 filed on December 08, 2021; the contents of each of which are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
The present invention relates to compounds that target p53 Y220C, pharmaceutical compositions comprising the compounds and the use thereof.
BACKGROUND OF THE INVENTION
The p53 protein, referred to as the “guardian of the human genome” , is a tetrameric transcription factor that prevents mutation to the genome by regulating the expression of a subgroup of target genes. Although biologically active as a homotetramer, each p53 monomer is comprised of 393 amino acids, and is divided into five key regulatory domains: the transactivation domain (TAD) , proline-rich region (PR) , the DNA binding domain (DBD) , the oligomerization domain (OD) , and the C-terminus.
Under normal conditions, the p53 protein has a "cancer suppressor" effect but p53 is unstable, with a half-life ranging from 5 to 30 minutes. Activation of p53 initiates pathways involved in apoptosis, DNA repair, cell cycle arrest, anti-angiogenesis, and senescence in order to avoid propagation of damaged cells. P53 activation occurs via a complicated regulatory network composed of three key steps: (1) p53 stabilization by phosphorylation, (2) DNA binding, and (3) target gene activation.
But once a mutation occurs, p53 will change and promote the development of cancer. Mutations in p53 located in the DNA binding domain of the protein or periphery of the DNA-binding surface result in aberrant protein folding required for DNA recognition and binding. Mutations in p53 can occur, for example, at amino acids Vall43, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, and Arg282. P53 mutations that can abrogate the activity of p53 include, for example, R175H, Y220C, G245S, R248Q, R248W, R273H, and R282H. These p53 mutations can either distort the structure of the DNA-binding site or thermodynamically destabilize the folded protein at body temperature. Wild-type function of p53 mutants can be recovered by binding of the p53 mutant to a compound that can shift the folding-unfolding equilibrium towards the folded state, thereby reducing the rate of unfolding and destabilization.
The p53 Y220C mutation is associated with many cancers, including breast cancer, non-small cell lung cancer, colorectal cancer, pancreatic cancer, and ovarian cancer.
SUMMARY OF THE INVENTION
In one aspect, the present invention provided compounds that target p53 Y220C mutant. The compounds are represented by formula (I)
Figure PCTCN2022085296-appb-000001
or a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof.
Wherein:
Each
Figure PCTCN2022085296-appb-000002
is independently a single bond or a double bond;
X 1 is CR 5, NR 6, O, S, C=O, C=S or a carbon atom connected to R 2;
X 2 is CR 7, NR 8, O, S, C=O, C=S or a carbon atom connected to R 2;
X 3 is CR 9, NR 10, O, S, C=O, C=S or a carbon atom connected to R 2;
X 4 is CR 11, NR 12, O, S, C=O, C=S or a carbon atom connected to R 2;
X 5, X 6 is independently selected from CR 13 or N;
X 7 is CR 14 or NR 14;
wherein at least one of X 1, X 2, X 3 and X 4 is a carbon atom connect to R 2;
at least one of X 5 and X 6 is N;
R 1 is H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, nitro, nitroso, cyano, amino, carboxyl, -C (O) OR 15, -NR 16R 17, aryl, heteroaryl or heterocyclyl; wherein said alkyl, cycloalkyl, alkoxyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 18;
R 2 is alkyl, cycloalkyl, -NR 19R 20, -C 1-6alkylNR 19R 20, haloalkyl, halogen, hydroxyl, alkoxyl, -C (O) NR 19R 20, aryl, heteroaryl or heterocyclyl; wherein said alkyl, alkoxyl, cycloalkyl, aryl, heteroaryl and heterocyclyl is optionally substituted by one or more R 21;
R 3 is independently H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl;
R 4 is aryl, heteroaryl, 
Figure PCTCN2022085296-appb-000003
each of which is optionally substituted by one or more R 22;
each R 5, R 6, R 7, R 8, R 9, R 10, R 11, R 12, and R 13 is independently H, alkyl, halogen, haloalkyl, cycloalkyl, hydroxyl, nitro, amino or alkoxyl;
each R 14, R 16, R 17, R 19, R 20 is independently H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, nitro, nitroso, cyano, amino, carboxyl, -C (O) OR 15, -NR 16R 17, aryl, heteroaryl or heterocyclyl; said alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 23;
Y is (C (R 15)  2)  m;
m is 0, 1, 2, 3;
each R 15 is independently H, hydroxyl, alkyl, cycloalkyl or halogen;
or R 16, R 17, together with N atom they are bound form a 3-to 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 24;
or R 19, R 20, together with N atom they are bound form a 3-to 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 25;
R 18 is halogen, cycloalkyl, alkyl, nitro, cyano, alkoxyl or hydroxyl;
R 23 is -NR 26R 27, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, nitro, carboxyl, -C (O) C 1-3 alkylNR 26R 27, -C (O) NR 26R 27, heterocyclyl, aryl, or heteroaryl, wherein alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of alkyl, alkoxyl, hydroxyl, amino and halogen;
each R 21, R 22, R 24, R 25 is independently selected from H, alkyl, alkenyl, alkynyl, cycloalkyl, alkoxyl, hydroxyl, amino, alkylamino-, nitro, carboxyl, cyano, halogen, -C (O) OR 28, -C (O) NR 29R 30, -C 1-3alkylC (O) NR 29R 30, -C (O) C 1-3alkylNR 29R 30, -S (O)  2R 28, -S (O) R 28, -S (O)  2NR 29R 30, -P (O) R 29R 30, aryl, heteroaryl or heterocyclyl, wherein aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of halogen, hydroxyl, amino, alkyl or alkoxyl;
each R 26, R 27, R 28, R 29, R 30 is independently selected from H, hydroxyl, alkyl, hydroxylalkyl, alkoxyl, amino, aminoalkyl, cycloalkyl or halogen;
or R 29 and R 30, along with the N or P atom form a 3-to 6-membered ring which is optionally substituted by one or more substituents independently selected from -C 1-6 alkyl.
In another aspect, the invention provided a pharmaceutical composition, comprising a therapeutically effective amount of compound of formula (I) , a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier, diluent, or excipient.
Also provided herein is use of the compound of formula (I) or pharmaceutical composition for the manufacture of a medicament for the prevention or treatment of a disease or condition. In some embodiments, the disease or condition is cancer selected from ovarian cancer, breast cancer or lung cancer.
Also provided herein is a method for preventing or treating a disease or condition, comprising administering to a subject a compound of formula (I) or a pharmaceutical composition in an amount effective for treating the disease or condition, wherein the disease or condition is selected from ovarian cancer, breast cancer or lung cancer.
DETAILED DESCRIPTION
The present invention provides compounds and methods for restoring wild-type function of p53 mutant. The compounds of the present invention can bind to p53 mutant and restore its ability to bind DNA. The restoration of activity of the p53 mutant can allow for the activation of downstream effectors of p53 leading to inhibition of cancer progression.
The Y220C mutant is a temperature sensitive mutant, which binds to DNA at lower temperature and is denatured at body temperature. A compound of the invention can selectively bind to the p53 Y220Cs and stabilize the Y220C mutant to reduce the likelihood of denaturation of the protein at body temperature.
The compounds of the invention are represented by formula (I)
Figure PCTCN2022085296-appb-000004
or a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof.
Wherein: Each
Figure PCTCN2022085296-appb-000005
is independently a single bond or a double bond; X 1 is CR 5, NR 6, O, S, C=O, C=S or a carbon atom connected to R 2; X 2 is CR 7, NR 8, O, S, C=O, C=S or a carbon atom connected to R 2; X 3 is CR 9, NR 10, O, S, C=O, C=S or a carbon atom connected to R 2; X 4 is CR 11, NR 12, O, S, C=O, C=S or a carbon atom connected to R 2; X 5, X 6 is independently selected from CR 13 or N; X 7 is CR 14 or NR 14; wherein at least one of X 1, X 2, X 3 and X 4 is a carbon atom connect to R 2; at least one of X 5 and X 6 is N; R 1 is H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, nitro, nitroso, cyano, amino, carboxyl, -C (O) OR 15, -NR 16R 17, aryl, heteroaryl or heterocyclyl; wherein said alkyl, cycloalkyl, alkoxyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 18; R 2 is alkyl, cycloalkyl, -NR 19R 20, -C 1-6alkylNR 19R 20, haloalkyl, halogen, hydroxyl, alkoxyl, -C (O) NR 19R 20, aryl, heteroaryl or heterocyclyl; wherein said alkyl, cycloalkyl, aryl, heteroaryl and heterocyclyl is optionally substituted by one or more R 21; R 3 is H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl; R 4 is aryl or heteroaryl, each of which is optionally substituted by one or more R 22; each R 5, R 6, R 7, R 8, R 9, R 10, R 11, R 12, R 13 and R 14 is independently H, alkyl, halogen, hydroxyl, nitro, amino or alkoxyl; each R 16 , R 17, R 19, R 20 is independently H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, carboxyl, -C (O) OR 15, aryl, heteroaryl or heterocyclyl; said alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 23; Y is (C (R 15)  2)  m; m is 0, 1, 2, 3; R 15 is H, alkyl, cycloalkyl or halogen; or R 16, R 17, together with N atom they are bound form a 3-to 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 24 ; or R 19, R 20, together with N atom they are bound form a 3-to 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 25; R 18 is halogen, cycloalkyl, alkyl, nitro, cyano, alkoxyl or hydroxyl; R 23 is -NR 26R 27, alkyl, cycloalkyl, haloalkyl, halogen,  hydroxyl, nitro, carboxyl, -C (O) C 1-3alkylNR 26R 27, -C (O) NR 26R 27, heterocyclyl, aryl, or heteroaryl, wherein alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of alkyl, alkoxyl, hydroxyl, amino and halogen; each R 21, R 22, R 24, R 25 is independently selected from alkyl, alkenyl, alkynyl, cycloalkyl, alkoxyl, hydroxyl, amino, nitro, carboxyl, cyano, halogen, -C (O) OR 28, -C (O) NR 29R 30, -S (O)  2R 28, -S (O) R 28, -S (O)  2NR 29R 30, aryl, heteroaryl or heterocyclyl, wherein aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of halogen, hydroxyl, amino, alkyl or alkoxyl; each R 26, R 27, R 28, R 29, R 30 is independently selected from H, alkyl, amino, cycloalkyl or halogen.
In some embodiments, the compound is of the formula
Figure PCTCN2022085296-appb-000006
In some embodiments, the compound is of the formula
Figure PCTCN2022085296-appb-000007
In some embodiments, the compound is of the formula
Figure PCTCN2022085296-appb-000008
In some embodiments, the compound is of the formula
Figure PCTCN2022085296-appb-000009
In some embodiments, the compound is of the formula
Figure PCTCN2022085296-appb-000010
In some embodiments, the compound is of the formula
Figure PCTCN2022085296-appb-000011
In some embodiments, R 1 is H, C 1-6alkyl, halo C 1-6alkyl, cycloalkyl, C 1-6 alkoxyl, C 6-12aryl, heterocyclyl or 5-to 12-membered  heteroaryl, wherein C 1-6alkyl, cycloalkyl, C 1-6 alkoxyl, C 6-12aryl, heterocyclyl or 5-to 12-membered heteroaryl is optionally substituted by one or more R 18, R 18 is halogen, cycloalkyl, alkyl, nitro, cyano, alkoxyl or hydroxyl.
In some embodiments, R 1 is C 1-6alkyl, halo C 1-6alkyl, cycloalkyl, C 1-6 alkoxyl, C 6-12aryl or 5-to 12-membered heteroaryl, said C 1-6alkyl is substituted by cycloalkyl or cyano.
In some embodiments, R 1 is selected from the group consisting of
Figure PCTCN2022085296-appb-000012
Figure PCTCN2022085296-appb-000013
In some embodiments, R 2 is alkyl, cycloalkyl, -NR 19R 20, -C 1-6alkylNR 19R 20, -C (O) NR 19R 20, or heterocyclyl. each R 19, R 20 is independently H, C 1-6alkyl, C 3-6cycloalkyl, haloC 1-6alkyl, halogen, hydroxyl, C 1-6alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, carboxyl, -C (O) OR 15, C 6-12aryl, 5-to 12-membered heteroaryl or 5-to 12-membered heterocyclyl. R 15 is H, alkyl, cycloalkyl or halogen. In some embodiments, R 19 is H, R 20 is alkyl, cycloalkyl or
Figure PCTCN2022085296-appb-000014
each of which is optionally substituted by one or more R 23;; wherein X is CH or N; Z is CR 23, NH, O, N-CH 3 or S (O)  2. R 23 is -NR 26R 27, C 1-6alkyl, haloC 1-6alkyl, halogen, hydroxyl, nitro, carboxyl, -C (O) C 1-3alkylNR 26R 27 or -C (O) NR 26R 27, said C 1-6alkyl is substituted by one or more substituents selected from the group consisting of alkyl, alkoxyl, hydroxyl, amino and halogen; R 26, R 27 is independently selected from H, alkyl, amino, cycloalkyl or halogen. In some embodiments, R 19, R 20, together with N atom they are bound form a 5-or 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 25.
In some embodiments, R 2 is selected from the group consisting of
Figure PCTCN2022085296-appb-000015
Figure PCTCN2022085296-appb-000016
In some embodiments, R 3 is H. R 4 is C 6-12aryl or 5-to 12-membered heteroaryl. Wherein said C 6-12aryl or 5-to 12-membered heteroaryl is optionally substituted by one or more R 22. R 22 is C 1-6alkyl, C 2-6alkenyl, C 2-6alkynyl, C 1-6alkoxyl, hydroxyl, amino, nitro, carboxyl, cyano, halogen, -C (O) OR 28, -C (O) NR 29R 30, -S (O)  2R 28, -S (O) R 28 or -S (O)  2NR 29R 30. In some embodiments, R 22 is C 1-6alkyl, C 1-6alkoxyl, halogen, -S (O)  2R 28 or -C (O) NR 29R 30. R 28, R 29, R 30 is independently selected from H, alkyl, amino, cycloalkyl or halogen. In some embodiments, R 3 is selected from the group consisting of
Figure PCTCN2022085296-appb-000017
Figure PCTCN2022085296-appb-000018
Non-limiting examples of compounds of Formula (I) of the present invention include the following compounds in table A.
Table A
Figure PCTCN2022085296-appb-000019
Figure PCTCN2022085296-appb-000020
Figure PCTCN2022085296-appb-000021
Figure PCTCN2022085296-appb-000022
Figure PCTCN2022085296-appb-000023
Figure PCTCN2022085296-appb-000024
Figure PCTCN2022085296-appb-000025
Figure PCTCN2022085296-appb-000026
Figure PCTCN2022085296-appb-000027
Figure PCTCN2022085296-appb-000028
Figure PCTCN2022085296-appb-000029
Figure PCTCN2022085296-appb-000030
Figure PCTCN2022085296-appb-000031
Figure PCTCN2022085296-appb-000032
Figure PCTCN2022085296-appb-000033
Figure PCTCN2022085296-appb-000034
Figure PCTCN2022085296-appb-000035
Figure PCTCN2022085296-appb-000036
Figure PCTCN2022085296-appb-000037
Figure PCTCN2022085296-appb-000038
Figure PCTCN2022085296-appb-000039
Figure PCTCN2022085296-appb-000040
Figure PCTCN2022085296-appb-000041
Figure PCTCN2022085296-appb-000042
Figure PCTCN2022085296-appb-000043
Figure PCTCN2022085296-appb-000044
Figure PCTCN2022085296-appb-000045
Figure PCTCN2022085296-appb-000046
Figure PCTCN2022085296-appb-000047
Figure PCTCN2022085296-appb-000048
Figure PCTCN2022085296-appb-000049
Figure PCTCN2022085296-appb-000050
Figure PCTCN2022085296-appb-000051
Figure PCTCN2022085296-appb-000052
Figure PCTCN2022085296-appb-000053
Figure PCTCN2022085296-appb-000054
Figure PCTCN2022085296-appb-000055
Figure PCTCN2022085296-appb-000056
Figure PCTCN2022085296-appb-000057
Figure PCTCN2022085296-appb-000058
Figure PCTCN2022085296-appb-000059
Figure PCTCN2022085296-appb-000060
Figure PCTCN2022085296-appb-000061
Figure PCTCN2022085296-appb-000062
Figure PCTCN2022085296-appb-000063
Figure PCTCN2022085296-appb-000064
Figure PCTCN2022085296-appb-000065
Figure PCTCN2022085296-appb-000066
Figure PCTCN2022085296-appb-000067
Figure PCTCN2022085296-appb-000068
Figure PCTCN2022085296-appb-000069
Figure PCTCN2022085296-appb-000070
Figure PCTCN2022085296-appb-000071
Figure PCTCN2022085296-appb-000072
Figure PCTCN2022085296-appb-000073
Figure PCTCN2022085296-appb-000074
Figure PCTCN2022085296-appb-000075
Figure PCTCN2022085296-appb-000076
Figure PCTCN2022085296-appb-000077
Figure PCTCN2022085296-appb-000078
Figure PCTCN2022085296-appb-000079
Figure PCTCN2022085296-appb-000080
Figure PCTCN2022085296-appb-000081
Figure PCTCN2022085296-appb-000082
Figure PCTCN2022085296-appb-000083
Figure PCTCN2022085296-appb-000084
Figure PCTCN2022085296-appb-000085
Figure PCTCN2022085296-appb-000086
Figure PCTCN2022085296-appb-000087
Figure PCTCN2022085296-appb-000088
Figure PCTCN2022085296-appb-000089
Figure PCTCN2022085296-appb-000090
Figure PCTCN2022085296-appb-000091
Figure PCTCN2022085296-appb-000092
Figure PCTCN2022085296-appb-000093
Figure PCTCN2022085296-appb-000094
Figure PCTCN2022085296-appb-000095
Figure PCTCN2022085296-appb-000096
Figure PCTCN2022085296-appb-000097
Figure PCTCN2022085296-appb-000098
Figure PCTCN2022085296-appb-000099
Figure PCTCN2022085296-appb-000100
Figure PCTCN2022085296-appb-000101
Figure PCTCN2022085296-appb-000102
Figure PCTCN2022085296-appb-000103
Figure PCTCN2022085296-appb-000104
Figure PCTCN2022085296-appb-000105
Figure PCTCN2022085296-appb-000106
Figure PCTCN2022085296-appb-000107
Figure PCTCN2022085296-appb-000108
Figure PCTCN2022085296-appb-000109
Figure PCTCN2022085296-appb-000110
Figure PCTCN2022085296-appb-000111
Figure PCTCN2022085296-appb-000112
Figure PCTCN2022085296-appb-000113
Figure PCTCN2022085296-appb-000114
Figure PCTCN2022085296-appb-000115
Figure PCTCN2022085296-appb-000116
Figure PCTCN2022085296-appb-000117
Figure PCTCN2022085296-appb-000118
Figure PCTCN2022085296-appb-000119
Figure PCTCN2022085296-appb-000120
Figure PCTCN2022085296-appb-000121
Figure PCTCN2022085296-appb-000122
Figure PCTCN2022085296-appb-000123
Figure PCTCN2022085296-appb-000124
Figure PCTCN2022085296-appb-000125
Figure PCTCN2022085296-appb-000126
Figure PCTCN2022085296-appb-000127
Figure PCTCN2022085296-appb-000128
Figure PCTCN2022085296-appb-000129
Figure PCTCN2022085296-appb-000130
In another aspect of the present invention, the compound of Formula (I) is represented by formula (II) :
Figure PCTCN2022085296-appb-000131
wherein:
R 3 is selected from the group consisting of H, -hydroxyl, -halogen, -nitro, -cyano, -C 1-6alkyl, -C 1-6alkoxyl, halo C 1-6alkyl-and -cycloalkyl;
R 14 is selected from the group consisting of -C 1-6alkyl, halo C 1-6alkyl-and -cycloalkyl, each of which is optionally substituted by –cyano, C 1-6alkoxyl or –cycloalkyl;
R 2 is selected from the group consisting of -NR 19R 20, -C 1-6alkylNR 19R 20, -C (O) NR 19R 20, aminoacyl-and aminoC 1-6alkoxyl-.
R 19 and R 20 is independently selected from the group consisting of H, -C 1-6alkyl, aminoC 1-6alkyl-, 3-to 6-membered cycloalkyl, 3-to 6-membered heterocycle, aryl, heteroaryl, or arylC 1-3alkyl-, wherein said C 1-6alkyl, aminoC 1-6alkyl-, 3-to 6-membered cycloalkyl, 3-to 6-membered heterocycle, aryl, heteroaryl or arylC 1-3alkyl-is independently optionally substituted by one or more R 21;
or R 19 and R 20, along with the N atom to which they are attached, form a 3-to 6-membered saturated or unsaturated ring which is optionally substituted by one or more R 21
R 21 is independently selected from the group consisting of -hydroxyl, -C 1-6alkyl, -cyano, -C (O) NR’R”, C 1-6alkylcarbonyl-, -C 1-3alkylC (O) NR’R”, -C (O) C 1-3alkylNR’R”, -C 1-6alkylOH, C 1-3alkylsulfonyl-, C 1-3alkylamino-and heterocycyl, wherein said C 1-3alkylamino-and heterocycyl is optionally substituted by one or more of hydroxyl or -amino;
R’ or R” is independently selected from H or -C 1-3alkyl;
or R’ and R”, along with the N atom to which they are attached, form a 3-to 6-membered heterocycle, said 3-to 6-membered heterocycle is optionally substituted by one or more of hydroxyl or -amino;
A is an aryl or heteroaryl, said aryl or heteroaryl is optionally substituted by one or more R 22;
R 22 and
Figure PCTCN2022085296-appb-000132
are at both ends of a bond;
R 22 is selected from H, halogen, -C 1-3 alkyl, -C 1-3 alkoxyl, -cyano;
or R 22 and R 29, along with the atom to which they are attached, form a 5-6 membered ring;
R 29 and R 30 is independently selected from the group consisting of -hydroxyl, -cycloalkyl, -C 1-6 alkyl, aminoC 1-3alkyl-, -amino, -C 1-6alkoxyl and hydroxyC 1-6alkyl-;
or R 29 and R 30, along with the P atom form a 3-to 6-membered ring which is optionally substituted by one or more substituents independently selected from -C 1-6 alkyl.
In some embodiments, the A moiety of the compound of Formula (II) of the present invention is 5 or 6 membered aryl or heteroaryl, which is optionally substituted by one or more R 22.
In some embodiments, the compound of Formula (II) of the present invention is selected from compounds in table B shown below.
Table B
Figure PCTCN2022085296-appb-000133
Figure PCTCN2022085296-appb-000134
Figure PCTCN2022085296-appb-000135
Figure PCTCN2022085296-appb-000136
Figure PCTCN2022085296-appb-000137
Figure PCTCN2022085296-appb-000138
Figure PCTCN2022085296-appb-000139
Figure PCTCN2022085296-appb-000140
Figure PCTCN2022085296-appb-000141
Figure PCTCN2022085296-appb-000142
Figure PCTCN2022085296-appb-000143
Figure PCTCN2022085296-appb-000144
Figure PCTCN2022085296-appb-000145
In another aspect of the present invention, the compound of Formula (I) of the present invention is represented by formula (III) :
Figure PCTCN2022085296-appb-000146
wherein A is aryl or heteroaryl, each of which is optionally substituted by one or more R 22;
Z 1, Z 2 or Z 3 is independently selected from CR’R”, O, S, S (O)  2 or NR’;
each R’ or R” is independently H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl;
and
R 1, R 2, R 3, R 14, or Y is defined as that in the formula (I) above.
In some embodiments, the A moiety of the compound of formula (III) is phenyl.
In some embodiments, 
Figure PCTCN2022085296-appb-000147
of the compound of formula (III) is selected from the group consisting of
Figure PCTCN2022085296-appb-000148
Figure PCTCN2022085296-appb-000149
In some embodiments, the compound of formula (III) of the present invention is selected from compounds in table C shown below.
Table C
Figure PCTCN2022085296-appb-000150
Figure PCTCN2022085296-appb-000151
