WO2022204151A1 - Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation - Google Patents

Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation Download PDF

Info

Publication number
WO2022204151A1
WO2022204151A1 PCT/US2022/021352 US2022021352W WO2022204151A1 WO 2022204151 A1 WO2022204151 A1 WO 2022204151A1 US 2022021352 W US2022021352 W US 2022021352W WO 2022204151 A1 WO2022204151 A1 WO 2022204151A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
sequence
chimeric polypeptide
receptor
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/021352
Other languages
English (en)
French (fr)
Inventor
Kole T. ROYBAL
Iowis ZHU
Raymond Liu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to US18/552,141 priority Critical patent/US20240181057A1/en
Priority to EP22776476.8A priority patent/EP4314038A4/en
Priority to AU2022244245A priority patent/AU2022244245A1/en
Priority to CA3213044A priority patent/CA3213044A1/en
Priority to JP2023558552A priority patent/JP2024512573A/ja
Priority to CN202280032798.0A priority patent/CN117255799A/zh
Publication of WO2022204151A1 publication Critical patent/WO2022204151A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4264Cancer antigens from embryonic or fetal origin
    • A61K40/4266Carcinoembryonic antigen [CEA]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/13B-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/33Antibodies; T-cell engagers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4203Receptors for growth factors
    • A61K40/4204Epidermal growth factor receptors [EGFR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4203Receptors for growth factors
    • A61K40/4205Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ ErbB4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4254Adhesion molecules, e.g. NRCAM, EpCAM or cadherins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4256Tumor associated carbohydrates
    • A61K40/4257Mucins, e.g. MUC-1
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4707Muscular dystrophy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/485Epidermal growth factor [EGF], i.e. urogastrone
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70517CD8
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7153Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for colony-stimulating factors [CSF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3007Carcino-embryonic Antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3076Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties
    • C07K16/3092Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties against tumour-associated mucins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03048Protein-tyrosine-phosphatase (3.1.3.48)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Definitions

  • the present disclosure relates generally to new synthetic cellular receptors that bind cell-surface ligands and have selectable specificities and activities.
  • the disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding same, host cells genetically modified with the nucleic acids, as well as methods for modulating an activity of a cell and/or for the treatment of various diseases such as cancers.
  • CAR-T chimeric antigen receptor T cells
  • Another problem includes off-target activity and off-turn or/on-target activity (i.e., wherein the CAR-T target antigen is also found on normal cells outside the tumor).
  • One possible solution to these problems is to use a synthetic receptor that is capable of modifying gene expression and/or cellular behavior.
  • SynNotch synthetic Notch receptors
  • NRR Notch regulatory regions
  • the present disclosure provides, among other things, novel chimeric polypeptides, including a new class of synthetic receptors that do not require sequence from Notch receptors.
  • the present disclosure describes synthetic chimeric polypeptides (e.g ., chimeric receptors) that do not require sequence from Notch receptors.
  • synthetic chimeric polypeptides e.g ., chimeric receptors
  • a ADAM protease cleavable extracellular domain e.g., hinge domain from CD8
  • TMD g-secretase cleavable transmembrane domain
  • SynRIPRs synthetic regulated intermembrane proteolysis receptors
  • these receptors can be used to target various therapeutically relevant cell types to sites of disease and regulate the therapeutic activity the cell in a controlled and localized fashion.
  • receptors can be linked to inducible transcriptional programs such that when the cell senses a disease site it will locally produce therapeutics such as antibodies, cytokines, toxins, and adjuvants. They are a highly versatile and programmable platform for cellular engineering, and essentially the production of any genetically encodable therapeutic can regulated by these receptors.
  • synthetic chimeric receptors that exhibit a range of signal characteristics mediated by inclusion of heterologous STS and TMD sequences. These receptors provide a range of sensitivity, including a receptor that is sensitive to the degree of T-cell activation when it is expressed in an activated T cell. Some embodiments, when expressed in a T-cell, exhibit higher ligand-induced signal levels when the T-cell is activated, as compared to the ligand-induced signal level when the T-cell is not activated.
  • the present disclosure provides, among other things, a new class of chimeric receptors containing a non-Notch transmembrane domain (TMD) including at least one g-secretase site. It is believed that the modulation of TMD cleavage facilitates the optimization and/or improvement of the activity of the chimeric receptors disclosed herein, which in turn can be particularly useful in modulating cell activity and/or in treating diseases.
  • the chimeric receptors of the disclosure include non-Notch STS sequences, which allow the chimeric receptors disclosed herein to have a broad range of desired characteristics.
  • the STS as described herein by altering the STS as described herein, and selecting different juxtamembrane domains, one can produce receptors having different noise levels (i.e., the basal level of receptor activation in the absence of the selected target ligand), different signal levels (i.e., the expression level obtained in the presence of the selected target ligand), and different signal moise ratios.
  • noise levels i.e., the basal level of receptor activation in the absence of the selected target ligand
  • signal levels i.e., the expression level obtained in the presence of the selected target ligand
  • different signal moise ratios i.e., the expression level obtained in the presence of the selected target ligand
  • chimeric polypeptides including, from N-terminus to C-terminus: (a) an extracellular binding domain having a binding affinity for a selected ligand; (b) a linking sequence; (c) a transmembrane domain (TMD) having at least about 80% sequence identity to the transmembrane domain of a Type 1 transmembrane receptor and including one or more ligand-inducible proteolytic cleavage sites; and (d) an intracellular domain (ICD) including a transcriptional regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcriptional regulator and the linking sequence, and wherein the chimeric polypeptide does not include a sequence from a Notch receptor.
  • TMD transmembrane domain
  • ICD intracellular domain
  • Non-limiting exemplary embodiments of the chimeric polypeptides provided herein include one or more of the following features: in some embodiments, the chimeric polypeptide further includes a stop-transfer sequence (STS) between the TMD and the ICD; in some embodiments, the TMD includes a polypeptide sequence having at least 80% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor and includes a g-secretase cleavage site; in some embodiments, the TMD includes a polypeptide sequence having at least 90% sequence identity to a transmembrane domain from a Type I transmembrane receptor and includes a g-secretase cleavage site; in some embodiments, the TMD includes a polypeptide sequence having at least 95% sequence identity to a transmembrane domain from a Type I transmembrane receptor and includes a g-secretase cleavage site.
  • STS stop-transfer sequence
  • the Type 1 transmembrane receptor is selected from the group consisting of CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNBl, EFNB2, ErbB4, GHR, HLA- A, IFNAR2, IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTINl,
  • the Type 1 transmembrane receptor is APP, CLSTN1, CLSTN2, EPCAM, KCNE3, NECTINl, PCDHGC3, and PTPRF.
  • the chimeric polypeptides provided herein include a stop-transfer sequence (STS), and wherein the STS is heterologous to the TMD.
  • the STS includes a sequence having at least 70% sequence identity to a STS sequence from CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRPIB, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, PTPRF, or PTPRM.
  • the STS comprises a sequence having at least 70% sequence identity to a STS sequence from CSF1R, DAG1, AGER, NRG1, KCNE3, PTPRF, or PTPRM.
  • the extracellular domain includes an anti gen -binding moiety capable of binding to a ligand on the surface of a cell.
  • the cell is a pathogenic cell.
  • the ligand includes a protein or a carbohydrate. In some embodiments, the ligand is selected from the group consisting of CD1, CD la, CD lb, CDlc,
  • CD 134, CD 140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD 183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD- L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, BCMA (CD269), ALPPL2, GFP, eGFP, and SIRPa.
  • the ligand is selected from the group consisting of CD1, CD la, CDlb, CDlc, CD Id, CDle, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD 183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD- L2), CD274 (PD-L1), CD276 (B7H3), CD279,
  • the ligand is selected from cell surface receptors, adhesion proteins, integrins, mucins, lectins, tumor-associated antigens, and tumor-specific antigens. In some embodiments, the ligand is a tumor-associated antigen or a tumor-specific associated antigen. In some embodiments, the extracellular binding domain includes the ligand-binding portion of a receptor.
  • the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab')2 fragment, a Fab fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), or a functional fragment thereof.
  • the antigen-binding moiety includes an scFv.
  • the antigen-binding moiety is a tumor-associated antigen selected from the group consisting of CD19, B7H3 (CD276), BCMA (CD269), ALPPL2,
  • the tumor-associated antigen is CD 19, CEA, HER2, MUC1, CD20, BCMA, ALPPL2, or EGFR. In some embodiments, the tumor-associated antigen is CD 19.
  • the ligand-inducible proteolytic cleavage site is a g-secretase cleavage site.