Figure PCTCN2022085296-appb-000152
Figure PCTCN2022085296-appb-000153
Figure PCTCN2022085296-appb-000154
Figure PCTCN2022085296-appb-000155
Figure PCTCN2022085296-appb-000156
Figure PCTCN2022085296-appb-000157
Figure PCTCN2022085296-appb-000158
Figure PCTCN2022085296-appb-000159
Figure PCTCN2022085296-appb-000160
Figure PCTCN2022085296-appb-000161
Figure PCTCN2022085296-appb-000162
Figure PCTCN2022085296-appb-000163
Figure PCTCN2022085296-appb-000164
Figure PCTCN2022085296-appb-000165
Figure PCTCN2022085296-appb-000166
Figure PCTCN2022085296-appb-000167
Figure PCTCN2022085296-appb-000168
Figure PCTCN2022085296-appb-000169
Figure PCTCN2022085296-appb-000170
Figure PCTCN2022085296-appb-000171
Figure PCTCN2022085296-appb-000172
Figure PCTCN2022085296-appb-000173
Figure PCTCN2022085296-appb-000174
Figure PCTCN2022085296-appb-000175
Figure PCTCN2022085296-appb-000176
In other aspect, there is provided a compound of formula (IV) targeting p53 Y220C mutant, a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof;
Figure PCTCN2022085296-appb-000177
wherein,
D 1 is CR D, N, or a carbon atom connected to Y 4;
D 2 is CR D, N, or a carbon atom connected to Y 4;
D 3 is CR D, N, or a carbon atom connected to Y 4;
D 4 is CR D, or N;
ring E is selected from a 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 member heteroaryl; said ring E is optionally substituted with one or more R E;
R E at each occurrence is independently selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a1, -SR a1, -C (O) R b1, -C (O) NR c1R d1, -C (O) OR a1, -OC (O) R b1, -OC (O) NR c1R d1, -C (=NR e1) R b1, -C (=NR e1) NR c1R d1, -NR c1C (=NR e1) NR c1R d1, -NR c1R d1, -NR c1C (O) R b1, -NR c1C (O) OR a1, -NR c1C (O) NR c1R d1, -S (O) R b1, -S (O) NR c1 R d1, -NR c1S (O) R b1, -NR c1S (O) NR c1R d1, -S (O)  2R b1, -S (O)  2NR c1R d1, -NR c1S (O)  2R b1, -NR c1S (O)  2NR c1R d1, -PO (R c1)  2, -PO 2, 3-1 2 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a1, -SR a1, -C (O) R b1, -C (O) NR c1R d1, -C (O) OR a1, -OC (O) R b1, -OC (O) NR c1R d1, -C (=NR e1) R b1, -C (=NR e1) NR c1R d1, -NR c1C (=NR e1) NR c1R d1, -NR c1R d1, -NR c1C (O) R b1, -NR c1C (O) OR a1, -NR c1C (O) NR c1R d1, -S (O) R b1, -S (O) NR c1R d1, -NR c1S (O) R b1, NR c1S (O) NR c1R d1, -S (O)  2R b1, -S (O)  2NR c1R d1, -NR c1S (O)  2R b1, -NR c1S (O)  2NR c1R d1, -PO (R c1)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl;
each of Y 1, Y 2, Y 3, and Y 4 at each occurrence is independently selected from –CR Y1R Y2-, -CR Y1=CR Y2-, -C≡C-, -C (=N) -, -O-, -N (R Y1) -, -S-, -SO-, -SO 2-, or -CO-;
R Y3 is selected from hydrogen, halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a2, -SR a2, -C (O) R b2, -C (O) NR c2R d2, -C (O) OR a2, -OC (O) R b2, -OC (O) NR c2R d2, -NR c2R d2, -NR c2C (O) R b2, -NR c2C (O) OR a2, -NR c2C (O) NR c2R d2, -C (=NR e2) R b2, -C (=NR e2) NR c2R d2, -NR c2C (=NR e2) NR c2R d2, -S (O) R b2, -S (O) NR c2R d2, -NR c2S (O) R b2, -NR c2S (O) NR c2R d2, -S (O)  2R b2, -S (O)  2NR c2R d2, -NR c2S (O)  2R b2, -NR c2S (O)  2NR c2R d2, -PO (R c2)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a2, -SR a2, -C (O) R b2, -C (O) NR c2R d2, -C (O) OR a2, -OC (O) R b2, -OC (O) NR c2R d2, -NR c2R d2, -NR c2C (O) R b2, -NR c2C (O) OR a2, -NR c2C (O) NR c2R d2, -C (=NR e2) R b2, -C (=NR e2) NR c2R d2, -NR c2C (=NR e2) NR c2R d2, -S (O) R b2, -S (O) NR c2R d2, -NR c2S (O) R b2, -NR c2S (O) NR c2R d2, -S (O)  2R b2, -S (O)  2NR c2R d2, -NR c2S (O)  2R b2, -NR c2S (O)  2NR c2R d2, -PO (R c2)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl;
R Y4 is selected from hydrogen, halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a3, -SR a3, -C (O) R b3, -C (O) NR c3R d3, -C (O) OR a3, -OC (O) R b3, -OC (O) NR c3R d3, -NR c3R d3, -NR c3C (O) R b3, -NR c3C (O) OR a3, -NR c3C (O) NR c3R d3, -C (=NR e3) R b3, -C (=NR e3) NR c3R d3, -NR c3C (=NR e3) NR c3R d3, -S (O) R b3, -S (O) NR c3R d3, -NR c3S (O) R b3, -NR c3S (O) NR c3R d3, -S (O)  2R b3, -S (O)  2NR c3R d3, -NR c3S (O)  2R b3, -NR c3S (O)  2NR c3R d3, -PO (R c3)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more R’ Y4;
R’ Y4 at each occurrence is independently selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a4, -SR a4, -C (O) R b4, -C (O) NR c4R d4, -C (O) - (C 1-6alkylene) -NR c4R d4, -C (O) OR a4, -OC (O) R b4, -OC  (O) NR c4R d4, -NR c4R d4, -NR c4C (O) R b4, -NR c4C (O) OR a4, -NR c4C (O) NR c4R d4, -C (=NR e4) R b4, -C (=NR e4) NR c4R d4, -NR c4C (=NR e 4) NR c4R d4, -S (O) R b4, -S (O) NR c4R d4, -NR c4S (O) R b4, -NR c4S (O) NR c4R d4, -S (O)  2R b4, -S (O)  2NR c4R d4, -NR c4S (O)  2R b4, -NR c4S (O)  2NR c4R d4, -PO (R c4)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a4, -SR a4, -C (O) R b4, -C (O) NR c4R d4, -C (O) - (C 1-6alkylene) -NR c4R d4, -C (O) OR a4, -OC (O) R b4, -OC (O) NR c4R d4, -NR c4 R d4, -NR c4C (O) R b4, -NR c4C (O) OR a4, -NR c4C (O) NR c4R d4, -C (=NR e4) R b4, -C (=NR e4) NR c4R d4, -NR c4C (=NR e4) NR c4R d4, -S (O) R b 4, -S (O) NR c4R d4, -NR c4S (O) R b4, -NR c4S (O) NR c4R d4, -S (O)  2R b4, -S (O)  2NR c4R d4, -NR c4S (O)  2R b4, -NR c4S (O)  2NR c4R d4, -PO (R c4)  2, -PO 2, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12aryl ring, or 5-12 membered heteroaryl ring;
R D, R Y1 and R Y2 at each occurrence are independently selected from hydrogen, halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2- 6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a5, -SR a5, -C (O) R b5, -C (O) NR c5R d5, -C (O) OR a5, -OC (O) R b5, -OC (O) NR c 5R d5, -NR c5R d5, -NR c5C (O) R b5, -NR c5C (O) OR a5, -NR c5C (O) NR c5R d5, -C (=NR e5) R b5, -C (=NR e5) NR c5R d5, -NR c5C (=NR e5) NR c5 R d5, -S (O) R b5, -S (O) NR c5R d5, -NR c5S (O) R b5, -NR c5S (O) NR c5R d5, -S (O)  2R b5, -S (O)  2NR c5R d5, -NR c5S (O)  2R b5, -NR c5S (O)  2NR c5 R d5, -PO (R c5)  2, -PO 2, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12aryl ring, or 5-12 membered heteroaryl ring; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered carbocyclic ring, 3-12 mem bered heterocyclic ring, -C 6-12 aryl ring or 5-12 membered heteroaryl ring at each occurrence is independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a5, -SR a5, -C (O) R b5, -C (O) NR c5R d5, -C (O) OR a5, -OC (O) R b5, -OC (O) NR c5R d5, -NR c5R d5, -NR c5C (O)R b5, -NR c5C (O) OR a5, -NR c5C (O) NR c5R d5, -C (=NR e5) R b5, -C (=NR e5) NR c5R d5, -NR c5C (=NR e5) NR c5R d5, -S (O) R b5, -S (O) NR c 5R d5, -NR c5S (O) R b5, -NR c5S (O) NR c5R d5, -S (O)  2R b5, -S (O)  2NR c5R d5, -NR c5S (O)  2R b5, -NR c5S (O)  2NR c5R d5, -PO (R c5)  2, -PO 2, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12aryl ring, or 5-12 membered heteroaryl ring;
each R a1, R b1, R c1, R d1, R a2, R b2, R c2, R d2, R a3, R b3, R c3, R d3, R a4, R b4, R c4, R d4, R a5, R b5, R c5, or R d5 is independently selected from -H, -C 1-6alkyl, -C 1-6haloalkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6alkoxy, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 1-6haloalkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6alkoxy, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -OH, -CN, -NH 2, -C 1-6alkyl, -C 1-6haloalkyl, or -C 1-6alkoxy; each R e1, R e2, R e3, R e4, or R e5 is independently selected from -H, -C 1-4alkyl, -C 1-4alkoxy, or -CN;
n 1 is 0, 1, 2 or 3;
n 2 is 0, 1, 2 or 3;
n 3 is 0, 1, 2 or 3;
n 4 is 0, 1, 2 or 3;
m 3 is 0, 1, 2, 3, 4, 5, or 6;
each of heterocycloalkyl, heterocycloalkenyl, and heteroaryl at each occurrence independently contains one or more heteroatoms selected from N, O or S.
In some embodiments, the moiety of ring A in the compound of formula (IV) is selected from 4 membered cycloalkyl, 4 membered cycloalkenyl, 4 membered heterocycloalkyl, 4 membered heterocycloalkenyl, 5 membered cycloalkyl, 5 membered cycloalkenyl, 5 membered heterocycloalkyl, 5 membered heterocycloalkenyl, 6 membered cycloalkyl, 6 membered cycloalkenyl, 6 membered heterocycloalkyl, 6 membered heterocycloalkenyl, 7 membered cycloalkyl, 7 membered cycloalkenyl, 7 membered heterocycloalkyl, 7 membered heterocycloalkenyl, 8 membered cycloalkyl, 8 membered cycloalkenyl, 8 membered heterocycloalkyl, 8 membered heterocycloalkenyl, 9 membered cycloalkyl, 9 membered cycloalkenyl, 9 membered heterocycloalkyl, 9 membered heterocycloalkenyl, phenyl, naphthyl, biphenyl, 5 membered heteroaryl, 6 membered heteroaryl, 7 membered heteroaryl, 8 membered heteroaryl, 9 membered heteroaryl, 10 membered heteroaryl, 11 membered heteroaryl, or 12 membered heteroaryl; each of heterocycloalkyl, heterocycloalkenyl and heteroaryl at each occurrence independently contains 1, 2, or 3 heteroatoms selected from N, O or S.
In some embodiments, the compound of formula (IV) of the present invention is selected from compounds in table D shown below:
Table D
Figure PCTCN2022085296-appb-000178
Figure PCTCN2022085296-appb-000179
Figure PCTCN2022085296-appb-000180
Figure PCTCN2022085296-appb-000181
Figure PCTCN2022085296-appb-000182
Figure PCTCN2022085296-appb-000183
Figure PCTCN2022085296-appb-000184
Figure PCTCN2022085296-appb-000185
Figure PCTCN2022085296-appb-000186
In some embodiments, there is provided a pharmaceutical composition containing a therapeutically effective amount of the compound of formula (I) , (II) , (III) or (IV) of the present invention, and a pharmaceutically acceptable carrier, diluent, or excipient.
In some embodiments, there is provided use of the compound of formula (I) , (II) , (III) or (IV) or the pharmaceutical composition containing said compounds of the present invention for the manufacture of a medicament for the prevention or treatment of a disease or condition.
In some embodiments, there is provided a method for preventing or treating a disease or condition related to p53 mutant, comprising administering to a subject a therapeutically effective amount of the above-mentioned compound or pharmaceutical composition of the present invention.
The total number of carbon atoms present in a chemical group as defined herein is represented by a shorthand notation before the group. For example, C 1-6 alkyl refers to an alkyl group as defined hereinafter having 1 to 6 carbon atoms in total; C 3-8 cycloalkyl refers to a cycloalkyl group as defined hereinafter having 3 to 8 carbon atoms in total; C 6-12 aryl refers to an aryl group as defined hereinafter having 6 to 12 carbon atoms in total. Carbon atoms that may exist in the substituents of the chemical group are not included in the total number of carbon atoms in the shorthand notation.
Unless otherwise indicated in this specification, all combined groups according to the present invention (i.e., groups comprised of two or more groups) are attached to the rest of the molecule in such a way that the lastly described group acts as the point of  attachment. By way of example, "arylalkyl" means that the aryl group is attached to the rest of the molecule via the alkyl group; "alkoxyl" means that the aliphatic group is attached to the rest of the molecule via an oxy group; etc.
In the present application, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not. For example, "alkyl optionally substituted by one or more halogens" means the alkyl group is unsubstituted or substituted by one or more halogens, and that the description includes both substituted alkyl groups and unsubstituted alkyl groups.
“Substitute” or “substituted” refers to the H attached to carbon may be substituted, or the H attached to heteroatom may be substituted, said heteroatom including but not limited to N, O or S.
The term "stereoisomer" refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures. The present invention contemplates various stereoisomers and mixtures thereof.
The term “tautomer” refers to an isomer resulted from a proton shift from one atom of a molecule to another atom of the same molecule. All tautomeric forms of the compound of formula Ⅰ of the present invention are include within the scope of the present invention.
Unless specified otherwise, the alkenyl of the compound in the present application includes both E-and Z-geometric isomers.
Unless specified otherwise, the bound
Figure PCTCN2022085296-appb-000187
in this application includes
Figure PCTCN2022085296-appb-000188
All isotopes of any particular atom or element as specified are contemplated within the scope of the compounds of the invention and their uses. Isotopes include those atoms having the same atomic number but different mass numbers. Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine and iodine, such as 2H, 3H, 11C, 13C, 14C, 13N, 15N, 15O, 17O, 18O, 32P, 33P, 35S, 18F, 36Cl, 123I or 125I. By way of general example and without limitation, isotopes of hydrogen include deuterium and tritium. The isotopes of hydrogen can be denoted as 1H (hydrogen) , 2H (deuterium) and 3H (tritium) . They are also commonly denoted as D for deuterium and T for tritium. In the application, CD3 denotes a methyl group wherein all of the hydrogen atoms are deuterium. Isotopes of carbon include 13C and 14C. Isotopically labeled compounds of the present disclosure are equivalent to those unlabeled, for example, deuterated compounds of the present disclosure are equivalent to those non-deuterated. Isotopically-labeled compounds of the invention can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein, using an appropriate isotopically-labeled reagent in place of the non-labeled reagent.
In addition to the above-mentioned, as used in the specification and claims, unless otherwise indicated, the following terms have the meanings as set forth below:
"amino" refers to the -NH2 group.
"cyano" refers to the -CN group.
"hydroxy" refers to the---OH group
"nitro" refers to the -NO2 group.
“carboxyl” refers to the –COOH group.
“nitroso” refers to the-N=O group.
The term “halogen” , as used herein, unless otherwise indicated, means fluoro, chloro, bromo or iodo. The preferred halogen groups include -F, -Cl and -Br.
The term “alkyl” , as used herein, unless otherwise indicated, includes saturated monovalent hydrocarbon radicals having straight or branched. For example, alkyl radicals include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, 3- (2-methyl) butyl, 2-pentyl, 2-methylbutyl, neopentyl, n-hexyl, 2-hexyl and 2-methylpentyl. Similary, C 1-6, as in C 1-6alkyl is defined to identify the group as having 1, 2, 3, 4, 5 or 6 carbon atoms in a linear or branched arrangement.
The term “alkenyl” means a straight or branch-chained hydrocarbon radical containing one or more double bonds and typically from 2 to 20 carbon atoms in length. For example, “C 2-6alkenyl” contains from 2 to 6 carbon atoms. Alkenyl group include, but are not limited to, for example, ethenyl, propenyl, butenyl, 2-methyl-2-buten-1-yl, hepetenyl, octenyl and the like.
The term “alkynyl” contains a straight or branch-chained hydrocarbon radical containing one or more triple bonds and typically from 2 to 20 carbon atoms in length. For example, “C 2-6alkynyl” contains from 2 to 6 carbon atoms. Representative alkynyl groups include, but are not limited to, for example, ethynyl, 1-propynyl, 1-butynyl, heptynyl, octynyl and the like.
The term “alkoxyl” radicals are oxygen ethers formed from the previously described alkyl groups.
The term “cycloalkyl” refers to a substituted or unsubstituted monocyclic ring, bicyclic ring bridged ring, fused ring, sipiro ring non-aromatic ring system onle containing carbon atoms. Examplary “cycloalkyl” groups includes but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and so on.
The term “aryl” , as used herein, unless otherwise indicated, refers to an unsubstituted or substituted mono or polycyclic aromatic ring system containing carbon ring atoms. The preferred aryls are mono cyclic or bicyclic aromatic ring systems. Phenyl and naphthyl are preferred aryls.
The term “heteroaryl” , as used herein, unless otherwise indicated, represents an aromatic ring system containing carbon (s) and at least one heteroatom. Heteroaryl may be monocyclic or polycyclic, substituted or unsubstituted. A monocyclic heteroaryl group may have 1 to 4 heteroatoms in the ring, while a polycyclic heteroaryl may contain 1 to 10 hetero atoms. A polycyclic heteroaryl ring may contain fused, spiro or bridged ring junction, for example, bycyclic heteroaryl is a polycyclic heteroaryl. Bicyclic heteroaryl rings may contain from 8 to 12 member atoms. Monocyclic heteroaryl rings may contain from 5 to 8 member atoms (cabons and heteroatoms) . Examples of heteroaryl groups include, but are not limited to thienyl, furanyl, imidazolyl, isoxazolyl, oxazolyl, pyrazolyl, pyrrolyl, thiazolyl, thiadiazolyl, triazolyl, pyridyl, pyridazinyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, benzofuranyl, benzothienyl, benzisoxazolyl, benzoxazolyl, benzopyrazolyl, benzothiazolyl, benzothiadiazolyl, benzotriazolyl adeninyl, quinolinyl or isoquinolinyl.
In the present application, as an independent group or a part of other group (s) , the term "heterocyclyl" refers to a stable 3-to 18-membered non-aromatic ring group comprising 1 to 6 heteroatoms selected from the group consisting of nitrogen, oxygen and sulphur. Unless indicated otherwise specifically in the specification, the heterocyclyl group may be a monocyclic, bicyclic, tricyclic or polycyclic ring system, which may include fused or bridged ring systems. For purpose of the present invention, heterocyclyl is preferably a stable 3-to 12-membered non-aromatic monocyclic or bicyclic ring group comprising 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulphur, more preferably a stable 3-to 8-membered non-aromatic monocyclic ring group comprising 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulphur. The nitrogen, carbon or sulphur atom in the heterocyclyl groupmay be optionally oxidized; the nitrogen atom may be optionally quatemized; and the heterocyclyl group may be partially or fully saturated. The heterocyclyl group may be attached to the rest of the molecule by a single bond via a carbon atom or a heteroatom. In a heterocyclyl group containing fused rings, one or more rings may be aryl or heteroaryl.
The term “composition” , as used herein, is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts. Accordingly, pharmaceutical compositions containing the compounds of the present invention as the active ingredient as well as methods of preparing the instant compounds are also part of the present invention. Furthermore, some of the crystalline forms for the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e., hydrates) or common organic solvents and such solvates are also intended to be encompassed within the scope of this invention.
When the compound and pharmaceutically acceptable salts thereof exist in the form of solvates or polymorphic forms, the present invention includes any possible solvates and polymorphic forms. A type of a solvent that forms the solvate is not particularly limited so long as the solvent is pharmacologically acceptable. For example, water, ethanol, propanol, acetone or the like can be used.
The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids. When the compound of the present invention is acidic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic bases, including inorganic bases and organic bases. When the compound of the present invention is basic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Since the compounds are intended for pharmaceutical use they are preferably provided in substantially pure form, for example at least 60%pure, more suitably at least 75%pure, especially at least 98%pure (%are on a weight for weight basis) .
The pharmaceutical compositions of the present invention comprise a compound (or a pharmaceutically acceptable salt thereof) as an active ingredient, a pharmaceutically acceptable carrier and optionally other therapeutic ingredients or adjuvants. The compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered. The pharmaceutical compositions may be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
In practice, the compounds or a prodrug or a metabolite or pharmaceutically acceptable salts thereof, of this invention can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g. oral or parenteral (including intravenous) . Thus, the pharmaceutical compositions of the present invention can be presented as discrete units suitable for oral administration such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient. Further, the compositions can be presented as a powder, as granules, as a solution, as a suspension in an aqueous liquid, as a non-aqueous liquid, as an oil-in-water emulsion or as a water-in-oil liquid emulsion. In addition to the common dosage forms set out above, the compound or a pharmaceutically acceptable salt thereof, may also be administered by controlled release means and/or delivery devices. The compositions may be prepared by any of the methods of pharmacy. In general, such methods include a step of bringing into association the active ingredient with the carrier that constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped into the desired presentation.
Thus, the pharmaceutical compositions of this invention may include a pharmaceutically acceptable carrier and a compound or a pharmaceutically acceptable salt. The compounds or pharmaceutically acceptable salts thereof, can also be included in pharmaceutical compositions in combination with one or more other therapeutically active compounds.