  • the transcriptional regulator includes a transcriptional activator, or a transcriptional repressor.
  • the ICD includes a nuclear localization sequence and a transcriptional regulator sequence selected from Gal4-VP16, Gal4- VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP 1 -VP 16.
  • the chimeric polypeptides of the disclosure further include a signal sequence, a detectable label, a tumor-specific cleavage site, a disease-specific cleavage site, or a combination thereof.
  • the chimeric polypeptides of the disclosure include an STS with an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 89, 92, 108, 115, 138, 146, or 156.
  • the hinge domain is capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding.
  • the linking sequence includes an amino acid sequence having at least 80% sequence identity to a hinge domain derived from CD8a hinge domain, a CD28 hinge domain, a CD 152 hinge domain, a PD- 1 hinge domain, a CTLA4 hinge domain, an 0X40 hinge domain, an IgGl hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any thereof.
  • the hinge domain is derived from a CD8a hinge domain or a functional variant thereof.
  • the hinge domain comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 157-161.
  • the TMD includes an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-2, 6, 20, 43, 39, 54, and 64. In some embodiments, the TMD includes an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOS: 1-2, 6, 20, 43, 39, 54, and 64. In some embodiments, the TMD includes an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOS: 1-2, 6, 20, 43, 39, 54, and 64. In some embodiments, the TMD includes an amino acid sequence substantially identical to any one of SEQ ID NOS: 1-2, 6, 20, 43, 39, 54, and 64.
  • the chimeric polypeptides of the disclosure include: (a) a linking sequence including an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 157-161; (b) a TMD including an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NO: 1-84, 178, 182-185, and 190-192; and (c) a STS including an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 85-156 and 173.
  • nucleic acids including a nucleotide sequence that encodes a chimeric polypeptide as disclosed herein.
  • the nucleotide sequence is incorporated into an expression cassette or an expression vector.
  • the expression vector is a viral vector.
  • the viral vector is a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a retroviral vector.
  • the viral vector is a lentivival vector.
  • recombinant cells including (a) a chimeric polypeptide as disclosed herein and/or (b) a recombinant nucleic acid as disclosed herein.
  • the cell is a mammalian cell.
  • the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell.
  • the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, or other T cell.
  • the recombinant cell further includes: (a) a second chimeric polypeptide as disclosed herein; and/or (b) a second nucleic acid as disclosed herein; wherein the first chimeric polypeptide and the second chimeric polypeptide do not have the same sequence, and/or the first nucleic acid or the second nucleic acid do not have the same sequence.
  • the chimeric polypeptide modulates the expression and/or activity of the second chimeric polypeptide.
  • the recombinant cell of the disclosure further includes an expression cassette encoding a protein of interest operably linked to a promoter, wherein expression of the protein is modulated by the transcriptional regulator encoded by the chimeric receptor.
  • the protein of interest is heterologous to the cell.
  • the promoter is GAIA
  • the protein of interest is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor, a de-differentiation factor, an immune cell receptor, or a reporter.
  • cell cultures including at least one recombinant cell as disclosed herein and a culture medium.
  • compositions including a pharmaceutically acceptable carrier and one or more of the following: (a) a recombinant nucleic acid as disclosed herein, or (b) a recombinant cell as disclosed herein.
  • the disclosed pharmaceutical composition includes a recombinant nucleic acid as disclosed herein and a pharmaceutically acceptable carrier.
  • the recombinant nucleic acid is encapsulated in a viral capsid or a lipid nanoparticle (LNP).
  • methods for modulating an activity of a cell including: (a) providing a recombinant cell of the disclosure, and (b) contacting it with a selected ligand, wherein binding of the selected ligand to the extracellular binding domain induces cleavage of a ligand-inducible proteolytic cleavage site and releases the transcriptional regulator, wherein the released transcriptional regulator modulates an activity of the recombinant cell.
  • the contacting is carried out in vivo , ex vivo , or in vitro.
  • the activity of the cell is selected from the group consisting of: expression of a selected gene of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, de-differentiation of the cell, migration of the cell, secretion of a molecule from the cell, cellular adhesion of the cell, and cytolytic activity of the cell.
  • the released transcriptional regulator modulates expression of a gene product of the cell. In some embodiments, the released transcriptional regulator modulates expression of a heterologous gene product.
  • the gene product of the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen derived protein, a proliferation inducer, a receptor, an RNA guided nuclease, a site-specific nuclease, a T cell receptor, a toxin, a toxin-derived protein, a transcriptional regulator, a transcriptional activator, a transcriptional repressor, a translational regulator, a translational activator, a translational repressor, an activating immuno-receptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T cell receptor, an immuno- activator, an immuno-inhibitor, and an inhibiting immuno-receptor.
  • Another aspect relates to methods for inhibiting an activity of a target cell in an individual, including administering to the individual an effective number of the recombinant cell of the disclosure, wherein the recombinant cell inhibits an activity of the target cell in the individual.
  • the target cell is an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B-cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a liver cancer cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T-cell lymphoma cell, a renal cancer cell, a sarcoma cell, a stomach cancer cell, a carcinoma cell, a mesothelioma cell, or
  • the target cell is a pathogenic cell.
  • methods for treating a disease in an individual including a step of administering to the individual an effective number of the recombinant cell of the disclosure, wherein the recombinant cell treats the disease in the individual.
  • the treatment methods of the disclosure further include administering to the individual a second therapy.
  • the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, or toxin therapy.
  • the first therapy and the second therapy are administered together, in the same composition or in separate compositions. In some embodiments, the first therapy and the second therapy are administered simultaneously.
  • the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy and the second therapy are administered in rotation.
  • systems for modulating an activity of a cell, modulating an activity of a target cell, or treating a disease in an individual in need thereof wherein the system includes one or more of: a chimeric polypeptide of the disclosure; a polynucleotide of the disclosure; a recombinant cell of the disclosure; or a pharmaceutical composition of the disclosure.
  • a recombinant cell of the disclosure including: (a) providing a cell capable of protein expression; and (b) contacting the provided cell with a recombinant nucleic acid of the disclosure.
  • the cell is obtained by leukapheresis performed on a sample obtained from a human subject or patient, and the cell is contacted ex vivo.
  • the recombinant nucleic acid is encapsulated in a viral capsid or a lipid nanoparticle (LNP).
  • a chimeric polypeptide of the disclosure a polynucleotide of the disclosure, a recombinant cell of the disclosure, or a pharmaceutical composition of the disclosure, for the treatment of a disease.
  • the disease is cancer.
  • a chimeric polypeptide of the disclosure in another aspect, is the use of one or more of: a chimeric polypeptide of the disclosure, a polynucleotide of the disclosure, a recombinant cell of the disclosure, or a pharmaceutical composition of the disclosure, in the manufacture of a medicament for the treatment of a disease.
  • FIGS. 1A-1C schematically illustrate the experimental design and testing of exemplary non-Notch synthetic regulated intramembrane proteolysis receptors (SynRIPRs or SNIPRs) in accordance with some non-limiting embodiments of the disclosure.
  • FIG. 1A schematically illustrates the modular assembly of an exemplary non-Notch SNIPR around a CLSTN2 core.
  • FIGS. 1B-1C schematically summarize the results of JMD-based SNIPR tuning experiments.
  • the reference receptor was an optimized CD8a Notch receptor (HingeNotch) composed of a truncated CD8a extracellular domain (ECD), a transmembrane domain (TMD) of human Notchl, and a C-terminal juxtamembrane domain (JMD) from Notchl.
  • ECD truncated CD8a extracellular domain
  • TMD transmembrane domain
  • JMD C-terminal juxtamembrane domain
  • the extracellular binding domain comprises a single-chain antigen-binding fragment (scFv) having a binding affinity for a selected ligand, which in this example is the B-lymphocyte antigen CD 19.
  • scFv single-chain antigen-binding fragment
  • FIGS. 1B-1C assembly of a non-Notch SynRIPR using the CLSTN2 TMD and CLSTN2 JMD results in an inactive receptor, however the receptor function can be restored when the CLSTN2 JMD is replaced with a higher performing JMD, such as a JMD from KCNE3 or PTPRF.
  • FIG. 2 depicts the experimental design of a screen for TMDs and JMDs/STSs that can be deployed in the chimeric polypeptides and non-Notch SynRIPR described herein including modular assemblies of SynRIPRs with tunable transcriptional output.
  • STS Notchl JMD
  • STS JMD
  • T cells expressing high-performing “SynRIPR BFP expression” circuits were co-incubated with sender cells for 48 hours. BFP output was measured using flow cytometry.