A tablet containing the composition of this invention may be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants. Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent. Each tablet preferably contains from about 0.05mg to about 5g of the active ingredient and each cachet or capsule preferably containing from about 0.05mg to about 5g of the active ingredient. For example, a formulation intended for the oral administration to humans may contain from about 0.5mg to about 5g of active agent, compounded with an appropriate and convenient amount of carrier material which may vary from about 0.05 to about 95 percent of the total composition. Unit dosage forms will generally contain between from about 0.0lmg to about 2g of the active ingredient, typically 0.01mg, 0.02mg, 1mg, 2mg, 3mg, 4mg, 5mg, 6mg, 7mg, 8mg, 9mg, 10mg, 25mg, 50mg, l00mg, 200mg, 300mg, 400mg, 500mg, 600mg, 800mg or l000mg.
Pharmaceutical compositions of the present invention suitable for parenteral administration may be prepared as solutions or suspensions of the active compounds in water. A suitable surfactant can be included such as, for example, hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Further, a preservative can be included to prevent the growth of detrimental microorganisms.
Pharmaceutical compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. In all cases, the final injectable form must be sterile and must be effectively fluid for easy syringability. The pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol) , vegetable oils, and suitable mixtures thereof.
Pharmaceutical compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder or the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations may be prepared, utilizing a compound of this invention or a pharmaceutically acceptable salt thereof, via conventional processing methods. As an example, a cream or ointment is prepared by admixing hydrophilic material and water, together with about 0.05wt%to about 10wt%of the compound, to produce a cream or ointment having a desired consistency.
Pharmaceutical compositions of this invention can be in a form suitable for rectal administration wherein the carrier is a solid. It is preferable that the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by first admixing the composition with the softened or melted carrier (s) followed by chilling and shaping in molds.
In addition to the aforementioned carrier, the pharmaceutical formulations described above may include, as appropriate, one or more additional carrier such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like. Furthermore, other adjuvants can be included to render the formulation  isotonic with the blood of the intended recipient. Compositions containing a compound or pharmaceutically acceptable salts thereof, may also be prepared in powder or liquid concentrate form.
Generally, dosage levels on the order of from about 0.001mg/kg to about 150mg/kg of body weight per day are useful in the treatment of the above-indicated conditions or alternatively about 0.05mg to about 7g per patient per day. For example, inflammation, cancer, psoriasis, allergy/asthma, disease and conditions of the immune system, disease and conditions of the central nervous system (CNS) , may be effectively treated by the administration of from about 0.001 to 50mg of the compound per kilogram of body weight per day or alternatively about 0.05mg to about 3.5g per patient per day.
It is understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods. All parts and percentages are by weight and all temperatures are by degrees Celsius, unless explicitly stated otherwise.
The following abbreviations have been used in the examples:
Abbreviation Meaning
THF Tetrahydrofuran
EA Ethyl acetate
DCM Methylene Chloride
TEA Triethylamine
EtOH ethanol
TFA Trifluoroacetic acid
DPPA Diphenyl phosphoryl azide
DMSO Dimethyl sulfoxide
EXAMPLES
Example part A
Example A-1
4- ( (3- (8- ( (1-methylpiperidin-4-yl) amino) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfo namide (A-1)
The compound 1 is synthesized according to the scheme below.
Figure PCTCN2022085296-appb-000189
Step1. ethyl 3-amino-8-bromo-imidazo [1, 2-a] pyridine-2-carboxylate
3-bromopyridin-2-amine (5.03 g, 29.07 mmol) and ethyl 2-oxoacetate (5.68 g, 55.63 mmol) were dissolved in THF (10 mL) . The mixture was stirred at room temperature for 1 h. TEA (6.50 g, 57.94mmol) and trimethylsilanecarbonitrile (6.19 g, 62.39 mmol) were added at 0℃ in dropwise. The reaction was stirred under microwave at 120 ℃ for 0.5 h. The reaction mixture was concentrated under vacuum to afford the crude product. The crude was purified by silica gel column eluted with EA/hexane (v/v=4/1) to obtain 0.77g ethyl 3-amino-8-bromo-imidazo [1, 2-a] pyridine-2-carboxylate as yellow solid. LCMS: m/z = 284 [M+1]  +. (10%yield) 
Step 2. ethyl 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-2-carboxylate.
Ethyl 3-amino-8-bromo-imidazo [1, 2-a] pyridine-2-carboxylate (0.802 g, 2.82 mmol) and 2, 5-Dimethoxytetrahydrofuran were dissolved in acetic acid (1 mL) and DCM (10 mL) . The reaction was stirred at 80 ℃ for 1 h. The reaction mixture was concentrated under vacuum to afford the crude product. The crude was purified by silica gel column eluted with EA/hexane (v/v=3/2) to obtain 0.91 g ethyl 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-2-carboxylate as light yellow solid. LCMS: m/z = 334 [M+1]  +. (96%yield)
Step3. 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-2-carboxylic acid. ethyl 8-bromo-3-pyrrol-1-yl-imidazo [1, 2-a] pyridine-2-carboxylate (0.798 g, 2.38mmol) , NaOH (0.29 g, 7.45 mmol) were dissolved in EtOH (10 mL) and water (2 mL) . The reaction mixture was stirred at 50 ℃ for 1 h. The mixture was concentrated under vacuum. The residue was dissolved in water and adjusted PH to 7～8 with HCl (aq, 12N) . The resulted solution was extracted with EA (3 x 30 mL) , washed with brine (2 x 30 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum to obtain 0.69 g 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-2-carboxylicacid as light red solid. LCMS: m/z = 306 [M+1]  +. (95%yield)
Step4.
tert-butyl (8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) carbamate
8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-2-carboxylic acid (0.40g, 1.31 mmol) , DPPA (0.48g, 1.76 mmol) and N, N-Diisopropylethylamine (0.52 g, 4.04 mmol) were dissolved in tert-Butanol (8 mL) . The reaction mixture was stirred overnight under reflux. The reaction mixture was concentrated under vacuum to afford the crude product. The crude was purified by silica gel column eluted with EA/hexane (v/v=6/1) to obtain 0.38 g tert-butyl N- (8-bromo-3-pyrrol-1-yl-imidazo [1, 2-a] pyridin-2-yl) carbamate as off-white solid. LCMS: m/z = 377 [M+1]  +. (77%yield)
Step 5. 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-amine.
Tert-butyl N- (8-bromo-3-pyrrol-1-yl-imidazo [1, 2-a] pyridin-2-yl) carbamate (0.34 g, 909.24 μmol) was dissolved in DCM (8 mL) and TFA (4 mL) . The reaction mixture was stirred at room temperature for 2h. The residue was dissolved in water and adjusted PH to 7～8 with NaOH (aq, 2M) . The resulted solution was extracted with EA (3 x 30 mL) , washed with brine (2 x 30 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum to obtain 0.24 g 8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-amine as off-white solid. LCMS: m/z = 277 [M+1]  +. (96%yield)
Step 6. 8-bromo-2-iodo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine.
8-bromo-3-pyrrol-1-yl-imidazo [1, 2-a] pyridin-2-amine (0.23 g, 844.40 μmol) , tert-butyl nitrite (0.28 g, 2.77 mmol) , diiod omethane (0.24 g, 899.80 μmol) and iodine (0.22 g, 866.79 μmol) were dissolved in THF (5 mL) . The reaction mixture was stirred at 80 ℃ for 1 h. The mixture was concentrated under vacuum to afford the crude product. The crude was purified by silica gel column eluted with EA/hexane (v/v=2/1) to obtain 0.080 g 8-bromo-2-iodo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine as brown oil. LCMS: m/z = 388 [M+1]  +. (24%yield) 
Step7. 4- ( (3- (8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
8-bromo-2-iodo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine (0.069 g, 177.83 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.083 g, 224.28 μmol) , tetrakis (triphenylphosphine) palladiumn (0.031 g, 26.82 μmol) , CuI (0.018 g, 94.51μmol) and N,N-Diisopropylethylamine (0.044 g, 340.44 μmol) were dissolved in DMSO (1 mL) . The reaction mixture was stirred at 50 ℃ for 1 h. The reaction mixture was concentrated under vacuum. The residue was purified by silica gel column eluted with EA/hexane (v/v=3/2) to obtain 0.021 g 4- ( (3- (8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide as brown oil. LCMS: m/z = 470 [M+1]  +. (25%yield)
Step8. 4- ( (3- (8- ( (1-methylpiperidin-4-yl) amino) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (A-1)
4- ( (3- (8-bromo-3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.021 g, 44.64 μmol) , 1-methylpiperidin-4-amine (0.025 g, 218.93 μmol) , xantphos (0.026 g, 44.93 μmol) , potassium carbonate (0.033 g, 238.77μmol) and Chloro [ (4, 5-bis (diphenylphosphino) -9, 9-dimethylxanthene) -2- (2-amino-1, 1-biphenyl) ] palladium (II) , (0.032 g, 32.79 μmol) were dissolved in 1, 4-Dioxane (1 mL) . The mixture was stirred at 50 ℃ for 1h. The crude was purifiedby prep-HPLC eluted with CH 3CN/H 2O (0.5%NH 4HCO 3) (v/v=7/3) to obtain 0.002g of 4- ( (3- (8- ( (1-methylpiperidin-4-yl) amino) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (A-1) as off-white solid. LCMS: m/z =504 [M+1]  +. (8.8%yield)
Example A-2
N- ( (2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-7-yl) methyl) tetrahydro-2H-pyran-4-amine (A-2)
Reaction scheme:
Figure PCTCN2022085296-appb-000190
Experimental details:
Step 1. methyl 2- (4-fluorophenyl) imidazo [1, 2-a] pyridine-7-carboxylate
Into a 250-mL round-bottom flask was placed methyl 2-aminoisonicotinate (10.051 g, 66.06 mmol) , 2-bromo-1- (4-fluoro phenyl) ethan-1-one (14.431 g, 66.49 mmol) , Na 2CO 3 (7.075 g, 66.75 mmol) , EtOH (100 mL) and water (0.1 mL) . The reaction mixture was stirred at 70℃ for 3h. The reaction was quenched with water (200 mL) . The slurry was filtered and the filter cake was washed with EA (120 mL) . The filter cake was dried in the oven. This resulted in 12.15 g (68.06%) of methyl 2- (4-fluorophenyl) imidazo [1, 2-a] pyridine-7-carboxylate as brown solid. LCMS: m/z = 271 [M+1]  +.
Step 2. methyl 3-bromo-2- (4-fluorophenyl) imidazo [1, 2-a] pyridine-7-carboxylate
Into a 250-mL round-bottom flask was placed methyl 2- (4-fluorophenyl) imidazo [1, 2-a] pyridine-7-carboxylate (12.07 g, 44.66 mmol) , NBS (9.68 g, 54.39 mmol) , DMF (120 mL) . The reaction mixture was stirred at 70℃ for 1 h. The reaction was quenched with water (200 mL) . The slurry was filtered and washed with H 2O (100 mL) and the filter cake was dried in the oven. This resulted in 14.45 g (92.67%) of methyl 3-bromo-2- (4-fluorophenyl) imidazo [1, 2-a] pyridine-7-carboxylate as brown solid. LCMS: m/z = 349 [M+1]  +.
Step 3. methyl2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-7-carboxylate
Into a 40-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed methyl 3-bromo-2- (4-fluorophenyl) imidazo [1, 2-a] pyridine-7-carboxylate (2.027 g, 5.81 mmol) , 1H-pyrrole (7.936 g, 0.12 mol) , DMEDA (0.525 g, 5.96 mmol) , CuI (0.563 g, 2.96 mmol) , K 3PO 4 (3.684 g, 17.36 mmol) , DMSO (20 mL) . The reaction mixture w as stirred at 80℃ for 12 h. The mixture was purified by C 18 column eluted with ACN/water (v/v = 1/2) to afford 1.95 g (22.29%) of methyl2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-7-carboxylate as yellow solid. LCMS: m/z = 336 [M+1]  +.
Step 4. (2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-7-yl) methanol
To a mixture of methyl2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-7-carboxylate (0.162 g, 0.48 mmol) in 4 mL THF was added LiAlH 4 (0.057 g, 1.50 mmol) at 0℃. The mixture was stirred at room temperature for 1 h. The reaction was quenched with water (10 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with brine (20 mL) , separated and concentrated under vacuum. This resulted in 0.116 g (78.13%) of (2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-7-yl) methanol (0.116 g, 78%yield) as a yellow solid. LCMS: m/z = 308 [M+1]  +
Step5. 2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-7-carbaldehyde
To a mixture of (2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-7-yl) methanol (0.116 g, 0.38 mmol) in 2 mL THF was added Dess-Martin (0.180 g, 0.42 mmol) at 0℃. The mixture was stirred at room temperature for 1 h. The reaction was quenched with water (10 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with brine (20 mL) and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/4) to afford 2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-7-carbaldehyde (0.082 g, 71.16%yield) as yellow solid. LCMS: m/z = 306 [M+1]  +
Step 6. N- ( (2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-7-yl) methyl) tetrahydro-2H-pyran-4-amine (A-2)
Into a 25-mL round-bottom flask was placed 2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridine-7-carbaldehyde (0.079 g, 0.26 mmol) , tetrahydro-2H-pyran-4-amine (0.030 g, 0.30 mmol) , MeOH (4 mL) . The reaction mixture was stirred at room temperature for 12h. NaBH 4 (0.039 g, 1.03 mmol) was added and stirred. The reaction was quenched with water (10 mL) , extracted with EA (20 mL x 2) . The combined organic layers were washed with brine (20 mL) and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 50-70-90%B (2-30-60min) ; 220 nm; RT: 33.580 -36.110 min) to afford N- ( (2- (4-fluorophenyl) -3- (1H-pyrrol-1-yl) imidazo [1, 2-a] pyridin-7-yl) methyl) tetrahydro-2H-pyran-4-amine (A-2) (0.042 g, 41.57%yield) as white solid. LCMS: m/z = 391 [M+1]  +
1H NMR (400 MHz, MeOD) δ 7.66 (d, J = 7.2 Hz, 1H) , 7.60 (s, 1H) , 7.53 –7.44 (m, 2H) , 7.10 –7.02 (m, 3H) , 6.96 –6.90 (m, 2H) , 6.57 –6.52 (m, 2H) , 4.02 –3.95 (m, 2H) , 3.93 (s, 2H) , 3.47 –3.36 (m, 2H) , 2.81 –2.73 (m, 1H) , 1.98 –1.89 (m, 2H) , 1.56 –1.42 (m, 2H) .
Example A-3
N- (3-fluoro-1-methylpiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-3)
Reaction scheme:
Figure PCTCN2022085296-appb-000191
Experimental details
Step 1. 2-bromo-4, 4, 4-trifluorobutanal
Into a 1 L flask purged and maintained with an inert atmosphere of nitrogen, was placed 4, 4, 4-trifluorobutyraldehyde (20.91 g, 165.85 mmol) , 1, 4-dioxane (500 mL) , Then the solution of bromine (26.535 g, 166.04 mmol) was added dropwise at 0℃. The reaction mixture was stirred at room temperature for 1 h. Then saturated sodium hydrogen carbonate aqueous solution (100 mL) was added to the mixture at 0℃. The resulting solution was extracted with DCM (3 x 500 mL) . The organic layers was combined, washed with brine (500 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. This resulted in 31.91 g (93.87%yield) of 2-bromo-4, 4, 4-trifluorobutanal as yellow oil. LCMS: m/z = 205 [M+1]  +.
Step 2. 8-nitro-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine
Into a 250 mL flask was placed 2-bromo-4, 4, 4-trifluorobutanal (15.62 g, 76.21 mmol) , 2-amino-3-nitropyridine (5.15 g, 37.02 mmol) , ethanol (50 mL) . The reaction mixture was stirred at 80 ℃ for 8 h under microwave conditions. The reaction was cooled and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 2/5) . This resulted in 1.538 g (8.23%yield) of 8-nitro-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine as yellow solid. LCMS: m/z = 246 [M+1]  +.
Step 3. 2-iodo-8-nitro-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 8-nitro-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine (0.167 g, 681.19 μmol) , N-iodosuccinimide (0.163 g, 724.50 μmol) , acetic acid (0.5 mL) , N, N -dimethylformamide (3 mL) . The reaction mixture was stirred at 50℃ for 2.5 h. The residues were purified by C 18 chromatography column eluted with ACN/H 2O (v/v = 1/1) . This resulted in 0.253 g (100.00%yield) of 2-iodo-8-nitro-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine (crude) as white solid. LCMS: m/z = 372 [M+1]  +.
Step 4. 2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine
Into a 25 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-iodo-8-nitro-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine (0.251 g, 676.45 μmol) , methanol (8 mL) , iron (0.200 g, 3.58mmol) , ammonium chloride (0.370 g, 6.92 mmol) , water (1 mL) . The reaction mixture was stirred at 45℃ for 1 h. Then the catalyst was removed by filtration, the filtrate was extracted with EA (3 x 10 mL) . The organic layers was combined, washed with bri ne (10 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residue was applied onto a silica gelcolumn eluted with EA/hexane (v/v = 1/5) . This resulted in 0.158 g (68.48%yield) of 2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine as yellow solid. LCMS: m/z = 342 [M+1]  +.
Step 5. tert-butyl 3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridine-8-yl) amino) piperidine-1-carboxylate
Into a 25 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (0.155 g, 454.45 μmol) , 3-fluoro-4-oxopiperidin-1-carboxylate (0.304 g, 1.40 mmol) , N, N-dimethylformamide (10 mL) . The reaction mixture was stirred at 0 ℃ for 1 h. Then the solution of borane-tetrahydrofuran complex (5 mL) was added dropwise at 0℃. The reaction mixture was stirred at 0℃ for another 1 h. The reaction was quenched by the addition of water (20 mL) . The resulting solution was extracted with EA (3 x 20 mL) . The organic layer was combined, washed with brine (20 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residues were purified by C 18 chromatography column eluted with ACN/H 2O (v/v = 5/3) . This resulted in 0.121 g (49.10%yield) of tert-butyl 3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-yl) amino) piperidine-1-carboxylate as yellow solid. LCMS: m/z = 543 [M+1]  +.
Step 6. tert-butyl 3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-yl) amino) piperidine-1-carboxylate
Into a 100 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-yl) amino) piperidine-1-carboxylate (0.119 g, 219.43 μmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.067 g, 278.00 μmol) , [1, 1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (0.029 g, 41.08 μmol) , triethylamine (0.039 g, 385.42 μmol) , cuprous iodide (0.015 g, 78.76 μmol) , methyl sulfoxide (3 mL) . The reaction mixture was stirred at room temperature for 2 h. The residues were purified by C 18 chromatography column eluted with ACN/H 2O (v/v = 1/1) . This resulted in 0.130 g (90.63%yield) of tert-butyl 3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-yl) amino) piperidine-1-carboxylate as yellow solid.
Step 7. N- (3-fluoropiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine
Into a 8 mL flask was placed tert-butyl 3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-yl) amino) piperidine-1-carboxylate (0.129 g, 197.34 μmol) , hydrogen chloride (4 M in EA, 3 mL) . The reaction mixture was stirred at room temperature for 1 h. Then saturated sodium hydrogen carbonate aqueous solution was added to the mixture until pH = 7～8. The resulting solution was extracted with EA (2 x 10 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. This resulted in 0.091 g (83.30%yield) of N- (3-fluoropiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine as yellow oil. LCMS: m/z = 554 [M+1]  +.
Step 8. N- (3-fluoro-1-methylpiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-3)
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed N- (3-fluoropiperidin-4-yl) -2 - (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (0.091 g, 164.39 μmol) , paraformaldehyde (0.046 g, 1.53 mmol) , sodium cyanoboronhydride (0.025 g, 583.08 μmol) , methanol (3 mL) , acetic acid (0.1 mL) . The reaction mixture was stirred at room temperature for 0.5 h. The reaction was then quenched by the addition of water (2 mL) . The resulting solution was extracted with EA (2 x 10 mL) . The organic layer was combined, washed with brine (10 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 20-55-75%B (2-30-60min; 258 nm; RT: 29.415-30.610 min) . This resulted in 0.009 g (32.32%yield) of N- (3-fluoro-1-methylpiperidin-4-yl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-3) as white solid. LCMS: m/z = 568 [M+1]  +.
1H NMR (400 MHz, DMSO) δ 7.56 (d, J = 6.7 Hz, 1H) , 7.41 (d, J = 8.6 Hz, 1H) , 7.25 (s, 1H) , 6.96 (d, J = 8.4 Hz, 1H) , 6.85 (s, 1H) , 6.51 (s, 1H) , 6.40 (d, J = 7.3 Hz, 1H) , 6.09 (d, J = 8.3 Hz, 1H) , 4.43 (d, J = 5.5 Hz, 2H) , 3.89 (s, 3H) , 3.68 (d, J = 11.6 Hz, 3H) , 3.09 (s, 3H) , 2.67 (s, 2H) , 2.33 (s, 2H) , 2.22 (s, 3H) , 2.05 (d, J = 13.1 Hz, 3H) .
Example A-4
2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-4)
Reaction scheme:
Figure PCTCN2022085296-appb-000192
Experimental details
Step 1. 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-iodo-3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (0.096 g, 281.47 μmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.50 g, 2.09 mmol) , cuprous iodide (0.022 g, 115.52 μmol) , triethylamine (0.090 g, 889.42 μmol) , [1, 1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (0.033 g, 46.75 μmol) , methyl sulfoxide (3 mL) . The reaction mixture was stirred at room temperature for 2 h. The reaction was added EA (20 mL) and washed with brine (3 x 30 mL) . The organic layers was collected, dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 1/3) . This resulted in 0.094 g (73.81%yield) of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine as yellow oil. LCMS: m/z = 453 [M+1]  +.
Step 2. 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-4)