  • the present disclosure generally relates to, among other things, novel chimeric polypeptides, including a new class of synthetic receptors that do not require sequence from Notch receptors.
  • a ADAM protease cleavable extracellular domain e.g ., hinge domain from CD8
  • TMD g-secretase cleavable transmembrane domain
  • SynRIPRs stop-transfer-sequence to rationally build synthetic regulated intermembrane proteolysis receptors
  • these receptors do not occur in nature.
  • the chimeric polypeptides of the disclosure can be synthetic polypeptides, or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g., modulating transcription.
  • these receptors can be used to target various therapeutically relevant cell types to sites of disease and regulate the therapeutic activity the cell in a controlled and localized fashion.
  • These receptors can be linked to inducible transcriptional programs such that when the cell senses a disease site it will locally produce therapeutics such as antibodies, cytokines, toxins, and adjuvants. They are a highly versatile and programmable platform for cellular engineering, and essentially the production of any genetically encodable therapeutic can regulated by these receptors.
  • the SynRIPRs described herein could be potentially be used in any of the cell therapies for cancer, autoimmunity, or the regeneration of damaged tissue.
  • these receptors are compact in size.
  • Polynucleotides encoding the chimeric receptors provided herein can be made smaller than existing SynNotch-encoding polynucleotides, which enables the use of vectors having more limited capacity but otherwise more desirable characteristics, or the inclusion of additional elements that would otherwise be excluded vector capacity-related size constraints.
  • the experimental data described herein demonstrate that advanced engineering efforts can now allow scientists to rationally design receptors that function like Notch receptors but share no sequence with the Notch proteins.
  • the present disclosure provides a new class of chimeric receptors containing a non-Notch transmembrane domain (TMD) including at least one g-secretase site.
  • TMD non-Notch transmembrane domain
  • cleavage of the TMD is an essential step in signaling mediated by these synthetic receptors. Without being bound to any particular theory, it is believed that modulation of TMD cleavage facilitates the optimization and/or improvement of the receptors disclosed herein, which in turn can be particularly useful in modulating cell activity, e.g ., activating or inhibiting selected biosynthetic pathways and/or in treating diseases.
  • the receptors disclosed herein bind a target cell-surface displayed ligand, which triggers proteolytic cleavage of the receptors and release of a transcriptional regulator that modulates a custom transcriptional program in the cell.
  • the chimeric receptors disclosed herein also include non-Notch STS sequences, which allow the new synthetic chimeric receptors of the disclosure to have a broad range of desired characteristics. For example, by altering the STS, and selecting different juxtamembrane domains, one can produce receptors having different noise levels (i.e., the basal level of receptor activation in the absence of the selected target ligand), different signal levels (i.e., the expression level obtained in the presence of the selected target ligand), and different signal moise ratios.
  • noise levels i.e., the basal level of receptor activation in the absence of the selected target ligand
  • signal levels i.e., the expression level obtained in the presence of the selected target ligand
  • signal moise ratios i.e., the expression level obtained in the presence of the selected target ligand
  • administration refers to the delivery of a composition or formulation by an administration route including, but not limited to, intravenous, intra-arterial, intracerebral, intrathecal, intramuscular, intraperitoneal, subcutaneous, intramuscular, and combinations thereof.
  • administration includes, but is not limited to, administration by a medical professional and self-administration.
  • host cell and “recombinant cell” are used interchangeably herein. It is understood that such terms, as well as “cell”, “cell culture”, “cell line”, refer not only to the particular subject cell or cell line but also to the progeny or potential progeny of such a cell or cell line, without regard to the number of transfers. It should be understood that not all progeny are exactly identical to the parental cell.
  • progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein, so long as the progeny retain the same functionality as that of the original cell or cell line.
  • the term “construct” is intended to mean any recombinant nucleic acid molecule such as an expression cassette, plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide molecule, derived from any source, either capable of genomic integration or autonomous replication, including a nucleic acid molecule where one or more nucleic acid sequences has been linked in a functionally operative manner, e.g., operably linked.
  • operably linked denotes a physical or functional linkage between two or more elements, e.g, polypeptide sequences or polynucleotide sequences, which permits them to operate in their intended fashion.
  • heterologous refers to nucleic acid sequences or amino acid sequences operably linked or otherwise joined to one another in a nucleic acid construct or chimeric polypeptide that are not operably linked or are not contiguous to each other in nature.
  • percent identity refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (e.g, about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection.
  • Sequence identity can be calculated over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence.
  • Sequence identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al, Nucleic Acids Res (1984) 12:387), BLASTP, BLASTN, FASTA (Atschul et al., JMol Biol (1990) 215:403). Sequence identity can be measured using sequence analysis software such as the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), with the default parameters thereof.
  • recombinant when used with reference to a cell, a nucleic acid, a protein, or a vector, indicates that the cell, nucleic acid, protein or vector has been altered or produced through human intervention such as, for example, has been modified by or is the result of laboratory methods.
  • recombinant cells, proteins, and nucleic acids include cells, proteins, and nucleic acids produced by laboratory methods.
  • Recombinant proteins can include amino acid residues not found within the native (non-recombinant or wild-type) form of the protein or can be include amino acid residues that have been modified, e.g ., labeled.
  • the term recombinant can include any modifications to the peptide, protein, or nucleic acid sequence.
  • Such modifications may include the following: any chemical modifications of the peptide, protein or nucleic acid sequence, including of one or more amino acids, deoxyribonucleotides, or ribonucleotides; addition, deletion, and/or substitution of one or more of amino acids in the peptide or protein; creation of a fusion protein, e.g. , a fusion protein comprising an antibody fragment; and addition, deletion, and/or substitution of one or more of nucleic acids in the nucleic acid sequence.
  • ’’recombinant when used in reference to a cell is not intended to include naturally-occurring cells but encompass cells that have been engineered/modified to include or express a polypeptide or nucleic acid that would not be present in the cell if it was not engineered/modified.
  • a “therapeutically effective amount” of an agent is an amount or number sufficient to provide a therapeutic benefit in the treatment or management of a health condition or disease, e.g. , cancer, or to delay or minimize one or more symptoms associated with the condition or disease.
  • a therapeutically effective amount or number of a therapeutic agent means an amount or number of the therapeutic agent, alone or in combination with other therapeutic agents, which provides a therapeutic benefit in the treatment or management of the condition or disease.
  • the term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the condition or disease, or enhances the therapeutic efficacy of another therapeutic agent.
  • an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.”
  • a “reduction” of a symptom means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s).
  • the exact amount or number of a therapeutic agent including a “therapeutically effective amount” will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 2010); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (2016); Pickar, Dosage Calculations (2012); and Remington: The Science and Practice of Pharmacy, 22nd Edition,
  • a “subject” or an “individual” includes animals, such as human (e.g, human individuals) and non-human animals.
  • a “subject” or “individual” can be a patient under the care of a physician.
  • the subject can be a human patient or an individual who has, is at risk of having, or is suspected of having a disease of interest (e.g, cancer) and/or one or more symptoms of the disease.
  • the subject can also be an individual who is diagnosed with a risk of the condition of interest at the time of diagnosis or later.
  • non-human animals includes all vertebrates, e.g, mammals, e.g, rodents, e.g, mice, and non mammals, such as non-human primates, sheep, dogs, cows, chickens, amphibians, reptiles, and the like.
  • aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments.
  • “comprising” is synonymous with “including”, “containing”, or “characterized by”, and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
  • “consisting of’ excludes any elements, steps, or ingredients not specified in the claimed composition or method.
  • “consisting essentially of’ does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method.
  • the present disclosure provides a new class of chimeric polypeptide receptors engineered to modulate transcriptional regulation in a ligand- dependent manner having multiple advantages over existing synthetic receptors.
  • some embodiments of the disclosure provides synthetic receptors that do not require sequence from Notch receptors.
  • inclusion of a heterologous TMD provides the new synthetic receptors with a variety of improved expression characteristics, thus expanding the palette of available receptors available to the cellular engineer.
  • the synthetic receptors disclosed herein also include non-Notch STS sequences, which allow the new synthetic receptors to have a broad range of desired characteristics.
  • these new synthetic receptors are compact in size, such that polynucleotides encoding these synthetic receptors can be made smaller than existing SynNotch-encoding polynucleotides, which enables the use of vectors having more limited capacity but otherwise more desirable characteristics, or the inclusion of additional elements that would otherwise be excluded vector capacity-related size constraints.