Into a 8 mL flask was placed 1-methyl-4-piperidone (0.084 g, 742.33 μmol) , 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (0.090 g, 198.92 μmol) , acetic acid (0.1 mL) , methanol (3 mL) , sodium cyanoboronhydride (34.6120 mg, 559.76 μmol) . The reaction mixture was stirred at 60℃ for 1 h. The reaction was quenched by the addition of water (10 mL) . The resulting solution was extracted with EA (2 x 10 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-75-95%B (2-30-60min; 254 nm; RT: 38.862-41.633 min) . This resulted in 0.037 g (33.84%yield) of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3- (2, 2, 2-trifluoroethyl) imidazo [1, 2-a] pyridin-8-amine (A-4) as white solid. LCMS: m/z = 550 [M+1]  +.
1H NMR (400 MHz, DMSO) δ 7.56 (d, J = 6.2 Hz, 1H) , 7.41 (d, J = 8.3 Hz, 1H) , 7.25 (s, 1H) , 6.96 (d, J = 8.3 Hz, 1H) , 6.86 (t, J = 7.2 Hz, 1H) , 6.51 (s, 1H) , 6.32 (d, J = 8.0 Hz, 1H) , 5.61 (d, J = 8.3 Hz, 1H) , 4.43 (d, J = 6.2 Hz, 2H) , 3.89 (s, 3H) , 3.67 (dd, J = 21.6, 10.6 Hz, 3H) , 3.09 (s, 2H) , 2.79 –2.65 (m, 2H) , 2.16 (s, 2H) , 2.01 (t, J = 11.6 Hz, 2H) , 1.88 (d, J = 11.9 Hz, 2H) , 1.67 –1.49 (m, 2H) , 1.23 (s, 2H) .
Example part B
Example B-1
dimethyl (4- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide (B-1)
Figure PCTCN2022085296-appb-000193
Step1. Synthesis of 4-nitro-1- (phenylsulfonyl) -1H-indole
4-nitro-1H-indole (100.96 g, 622.65 mmol) was dissolved in THF (1 L) . NaH (62.84 g, 2.6186 mol) was added at 0℃ in portions. The reaction mixture was stirred at 0 ℃ for 1 h. Then Benzenesulfonyl chloride (69.60 g, 394.06 mmol) was added. The reaction mixture was stirred at 0 ℃ for another 2 h. The reaction was quenched by water (1 L) , extracted by EA (3x1 L) . The organic layers combined and concentrated under vacuum. Recrystallization with HEX/EA (v/v=9/1) to give 175.02 g (92%) of (4-nitro-1- (phenylsulfonyl) -1H-indole as white solid. LCMS: m/z =303 [M+1]  +.
Step 2. Synthesis of 2-iodo-4-nitro-1- (phenylsulfonyl) -1H-indole.
Diisopropylamine (32.06 g, 316.83 mmol) was dissolved in THF (500 mL) at an inert atmosphere of nitrogen. n-BuLi (133 mL, 333.68 mmol) was added at -70 ℃. The reaction mixture was stirred at -70 ℃ for 1 h. Then 4-nitro-1- (phenylsulfonyl) -1H-indole in 100 mL THF was added at -70 ℃. The reaction mixture was stirred at -70 ℃ for another 1 h. Iodine (43.24 g, 170.36 mmol) in 100 mL THF was added. The reaction mixture was stirred at -70 ℃ for another 1 h. The reaction was quenched by saturated NaHSO 3 (1 L) , extracted with EA (3x1 L) . The organic layers combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/hexane (v/v=2/8) . This resulted in 42.12 g (73%yield) of 2-iodo-4-nitro-1- (phenylsulfonyl) -1H-indole as yellow solid. LCMS: m/z = 429 [M+1]  +.
Step3. Synthesis of 2-iodo-4-nitro-1H-indole.
2-iodo-4-nitro-1- (phenylsulfonyl) -1H-indole (37.82g, 88.33mmol) and NaOH (6.62 g, 165.48 mmol) were dissolved in MeOH (200 mL) . The reaction mixture was stirred at 40 ℃ for 1 h. The reaction mixture was concentrated under vacuum. The residue was purified by silica gel column eluted with EA/hexane (v/v=3/7) . This resulted in 15.36 g (60%yield) of 2-iodo-4-nitro-1- (phenylsulfonyl) -1H-indole as red solid. LCMS: m/z = 289 [M+1]  +.
Step4. Synthesis of 2-iodo-4-nitro-1- (2, 2, 2-trifluoroethyl) -1H-indole.
2-iodo-4-nitro-1H-indole (33.18 g, 115.19 mmol) was dissolved in THF (200 mL) . Then NaH (9.48 g, 395.03 mmol) was added at 0 ℃ in portions. The reaction mixture was stirred at 0 ℃ for 1 h. This was followed by the added of 2, 2, 2-trifluoroethyl trifluoromethanesulfonate (15.14 g, 65.23 mmol) . The reaction mixture was stirred at 0 ℃ for anot  her 2 h. The reaction was quenched by water (100 mL) , extracted with EA (3x100 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/hexane (v/v=1/1) . This resulted in 8.28 g (19%yield) of 2-iodo-4-nitro-1- (2, 2, 2-trifluoroethyl) -1H-indole as yellow solid. LCMS: m/z =371 [M+1]  +.
Step 5. Synthesis of 2-iodo-1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine.
2-iodo-4-nitro-1- (2, 2, 2-trifluoroethyl) -1H-indole (6.12g, 16.53mmol) and iron (5.60 g, 100.27 mmol) were dissolved in acetic acid (100 mL) . The reaction mixture was stirred at 50 ℃ for 4 h. The reaction mixture was filter and washed with MeOH (3x100 mL) . The filtrated was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/hexane (v/v=4/6) . This resulted in 8.30 g (113%yield) of 2-iodo-1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine as yellow solid. LCMS: m/z = 341 [M+1]  +.
Step 6. Synthesis of 2-iodo-N- (1-methylpiperidin-4-yl) -1- (2, 2, 2-trifluoroethyl) -1H -indol-4-amine.
2-iodo-1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.072 g, 211.7131 μmol) was dissolved in MeOH (1 mL) , 1-methylpiperidin-4-one (0.086 g, 760.0060 μmol) and NaCNBH 3 (0.051 g, 1.1895 mmol) were addeed. The reaction mixture was stirred at 50 ℃ overnight. The reaction mixture was purified by C 18 chromatography column with ACN/H 2O (0.15%TFA) (v/v=30%～35%) . This resulted in 0.065 g (70.22%yield) of 2-iodo-N- (1-methyl-4-piperidyl) -1- (2, 2, 2-trifluoroethyl) indol-4-amine as yellow oil. LCMS: m/z =438 [M+1]  +.
Step 7. Synthesis of (4-aminophenyl) dimethylphosphine oxide.
4-bromoaniline (1.31 g, 7.6153 mmol) was dissolved in DMF (15 mL) , dimethylphosphine oxide (0.494 g, 6.3293 mmol) , palladium (II) acetate (0.073 g, 325.1581 μmol) , dimethylbisdiphenylphosphinoxanthene (1.605 g, 2.7739 mmol) and K 3PO 4 (1.790 g, 8.4332 mmol) were added. The reaction mixture was stirred at 150 ℃ for 2d. The reaction mixture was filtered and purified by C 18 chromatography column with ACN/H 2O (0.15%TFA) (v/v=0%～5%) . This resulted in 0.94 g (36.4848%yield, 50%purity) of (4-aminophenyl) dimethylphosphine oxide as colorless oil. LCMS: m/z =170 [M+1]  +.
Step 8. Synthesis of dimethyl (4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide.
(4-aminophenyl) dimethylphosphine oxide (0.311 g, 1.8385 mmol) was dissolved in DMF (5 mL) , K 2CO 3 (0.492 g, 3.5599 mmol) and 3-bromoprop-1-yne (0.224 g, 1.8830 mmol) were added. The mixture was stirred at 100 ℃ overnight. The reaction mixture was filtered and purified by C 18 chromatography column with ACN/H 2O (0.15%TFA) (v/v=25%～30%) . This resulted in 0.085 g (22.3125%yield) of dimethyl (4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide as yellow oil. LCMS: m/z =208 [M+1]  +.
Step 9. Synthesis of dimethyl (4- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide.
Dimethyl (4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide (0.032 g, 154.4342 μmol) , 2-iodo-N- (1-methylpiperidin-4-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.071 g, 162.3818 μmol) , CuI (0.006 g, 31.5043 μmol) , Pd (PPh 3)  4 (0.017 g, 14.7115 μmol) and DIEA (0.0072 g, 55.7093 μmol) were dissolved in Methyl sulfoxide (2 mL) . The mixture was stirred at 100℃ overnight. The reaction mixture was filtered and purified by C 18 chromatography column with ACN/H 2O (0.15%NH 3. H 2O) (v/v=50%～60%) to give product. This resulted in 0.017 g (21.3110%yield) of 2- [3- (4-dimethylphosphorylanilino) prop-1-ynyl] -N- (1-methyl-4-piperidyl) -1- (2, 2, 2-trifluoroethyl) indol-4-amine as yellow solid. LCMS: m/z =517 [M+1]  +.
1H NMR (400 MHz, DMSO-d6) δ 7.54 –7.44 (m, 2H) , 7.09 (s, 1H) , 7.00 (t, J = 8.0 Hz, 1H) , 6.80 (dd, J = 8.7, 2.3 Hz, 2H) , 6.68 (d, J = 8.4 Hz, 2H) , 6.15 (d, J = 7.8 Hz, 1H) , 5.47 (d, J = 8.0 Hz, 1H) , 4.91 (q, J = 9.1 Hz, 2H) , 4.28 (d, J = 6.1 Hz, 2H) , 3.29 (s, 1H) , 2.76 (d, J = 11.6 Hz, 2H) , 2.17 (s, 3H) , 2.04 –1.94 (m, 2H) , 1.91 (d, J= 12.5 Hz, 2H) , 1.55 (d, J = 13.2 Hz, 6H) , 1.51 –1.39 (m, 2H) .
Example part C
Example C-1
6- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (C-1)
Figure PCTCN2022085296-appb-000194
Step1. 6-aminobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide
6-nitrobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide (2.097 g, 9.197mmol) was dissolved in EtOH (20 mL) , 10%Pd/C (1.00 1g, 9.397mmol) was added. The mixture was stirred under hydrogen atmospheric for 2 days. The catalyst was removed by filtration and the filtrate was concentrated under vacuum to obtain 1.743 g 6-aminobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide as off-white solid. LCMS: m/z =199 [M+1]  +
Step2. 6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide
Zinc dust (1.338 g, 20.46 mmol ) , 6-aminob enzo [d] isothiazol-3 (2H) -one 1, 1-dioxide (0.496 g, 2.50 mmol) were dissolved in hydrochloric acid (12N, 5 mL) . The mixture was stirred at room temperature for 10 h. Then saturated aqueous sodium hydrogen carbonate solution was added to the mixture until the pH of the solution was 7～8. The mixture was filtered and extracted with ethyl acetate (3 x 80 ml) . The organic layers combined, washed with brine (20 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum to obtain 0.200 g 6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide as yellow solid. LCMS: m/z =185 [M+1]  +
Step3. 6- (prop-2-yn-1-ylamino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide
6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (0.177 g, 0.96 mmol) , 3-Bromopropyne (0.241 g, 2.03 mmol) and Cs 2CO 3 (0.638 g, 1.96 mmol) were dissolved in acetonitrile (2 mL) . The reaction mixture was stirred with an inert at mosphere of nitrogen at 80 oC for 1 h. The reaction was then quenched by the addition of water (10 mL) . The resulting solution was extracted with EA (2 x 30 mL) , the organic layers combined, washed with brine (15 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v= 0%～ 35%) to obtain 0.043 g 6- (prop-2-yn-1-ylamino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide as yellow oil. LCMS: m/z = 223 [M+1]  +
Step4. 6- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (C-1)
6- (prop-2-yn-1-ylamino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (0.034 g, 0.15 mmol) , 2-iodo-N- (1-methylpiperidin-4-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.073 g, 0.17 mmol) , Pd (pph 3)  4 (0.048 g, 0.04 mmol) , CuI (0.030 g, 0.16 mmol) and DIEA (0.067 g, 0.52 mmol) were dissolved in DMSO (1 mL) . The reaction mixture was stirred at room temperature with an inert atmosphere of nitrogen for 1 h. The residue was purified by Prep-HPLC CH 3CN/H 2O (0.05%NH 4OH) (v/v=2/1) to obtain 0.016 g 6- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (C-1) as off-white solid. LCMS: m/z =532 [M+1]  + (10%)
1H NMR (400 MHz, MeOD) δ 7.21 (s, 1H) , 7.04 –6.96 (m, 4H) , 6.71 (s, 1H) , 6.32 (s, 1H) , 4.44 (d, J = 12.0 Hz, 4H) , 3.46 (s, 1H) , 2.92 (s, 2H) , 2.33 (s, 3H) , 2.24 (s, 2H) , 2.09 (s, 2H) , 1.62 (d, J = 8.9 Hz, 2H) , 1.32 –1.21 (m, 2H) .
Example C-2
5- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (C-2)
Figure PCTCN2022085296-appb-000195
Step1. 6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide
Zinc dust (3.310 g, 50.62 mmol ) was added portionwise to a stirred suspension of 5-aminobenzo [d] isothiazol-3 (2H) -one 1, 1-dioxide (1.012 g, 5.11 mmol) in concentrated hydrochloric acid (10mL) . The mixture was stirred at room temperature for 2 h. Then saturated aqueous sodium hydrogen carbonate solution was added to the mixture until the pH of the solution was 7～8. The mixture was filtered and extracted with ethyl acetate (4 x 100 mL) . The organic layers was combined, washed with brine (20 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum to obtain 1.079 g 6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide as yellow solid. LCMS: m/z =185 [M+1]  +
Step2. 6- (prop-2-yn-1-ylamino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, 6-amino-2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (0.201 g, 1.09 mmol) , 3-Bromopropyne (0.251 g, 2.11 mmol) and Cs 2CO 3 (0.813 g, 2.49 mmol) were dissolved in acetonitrile (5 mL) . The reaction mixture was stirred with an inert atmosphere of nitrogen at 80 ℃for 1 h. The reaction was then quenched by the addition of water (20 mL) . The resulting solution was extracted with EA (2 x 50 mL) , the organic layers was combined, washed with brine (20 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v=0%～ 35%) to obtain 0.077 g 6- (prop-2-yn-1-ylamino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide as yellow oil. LCMS: m/z = 223 [M+1]  +
Step3. 5- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (C-2)
Into a 8-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, 6- (prop-2-yn-1-ylamino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (0.075 g, 0.34 mmol) , 2-iodo-N- (1-methylpiperidin-4-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.150 g, 0.34 mmol) , Pd (PPh 3)  4 (0.044 g, 0.04 mmol) , CuI (0.046 g, 0.24 mmol) and DIEA (0.135 g, 1.04 mmol) were dissolved in DMSO (1 mL) . The reaction mixture was stirred at room temperature with an inert atmosphere of nitrogen for 1 h. The residue was purified by Prep-HPLC CH 3CN/H 2O (0.05%NH 4OH) (v/v=2/1) to obtain 17mg 5- ( (3- (4- ( (1-methylpiperidin-4-yl) amino) -1- (2, 2, 2-trifluoroethyl) -1H-indol-2-yl) prop-2-yn-1-yl) amino) -2, 3-dihydrobenzo [d] isothiazole 1, 1-dioxide (C-2) as off-white solid. LCMS: m/z =532 [M+1]  + (10%) .
1H NMR (400 MHz, MeOD) δ 7.17 (d, J = 9.0 Hz, 1H) , 7.05 –6.96 (m, 3H) , 6.83 (s, 1H) , 6.57 (d, J = 8.1 Hz, 1H) , 6.19 (d, J = 7.9 Hz, 1H) , 4.72 –4.65 (m, 2H) , 4.22 (d, J = 9.4 Hz, 4H) , 3.38 (s, 1H) , 2.82 (s, 2H) , 2.24 (s, 3H) , 2.17 (s, 2H) , 2.00 (d, J = 14.4 Hz, 2H) , 1.51 (d, J = 10.5 Hz, 2H) .
Example part D
Example D-1
2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-9-amine (D-1)
Reaction scheme:
Figure PCTCN2022085296-appb-000196
Experimental details
Step 1. 2-chloro-1- (7-nitro-3, 4-dihydroquinolin-1 (2H) -yl) ethan-1-one
Into a 500 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 7-nitro-1, 2, 3, 4-tetrahydroquinoline (1.007 g, 5.65 mmol) , triethylamine (1.762 g, 17.41 mmol) , dichloromethane (50 mL) . Then the solution of monochloroacetyl chloride (0.635 g, 5.62 mmol) in dichloromethane (10 mL) was added dropwise. The reaction mixture was stirred at room temperature for 0.5 h. The reaction mixture was washed with H 2O (2 x 50 mL) , brine (2 x 50 mL) . The organic phase was dried over anhydrous Na 2SO 4 and concentrated under vacuum. This resulted in 1.365 g (94.84%yield) of 2-chloro-1- (7-nitro-3, 4-dihydroquinolin-1 (2H) -yl) ethan-1-one as brown solid. LCMS: m/z = 255 [M+1]  +.
Step 2. 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one
Into a 50 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-chloro-1- (7-nitro-3, 4-dihydroquinolin-1 (2H) -yl) ethan-1-one (4.951 g, 19.44 mmol) , Johnphos (5.731 g, 19.2057 mmol) , tris (dibenzylideneacetonyl) bis-palladium (9.094 g, 9.93mmol) , triethylamine (6.15 g, 60.78 mmol) , toluene (50 mL) . The reaction mixture was stirred at 80℃ for 1 h. The reaction was then quenched by the addition of water (50 mL) . The resulting solution was extracted with EA (3 x 50 mL) . The organic layers was combined, washed with brine (50 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residues were purified by C 18 chromatography column eluted with ACN/H 2O (0.05%TFA) (v/v = 2/5) . This resulted in 3.48 g (82.03%yield) of 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one as yellow oil. LCMS: m/z = 219 [M+1]  +.
Step 3. 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate
Into a 50 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one (3.431 g, 15.72 mmol) , 2, 6-bis (tert-butyl) pyridine (3.525 g, 18.43 mmol) , dichloromethane (20 mL) . Then the solution of trifluoromethanesulfonic anhydride (1.167 g, 4.14 mmol) in dichloromethane (10 mL) was added dropwise. The reaction mixture was stirred at 60℃ for 1 h. The reaction mixture was washed with brine (3 x 100 mL) . The organic phase was dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 1/10) . This resulted in 0.360 g (6.54%yield) of 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate as brown solid. LCMS: m/z = 351 [M+1]  +.
Step 4. 2-methoxy-4- (methylsulfonyl) -N- (3- (9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) aniline
Into a 50 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed cuprous iodide (0.032 g, 168.02 μmol) , 9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate (0.150 g, 428.24 μmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.210 g, 877.60 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.074 g, 104.83μmol) , triethylamine (0.107 g, 1.06 mmol) , N, N-dimethylformamide (20 mL) . The reaction mixture was stirred at room temperature for 0.5 h. The reaction was then quenched by the addition of water (100 mL) . The resulting solution was extracted with EA (2 x 200 mL) . The organic layers was combined, washed with brine (200 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 1/1) . This resulted in 0.154 g (81.83%yield) of 2-methoxy-4- (methylsulfonyl) -N- (3- (9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) aniline as yellow solid. LCMS: m/z = 440 [M+1]  +.
Step 5. 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-9-amine
Into a 50 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-methoxy-4- (methylsulfonyl) -N- (3- (9-nitro-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) aniline (0.151 g, 343.59 μmol) , ethanol (10mL) , disodium hydrosulfite (0.428 g, 2.46 mmol) , sodium hydroxide (0.031 g, 775.06 μmol) in water (10 mL) . The reaction mixture was stirred at 60℃ for 2 h. Then saturated hydrochloric acid aqueous solution was added to the mixture until pH = 6～7. Then the catalyst was removed by filtration and the filtrate was concentrated under vacuum. The residues were purified by C 18 chromatography column eluted with ACN/H 2O (0.05%TFA) (v/v = 1/20) . This resulted in 0.136 g (96.67%yield) of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-9-amine as yellow solid. LCMS: m/z = 410 [M+1]  +.
Step 6. 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-9-amine (D-1)
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-9-amine (0.125 g, 305.250 μmol) , methanol (3 mL) , 1-methyl-4-piperidone (34.541 mg, 305.25 μmol) , sodium cyanoboronhydride (13.088 mg, 305.25 μmol) , acetic acid (0.05 mL) . The reaction mixture was stirred at 70℃ for 15 h. Then saturated sodium hydrogen carbonate aqueous solution was added to the mixture until pH = 7～8. The resulting solution was extracted with dichloromethane (2 x 10 mL) . The organic layer was combined, washed with brine (10 mL) , dried over anhydrous Na 2SO 4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 40-75-90%B (2-30-60min) ; 249 nm; RT: 33.810-35.075) . This resulted in 0.004 g (2.59%yield) of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-9-amine (D-1) as yellow solid. LCMS: m/z = 507 [M+1]  +.
Example D-2
4- ( (3- (8- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-2)
Reaction scheme:
Figure PCTCN2022085296-appb-000197
Experimental details
Step1. 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one.
To a 20 mL flask was placed 8-bromo-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one (1.006 g, 4.00 mmol) , tributyl (1-ethoxyvinyl) stannane (1.466 g, 4.06 mmol) , K 2CO 3 (0.464 g, 7.99 mmol) , bis (triphenylphosphine) palladium (II) chloride (0.285 g, 403.72 μmol) , 1, 4-Dioxane (8 mL) . The reaction was stirred for 8 h at 80℃. LCMS showed the reaction was complete, the reaction was quenched with water (100 mL) , extracted with EA (50 mL x 2) . The organic layers were washed with water (100 mL) and brine (100 mL) successively, separated and concentrated under vacuum. The residue was purified with silica gel column eluted with EA/n-Hex (v/v = 2/3) to afford 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one (0.261 g, 1.2126 mmol, 30.39 yield) as a yellow solid. LCMS: m/z =216 [M+1]  +.
Step 2. 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate.
Into an ice-cold 4 mL flask was placed 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2 (1H) -one (0.095 g, 441.35 μmol) , TEA (0.072 g, 711.54 μmol) , trifluoromethanesulfonic anhydride (0.161 g, 570.64 μmol) , DCM (1 mL) . The reaction was stirred for 1 h at 0 ℃. TLC showed that the reaction was complete. The reaction was purified with silica gelcolumn eluted with EA/hexane (v/v = 1/4) to afford 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate (0.051 g, 146.84 μmol, 33.27%yield) as brown oil. LCMS: m/z = 370 [M+1]  +.
Step 3. 4- ( (3- (8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 4 mL vial purged and maintained with nitrogen atmosphere was placed 8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl trifluoromethanesulfonate (0.049 g, 141.08 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.068 g, 323.42 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.011 g, 15.58 μmol) , CuI (0.003 g, 15.75 μmol) , TEA (0.031 g, 306.36 μmol ) , 1, 4-Dioxane (0.5 mL) . The reaction was stirred for 1 h at room temperature. LCMS showed that the reaction was complete. The reaction was quenched with water (10 mL) , extracted with EA (5 mL x 2) . The organiclayers were washed with water (10 mL) and brine (10 mL) successively, separated and concentrated with vacuum. The residue was purified with silica gel column eluted with EA/n-Hex (v/v = 1/2) to afford 4- ( (3- (8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.049 g, 120.25 μmol, 85.23 %yield) as brownsolid. LCMS: m/z = 408 [M+1]  +.
Step 4. 4- ( (3- (8- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-2) .
Into a 4 mL flask was placed 4- ( (3- (8-acetyl-5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) prop-2-yn-1-yl) amino) benzenesu lfonamide (0.042 g, 103.07 μmol) , 1-methylpiperidin-4-amine (0.062 g, 542.96 mmol) , sodium cyanoborohydride (69.22 39 mg, 1.12 mmol) , acetic acid (0.01 μmol) , ethanol (0.25 mL) . The reaction was stirred overnight at 80℃. After LC MS showed the reaction was complete, the reaction was purified with prep-HPLC (Mobile Phase A: water (ammoniu m hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 40-60-80%B (2-30-60min) ; 242 nm; RT: 38.468 –42.205 min; ) to afford 4- ( (3- (8- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -5, 6-dihydro-4H-pyrrolo [3, 2, 1-ij] quinolin-2-yl) pr op-2-yn-1-yl) amino) benzenesulfonamide (D-2) 14 mg (27.69 μmol, 26.86 %yield) as off-white solid . LCMS: m/z = 50 6 [M+1]  +
1H NMR (400 MHz, DMSO-d 6) δ 7.59 (d, J = 8.3 Hz, 2H) , 7.20 (s, 1H) , 6.94 (d, J = 13.1 Hz, 3H) , 6.88 –6.83 (m, 1H) , 6.79 (d, J = 8.3 Hz, 2H) , 6.54 (s, 1H) , 4.30 (d, J = 5.6 Hz, 2H) , 4.00 (t, J = 5.5 Hz, 2H) , 3.86 (q, J = 6.9 Hz, 1H) , 2.87 (d, J = 6.4 Hz, 2H) , 2.61 (d, J = 13.1 Hz, 2H) , 2.17 –2.07 (m, 3H) , 2.04 (s, 3H) , 1.81 (d, J = 12.5 Hz, 1H) , 1.67 (q, J = 12.6 Hz, 2H) , 1.54 (d, J = 12.5 Hz, 1H) , 1.27 –1.16 (m, 5H) .
Example D-3
4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-3)
Reaction scheme:
Figure PCTCN2022085296-appb-000198
Experimental details
Step 1. 2, 3, 4, 5-tetrahydro-1H-benzo [b] azepine.
Into a 100 mL flask purged and maintained with hydrogen atmosphere was placed 8-bromo-2, 3, 4, 5-tetrahydro-1H-benzo [b] azepine (1.92 g, 8.49 mmol) , Pd/C (0.70 g, 6.58 mmol) , MeOH (15 mL) , con. HCl (0.01 mL, 12M) . The resulted mixture was stirred for 5 h at 50℃. LCMS showed the reaction was complete. The reaction was filtered and the filtrate was concentrated to afford 2, 3, 4, 5-tetrahydro-1H-benzo [b] azepine (0.261 g, 1.2126 mmol, 30.39%yield) as a yellow s olid. LCMS: m/z =148 [M+1]  +.
Step 2. 2-chloro-1- (2, 3, 4, 5-tetrahydro-1H-benzo [b] azepin-1-yl) ethan-1-one.
Into an ice-cold 100 mL flask was placed 2, 3, 4, 5-tetrahydro-1H-benzo [b] azepine (2.11 g, 14.33 mmol) , TEA (1.54 g, 15.22 mmol) , monochloroacetyl chloride (1.62 g, 14.34 mmol) , DCM (30 mL) , and stirred for 1 h at room temperature. TLC monitored that the reaction was complete. The reaction was purified by silica gel column, eluted with DCM to afford 2-chloro-1- (2, 3, 4, 5-tetrahydro-1H-benzo [b] azepin-1-yl) ethan-1-one (1.96 g, 8.76 mmol, 61.13 %yield) as brown solid. LCMS: m/z = 224 [M+1]  +.
Step 3. 1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one.
Into a 100 mL vial purged and maintained with nitrogen atmosphere was placed 2-chloro-1- (2, 3, 4, 5-tetrahydro-1H-benzo [b] azepin-1-yl) ethan-1-one (1.109 g, 4.96 mmol) , Pd 2 (dba)  3 (2.451 g, 2.68 mmol) , Johnphos (2.511 g, 8.41 mmol) , TEA (0.868 g, 8.58 mmol) , toluene (10 mL) , and stirred for 1 h at 130℃. LCMS monitored that the reaction was complete. The reaction was quenched with water (20 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (10 mL) and brine (10 mL) successively, separated and concentrated with vacuum. The residue was purified with silica gel column eluted with EA/n-Hexane (v/v = 1/5) to afford 1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one (0.966 g, 5.16 mmol, 104.06 %yield) as brown solid. LCMS: m/z = 188 [M+1]  +.
Step 4. 9-bromo-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one.
Into a 40 mL flask was placed 1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one (0.042 g, 103.07 μmol) , NBS (0.937 g, 5.26 mmol) , MeCN (0.25 mL) , glacial acetic acid (0.01 mL) . The reaction was stirred for 1 h at room temperature. LCMS showed that the reaction was complete. The reaction was concentrated under vacuum, purified with silica-gelcolumn, eluted with EA/n-Hexane (v/v = 1/5) to afford 9-bromo-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one (0.785 g, 2.95 mmol, 58.38%yield) as a brown solid. LCMS: m/z = 266 [M+1]  +
Step 5. 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one.
Into a 40 mL flask was placed 9-bromo-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one (0.237 g, 890.53 μmol) , tributyl (1-ethoxyvinyl) stannane (0.330 g, 913.75 μmol) , KF (0.060 g, 1.03 mmol) , Pd (PPh 3)  2Cl 2 (0.101 g, 143.07 μmol) , 1, 4-dioxane (2 mL) . The reaction was stirred for 2.5 h at 80℃. LCMS showed the reaction was complete. The reaction was quenched with water (20 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (20 mL) and brine (20 mL) successively, separated and concentrated under vacuum. The residue was purified with C 18 column, eluted with ACN/water (v/v = 1/2) to afford 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one (0.077 g, 335.84 μmol, 37.71%yield) as a brown solid. LCMS: m/z = 230 [M+1]  +
Step 6. 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl trifluoromethanesulfonate.
Into an ice-cold 4 mL flask was placed 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6 (7H) -one (0.067 g, 292.23 μmol) , TEA (0.067 g, 662.12 μmol) , trifluoromethanesulfonic anhydride (0.126g, 446.59 μmol) , DCM (1 mL) . The reaction was stirred for 0.6 h at room temperature. LCMS showed that the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers was washed with water (3 mL) and brine (3 mL) successively, separated and concentrated with vacuum. The residue was purified by silica gel column eluted with EA/n-Hexane (v/v = 1/4) to afford 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl trifluoromethanesulfonate (0.073 g, 202.03 μmol, 69.13%yield) as dark brown oil. LCMS: m/z = 362 [M+1]  +.
Step 7. 4- ( (3- (9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 4 mL vial purged and maintained with nitrogen atmosphere was placed 9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl trifluoromethanesulfonate (0.070 g, 193.73 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.085 g, 404.27 μmol ) , Pd (PPh 3)  2Cl 2 (0.015 g, 21.25 μmol) , CuI (0.004 g, 21.00 μmol) , TEA (0.050 g, 494.12 μmol) , DMF (1 mL) The resulted mixture was stirred for 1 h at room temperature. LCMS showed that the reaction was complete. The reaction was quenched with water (2 mL) , extracted with EA (5 mL x 2) . The combined organic layers was washed with water (5 mL) and brine (5 mL) successively, separated and concentrated under vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/1) to afford 4- ( (3- (9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.049 g, 116.25 μmol, 60.01%yield) as light brown solid. LCMS: m/z = 422 [M+1]  +.
Step 8. 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-3)
Into a 4 mL vial was placed 4- ( (3- (9-acetyl-1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.049 g, 116.25 μmol) , 1-methylpiperidin-4-amine (0.067 g, 586.75 μmol) , sodium cyanoborohydride (79 mg, 1.29 mmol) , acetic acid (0.01 μmol) , ethanol (0.5 mL) . The resulted mixture was stirred overnight at 80℃. LCMS showed the reaction was complete. The reaction was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 35-60-80%B (2-30-60min) ; 245 nm; RT: 42.293 –46.665 min) to afford 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -1, 2, 3, 4-tetrahydroazepino [3, 2, 1-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-3) (27 mg, 51.95 μmol, 44.69%yield) as off-white solid . LCMS: m/z = 520 [M+1]  +.  1H NMR (400 MHz, DMSO-d 6) δ 7.59 (d, J = 8.2 Hz, 2H) , 7.22 (s, 1H) , 6.94 (d, J = 14.7 Hz, 3H) , 6.86 (t, J = 6.2 Hz, 1H) , 6.79 (d, J = 8.4 Hz, 2H) , 6.62 (s, 1H) , 4.30 (d, J = 5.8 Hz, 2H) , 4.14 (t, J = 5.3 Hz, 2H) , 3.84 (q, J =6.6 Hz, 1H) , 3.08 –2.96 (m, 2H) , 2.68 –2.55 (m, 2H) , 2.16 –2.07 (m, 1H) , 2.04 (s, 3H) , 2.02 –1.90 (m, 4H) , 1.80 (d, J = 12.7 Hz, 1H) , 1.67 (q, J = 12.5 Hz, 2H) , 1.54 (d, J = 12.6 Hz, 1H) , 1.27 –1.14 (m, 5H) .
Example D-4
4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino)benzenesulfonamide (D-4)
Reaction scheme:
Figure PCTCN2022085296-appb-000199
Experimental details
Step1. 2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine.
Into a 100 mL flask was placed 2-aminobenzenethiol (10.02 g, 80.04 mmol) , 1, 3-dibromopropane (17.77 g, 88.02 mmo l) , K 2CO 3 (13.32 g, 96.38 mmol) , DMF (160 mL) . The reaction was stirred for 1 h at 80℃. LCMS showed the reaction was complete. The reaction was quenched with water (250 mL) , extracted with EA (150 mL x 2) . The combined organic layers were washed with water (200 mL) and brine (200 mL) successively, separated, and concentrated with vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/2) to afford 2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine (8.17 g, 49.44 mmol, 61.77%yield) as a light yellow oil. LCMS: m/z =166 [M+1]  +.
Step 2. 2-chloro-1- (3, 4-dihydrobenzo [b] [1, 4] thiazepin-5 (2H) -yl) ethan-1-one.
Into an ice-cold 250 mL flask was placed 2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine (7.99 g, 48.35 mmol) , TEA (6.40 g, 63.25 mmol) , Monochloroacetyl chloride (6.56 g, 58.09 mmol) , DCM (100 mL) , and stirred for 1 h at room temperature. TLC monitored that the reaction was complete. The reaction was purified by silica gel column, eluted with EA/n-Hexane (v/v = 1/2) to afford 2-chloro-1- (3, 4-dihydrobenzo [b] [1, 4] thiazepin-5 (2H) -yl) ethan-1-one (7.08 g, 29.29 mmol, 60.57%yield) as brown solid. LCMS: m/z = 242 [M+1]  +.
Step3. 3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into a 40 mL vial purged and maintained with nitrogen atmosphere was placed 2-chloro-1- (3, 4-dihydrobenzo [b] [1, 4] thiazepin-5 (2H) -yl) ethan-1-one (0.999 g, 4.14 mmol) , Pd 2 (dba)  3 (1.922 g, 2.10 mmol) , X-Phos (1.977 g, 4.15 mmol) , TEA (0.640 g, 6.32 mmol) , toluene (10 mL) , and stirred for 1 h at 90℃. LCMS showed that the reaction was complete. The reaction was quenched with water (20 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (10 mL) and brine (10 mL) successively, separated, and concentrated with vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/4) to afford 3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (0.790 g, 3.8485 mmol, 93.13%yield) as brown solid. LCMS: m/z = 206 [M+1]  +.
Step4. 9-bromo-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into a 40 mL flask was placed 3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (0.778 g, 3.79 mmol) , NBS (0.810 g, 4.55 mmol) , MeCN (10 mL) , glacial acetic acid (0.01 mL) . The reaction was stirred for 1.5 h at room temperature. LCMS showed the reaction was complete. he reaction was concentrated under vacuum, purified with silica-gel column, eluted with EA/n-Hexane (v/v = 1/5) to afford 9-bromo-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (0.363 g, 1.28 mmol, 33.70 %yield) as a brown solid. LCMS: m/z = 286 [M+1]  +
Step5. 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into a 40 mL flask was placed 9-bromo-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (1.163 g, 4.09 mmol) , tributyl (1-ethoxyvinyl) stannane (1.821 g, 5.04 mmol) , KF (0.297 g, 5.11 mmol) , Pd (PPh 3)  2Cl 2 (0.367 g, 0.52 mmol) , 1, 4-dioxane (10 mL) . The reaction was stirred for 1 h at 80℃. LCMS showed the reaction was complete. The reaction was quenched with water (10 mL) , extracted with EA (5 mL x 2) . The combined organic layers were washed with water (10 mL) and brine (10 mL) successively, separated, then concentrated with vacuum. The residue was purified with silica-gel column, eluted with EA/n-Hexane (v/v = 1/7) to afford 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (0.332 g, 1.34 mmol, 32.80%yield) as a brown solid. LCMS: m/z = 248 [M+1]  +
Step6. 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
Into an ice-cold 4 mL flask was placed 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (0.332 g, 1.34 mmol) , TEA (0.209 g, 2.07 mmol) , Trifluoromethanesulfonic anhydride (0.459 g, 1.62 mmol) , DCM (5 mL) . The reaction was stirred for 0.6 h at room temperature. LCMS showed that the reaction was complete. The reaction was quenched with water (20 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (15 mL) and brine (15 mL) successively, separated, then concentrated with vacuum. The residue was purified by silica gelcolumn, eluted with EA/n-Hexane (v/v = 1/6) to afford 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.335 g, 883.03 μmol, 65.77 %yield) as dark brown oil. LCMS: m/z = 380 [M+1]  +.
Step7. 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 8 mL vial purged and maintained with nitrogen atmosphere was placed 9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.307 g, 809.23 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.395 g, 1.88 mmol) , Pd (PPh 3)  2Cl 2 (0.100 g, 141.66 μmol) , CuI (0.024 g, 126.02 μmol) , TEA (0.197 g, 1.95 μmol) , DMF (3 mL) , and stirred for 1 h at room temperature. LCMS monitored that the reaction was complete. The reaction was quenched with water (20 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (20 mL) and brine (20 mL) successively, separated, then concentrated with vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/1) to afford 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.179 g, 407.2350 μmol, 50.32%yield) as brown solid. LCMS: m/z = 440 [M+1]  +.
Step8. 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-4) .
Into a 4 mL flask was placed 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.176 g, 400.41 μmol) , 1-methylpiperidin-4-amine (0.094 mg, 0.82 , mol) , Sodium cyanoborohydride (165.85 mg, 2.68 mmol) , acetic acid (0.01 μmol) , Ethanol (2 mL) and stirred overnight at 80℃. LCMS showed the reaction was complete, the reaction was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile  Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-70-85%B (2-30-60min) ; 265 nm; RT: 41.683 –46.970 min) to afford 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-4) (75 mg, 139.47 μmol, 34.83 %yield) as off-white solid . LCMS: m/z = 538 [M+1]  +.
1H NMR (400 MHz, DMSO-d 6) δ 7.59 (d, J = 8.3 Hz, 2H) , 7.27 (s, 1H) , 7.09 (s, 1H) , 6.98 (s, 2H) , 6.88 (t, J = 6.2 Hz, 1H) , 6.80 (d, J = 8.4 Hz, 2H) , 6.61 (s, 1H) , 4.61 –4.53 (m, 2H) , 4.31 (d, J = 5.6 Hz, 2H) , 3.94 –3.91 (m, 1H) , 3.33 –3.21 (m, 3H) , 2.73 (t, J = 12.2 Hz, 2H) , 2.30 –2.18 (m, 2H) , 2.15 (s, 3H) , 1.95 –1.81 (m, 3H) , 1.64 (d, J = 12.9 Hz, 1H) , 1.41 –1.28 (m, 2H) , 1.24 (d, J = 6.5 Hz, 3H) .
Example D-5
6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine (D-5)
Reaction scheme:
Figure PCTCN2022085296-appb-000200
Experimental details
Step1. 2-amino-4-nitrobenzenethiol.
Into a 500 mL flask was placed 2-fluoro-5-nitroaniline (19.96 g, 127.86 mmol) , Sodium sulfide nonahydrate (33.76 g, 432.57 mmol) , K 2CO 3 (19.61 g, 141.89 mmol) , water (250 mL) . The reaction was heated reflux and stirred for 1 h. LCMS showed the reaction was complete. The reaction was quenched with 1M HCl (aq. ) to pH 5～6, extracted with EA (300 mL x 2) . The combined organic layers were washed with water (500 mL) and brine (200 mL) successively, separated, and concentrated with vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/1) to afford 2-amino-4-nitrobenzenethiol (15.63 g, 91.8392 mmol, 71.83 %yield) as a yellow solid. LCMS: m/z =171 [M+1]  +.
Step 2. 7-nitro-2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine.
Into an ice-cold 250 mL flask was placed 2-amino-4-nitrobenzenethiol (4.04 g, 23.74 mmol) , NaH (2.29 g, 95.43 mmol) , DMF (50 mL) . The reaction stirred for 1 h and warmed to room temperature naturally. 1, 3-Dibromopropane (6.01 g,29.77 mmol) was added to the reaction, and the reaction was heated to 80℃ with stirring. LCMS showed the reaction was complete. The reaction was quenched with sat. NH 4Cl aq. (150 mL) , extracted with EA (100 mL x 2) . The combined organic layers were washed with water (100 mL) and brine (100 mL) successively, separated, and concentrated under vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/3) to afford 7-nitro-2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine (1.16 g, 5.52 mmol, 23.24 %yield) as a brown oil. LCMS: m/z =211 [M+1]  +.
Step 3. 2-chloro-1- (7-nitro-3, 4-dihydrobenzo [b] [1, 4] thiazepin-5 (2H) -yl) ethan-1-one.
Into an ice-cold 100 mL flask was placed 7-nitro-2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] thiazepine (1.07 g, 5.09 mmol) , TEA (0.79 g, 7.81 mmol) , Monochloroacetyl chloride (0.86 g, 7.61 mmol) , DCM (10 mL) , and stirred for 1 h at room temperature. TLC monitored that the reaction was complete. The reaction was purified by silica gel column, eluted with EA/n-Hexane (v/v = 1/3) to afford 2-chloro-1- (7-nitro-3, 4-dihydrobenzo [b] [1, 4] thiazepin-5 (2H) -yl) ethan-1-one (0.72 g, 2.51 mmol, 49.34 %yield) as brown solid. LCMS: m/z = 287 [M+1]  +.
Step4. 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-ol.
Into a 100 mL flask was placed 2-chloro-1- (7-nitro-3, 4-dihydrobenzo [b] [1, 4] thiazepin-5 (2H) -yl) ethan-1-one (0.293 g, 1.02mmol) , t-BuOK (0.179 g, 1.60 mmol) , DMSO (10 mL) , and stirred for 1 h at room temperature. LCMS showed that the reaction was complete. The reaction was quenched to pH 5 ～ 6 with 1M HCl aq., extracted with EA (5 mL x 2) . The combined organic layers were washed with water (5 mL) and brine (5 mL) successively, separated, and concentrated with vacuum. The residue was purified with silica gel column EA/n-Hexane (v/v = 1/2) to afford 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-ol (0.075 g, 299.67 μmol, 29.33 %yield) as brown solid. LCMS: m/z = 251 [M+1]  +.
Step5. 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
Into an ice-cold 25 mL flask was placed 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-ol (0.072 g, 287.69 μmol) , Trifluoromethanesulfonic anhydride (0.166 g, 588.36 μmol) , TEA (0.066 g, 652.24 μmol) , DCM (10 mL) . The reaction was stirred for 1.5 h at room temperature. LCMS showed the reaction was complete. The reaction was concentrated under vacuum, purified with silica-gel column, eluted with EA/n-Hexane (v/v = 1/3) to afford 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.053 g, 138.62 μmol, 48.18 %yield) as a brown oil. LCMS: m/z = 383 [M+1]  +
Step6. 2-methoxy-4- (methylsulfonyl) -N- (3- (8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) aniline.
Into a 4 mL vial purged and maintained with nitrogen atmosphere was placed 8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.048 g, 125.54 μmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.062 g, 259.10 μmol) , Pd (PPh 3)  2Cl 2 (0.009 g, 12.75 μmol) , CuI (0.006 g, 31.50 μmol) , TEA (0.028 g, 276.71 μmol) , DMF (0.5 mL) , and stirred overnight at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (3 mL x 2) . The combined organic layers were washed with water  (3 mL) and brine (3 mL) successively, separated, then concentrated with vacuum. The residue was purified with C 18 column, eluted with ACN/water (v/v = 1/1) to afford 2-methoxy-4- (methylsulfonyl) -N- (3- (8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) aniline (0.054 g, 114.52 μmol, 91.21%yield) as a brown solid. LCMS: m/z =472 [M+1]  +
Step7. 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine.
Into a 25 mL flask was placed 2-methoxy-4- (methylsulfonyl) -N- (3- (8-nitro-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) aniline (0.051 g, 108.15 μmol) , disodium hydrosulfite (0.078 g, 448.00 μmol) , NaOH (0.035 g, 875.06 μmol) , EtOH (1 mL) , water (1 mL) , THF (0.5 mL) . The reaction was stirred for 3 h at 70℃. LCMS showed that the reaction was complete. The reaction was quenched with water (5 mL) , extracted with EA (3 mL x 2) . The combined organic layers were washed with water (3 mL) and brine (3 mL) successively, separated, then concentrated with vacuum. The residue was purified by C 18 column, eluted with ACN/water (v/v = 2/3) to afford 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine (0.025 g, 56.62 μmol, 52.35 %yield) as brown solid. LCMS: m/z = 442 [M+1]  +.
Step8. 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine (D-5) .
Into a 25 mL flask was placed 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine (0.021 g, 47.56 μmol) , 1-methylpiperidin-4-one (0.052 g, 459.54 mol) , Sodium cyanoborohydride (0.030 g, 699.70 μmol) , acetic acid (0.01 μmol) , Ethanol (1 mL) and stirred overnight at 70℃. LCMS showed the reaction was complete, the reaction was concentrated under vacuum and purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 35-65-95%B (2-30-60min) ; 268nm;RT: 38.890 –40.150 min; ) to afford 6- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1-methylpiperidin-4-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-8-amine (D-5) (13 mg, 24.13 μmol, 50.74 %yield) as off-white solid . LCMS: m/z = 539 [M+1]  +.
1H NMR (400 MHz, DMSO-d 6) δ 7.44 –7.39 (m, 1H) , 7.25 (s, 1H) , 6.92 –6.86 (m, 2H) , 6.78 (d, J = 8.0 Hz, 1H) , 6.50 (t, J = 6.4 Hz, 1H) , 5.94 (d, J = 8.0 Hz, 1H) , 5.43 (d, J = 7.9 Hz, 1H) , 4.65 –4.53 (m, 2H) , 4.35 (d, J = 6.0 Hz, 2H) , 3.89 (s, 3H) , 3.19 –3.08 (m, 6H) , 2.83 (d, J = 11.4 Hz, 2H) , 2.24 (s, 3H) , 2.19 –2.06 (m, 4H) , 1.95 –1.86 (m, 2H) , 1.54 –1.42 (m, 2H) .
Example D-6
4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-6)
Reaction scheme:
Figure PCTCN2022085296-appb-000201
Experimental details
Step1. 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indole-9-carbonitrile.
Into a 50 mL flask was placed 9-bromo-3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6 (7H) -one (0.606 g, 2.13 mmol) , zinc cyanide (0.741 g, 6.31 mmol) , Pd (dppf)  2Cl 2 (0.156 g, 213.20 μmol) , TEA (0.436 g, 4.31 mmol) , zinc (0.019 g, 290.56 μmol) , DMF (4 mL) . The reaction was stirred for 1 h at 150℃. LCMS showed the reaction was complete. The reaction was cooled to room temperature and quenched with water (10 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (5 mL) and brine (5 mL) successively, separated, and concentrated with vacuum. The residue was purified with silica gel column, eluted with EA/n-Hexane (v/v = 2/1) to afford 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indole-9-carbonitrile (0.331 g, 1.44 mmol, 67.40 %yield) as a yellow solid. LCMS: m/z =231 [M+1]  +.
Step 2. tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