  • chimeric polypeptide receptors facilitate amplified activation under certain specific cellular and environmental contexts. This type of feedback on the receptor activity is a new feature that can be exploited to enhance and tune the expression of therapeutic payloads by engineered cells. As described in the Examples herein, chimeric polypeptide receptors have been tested and validated in primary human T cells.
  • chimeric polypeptides engineered to modulate transcriptional regulation in a ligand-dependent manner.
  • These new receptors generally include (1) a g-secretase cleavable transmembrane domain (TMD), and (2) a stop-transfer-sequence.
  • TMD g-secretase cleavable transmembrane domain
  • a stop-transfer-sequence Inclusion of heterologous STS and TMD sequences facilitates the optimization and/or improvement of the new chimeric receptors disclosed herein, which in turn is useful in modulating cell activity and/or in treating diseases.
  • the receptors provided herein bind a target cell-surface displayed ligand, triggering proteolytic cleavage of the receptors and releasing a transcriptional regulator that modulates a custom transcriptional program in the cell.
  • a chimeric polypeptide including, from N- terminus to C-terminus: (a) an extracellular binding domain having a binding affinity for a selected ligand; (b) a linking sequence; (c) a TMD having at least about 80% sequence identity to the transmembrane domain of a Type 1 transmembrane receptor and including one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD including a transcriptional regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcriptional regulator and the linking sequence, and wherein the chimeric polypeptide does not include a sequence from a Notch receptor.
  • the ECD of the chimeric polypeptides and chimeric receptors (e.g ., SynRIPRs) disclosed herein has a binding affinity for one or more target ligands.
  • the target ligand is a cell- surface ligand.
  • suitable cell-surface ligands include cell surface receptors; adhesion proteins; carbohydrates, lipids, glycolipids, lipoproteins, and lipopolysaccharides that are surface-bound; integrins; mucins; and lectins.
  • the ligand is a protein.
  • the ligand is a carbohydrate.
  • the extracellular domain includes the ligand-binding portion of a receptor.
  • the extracellular domain includes an antigen-binding moiety that binds to one or more target antigens.
  • the ECD includes an antigen binding moiety capable of binding to one or more antigens on the surface of a cell ( e.g ., cell surface antigens).
  • the antigen-binding moiety includes one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment thereof.
  • a functional fragment thereof refers to a molecule having biological activity in common with the wild-type molecule from which the fragment or variant was derived.
  • a functional fragment or a functional variant of an antibody is one which retains essentially the same ability to bind to the same epitope as the antibody from which the functional fragment or functional variant was derived.
  • an antibody capable of binding to an epitope of a cell surface receptor may be truncated at the N-terminus and/or C- terminus, and the retention of its epitope binding activity assessed using assays known to those of skill in the art.
  • the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab') 2 fragment, a Fab fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), or a functional fragment thereof.
  • the antigen-binding moiety includes an scFv.
  • the antigen-binding moiety can include naturally-occurring amino acid sequences or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g., binding affinity.
  • binding affinity of an antigen-binding moiety e.g, an antibody
  • a target antigen e.g, CD 19 antigen
  • binding affinity is measured by an anti gen/ antibody dissociation rate.
  • binding affinity is measured by a competition radioimmunoassay.
  • binding affinity is measured by ELISA.
  • antibody affinity is measured by flow cytometry.
  • An antibody that “selectively binds” an antigen is an antigen-binding moiety that binds the antigen with high affinity and does not significantly bind other unrelated antigens.
  • an extracellular domain can be selected to target a receptor expressing cell to estrogen-dependent breast cancer cells.
  • the extracellular domain of the disclosed chimeric polypeptide receptors is capable of binding a tumor-associated antigen (TAA) or a tumor-specific antigen (TSA).
  • TAAs include a molecule, such as, for example, a protein, present on tumor cells and on a sub-population of normal cells, or on many normal cells, but at much lower concentration than on tumor cells. Examples include, without limitation, CEA, AFP, HER2, CTAG1B and MAGEA1.
  • TSAs generally include a molecule, such as, e.g., a protein, present on tumor cells but not expressed on normal cells. Examples include, without limitation, oncoviral antigens and mutated proteins (also known as neoantigens).
  • the antigen-binding moiety is specific for an epitope present in an antigen that is expressed by a tumor cell, i.e., a tumor-associated antigen or a tumor-specific antigen.
  • the tumor-associated or tumor-specific antigen can be an antigen associated with, e.g, a breast cancer cell, a B cell lymphoma, a pancreatic cancer, a Hodgkin lymphoma cell, an ovarian cancer cell, a prostate cancer cell, a mesothelioma, a lung cancer cell, a non-Hodgkin B-cell lymphoma (B-NHL) cell, an ovarian cancer cell, a prostate cancer cell, a mesothelioma cell, a melanoma cell, a chronic lymphocytic leukemia cell, an acute lymphocytic leukemia cell, a neuroblastoma cell, a glioma, a glioblastoma,
  • a tumor-associated antigen may also be expressed by a non-cancerous cell.
  • the antigen-binding domain is specific for an epitope present in a tissue- specific antigen. In some embodiments, the antigen-binding domain is specific for an epitope present in a disease-associated antigen.
  • suitable surface antigens that may be targeted by the chimeric polypeptide receptors disclosed herein.
  • suitable target antigens include CD 19, B7H3 (CD276), BCMA (CD269), alkaline phosphatase, placental-like 2 (ALPPL2), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), signal regulatory protein a (SIRPa), CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2/neu), IGLL1, IL-l lRa, KIT (CD
  • the target antigen is selected from CD 19, B7H3 (CD276), BCMA (CD269), CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2/neu), IGLL1, IL-1 IRa, KIT (CD117), MUC1, NCAM, PAP, PDGFR-b, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1/CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, Axl, GPC2, human epidermatitis, CD19, CD19
  • suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor g alternate reading frame protein), Trp-p8, STEAPl (six-transmembrane epithelial antigen of the prostate 1), an abnormal ras protein, an abnormal p53 protein, integrin b3 (CD61), galactin, K- Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), Ral-B, GPC2, CD276 (B7-H3), or IL-13Ra.
  • the antigen is ALPPL2.
  • the antigen is BCMA.
  • the antigen-binding moiety of the ECD is specific for a reporter protein, such as GFP and eGFP.
  • Non-limiting examples of such antigen binding moiety include a LaG17 anti-GFP nanobody.
  • the antigen-binding moiety of the ECD includes an anti-BCMA fully-humanized VH domain (FHVH).
  • the antigen is signal regulatory protein a (SIRPa).
  • Additional antigens that can be suitable for the chimeric polypeptide receptors disclosed herein include, but are not limited to GPC2, human epidermal growth factor receptor 2 (Her2/neu), CD276 (B7-H3), IL-13Ral, IL-13Ra2, a-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen- 125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA).
  • GPC2 human epidermal growth factor receptor 2
  • CD276 B7-H3
  • IL-13Ral IL-13Ral
  • IL-13Ra2 a-fetoprotein
  • CEA carcinoembryonic antigen
  • CA-125 cancer antigen- 125
  • CA19-9 calretinin
  • MUC-1 epithelial membrane protein
  • EMA epithelial tumor antigen
  • ETA epithelial tumor antigen
  • target antigens include, but are not limited to, tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-Dl, muscle- specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor- 1.
  • MAGE melanoma-associated antigen
  • CD34 CD45
  • CD123 CD93
  • CD99 chromogranin
  • GFAP glial fibrillary acidic protein
  • Additional suitable antigens include, but are not limited to, those associated with an inflammatory disease such as, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD 154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (one subunit of the heterodimeric IL-2 receptor), CD3, CD4, CD5, IFNa, IFNy, IgE, IgE Fc region, IL-1, IL-12, IL- 23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin a.4, integrin a4b7, LFA-1 (CD 11a), myostatin, OX-40, scleroscin, SOST, T ⁇ RbI, TNFa, and VEGF-A.
  • VAP-1 AOC3
  • CAM-3001 CCL11 (eotaxin-1), CD
  • antigens suitable for the chimeric polypeptides and SynRIPRs disclosed herein include, but are not limited to the pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CDla, SLAMF7/CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, Kappa light chain, Lamba light chain, CD 16/ FcyRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and isovariants thereof, TEM-8, sperm protein 17 (Spl7), mesothelin.
  • pyruvate kinase isoenzyme type M2 tumor M2-PK
  • CD20 CD5, CD7, CD3, TRBC
  • suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAPl (six-transmembrane epithelial antigen of the prostate-1), an abnormal ras protein, an abnormal p53 protein, integrin b3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B.
  • the antigen is ALPPL2.