Into a 100 mL flask purged and maintained with hydrogen atmosphere was placed 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indole-9-carbonitrile (0.249 g, 1.08 mol) , nickle (0.244 g, 4.16 mmol) , Boc 2O (0.688 g, 3.15 mmol) , MeOH (15 mL) . The reaction stirred for 5 h at room temperature. LCMS showed the reaction was complete. The reaction was filtered, the filter cake was washed with MeOH /DCM (v/v = 1: 1, 10 mL x 2) . The filtrate was concentrated under vacuum. The residue was purified with silica gel column, eluted with EA/n-Hexane (v/v = 1/2) to afford tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate (0.118 g, 352.84 μmol, 32.63%yield) as a brown oil. LCMS: m/z =335 [M+1]  +.
Step3. 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
Into an ice-cold 4 mL vial was placed tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate (0.110 g, 328.92 μmol) , Trifluoromethanesulfonic anhydride (0.138 g, 489.12 μmol) , TEA (0.083 g, 820.24 μmol) , DCM (1 mL) . The reaction was stirred for 4.5 h at room temperature. LCMS showed the reaction was complete. The reaction was concentrated under vacuum, purified with prep-TLC, developed with EA/n-Hexane (v/v = 1/3) to afford 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.035 g, 75.03 μmol, 22.81%yield) as a brown oil. LCMS: m/z = 467 [M+1]  +
Step4. tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
Into a 4 mL flask purged and maintained with nitrogen atmosphere was placed 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.033 g, 70.74 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.028 g, 133.17 μmol) , Pd (PPh 3)  2Cl 2 (0.008 g, 11.33 μmol) , CuI (0.003 g, 15.75 μmol) , TEA (0.024 g, 237.18 μmol) , DMF (0.5 mL) , and stirred for 1.5 h at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with silica-gel column, eluted with EA/n-Heptane (v/v = 1/2) to afford tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate (0.020 g, 37.97 μmol, 53.68%yield) as a brown solid. LCMS: m/z = 527 [M+1]  +
Step5. 4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-6) .
Into a 25 mL flask was placed tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate (0.020 g, 37.97 μmol) , HCl (g) in EtOAc (1M, 1 mL) and stirred for 1 h at room temperature. LCMS showed the reaction was complete, the reaction was quenched with sat. NaHCO 3 aq. to pH 8 ～9 under 0℃, extracted with EA (3 mL x3) . The combined organic layers were washed with water (3 mL) and brine (3 mL) successively, separated, then concentrated with vacuum. The crude product was dissolved with EtOH (0.5 mL) in a 4 mL vial. Into the vial 1-methylpiperidin-4-one (0.022 g, 194.42 μmol) , Sodium cyanoboronhydride (43.27 mg, 699.70 μmol) , glacial acetic acid (0.01 mL) was added under room temperature. The reaction was stirred for 1.5 h at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 35-65-95%B (2-30-60min) ; 270 nm; RT: 39.305 –40.943 min; ) to afford 4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] thiazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-6) (1 mg, 1.91 μmol, 5.03%yield) as off-white solid. LCMS: m/z = 524 [M+1]  +.
Example D-7
4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-7)
Reaction scheme:
Figure PCTCN2022085296-appb-000202
Experimental details:
Step 1. N- (2-hydroxyphenyl) formamide.
Into a 250-mL round-bottom flask was placed 2-aminophenol (10.14 g, 92.92 mmol) , HCOONa (6.39, 93.96 mmol) , HCOOH (100 mL) . The mixture was stirred at 90℃ for 16 h. The reaction was concentrated under vacuum to about 10 mL. Then Na 2CO 3 (aq, 200 mL) was added. The mixture was extracted with EA (3x200 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/Hex (v/v= 1/10) . This resulted in 9.58 g (75%yield) of N- (2-hydroxyphenyl) formamide as white solid. LCMS: m/z = 138 [M+1]  +.
Step 2. 3, 4-dihydrobenzo [b] [1, 4] oxazepine-5 (2H) -carbaldehyde.
Into a 250-mL round-bottom flask was placed N- (2-hydroxyphenyl) formamide (8.09 g, 58.99 mmol) , NaH (7.15 g, 297.94 mmol) , DMF (100 mL) . The mixture was stirred at 120℃. Then 1, 3-dibromopropane (17.15 g, 84.95 mmol) was added. The reaction was stirred for 2 h at 120℃. The reaction was quenched by water (200 mL) , extracted with EA (3 x 200 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/Hex (v/v=1/3) . This resulted in 5.24 g (50%yield) of 3, 4-dihydrobenzo [b] [1, 4] oxazepine-5 (2H) -carbaldehyde as white solid. LCMS: m/z = 178 [M+1]  +.
Step 3. 2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] oxazepine.
Into a 100-mL round-bottom flask was placed 3, 4-dihydrobenzo [b] [1, 4] oxazepine-5 (2H) -carbaldehyde (4.77 g, 26.92 mmol) , HCl (20 mL) , H 2O (20 mL) . The reaction was stirred for 1 h at 80 ℃. The reaction was concentrated under vacuum to about 10 mL. Then Na 2CO 3 (aq, 50 mL) was added. The resulted mixture was extracted with EA (3 x 50 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/Hex (v/v = 1/10) . This resulted in 4.60 g (95%yield) of 2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] oxazepine as white solid. LCMS: m/z = 150 [M+1]  +.
Step 4. 2-chloro-1- (3, 4-dihydrobenzo [b] [1, 4] oxazepin-5 (2H) -yl) ethan-1-one.
Into a 100-mL round-bottom flask was placed 2, 3, 4, 5-tetrahydrobenzo [b] [1, 4] oxazepine (4.03 g, 20.75 mmol) , 2-chloroacetyl chloride (2.95 g, 26.12 mmol) , TEA (6.36 g, 62.85 mmol) and DCM (20 mL) . The reaction was stirred at 25℃for 1 h. The reaction was quenched by water (50 mL) , extracted with DCM (3 x 50 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/Hex (v/v=1/10) . This resulted in 6.22 g (98%yield) of 2-chloro-1- (3, 4-dihydrobenzo [b] [1, 4] oxazepin-5 (2H) -yl) ethan-1-one as white solid.  LCMS: m/z = 226 [M+1]  +.
Step 5. 3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into a 100-mL round-bottom flask was placed 2-chloro-1- (3, 4-dihydrobenzo [b] [1, 4] oxazepin-5 (2H) -yl) ethan-1-one (2.06 g, 9.13 mmol) , Pd 2dba 3 (4.10 g, 4.48 mmol) , Xphos (4.24 g, 8.89 mmol) , TEA (2.75 g, 27.18 mmol) , toluene (20 mL) . The reaction was stirred for 2 h at 90℃. The mixture was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with Hex/EA (v/v=10/1) . This resulted in 1.227 g (71%yield) of 3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one as white solid. LCMS: m/z = 190 [M+1]  +.
Step 6. 9-bromo-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into a 50-mL round-bottom flask was placed 3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (0.539 g, 2.85 mmol) , NBS (0.547 g, 3.07 mmol) , ACN (10 mL) . The mixture was stirred at 20℃ for 1 h. The mixture was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with Hex/EA (v/v=3/1) . This resulted in 0.548 g (71%yield) of 9-bromo-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one as white solid. LCMS: m/z = 268 [M+1]  +.
Step 7. 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into a 50-mL round-bottom flask was placed 9-bromo-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (0.336 g, 1.25 mmol) , tributyl (1-ethoxyvinyl) tin (0.547 g, 1.48 mmol) , KF (0.084 g, 1.44 mmol) , TEA (0.144 g, 1.42 mmol) , dioxane (10 mL) . The mixture was stirred at 90℃ for 1 h. The mixture was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with Hex/EA (v/v=5/1) . This resulted in 0.157 g (54%yield) of 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one as white solid. LCMS: m/z = 232 [M+1]  +.
Step 8. 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yltrifluoromethanesulfonate.
Into a 100-mL round-bottom flask was placed 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (0.178 g, 0.77 mmol) , trifluoromethanesulfonic anhydride (2.91 g, 1.03 mmol) , TEA (0.503 g, 4.97 mmol) and DCM (20 mL) . The reaction was stirred at 25℃ for 1 h. The reaction was quenched by water (50 mL) , extracted with DCM (3 x 50 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/Hex (v/v=1/10) . This resulted in 0.079 g (28%yield) of 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yltrifluoromethanesulfonate as white solid. LCMS: m/z = 364 [M+1]  +.
Step 9. 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 50-mL round-bottom flask was placed 9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yltrifluoromethanesul fonate (0.063 g, 173.41 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.042 g, 199.76 μmol) , CuI (0.049 g, 257.28 μmol) , Pd (PPh 3)  2Cl 2 (0.085 g, 120.41 μmol) , DIEA (0.100 g, 988.25 μmol) and Methyl sulfoxide (2 mL) . The mixture was stirred at 25℃ for 4h. The reaction mixture was purified by C18 column eluted with ACN/H 2O (v/v=1/1) . This resulted in 0.011 g (14%yield) of 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide as light yellow oil. LCMS: m/z = 424 [M+1]  +.
Step 10. 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-7) .
Into a 50-mL round-bottom flask was placed 4- ( (3- (9-acetyl-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.046 g, 108.62 μmol) , 1-methylpiperidin-4-one (0.045 g, 394.09 umol) , NaCNBH 3 (0.051 g, 1.19 mmol) , and EtOH (5 mL) . The mixture was stirred at 20℃ for 1 h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 50-70-90%B (35-65-95min) ; 247 nm; RT: 34.455 -36.854 min; ) . This resulted in 0.003 g (5%yield) of 4- ( (3- (9- (1- ( (1-methylpiperidin-4-yl) amino) ethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenes ulfonamide (D-7) as white solid. LCMS: m/z =522 [M+1]  +.
Example D-8
4- ( (3- (9- ( (1-methylpiperidin-4-yl) amino) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzene sulfonamide (D-8)
Reaction scheme:
Figure PCTCN2022085296-appb-000203
Experimental details
Step1. 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one.
Into an ice-cold 8 mL vial was placed 3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (0.301 g, 1.59 mmol) , KNO 3 (0.162 g, 1.60 mmol) , TFA (3 ml) . The reaction was warmed to room temperature and stirred for 40 min. LCMS showed the reaction was complete. The reaction was quenched with water (20 mL) , extracted with EA (10 mL x 2) . The combined organic layers were washed with water (10 mL) and brine (10 mL) successively, separated, then concentrated with vacuum to afford 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (0.330 g, 1.41 mmol, 88.57%yield) as a yellow solid. LCMS: m/z =235 [M+1]  +.
Step 2. 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
Into an ice-cold 8 mL flask was placed 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (0.273 g, 1.17 mmol) , Trifluoromethanesulfonic anhydride (0.608 g, 2.16 mmol) , TEA (0.243 g, 2.40 mmol) , DCM (2 mL) . The reaction was stirred for 2.5 h at room temperature. LCMS showed the reaction was complete. The reaction was concentrated under vacuum, purified with silica-gel column, eluted with EA/n-Hexane (v/v = 1/3) to afford 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.217 g, 592.46 μmol, 50.83%yield) as a brown oil. LCMS: m/z = 367 [M+1]  +
Step3. 4- ( (3- (9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 4 mL vial purged and maintained with nitrogen atmosphere was placed 9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.187 g, 510.55 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.180 g, 856.11 μmol) , Pd (PPh 3)  2Cl 2 (0.034 g, 48.16 μmol) , CuI (0.013 g, 68.26 μmol) , TEA (0.096 g, 948.72 μmol) , DMF (1mL) , and stirred for 1 h at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (3 mL x 2) . The combined organic layers were washed with water (3 mL) and brine (3 mL) successively, separated, then concentrated with vacuum. The residue was purified with C 18 column, eluted with ACN/water (v/v = 1/3) to afford 4- ( (3- (9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.054 g, 114.52 μmol, 91.21%yield) as a brown solid. LCMS: m/z = 427 [M+1]  +
Step4. 4- ( (3- (9-amino-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 25 mL flask was placed 4- ( (3- (9-nitro-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.134 g, 314.23 μmol) , disodium hydrosulfite (0.437 g, 2.51 mmol) , NaOH (0.109 g, 2.73 mmol) , EtOH (1 mL) , water (1 mL) , THF (0.5 mL) . The reaction was stirred for 3 h at 70℃. LCMS showed that the reaction was complete. The reaction was quenched with water (5 mL) , extracted with EA (3 mL x 2) . The combined organic layers were washed with water (3 mL) and brine (3 mL) successively, separated, then concentrated with vacuum. The residue was purified by C 18 column, eluted with ACN/water (v/v = 1/4) to afford 4- ( (3- (9-amino-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.058 g, 146.2940 μmol, 46.56%yield) as brown solid. LCMS: m/z = 397 [M+1]  +.
Step5. 4- ( (3- (9- ( (1-methylpiperidin-4-yl) amino) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-8) .
Into a 25 mL flask was placed 4- ( (3- (9-amino-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.021 g, 52.97 μmol) , 1-methylpiperidin-4-one (0.023 g, 203.26 μmol) , Sodium cyanoborohydride (0.022 g, 513.11 μmol) , acetic acid (0.01 μmol) , Ethanol (0.5 mL) and stirred for 5 h at room temperature. LCMS showed the reaction was complete, the reaction was concentrated under vacuum and purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 35-65-65%B (2-30-60min) ; 247 nm; RT: 28.365 –30.551 min; ) to afford 4- ( (3- (9- ( (1-methylpiperidin-4-yl) amino) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-8) (0.002 g, 4.05 μmol, 7.65%yield) as off-white solid. LCMS: m/z = 494 [M+1]  +.
Example D-9
4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-9)
Reaction scheme:
Figure PCTCN2022085296-appb-000204
Experimental details:
Step 1. 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indole-9-carbonitrile.
Into a 50-mL round-bottom flask was placed 9-bromo-3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6 (7H) -one (1.80 g, 6.71 mmol) , Zn (CN)  2 (2.58, 21.99 mmol) , Pd (dppf) Cl 2 (0.68 g, 0.92 mmol) , TEA (2.67 g, 26.35 mmol) , Zn (0.267 g, 4.08 mmol) , DMF (5 mL) . The mixture was stirred at 150℃ for 3h. The reaction was quenched by H 2O (20 mL) , extracted with EA (3 x 20 mL) . The organic layers combined and concentrated under vacuum. The residue was purifiedby silica gel column eluted with EA/hexane (v/v = 2/8) . This resulted in 2.49 g (97%yield) of 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indole-9-carbonitrile as yellow solid. LCMS: m/z = 215 [M+1]  +.
Step 2. tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
Into a 50-mL round-bottom flask was placed 6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indole-9-carbonitrile (2.16 g, 10.08mmol) , Raney Ni (7.10 g, 120.97 mmol) , Boc 2O (7.09 g, 32.49 mmol) , MeOH (20 mL) . The flask was charged with H 2 (g) . The mixture was stirred at 25℃ for 16 h. The reaction was quenched by water (100 mL) , extracted with EA (3 x 100 mL) . The organic layers was combined and concentrated under vacuum. The residue was purifiedby silica gel column eluted with EA/hexane (v/v=1/1) . This resulted in 1.56 g (48%yield) of tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate as yellow solid. LCMS: m/z = 319 [M+1]  +.
Step 3. 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate.
Into a 50-mL round-bottom flask was placed tert-butyl ( (6-oxo-3, 4, 6, 7-tetrahydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate (0.57 g, 2.12 mmol) , TEA (1.05 g, 10.34 mmol) , DCM (10 mL) . Then was added trifluoromethanesulfonic anhydride (0.79 g, 2.78 mmol) at 0℃. The reaction was stirred for 16 h at 20℃. The mixture was combined and concentrated under vacuum. The reaction mixture was purified by C 18 chromatography column with ACN/H 2O (0.15%NH 3. H 2O) (v/v=1/1) . This resulted in 0.539 g (56%yield) of 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate as white solid. LCMS: m/z =451 [M+1]  +.
Step 4. tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate.
Into a 8-mL vial was placed 9- ( ( (tert-butoxycarbonyl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl trifluoromethanesulfonate (0.297 g, 659.37 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.308 g, 1.46 mmol) , CuI (0.136 g, 714.10 μmol) , Pd (PPh 3)  2Cl 2 (0.122 g, 172.82 μmol) , TEA (0.459 g, 4.54 mmol) and Methyl sulfoxide (2 mL) .  The reaction was charged with N 2 and stirred at 25℃ for 3 h. The reaction was quenched by water (10 mL) , extracted with EA (3x10 mL) . The organic layers was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/hexane (v/v=2/1) . This resulted in 357 mg (98%yield) of tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate as yellow solid. LCMS: m/z = 511 [M+1]  +.
Step 5. 4- ( (3- (9- (aminomethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide.
Into a 100-mL round-bottom flask was placed tert-butyl ( (6- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-9-yl) methyl) carbamate (0.101 g, 0.19 mmol) , AlCl 3 (0.060 g, 0.45 mmol) , DCM (10 mL) . The reaction was stirred for 1 h at 20℃. The mixture was combined and concentrated under vacuum. The residue was purified by silica gel column eluted with DCM/MeOH (v/v=10/1) . This resulted in 82 mg (98%yield) of 4- ( (3- (9- (aminomethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide as white solid. LCMS: m/z = 411 [M+1]  +.
Step 6. 4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-9) .
Into a 50-mL round-bottom flask was placed 4- ( (3- (9- (aminomethyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.076 g, 185.15 μmol) , 1-methylpiperidin-4-one (0.136 g, 1.20 mmol) , NaCNBH 3 (0.095 g, 2.22 mmol) , and EtOH (5 mL) . The mixture was stirred at 20℃ for 1 h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 25-50-75%B (2-30-60min) ; 248 nm; RT: 31.110 –34.567 min; ) . This resulted in 8 mg (9%yield) of 4- ( (3- (9- ( ( (1-methylpiperidin-4-yl) amino) methyl) -3, 4-dihydro-2H- [1, 4] oxazepino [2, 3, 4-hi] indol-6-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (D-9) as white solid. LCMS: m/z =508 [M+1]  +.
Pharmacological Experiments
1. In vitro DNA binding assay.
After His-P53 Y220C (94-294) protein with a compound in the present of MAb Anti His-Tb cryptate (Cisbio, Cat. NO. 61HI2TLA) in a 384 well microplate (Greiner) for 15 min at 25℃, the assay plate was transferred into 27℃ incubator and incubate for 60 min. Biotinalyted p53 consensus DNA (ID: P53-SEQUENCE 2
-F: 5’ (biotin) -ATTAGGCATGTCTAGGCATGTCTAGG 3’
-R: 5’ CCTAGACATGCCTAGACATGCCTAAT 3’) was added into assay plate in the present of Streptaidin -d2 (Cisbio, Cat. NO. 610SADLF) cryptate (Final concentration: 20 mM HEPES pH = 7.4, 75 mM KCl, 1mM MgCl2, 0.1% (w/v) BSA, 1 mM DTT, 2.5 nM His-P53 Y220C (94-294) protein, 0.33 nM MAb Anti His-Tb cryptate, 2.5nM Streptaidin -d2 cryptate, 10 nM Biotinalyted DNA) and incubate for another 60 min. Wells containning 50 uM reference compound served as High control, and wells containing same percentage of DMSO served as low control. Homogeneous time-resolved fluorescence (HTRF) signals were read on Tecan Spark multimode microplate reader. HTRF ratios for each individual wells were calculated by equation: HTRF ratio = (Signal F665/Signal F620) *1000. The percent of activation of compounds treated wells were normalized between High control and low control (%Activation = (HTRF ratio  Compound treated –HTRF ratio  Low control) / (HTRF ratio  High control –HTRF ratio Low control) *100%) . Then the data were analyzed either by fitting a 4-parameter logistic model or by Excel to calculate EC 50 values. and the EC 50 was the concentration at 50%Activation on the curve.
The structure of reference compound:
Figure PCTCN2022085296-appb-000205
The p53 (Y220C) EC 50 (μM) values of some example compounds in Example part A of the present invention were shown in the following table I.
Table I
Figure PCTCN2022085296-appb-000206
The p53 (Y220C) EC 50 (μM) values of Reference compound used in the assay for compounds of Examples part A is shown as below.
Figure PCTCN2022085296-appb-000207
The p53 (Y220C) EC 50 (μM) values of some example compounds in Example part B of the present invention were shown in the following table II.
Table II
Figure PCTCN2022085296-appb-000208
The p53 (Y220C) EC 50 (μM) values of some example compounds in Example part C of the present invention were shown in the following table III.
Table III
Figure PCTCN2022085296-appb-000209
The p53 (Y220C) EC 50 (μM) values of some example compounds in Example part D of the present invention were shown in the following table IV.
Table IV
Example No. p53 (Y220C) EC 50 (μM)
D-1 ＞50
D-2 ＞50
D-3 ＞50
D-4 1.699
D-5 ＞50
D-7 35.997
D-8 ＞50
D-9 ＞50
The p53 (Y220C) EC 50 (μM) values of Reference compound used in the assay for compounds of Examples part D is shown as below.
Figure PCTCN2022085296-appb-000210
2. NUGC3 Cell with p53 Y220C mutant viability assay.
A desired number of cells were seeded into 96 well microplate and cultured in 37℃ cell incubator overnight. Compounds dissolved in cell culture medium were added into cell plate and cultured for 6 days. After equilibrium CellTiter-Glo reagent and cells at room temperature for 30 min, equal volume of CellTiter –Glo reagents was added to assay plate and shook for 2 min for cell lysis. The cells were balanced at room temperature for 10 minutes and Luminescence signal was read using Envision. The percent of viability of compounds treated wells were normalized between High control and low control. Wells containing cell culture medium and same percentage DMSO served as Low control. Wells containing cells and same percentage DMSO served as High control. Cell viability (%) = (Luminescence readout Compound treated–Luminescence readout Low control) / (Luminescence readout High control –Luminescence readout Low control) *100%. Then the data was analyzed either by fitting a 4-parameter logistic model or by Excel to calculate IC50 values and the IC50 was the concentration at 50%Cell viability on the curve.