  • the antigen is BCMA.
  • the antigen-binding moiety of the ECD is specific for a reporter protein, such as GFP and eGFP.
  • a reporter protein such as GFP and eGFP.
  • Non-limiting examples of such antigen binding moiety include a LaG17 anti- GFP nanobody.
  • the antigen-binding moiety of the ECD includes an anti- BCMA fully-humanized VH domain (FHVH).
  • the antigen is signal regulatory protein a (SIRPa).
  • antigens suitable for targeting by the chimeric polypeptides and chimeric receptors disclosed herein include ligands derived from a pathogen.
  • the antigen can be HER2 produced by HER2-positive breast cancer cells.
  • the antigen can be CD 19 that is expressed on B-cell leukemia.
  • the antigen can be EGFR that is expressed on glioblastoma multiform (GBM) but much less expressed so on healthy CNS tissue.
  • the antigen can be CEA that is associated with cancer in adults, for example colon cancer.
  • the antigen-binding moiety of the extracellular domain is specific for a cell surface target, where non-limiting examples of cell surface targets include CD 19, CD30, Her2, CD22, ENPP3, EGFR, CD20, CD52, CD 1 lot, and a-integrin.
  • the chimeric polypeptides and SynRIPRs disclosed herein include an extracellular domain having an antigen-binding moiety that binds CD 19, CEA, HER2, MUC1, CD20, or EGFR.
  • the chimeric polypeptides and SynRIPRs disclosed herein include an extracellular domain including an antigen-binding moiety that binds CD 19.
  • the chimeric polypeptides and receptors of the disclosure include a linking sequence disposed between the extracellular ligand-binding domain (ECD) and the TMD.
  • the linking sequence of the chimeric receptors has at least about 80% amino acid sequence identity to a polypeptide hinge domain.
  • the hinge domain of the chimeric polypeptides and SynRIPRs disclosed herein may serve several functions, including controlling flexibility and rigidity of the chimeric polypeptides and SynRIPRs, which in turn can affect antigen binding and signal transduction.
  • the length of the hinge domain can be tuned to enhance the SynRIPRs’ ability to reach antigens in the space between a SynRIPR and a target cell.
  • the hinge domain can also be tuned to mediate dimerization. Care should be taken in selecting a suitable hinge domain. For example, shorter hinge domain may be more rigid and more effective at transducing signal once engaged on target antigen but may not reach target that are more membrane proximal or otherwise specially constrained. In some embodiments, the hinge domain is capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding. In these instances, within the chimeric polypeptides and SynRIPRs disclosed herein, the hinge domain generally includes a flexible oligo- or polypeptide connector region disposed between the ECD and the TMD.
  • the hinge domain provides flexibility between the ECD and TMD and also provides sites for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex.
  • the hinge domain includes motifs that promote dimer formation of the chimeric polypeptides disclosed herein.
  • the hinge domain includes motifs that promote trimer formation of the chimeric polypeptides disclosed herein ( e.g ., a hinge domain derived from 0X40).
  • Hinge polypeptide sequences suitable for the compositions and methods of the disclosure can be naturally-occurring hinge polypeptide sequences (e.g., those from naturally- occurring immunoglobulins).
  • a hinge polypeptide sequence can be a synthetic sequence that corresponds to a naturally-occurring hinge polypeptide sequence, or can be an entirely synthetic hinge sequence, or can be engineered, designed, or modified to provide desired and/or improved properties, e.g, modulating transcription.
  • Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgGl hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or a functional variant thereof.
  • the hinge polypeptide sequence contains one or more CXXC motifs.
  • the hinge polypeptide sequence contains one or more CPPC motifs. Additional information in this regard can be found in, for example, a recent review by Vidarsson G. et al ., Frontiers Immunol. October 20, 2014, which is hereby incorporated by reference in its entirety.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgGl hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgG2 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgG3 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgA hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgD hinge domain or a functional variant thereof.
  • hinge polypeptide sequences suitable for the compositions and methods disclosed herein include, but are not limited to, hinge polypeptide sequences derived from a CD8a hinge domain, a CD28 hinge domain, a CD 152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an 0X40 hinge domain, an FcyRIIIa hinge domain, and functional variants thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from a CD8a hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an 0X40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.
  • any single-chain peptide including about one to 100 amino acid residues e.g ., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues
  • any single-chain peptide including about one to 100 amino acid residues (e.g ., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a hinge domain.
  • the hinge domain includes about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the hinge domain includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, about 50 to 70 amino acid residues. In some embodiments, the hinge domain includes about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the hinge domain includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues.
  • the linking sequence comprises an amino acid sequence having at least 80% sequence identity to a hinge domain derived from CD8a hinge domain, a CD28 hinge domain, a CD 152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an 0X40 hinge domain, an IgGl hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any thereof.
  • the hinge domain is derived from a CD8a hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 157-161.
  • the linking sequence comprises or consists of an amino acid sequence having at least about 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or about 99% sequence identity to a sequence set forth in SEQ ID NOS: 157-161 in the Sequence Listing.
  • the linking sequence comprises or consists of an amino acid sequence having at least about 80% sequence identity to a sequence set forth in SEQ ID NOS: 157-161.
  • the linking sequence comprises or consists of an amino acid sequence having at least about 90% sequence identity to a sequence set forth in SEQ ID NOS: 157-161.
  • the linking sequence comprises or consists of an amino acid sequence having at least about 95% sequence identity to a sequence set forth in SEQ ID NOS: 157-161. In some embodiments, the linking sequence comprises or consists of an amino acid sequence having about 100% sequence identity to a sequence set forth in SEQ ID NOS: 157-161. In some embodiments, the linking sequence comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NOS: 157-161, wherein one, two, three, four, or five of the amino acid residues in any one of SEQ ID NO: 157-161 is/are substituted by a different amino acid residues.
  • one or more domains of a ROBO (Roundabout) cell surface receptor are incorporated into the linking sequence of the chimeric receptors of the present disclosure.
  • ROBO receptors release a nuclear transcription factor domain following ligand- induced cleavage of the extracellular portion of the receptor by the ADAM 10 MMP and g- secretase.
  • ROBO does not contain a LIN/Notch domain, EGF-like repeats, or an HD domain.
  • the primary ligand for ROBO is a soluble protein (SLIT).
  • ROBOl-3 have five immunoglobulin-like (Ig) domains, three fibronectin (Fn) repeats, and a transmembrane domain linked to an intracellular domain.
  • Ig immunoglobulin-like
  • Fn fibronectin
  • ROB04 has only two Ig domains, and two Fn domains. Additional information in this regard can be found in, for example, H. Blockus et ak, Development (2016) 143:3037-44, which is hereby incorporated by reference.
  • the linking sequence of the chimeric receptors as disclosed herein includes at least one fibronectin (Fn) repeat derived from a ROBO receptor.
  • the linking sequence of the disclosed chimeric receptors can contain 1, 2, 3, 4, or 5 Fn repeats.
  • the 1 linking sequence of the chimeric receptors includes about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats.
  • the linking sequence of the chimeric receptors has at least about 80% amino acid sequence identity to a ROBOl JMD including at least one fibronectin repeat.
  • the linking sequence of the chimeric receptors has a polypeptide sequence of about 4 to about 40 amino acid residues in length (e.g ., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues).
  • the length and amino acid composition of the linking sequence can be optimized to vary the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure.
  • the linking sequence of the chimeric receptors has a polypeptide sequence of about 4 to about 40, about 5 to about 30, about 10 to about 20, about 10 to about 30, about 10 to about 40, about 5 to about 20, about 5 to about 40, or about 20 to about 40 amino acid residues in length.
  • Transmembrane domain [0089] As described above, the chimeric receptors of the disclosure include a transmembrane domain having at least about 80% sequence identity to the TMD of a Type 1 transmembrane receptor and comprising one or more ligand-inducible proteolytic cleavage sites.
  • proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, a metalloproteinase cleavage site for a matrix metalloproteinase (MMP) selected from collagenase-1, -2, and -3 (MMP-1, - 8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP).
  • MMP matrix metalloproteinase
  • the cleavage sequence of MMP-9 is Pro-X-X-Hy (wherein, X represents an arbitrary residue; Hy, a hydrophobic residue such as Leu, He, Val, Phe, Trp, Tyr, Val, Met, and Pro) (SEQ ID NO: 165), e.g., Pro-X-X-Hy-( S er/Thr) (SEQ ID NO: 166), e.g., Pro-Leu/Gln-Gly-Met-Thr-Ser (SEQ ID NO: 167) or Pro-Leu/Gln-Gly-Met-Thr (SEQ ID NO: 168.
  • a suitable protease cleavage site is a plasminogen activator cleavage site, e.g., a urokinase plasminogen activator (uPA) or a tissue plasminogen activator (tPA) cleavage site.
  • a suitable protease cleavage site is a prolactin cleavage site.
  • Specific examples of cleavage sequences of uPA and tPA include sequences comprising Val-Gly-Arg (SEQ ID NO: 169).
  • protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g, Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 170), where the protease cleaves between the glutamine and the serine.
  • TSV tobacco etch virus
  • protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g, Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 171), where cleavage occurs after the lysine residue.
  • enterokinase cleavage site e.g, Asp-Asp-Asp-Asp-Lys
  • Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g, Leu- Val -Pro- Arg (SEQ ID NO: 172).
  • protease cleavage sites include sequences cleavable by the following proteases: a PreScissionTM protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), a thrombin, cathepsin B, Epstein- Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMP, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin- 1, matrix metalloproteinase 13 (collagenase-3
  • proteases that are not native to the host cell in which the receptor is expressed can be used as a further regulatory mechanism, in which activation of the SynRIPR of the disclosure is reduced until the protease is expressed or otherwise provided.
  • a protease may be tumor-associated or disease-associated (expressed to a significantly higher degree than in normal tissue), and serve as an independent regulatory mechanism.
  • some matrix metalloproteases are highly expressed in certain cancer types.
  • the TMD suitable for the chimeric receptors disclosed herein can be any transmembrane domain of a Type 1 transmembrane receptor comprising at least one g-secretase cleavage site.
  • a Type 1 transmembrane receptor comprising at least one g-secretase cleavage site.
  • g-secretase complex as well as its substrate proteins, including amyloid precursor protein (APP), can, for example, be found in a recent review by Zhang et ah, Frontiers Cell Neurosci (2014).
  • Non-limiting suitable TMDs from Type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLPl, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, wherein the TMD includes at least one g-secretase cleavage site.
  • TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTINl, PCDHGC3, NRGl, LRPIB, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM.
  • Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1,
  • the TMD of the chimeric polypeptides or SynRIPRs of the disclosure is a TMD derived from the TMD of APP, CLSTN1, CLSTN2, EPCAM, KCNE3, NECTINl, PCDHGC3, and PTPRF.
  • the TMD of the chimeric polypeptides or SynRIPRs of the disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as, alcadein alpha and alcadein gamma.
  • the transmembrane domain includes an amino acid sequence exhibiting at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to a polypeptide sequence having at least about 70% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor that comprises a g-secretase cleavage site.
  • the transmembrane domain includes an amino acid sequence exhibiting at least 70% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor that comprises a g- secretase cleavage site.
  • the transmembrane domain includes an amino acid sequence exhibiting at least about 80% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor that comprises a g-secretase cleavage site. In some embodiments, the transmembrane domain includes an amino acid sequence exhibiting at least about 90% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor that comprises a g-secretase cleavage site. In some embodiments, the transmembrane domain includes an amino acid sequence exhibiting at least about 95% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor that comprises a g-secretase cleavage site.
  • the Type 1 transmembrane receptor is selected from the group consisting of CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, IFNAR2, IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTINl, PC
  • the TMD includes an amino acid sequence exhibiting at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOS: 1-84,
  • the transmembrane domain includes an amino acid sequence having at least about 90% sequence identity to SEQ ID NOS: 1-84, 178, 182-185, and 190-192. In some embodiments, the transmembrane domain includes an amino acid sequence having at least about 95% sequence identity to SEQ ID NOS: 1- 88. In some embodiments, the transmembrane domain includes an amino acid sequence having about 100% sequence identity to SEQ ID NOS: 1-84, 178, 182-185, and 190-192.
  • the transmembrane domain includes the amino acid sequence of SEQ ID NO: 1- 84, 178, 182-185, and 190-192, wherein one, two, three, four, or five of the amino acid residues in the amino acid sequence is/are substituted by a different amino acid residue.
  • the amino acid substitution(s) within the TMD includes one or more substitutions within a “GV” motif of the TMD.
  • at least one of such substitution(s) comprises a substitution to alanine.
  • one, two, three, four, five, or more of the amino acid residues of the sequence IATVVIIISVCMLVFVVAMGVY (SEQ ID NO: 2), as well as any one of sequences as set forth in SEQ ID NOS: 1, 6, 20, 43, 39, 54, and 64 may be substituted by a different amino acid residue.
  • the amino acid residue at position 18 and/or 19 of the “GV” motif within SEQ ID NO: 2 is substituted by a different amino acid residue.
  • the glycine residue at position 20 of SEQ ID NO: 2 is substituted by a different amino acid residue.
  • the valine residue at position 21 of SEQ ID NO: 2 is substituted by a different amino acid residue.
  • the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO: 2 with a mutation at the position corresponding to position 18 of SEQ ID NO: 20, such as G18A mutations.
  • the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO: 2 with a mutation at the position corresponding to position 21 of SEQ ID NO: 57, such as V19A mutations.
  • the chimeric receptors of the disclosure include a stop-transfer sequence (STS), which is essentially a highly-charged domain located between the TMD and the ICD.
  • STS stop-transfer sequence
  • a highly-charged domain disposed between the TMD and the ICD prevents the ICD from entering the membrane.
  • the length and/or amino acid composition of the STS there are no particular limitations to the length and/or amino acid composition of the STS.
  • any arbitrary single-chain peptide comprising about 1 to about 40 amino acid residues (e.g ., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues) can be used as an STS.
  • the STS includes about 1 to 15, about 5 to 20, about 8 to 25, about 10 to 30, about 12 to 35, about 14 to 40, about 5 to 40, about 10 to 35, about 15 to 30, about 20 to 25, about 20 to 40, about 10 to 30, about 4 to 20, or about 5 to 25 amino acid residues. In some embodiments, the STS includes about 1 to 10, about 5 to 12, about 6 to 14, about 7 to 18, about 8 to 20, about 9 to 22, about 10 to 24, or about 11 to 26 amino acid residues. In some embodiments, the STS includes about 4 to 10 residues, such as, 4, 5, 6, 7, 8, 9, or 10 amino acid residues.
  • the STS includes a sequence having at least about 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to the STS domain of a Type 1 receptor.
  • the STS includes an amino acid sequence having at least 90% sequence identity to the STS domain of a Type 1 receptor.
  • the STS includes a sequence having at least 70% sequence identity, such as, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a STS sequence from CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRPIB, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, PTPRF, or PTPRM.
  • sequence having at least 70% sequence identity such as, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a STS sequence from CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRPIB, Jag2, EPCAM, KC
  • the STS includes a sequence having at least 70% sequence identity, such as, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a STS sequence from CSF1R, DAG1, AGER, NRG1, KCNE3, PTPRF, or PTPRM.
  • the STS includes a sequence comprising only Lys (K) or Arg (R) in the first 4 residues.
  • the STS includes one, two, three, four, five, or more basic residues.
  • the STS includes five, four, three, two, one, or zero aromatic residues or residues with hydrophobic and/or bulky side chains.
  • the STS includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to SEQ ID NO: 85-156 and 173 in the Sequence Listing.
  • the STS includes an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 89, 92, 108, 115, 138, 146, and 156.
  • the STS includes an amino acid sequence having at least 95% sequence identity to SEQ ID NOS: 89, 92, 108, 115, 138, 146, and 156.
  • the STS includes an amino acid sequence having at least 100% sequence identity to SEQ ID NO: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, the STS includes an amino acid sequence having at least 90% or at least 95% sequence identity to SEQ ID NO: 146. In some embodiments, the STS includes an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 108. In some embodiments, the STS includes the amino acid sequence of any one of SEQ ID NOS: 89, 92, 108, 115, 138, 146, and 156, wherein one, two, three, four, or five of the amino acid residues in the amino acid sequence is/are substituted by a different amino acid residue.
  • ICD Intracellular domain
  • the chimeric receptor of the disclosure further comprises an intracellular domain (ICD) comprising a transcriptional regulator.
  • the transcriptional regulator is a biochemical element that acts to activate or repress the transcription of a promoter-driven DNA sequence.
  • Transcriptional regulators suitable for the compositions and methods of the disclosure can be naturally-occurring transcriptional regulators or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g ., modulating transcription.
  • the transcriptional regulator directly regulates expression of one or more genes involved in differentiation of the cell.
  • the transcriptional regulator indirectly modulates expression of one or more genes involved in differentiation of the cell by modulating the expression of a second transcription factor which in turn modulates expression of one or more genes involved in differentiation of the cell.