Claims (23)

  1. A compound of formula (I) , a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof;
    Figure PCTCN2022085296-appb-100001
    Wherein:
    Each
    Figure PCTCN2022085296-appb-100002
    is independently a single bond or a double bond;
    X 1 is CR 5, NR 6, O, S, C=O, C=S or a carbon atom connected to R 2;
    X 2 is CR 7, NR 8, O, S, C=O, C=S or a carbon atom connected to R 2;
    X 3 is CR 9, NR 10, O, S, C=O, C=S or a carbon atom connected to R 2;
    X 4 is CR 11, NR 12, O, S, C=O, C=S or a carbon atom connected to R 2;
    X 5, X 6 is independently selected from CR 13 or N;
    X 7 is CR 14 or NR 14;
    wherein at least one of X 1, X 2, X 3 and X 4 is a carbon atom connect to R 2;
    at least one of X 5 and X 6 is N;
    R 1 is H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, nitro, nitroso, cyano, amino, carboxyl, -C (O) OR 15, -NR 16R 17, aryl, heteroaryl or heterocyclyl; wherein said alkyl, cycloalkyl, alkoxyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 18;
    R 2 is alkyl, cycloalkyl, -NR 19R 20, -C 1-6alkylNR 19R 20, haloalkyl, halogen, hydroxyl, alkoxyl, -C (O) NR 19R 20, aryl, heteroaryl or heterocyclyl; wherein said alkyl, alkoxyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 21;
    R 3 is independently H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl;
    R 4 is aryl, heteroaryl, 
    Figure PCTCN2022085296-appb-100003
    each of which is optionally substituted by one or more R 22;
    each R 5, R 6, R 7, R 8, R 9, R 10, R 11, R 12, and R 13 is independently H, alkyl, halogen, haloalkyl, cycloalkyl, hydroxyl, nitro, amino or alkoxyl;
    each R 14, R 16, R 17, R 19, R 20 is independently H, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, alkoxyl, -SR 15, -S (O) R 15, -S (O)  2R 15, nitro, nitroso, cyano, amino, carboxyl, -C (O) OR 15, -NR 16R 17, aryl, heteroaryl or heterocyclyl; said alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more R 23;
    Y is (C (R 15)  2)  m;
    m is 0, 1, 2, 3;
    each R 15 is independently H, hydroxyl, alkyl, cycloalkyl or halogen;
    or R 16, R 17, together with N atom they are bound form a 3-to 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 24;
    or R 19, R 20, together with N atom they are bound form a 3-to 6-membered heterocyclyl, said heterocyclyl is optionally substituted by one or more R 25;
    R 18 is halogen, cycloalkyl, alkyl, nitro, cyano, alkoxyl or hydroxyl;
    R 23 is -NR 26R 27, alkyl, cycloalkyl, haloalkyl, halogen, hydroxyl, nitro, carboxyl, -C (O) C 1-3alkylNR 26R 27, -C (O) NR 26R 27,  heterocyclyl, aryl, or heteroaryl, wherein alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of alkyl, alkoxyl, hydroxyl, amino and halogen;
    each R 21, R 22, R 24, R 25 is independently selected from H, alkyl, alkenyl, alkynyl, cycloalkyl, alkoxyl, hydroxyl, amino, alkylamino-, nitro, carboxyl, cyano, halogen, -C (O) OR 28, -C (O) NR 29R 30, -C 1-3alkylC (O) NR 29R 30, -C (O) C 1-3alkylNR 29R 30, -S (O)  2R 28, -S (O) R 28, -S (O)  2NR 29R 30, -P (O) R 29R 30, aryl, heteroaryl or heterocyclyl, wherein aryl, heteroaryl or heterocyclyl is optionally substituted by one or more substituents selected from the group consisting of halogen, hydroxyl, amino, alkyl and alkoxyl;
    each R 26, R 27, R 28, R 29, R 30 is independently selected from H, hydroxyl, alkyl, hydroxylalkyl, alkoxyl, amino, aminoalkyl, cycloalkyl or halogen;
    or R 29 and R 30, along with the N or P atom form a 3-to 6-membered ring which is optionally substituted by one or more substituents independently selected from -C 1-6 alkyl.
  2. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 1, wherein the compound is of the formula selected from the group consisting of
    Figure PCTCN2022085296-appb-100004
  3. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 1, wherein the compound is selected from compounds showed in table A of the description.
  4. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 1, wherein the compound is represented by formula (II) :
    Figure PCTCN2022085296-appb-100005
    wherein:
    R 3 is selected from the group consisting of H, -hydroxyl, -halogen, -nitro, -cyano, -C 1-6alkyl, -C 1-6alkoxyl, halo C 1-6alkyl-and -cycloalkyl;
    R 14 is selected from the group consisting of -C 1-6alkyl, halo C 1-6alkyl-and -cycloalkyl, each of which is optionally substituted by –cyano, C 1-6alkoxyl or –cycloalkyl;
    R 2 is selected from the group consisting of -NR 19R 20, -C 1-6alkylNR 19R 20, -C (O) NR 19R 20, aminoacyl-and aminoC 1-6alkoxyl-.
    R 19 and R 20 is independently selected from the group consisting of H, -C 1-6alkyl, aminoC 1-6alkyl-, 3-to 6-membered cycloalkyl, 3-to 6-membered heterocycle, aryl, heteroaryl, or arylC 1-3alkyl-, wherein said C 1-6alkyl, aminoC 1-6alkyl-, 3-to 6-membered cycloalkyl, 3-to 6-membered heterocycle, aryl, heteroaryl or arylC 1-3alkyl-is independently optionally substituted by one or more R 21;
    or R 19 and R 20, along with the N atom to which they are attached, form a 3-to 6-membered saturated or unsaturated ring which is optionally substituted by one or more R 21;
    R 21 is independently selected from the group consisting of -hydroxyl, -C 1-6alkyl, -cyano, -C (O) NR’R”, C 1-6alkylcarbonyl-, -C 1-3alkylC (O) NR’R”, -C (O) C 1-3alkylNR’R”, -C 1-6alkylOH, C 1-3alkylsulfonyl-, C 1-3alkylamino-and heterocycyl, wherein said C 1-3alkylamino-and heterocycyl is optionally substituted by one or more of hydroxyl or -amino;
    R’ or R” is independently selected from H or -C 1-3alkyl;
    or R’ and R” , along with the N atom to which they are attached, form a 3-to 6-membered heterocycle, said 3-to 6-membered heterocycle is optionally substituted by one or more of hydroxyl or -amino;
    A is an aryl or heteroaryl, said aryl or heteroaryl is optionally substituted by one or more R 22;
    R 22 and
    Figure PCTCN2022085296-appb-100006
    are at both ends of a bond;
    R 22 is selected from H, halogen, -C 1-3 alkyl, -C 1-3 alkoxyl, -cyano;
    or R 22 and R 29, along with the atom to which they are attached, form a 5-6 membered ring;
    R 29 and R 30 is independently selected from the group consisting of -hydroxyl, -cycloalkyl, -C 1-6 alkyl, aminoC 1-3alkyl-, -amino, -C 1-6alkoxyl and hydroxyC 1-6alkyl-;
    or R 29 and R 30, along with the P atom form a 3-to 6-membered ring which is optionally substituted by one or more substituents independently selected from -C 1-6 alkyl.
  5. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 4, wherein A is 5 or 6 membered aryl or heteroaryl, which is optionally substituted by one or more R 22.
  6. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 4, wherein the compound is selected from compounds showed in table B of the description.
  7. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 1, wherein the compound is represented by formula (III) :
    Figure PCTCN2022085296-appb-100007
    wherein A is aryl or heteroaryl, each of which is optionally substituted by one or more R 22;
    Z 1, Z 2 or Z 3 is independently selected from CR’R”, O, S, S (O)  2 or NR’;
    each R’ or R” is independently H, hydroxyl, halogen, nitro, cyano, carboxyl, amino, alkyl, alkoxyl, haloalkyl or cycloalkyl.
  8. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 7, wherein A is phenyl.
  9. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 7, wherein
    Figure PCTCN2022085296-appb-100008
    is selected from the group consisting of
    Figure PCTCN2022085296-appb-100009
    Figure PCTCN2022085296-appb-100010
  10. The compound of Formula (I) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 7, wherein the compound is selected from compounds showed in table C of the description.
  11. A compound of formula (IV) , a stereoisomer thereof, a tautomer thereof or a pharmaceutically acceptable salt thereof;
    Figure PCTCN2022085296-appb-100011
    wherein,
    D 1 is CR D, N, or a carbon atom connected to Y 4;
    D 2 is CR D, N, or a carbon atom connected to Y 4;
    D 3 is CR D, N, or a carbon atom connected to Y 4;
    D 4 is CR D, or N;
    ring E is selected from a 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 member heteroaryl; said ring E is optionally substituted with one or more R E;
    R E at each occurrence is independently selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a1, -SR a1, -C (O) R b1, -C (O) NR c1R d1, -C (O) OR a1, -OC (O) R b1, -OC (O) NR c1R d1, -C (=NR e1) R b1, -C (=NR e1) NR c1R d1, -NR c1C (=NR e1) NR c1R d1, -NR c1R d1, -NR c1C (O) R b1, -NR c1C (O) OR a1, -NR c1C (O) NR c1R d1, -S (O) R b1, -S (O) NR c1R d1, -NR c1S (O) R b1, -NR c1S (O) NR c1R d1, -S (O)  2R b1, -S (O)  2NR c1R d1, -NR c1S (O)  2R b1, -NR c1S (O)  2NR c1R d1, -PO (R c1)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a1, -SR a1, -C (O) R b1, -C (O) NR c1R d1, -C (O) OR a1, -OC (O) R b1, -OC (O) NR c1R d1, -C (=NR e1) R b1, -C (=NR e1) NR c1R d1, -NR c1C (=NR e1) NR c1R d1, -NR c1R d1, -NR c1C (O) R b1, -NR c1C (O) OR a1, -NR c1C (O) NR c1R d1, -S (O) R b1, -S (O) NR c1R d1, -NR c1S (O) R b1, NR c1S (O) NR c1R d1, -S (O)  2R b1, -S (O)  2NR c1R d1, -NR c1S (O)  2R b1, -NR c1S (O)  2NR c1R d1, -PO (R c1)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl;
    each of Y 1, Y 2, Y 3, and Y 4 at each occurrence is independently selected from –CR Y1R Y2-, -CR Y1=CR Y2-, -C≡C-, -C (=N) -, -O-, -N (R Y1) -, -S-, -SO-, -SO 2-, or -CO-;
    R Y3 is selected from hydrogen, halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a2, -SR a2, -C (O) R b2, -C (O) NR c2R d2, -C (O) OR a2, -OC (O) R b2, -OC (O) NR c2R d2, -NR c2R d2, -NR c2C (O) R b2, -NR c2C (O) OR a2, -NR c2C (O) NR c2R d2, -C (=NR e2) R b2, -C (=NR e2) NR c2R d2, -NR c2C (=NR e2) NR c2R d2, -S (O) R b2, -S (O) NR c2R d2, -NR c2S (O) R b2, -NR c2S (O) NR c2R d2, -S (O)  2R b2, -S (O)  2NR c2R d2, -NR c2S (O)  2R b2, -NR c2S (O)  2NR c2R d2, -PO (R c2)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a2, -SR a2, -C (O) R b2, -C (O) NR c2R d2, -C (O) OR a2, -OC (O) R b2, -OC (O) NR c2R d2, -NR c2R d2, -NR c2C (O) R b2, -NR c2C (O) OR a2, -NR c2C (O) NR c2R d2, -C (=NR e2) R b2, -C (=NR e2) NR c2R d2, -NR c2C (=NR e2) NR c2R d2, -S (O) R b2, -S (O) NR c2R d2, -NR c2S (O) R b2, -NR c2S (O) NR c2R d2, -S (O)  2R b2, -S (O)  2NR c2R d2, -NR c2S (O)  2R b2, -NR c2S (O)  2NR c2R d2, -PO (R c2)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl;
    R Y4 is selected from hydrogen, halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a3, -SR a3, -C (O) R b3, -C (O) NR c3R d3, -C (O) OR a3, -OC (O) R b3, -OC (O) NR c3R d3, -NR c3R d3, -NR c3C (O) R b3, -NR c3C (O) OR a3, -NR c3C (O) NR c3R d3, -C (=NR e3) R b3, -C (=NR e3) NR c3R d3, -NR c3C (=NR e3) NR c3R d3, -S (O) R b3, -S (O) NR c3R d3, -NR c3S (O) R b3, -NR c3S (O) NR c3R d3, -S (O)  2R b3, -S (O)  2NR c3R d3, -NR c3S (O)  2R b3, -NR c3S (O)  2NR c3R d3, -PO (R c3)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more R’ Y4;
    R’ Y4 at each occurrence is independently selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a4, -SR a4, -C (O) R b4, -C (O) NR c4R d4, -C (O) - (C 1-6alkylene) -NR c4R d4, -C (O) OR a4, -OC (O) R b4, -OC (O) NR c4R d4, -NR c4R d4, -NR c4C (O) R b4, -NR c4C (O) OR a4, -NR c4C (O) NR c4R d4, -C (=NR e4) R b4, -C (=NR e4) NR c4R d4, -NR c4C (=NR e 4) NR c4R d4, -S (O) R b4, -S (O) NR c4R d4, -NR c4S (O) R b4, -NR c4S (O) NR c4R d4, -S (O)  2R b4, -S (O)  2NR c4R d4, -NR c4S (O)  2R b4, -NR c4S (O)  2NR c4R d4, -PO (R c4)  2, -PO 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a4, -SR a4, -C (O) R b4, -C (O) NR c4R d4, -C (O) - (C 1-6alkylene) -NR c4R d4, -C (O) OR a4, -OC (O) R b4, -OC (O) NR c4R d4, -NR c4R d4, -NR c4C (O) R b4, -NR c4C (O) OR a4, -NR c4C (O) NR c4R d4, -C (=NR e4) R b4, -C (=NR e4) NR c4R d4, -NR c4C (=NR e4) NR c4R d4, -S (O) R b 4, -S (O) NR c4R d4, -NR c4S (O) R b4, -NR c4S (O) NR c4R d4, -S (O)  2R b4, -S (O)  2NR c4R d4, -NR c4S (O)  2R b4, -NR c4S (O)  2NR c4R d4, -PO (R c4)  2, -PO 2, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12aryl ring, or 5-12 membered heteroaryl ring;
    R D, R Y1 and R Y2 at each occurrence are independently selected from hydrogen, halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2- 6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a5, -SR a5, -C (O) R b5, -C (O) NR c5R d5, -C (O) OR a5, -OC (O) R b5, -OC (O) NR c 5R d5, -NR c5R d5, -NR c5C (O) R b5, -NR c5C (O) OR a5, -NR c5C (O) NR c5R d5, -C (=NR e5) R b5, -C (=NR e5) NR c5R d5, -NR c5C (=NR e5) NR c5R d5, -S (O) R b5, -S (O) NR c5R d5, -NR c5S (O) R b5, -NR c5S (O) NR c5R d5, -S (O)  2R b5, -S (O)  2NR c5R d5, -NR c5S (O)  2R b5, -NR c5S (O)  2NR c5R d5, -PO (R c5)  2, -PO 2, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12aryl ring, or 5-12 membered heteroaryl ring; said -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12 aryl ring or 5-12 membered heteroaryl ring at each occurrence is independently optionally substituted with one or more substituents selected from halogen, -C 1-6alkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6haloalkyl, -CN, oxo, -NO 2, -N 3, -OR a5, -SR a5, -C (O) R b5, -C (O) NR c5R d5, -C (O) OR a5, -OC (O) R b5, -OC (O) NR c5R d5, -NR c5R d5, -NR c5C (O) R b5, -NR c5C (O) OR a5, -NR c5C (O) NR c5R d5, -C (=NR e5) R b5, -C (=NR e5) NR c5R d5, -NR c5C (=NR e5) NR c5R d5, -S (O) R b5, -S (O) NR c 5R d5, -NR c5S (O) R b5, -NR c5S (O) NR c5R d5, -S (O)  2R b5, -S (O)  2NR c5R d5, -NR c5S (O)  2R b5, -NR c5S (O)  2NR c5R d5, -PO (R c5)  2, -PO 2, 3-12 membered carbocyclic ring, 3-12 membered heterocyclic ring, -C 6-12aryl ring, or 5-12 membered heteroaryl ring;
    each R a1, R b1, R c1, R d1, R a2, R b2, R c2, R d2, R a3, R b3, R c3, R d3, R a4, R b4, R c4, R d4, R a5, R b5, R c5, or R d5 is independently selected from -H, -C 1-6alkyl, -C 1-6haloalkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6alkoxy, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, or 5-12 member heteroaryl; said -C 1-6alkyl, -C 1-6haloalkyl, -C 2-6alkenyl, -C 2-6alkynyl, -C 1-6alkoxy, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 member heteroaryl are independently optionally substituted with one or more substituents selected from halogen, -OH, -CN, -NH 2, -C 1-6alkyl, -C 1-6haloalkyl, or -C 1-6alkoxy; each R e1, R e2, R e3, R e4, or R e5 is independently selected from -H, -C 1-4alkyl, -C 1-4alkoxy, or -CN;
    n 1 is 0, 1, 2 or 3;
    n 2 is 0, 1, 2 or 3;
    n 3 is 0, 1, 2 or 3;
    n 4 is 0, 1, 2 or 3;
    m 3 is 0, 1, 2, 3, 4, 5, or 6;
    each of heterocycloalkyl, heterocycloalkenyl, and heteroaryl at each occurrence independently contains one or more heteroatoms selected from N, O or S.
  12. The compound of Formula (IV) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereof according to claim 11, wherein, the moiety of ring A in the formula (IV) is selected from 4 membered cycloalkyl, 4 membered cycloalkenyl, 4 membered heterocycloalkyl, 4 membered heterocycloalkenyl, 5 membered cycloalkyl, 5 membered cycloalkenyl, 5 membered heterocycloalkyl, 5 membered heterocycloalkenyl, 6 membered cycloalkyl, 6 membered cycloalkenyl, 6 membered heterocycloalkyl, 6 membered heterocycloalkenyl, 7 membered cycloalkyl, 7 membered cycloalkenyl, 7 membered heterocycloalkyl, 7 membered heterocycloalkenyl, 8 membered cycloalkyl, 8 membered cycloalkenyl, 8 membered heterocycloalkyl, 8 membered heterocycloalkenyl, 9 membered cycloalkyl, 9 membered cycloalkenyl, 9 membered heterocycloalkyl, 9 membered heterocycloalkenyl, phenyl, naphthyl, biphenyl, 5 membered heteroaryl, 6 membered heteroaryl, 7 membered heteroaryl, 8 membered heteroaryl, 9 membered heteroaryl, 10 membered heteroaryl, 11 membered heteroaryl, or 12 membered heteroaryl; each of heterocycloalkyl, heterocycloalkenyl and heteroaryl at each occurrence independently contains 1, 2, or 3 heteroatoms selected from N, O or S.
  13. The compound of Formula (IV) , stereoisomer thereof, tautomer thereof or pharmaceutically acceptable salt thereofaccording to claim 11, wherein the compound of formula (IV) is selected from compounds shown in table D of the description.
  14. A pharmaceutical composition, comprising a therapeutically effective amount of the compound according to any one of claims 1-13 and a pharmaceutically acceptable carrier, diluent, or excipient.
  15. Use of the compound according to any one of claims 1-13 or the pharmaceutical composition according to claim 14 for the manufacture of a medicament for the prevention or treatment of a disease or condition.
  16. The use according to claim 15, wherein the disease or condition is cancer.
  17. The use according to claim 16, wherein the cancer cell expresses a mutant of p53.
  18. The use according to claim 17, wherein the p53 mutant has a mutation at amino acid 220.
  19. The use according to claim 18, wherein the p53 mutant is p53 Y220C.
  20. The use according to any one of claims 15 to 19, wherein the disease or condition is selected from the group consisting of ovarian cancer, breast cancer and lung cancer.
  21. A method for preventing or treating a disease or condition related to p53 mutant, comprising administering to a subject a therapeutically effective amount of the compound according to any one of 1-13 or the pharmaceutical composition according to claim 14.
  22. The method according to claim 21, wherein the disease or condition is cancer, preferably ovarian cancer, breast cancer or lung cancer.
  23. The method according to claim 22, wherein the cancer cell expresses a mutant of p53, preferably p53 Y220C.
PCT/CN2022/085296 2021-04-08 2022-04-06 Compounds targeting y220c mutant of p53 WO2022213975A1 (en)