  • a transcriptional regulator can be a transcriptional activator or a transcriptional repressor.
  • the transcriptional regulator is a transcriptional repressor.
  • the transcriptional regulator is a transcriptional activator.
  • the transcriptional regulator can further include a nuclear localization signal.
  • the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP 1 -VP 16. In some embodiments, the transcriptional regulator is Gal4- VP64.
  • the extracellular domains located N-terminally to the TMD can further include an additional domain, for example a membrane localization signal such as a CD8a signal, a detectable marker such as a myc tag or his tag, and the like.
  • the chimeric receptors further comprise one or more additional proteolytic cleavage sites. In some embodiments, the chimeric receptors do not comprise an additional proteolytic cleavage site. In some embodiments, the chimeric receptors further comprise one or more glycosylation sites. In some embodiments, the chimeric receptors do not comprise a glycosylation site.
  • the chimeric receptors do not comprise a hinge domain for promoting oligomerization of the chimeric polypeptide via intermolecular disulfide bonding. [0099] In some embodiments, the chimeric receptors further comprise elements of the highly conserved ROBO cell surface receptors.
  • the chimeric receptors disclosed comprise, from N-terminus to C-terminus: (a) an extracellular ligand binding domain having a binding affinity for a selected ligand; (b) a ROBO domain comprising a fibronectin repeat; (c) a TMD including one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD including a transcriptional regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site in the TMD, and wherein the chimeric polypeptide does not include a sequence from a Notch receptor.
  • the chimeric receptors further comprise an extracellular oligomerization domain (e.g ., a hinge domain) to promote oligomerization, e.g. , dimerization, trimerization, or higher order multimers of the chimeric receptor.
  • an extracellular oligomerization domain e.g ., a hinge domain
  • the chimeric receptors disclosed comprise, from N-terminus to C-terminus: (a) an extracellular ligand binding domain having a binding affinity for a selected ligand; (b) a hinge domain; (c) a TMD including one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD including a transcriptional regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site in the TMD, and wherein the chimeric polypeptide does not include a sequence from a Notch receptor.
  • the hinge domain includes polypeptide motifs capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding.
  • a chimeric receptor disclosed herein includes, from N-terminus to C- terminus: (a) an extracellular ligand binding domain having a binding affinity for a selected ligand; (b) a hinge domain capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding; (c) a TMD comprising one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD comprising a transcriptional regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at a ligand- inducible proteolytic cleavage sites in the TMD, and wherein the chimeric polypeptide does not comprise a sequence from a Notch receptor.
  • Chimeric receptors of the present disclosure can be chimeric polypeptides of any length, including chimeric polypeptides that are generally between about 100 amino acids (aa) to about 1000 aa, e.g, from about 100 aa to about 200 aa, from about 150 aa to about 250 aa, from about 200 aa to about 300 aa, from about 250 aa to about 350 aa, from about 300 aa to about 400 aa, from about 350 aa to about 450 aa, from about 400 aa to about 500 aa in length.
  • aa amino acids
  • the disclosed chimeric polypeptides are generally between about 400 aa to about 450 aa, from about 450 aa to about 500 aa, from about 500 aa to about 550 aa, from about 550 aa to about 600 aa, from about 600 aa to about 650 aa, from about 650 aa to about 700 aa, from about 700 aa to about 750 aa, from about 750 aa to about 800 aa, from about 800 aa to about 850 aa, from about 850 aa to about 900 aa, from about 900 aa to about 950 aa, or from about 950 aa to about 1000 aa in length.
  • the chimeric polypeptides of the present disclosure have a length of from about 300 aa to about 400 aa. In some cases, the chimeric polypeptides of the present disclosure have a length of from 300 aa to 350 aa. In some cases, the chimeric polypeptides of the present disclosure have a length of from 300 aa to 325 aa. In some cases, the chimeric polypeptides of the present disclosure have a length of from 350 aa to 400 aa. In some cases, the chimeric polypeptides of the present disclosure have a length of from 750 aa to 850 aa.
  • the chimeric receptors of the disclosure include: (a) an extracellular ligand-binding domain (b) a linking sequence including an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 157-161; (c) a TMD including an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 1-84, 178, 182-185, and 190-192; (d) an STS including an amino acid sequence having at about least 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 89, 92, 108, 115, 138, 146, and 156; and (e) an ICD comprising a transcriptional regulator.
  • a linking sequence including an amino acid sequence having at least about 80%, 90%, 95%,
  • the chimeric receptor of the disclosure include: (a) a linking sequence including an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOS: 157-161; (b) a TMD including an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOS: 1-84, 178, 182-185, and 190-192; and (c) an STS including an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NO: 89, 92, 108, 115, 138, 146, and 156.
  • the chimeric receptors of the disclosure include: (a) a linking sequence including an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NO: 157-161; (b) a transmembrane domain including an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NO: 1-84, 178, 182-185, and 190-192; and (c) an STS including an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOS: 89, 92, 108, 115, 138, 146, and 156.
  • the chimeric polypeptides of the disclosure include an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein, e.g., those described in Table 1. Accordingly, in some embodiments, the chimeric polypeptides of the disclosure include an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248 in the Sequence Listing.
  • the chimeric polypeptides of the disclosure include an amino acid sequence having at least about 90% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248. In some embodiments, chimeric polypeptides of the disclosure include an amino acid sequence having at least about 95% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248. In some embodiments, the chimeric polypeptides of the disclosure include an amino acid sequence having at least about 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197- 248.
  • the chimeric polypeptides of the disclosure include an amino acid sequence having at least about 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248, wherein one, two, three, four, or five of the amino acid residues in the amino acid sequence is/are substituted by a different amino acid residue.
  • nucleic acid molecules comprising nucleotide sequences encoding the chimeric polypeptides and Notch receptors of the disclosure, including expression cassettes, and expression vectors containing these nucleic acid molecules operably linked to heterologous nucleic acid sequences such as, for example, regulatory sequences which direct in vivo expression of the receptor in a host cell.
  • Nucleic acid molecules of the present disclosure can be nucleic acid molecules of any length, including nucleic acid molecules that are generally between about 5 Kb and about 50 Kb, for example between about 5 Kb and about 40 Kb, between about 5 Kb and about 30 Kb, between about 5 Kb and about 20 Kb, or between about 10 Kb and about 50 Kb, for example between about 15 Kb to 30 Kb, between about 20 Kb and about 50 Kb, between about 20 Kb and about 40 Kb, about 5 Kb and about 25 Kb, or about 30 Kb and about 50 Kb.
  • the nucleic acid molecules comprise a nucleotide sequence encoding a chimeric receptor comprising, from N-terminus to C-terminus: (a) an extracellular ligand binding domain having a binding affinity for a selected ligand; (b) a linking sequence having: (i) at least about 80% sequence identity to a polypeptide hinge domain; or (ii) at least about 80% sequence identity to a ROBOl JMD including at least one fibronectin (Fn) repeat; (c) a TMD having at least about 80% sequence identity to the transmembrane domain of a Type 1 transmembrane receptor comprising one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD comprising a transcriptional regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcriptional regulator and the linking sequence, and wherein the
  • the nucleotide sequence is incorporated into an expression cassette or an expression vector.
  • an expression cassette generally includes a construct of genetic material that contains coding sequences and enough regulatory information to direct proper transcription and/or translation of the coding sequences in a recipient cell, in vivo and/or ex vivo.
  • the expression cassette may be inserted into a vector for targeting to a desired host cell or tissue and/or into an individual.
  • an expression cassette of the disclosure comprises a nucleotide sequence encoding a chimeric polypeptide operably linked to expression control elements sufficient to guide expression of the cassette in vivo.
  • the expression control element comprises a promoter and/or an enhancer and optionally, any or a combination of other nucleic acid sequences capable of effecting transcription and/or translation of the coding sequence.
  • the nucleotide sequence is incorporated into an expression vector.
  • vector generally refers to a recombinant polynucleotide construct designed for transfer between host cells, and that may be used for the purpose of transformation, e.g ., the introduction of heterologous DNA into a host cell.
  • the vector can be a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment.
  • the expression vector can be an integrating vector.
  • the expression vector can be a viral vector.
  • viral vector is widely used to refer either to a nucleic acid molecule (e.g ., a transfer plasmid) that includes virus-derived nucleic acid elements that generally facilitate transfer of the nucleic acid molecule or integration into the genome of a cell or to a viral particle that mediates nucleic acid transfer.