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
CNPCT/CN2021/085870 2021-04-08
CN2021085870 2021-04-08
CNPCT/CN2021/089317 2021-04-23
CN2021089317 2021-04-23
CNPCT/CN2021/089311 2021-04-23
CNPCT/CN2021/089287 2021-04-23
CN2021089311 2021-04-23
CN2021089287 2021-04-23
CNPCT/CN2021/136450 2021-12-08
CN2021136450 2021-12-08
CNPCT/CN2021/137124 2021-12-10
CN2021137124 2021-12-10

Publications (1)

Publication Number Publication Date
WO2022213975A1 true WO2022213975A1 (en) 2022-10-13

Family

ID=83545984

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/085296 WO2022213975A1 (en) 2021-04-08 2022-04-06 Compounds targeting y220c mutant of p53

Country Status (1)

Country Link
WO (1) WO2022213975A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023025324A1 (en) * 2021-08-27 2023-03-02 杭州紫晶医药科技有限公司 Compound serving as p53 regulator
WO2024017384A1 (en) * 2022-07-22 2024-01-25 深圳众格生物科技有限公司 Compound for recovering p53 mutation function and use thereof
US11963953B2 (en) 2022-01-27 2024-04-23 Pmv Pharmaceuticals, Inc. Deuterated compounds for restoring mutant p53 function

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017143291A1 (en) * 2016-02-19 2017-08-24 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021061643A1 (en) * 2019-09-23 2021-04-01 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262483A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262484A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Combination therapy for treatment of cancer
WO2021262541A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Companion diagnostic tool for mutant p53 reactivating compounds

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017143291A1 (en) * 2016-02-19 2017-08-24 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021061643A1 (en) * 2019-09-23 2021-04-01 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262483A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262484A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Combination therapy for treatment of cancer
WO2021262541A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Companion diagnostic tool for mutant p53 reactivating compounds

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE REGISTRY 12 February 2021 (2021-02-12), ANONYMOUS : "-Benzenamine, N-methyl-N-[3-(8-methylimidazo[1,2-a]pyridin-2-yl)-2-propyn-1- yl]-(CA INDEX NAME)", XP055976468, retrieved from STN Database accession no. 2588421-68-3 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023025324A1 (en) * 2021-08-27 2023-03-02 杭州紫晶医药科技有限公司 Compound serving as p53 regulator
US11963953B2 (en) 2022-01-27 2024-04-23 Pmv Pharmaceuticals, Inc. Deuterated compounds for restoring mutant p53 function
WO2024017384A1 (en) * 2022-07-22 2024-01-25 深圳众格生物科技有限公司 Compound for recovering p53 mutation function and use thereof

Similar Documents

Publication Publication Date Title
WO2022213975A1 (en) Compounds targeting y220c mutant of p53
JP7039802B2 (en) Pharmaceutical composition containing RHO-related protein kinase inhibitor, RHO-related protein kinase inhibitor, preparation method and use of the pharmaceutical composition.
ES2930804T3 (en) RHO-associated protein kinase inhibitor, pharmaceutical composition that comprises it, as well as method of preparation and use thereof
JP6692836B2 (en) Naphthyridine compounds as JAK kinase inhibitors
US10022374B2 (en) Certain protein kinase inhibitors
EP1605938B1 (en) Antibacterial derivatives of napthydrin and quinoline
JP2020525522A (en) RHO-related protein kinase inhibitor, pharmaceutical composition containing the same, preparation method and use thereof
WO2021057832A1 (en) Kras mutant protein inhibitor
CA3226720A1 (en) Kras g12d inhibitors and uses thereof
EP1560821B1 (en) Antibacterial agents
WO2012080284A2 (en) Substituted 6,6-fused nitrogenous heterocyclic compounds and uses thereof
WO2017202390A1 (en) Heterocyclic compound serving as fgfr4 inhibitor
JP2008505926A (en) Antibacterial agent
WO2015095492A1 (en) Tricyclic heterocycles as bet protein inhibitors
CA3174890A1 (en) Quinazoline compound and its use as a phosphatidylinositol 3-kinase (pi3k) inhibitor
WO2023284537A1 (en) Kras g12d inhibitors and uses thereof
AU2021290208B2 (en) Tricyclic compounds
WO2023016434A1 (en) Compounds targeting mutant of p53
CA3113732C (en) Aromatic heterocyclic compound with kinase inhibitory activity
CN112969694B (en) Rho-associated protein kinase inhibitors, pharmaceutical compositions containing same and uses thereof
CA3234810A1 (en) Methionine adenosyltransferase 2a (mat2a) inhibitors and uses thereof
RU2183626C2 (en) Derivatives of phenanthridinium showing antitumor activity, method of inhibition of cancer cells growth
WO2024041503A1 (en) Compounds targeting y220c mutant of p53
WO2005097752A1 (en) Quinolone carboxylic acid derivatives for treatment of hyperproliferative conditions
TW202320767A (en) Heteroaryl derivative PARP inhibitor and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22784041

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22784041

Country of ref document: EP

Kind code of ref document: A1