  • Viral particles will generally include various viral components and sometimes also host cell components in addition to nucleic acid(s).
  • the term viral vector may refer either to a virus or viral particle capable of transferring a nucleic acid into a cell or to the transferred nucleic acid itself.
  • Viral vectors and transfer plasmids contain structural and/or functional genetic elements that are primarily derived from a virus.
  • retroviral vector refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus.
  • lentiviral vector refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, including LTRs that are primarily derived from a lentivirus.
  • a nucleic acid molecule encoding a chimeric receptor of the disclosure can be incorporated into one or more lentiviral vector constructs.
  • a nucleic acid molecule encoding a chimeric receptor of the disclosure can be incorporated into a single lentiviral vector construct.
  • a nucleic acid molecule encoding a chimeric receptor of the disclosure can be incorporated into two, three, four, five, or more lentiviral vector constructs.
  • the recombinant nucleic acids encode a polypeptide with an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein.
  • the nucleic acid molecules encode a chimeric polypeptide comprising: (a) a linking sequence including an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 157-161; (b) a transmembrane domain including an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 1-84, 178, 182-185, and 190-192; and (c) an STS including an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 89, 92, 108, 115, 138, 146, and 156.
  • the nucleic acid molecules encode a chimeric polypeptide comprising: (a) a linking sequence including an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NO: 157-161; (b) a transmembrane domain including an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOS: 1-84, 178, 182-185, and 190-192; and (c) an STS including an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NO: 89, 92, 108, 115, 138, 146, and 156.
  • the nucleic acid molecules encode a chimeric polypeptide comprising: (a) a linking sequence including an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOS: 157-161; (b) a transmembrane domain including an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOS: 1-84, 178, 182-185, and 190-192; and (c) an STS including an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOS: 89, 92, 108, 115, 138, 146, and 156.
  • the nucleic acid sequences encoding the chimeric receptors can be optimized for expression in the host cell of interest.
  • the G-C content of the sequence can be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Methods for codon optimization are known in the art. Codon usages within the coding sequence of the chimeric receptor disclosed herein can be optimized to enhance expression in the host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons within the coding sequence have been optimized for expression in a particular host cell.
  • Some embodiments disclosed herein relate to vectors or expression cassettes including a recombinant nucleic acid molecule encoding the chimeric receptors disclosed herein.
  • the expression cassette generally contains coding sequences and sufficient regulatory information to direct proper transcription and/or translation of the coding sequences in a recipient cell, in vivo and/or ex vivo.
  • the expression cassette may be inserted into a vector for targeting to a desired host cell and/or into an individual.
  • An expression cassette can be inserted into a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, or bacteriophage, as a linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide, derived from any source, capable of genomic integration or autonomous replication, including a nucleic acid molecule where one or more nucleic acid sequences has been linked in a functionally operative manner, i.e., operably linked.
  • nucleic acid molecules can be contained within a vector that is capable of directing their expression in, for example, a cell that has been transformed/transduced with the vector.
  • Suitable vectors for use in eukaryotic and prokaryotic cells are known in the art and are commercially available, or readily prepared by a skilled artisan. See for example, Sambrook, J., & Russell, D. W. (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, D. W. (2001).
  • DNA vectors can be introduced into eukaryotic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (2012, supra) and other standard molecular biology laboratory manuals, such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, nucleoporation, hydrodynamic shock, and infection.
  • Viral vectors that can be used in the disclosure include, for example, retrovirus vectors, adenovirus vectors, and adeno-associated virus vectors, lentivirus vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors , CSH Laboratory Press, Cold Spring Harbor, N. Y.).
  • a chimeric receptor as disclosed herein can be produced in a eukaryotic host, such as a mammalian cells (e.g ., COS cells, NIH 3T3 cells, or HeLa cells).
  • nucleic acid molecules provided can contain naturally occurring sequences, or sequences that differ from those that occur naturally but encode the same gene product because the genetic code is degenerate.
  • These nucleic acid molecules can consist of RNA or DNA (for example, genomic DNA, cDNA, or synthetic DNA, such as that produced by phosphoramidite- based synthesis), or combinations or modifications of the nucleotides within these types of nucleic acids.
  • the nucleic acid molecules can be double-stranded or single-stranded (e.g., comprising either a sense or an antisense strand).
  • the nucleic acid molecules are not limited to sequences that encode polypeptides (e.g. , antibodies); some or all of the non-coding sequences that lie upstream or downstream from a coding sequence (e.g, the coding sequence of a chimeric receptor) can also be included.
  • polypeptides e.g. , antibodies
  • some or all of the non-coding sequences that lie upstream or downstream from a coding sequence e.g, the coding sequence of a chimeric receptor
  • Those of ordinary skill in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. They can, for example, be generated by treatment of genomic DNA with restriction endonucleases, or by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • transcripts can be produced, for example, by in vitro transcription.
  • the nucleic acid of the present disclosure can be introduced into a host cell, such as a human T lymphocyte, to produce a recombinant cell containing the nucleic acid molecule. Accordingly, some embodiments of the disclosure relate to methods for making recombinant cells, including the steps of: (a) providing a cell capable of protein expression and (b) contacting the provided cell with any of the recombinant nucleic acids described herein.
  • nucleic acid molecules of the disclosure can be achieved by viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.
  • PEI polyethyleneimine
  • the nucleic acid molecules are delivered to cells by viral or non-viral delivery vehicles known in the art.
  • the nucleic acid molecule can be stably integrated in the host genome, or can be episomally replicating, or present in the recombinant host cell as a mini-circle expression vector for a stable or transient expression.
  • the nucleic acid molecule is maintained and replicated in the recombinant host cell as an episomal unit.
  • the nucleic acid molecule is stably integrated into the genome of the recombinant cell.
  • Stable integration can be completed using classical random genomic recombination techniques or with more precise genome editing techniques such as using guide RNA directed CRISPR/Cas9, or DNA-guided endonuclease genome editing NgAgo (Natronobacterium gregoryi Argonaute), or TALENs genome editing (transcription activator-like effector nucleases).
  • the nucleic acid molecule present in the recombinant host cell as a mini-circle expression vector for a stable or transient expression.
  • the nucleic acid molecules can be encapsulated in a viral capsid or a lipid nanoparticle.
  • introduction of nucleic acids into cells may be achieved by viral transduction.
  • adeno-associated virus AAV
  • AAV serotypes have been described, and all of the known serotypes can infect cells from multiple diverse tissue types. AAV is capable of transducing a wide range of species and tissues in vivo with no evidence of toxicity, and it generates relatively mild innate and adaptive immune responses.
  • Lentiviral systems are also suitable for nucleic acid delivery and gene therapy via viral transduction.
  • Lentiviral vectors offer several attractive properties as gene-delivery vehicles, including: (i) sustained gene delivery through stable vector integration into host genome; (ii) the ability to infect both dividing and non-dividing cells; (iii) broad tissue tropisms, including important gene- and cell-therapy-target cell types; (iv) no expression of viral proteins after vector transduction; (v) the ability to deliver complex genetic elements, such as polycistronic or intron- containing sequences; (vi) potentially safer integration site profile; and (vii) a relatively easy system for vector manipulation and production.
  • host cells can be genetically engineered (e.g ., transduced, transformed, or transfected) with, for example, a vector comprising a nucleic acid sequence encoding a chimeric receptor as described herein, either a virus-derived expression vector or a vector for homologous recombination further comprising nucleic acid sequences homologous to a portion of the genome of the host cell.
  • Host cells can be either untransformed cells or cells that have already been transfected with one or more nucleic acid molecules.
  • the recombinant cell is a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is transformed in vivo. In some embodiments, the cell is transformed ex vivo. In some embodiments, the cell is transformed in vitro. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell.
  • the mammalian cell is an immune cell, a neuron, an epithelial cell, and endothelial cell, or a stem cell.
  • the recombinant cell is an immune system cell, e.g., a lymphocyte (e.g, a T cell or NK cell), or a dendritic cell.
  • the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, or other T cell.
  • the immune system cell is a T lymphocyte.
  • the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments of the cell, the cell is a lymphocyte. In some embodiments, the cell is a precursor T cell or a T regulatory (Treg) cell. In some embodiments, the cell is a CD34+, CD8+, or a CD4+ cell. In some embodiments, the cell is a CD8+ T cytotoxic lymphocyte cell selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, and bulk CD8+ T cells.
  • the cell is a CD4+ T helper lymphocyte cell selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, and bulk CD4+ T cells.
  • the cell can be obtained by leukapheresis performed on a sample obtained from a human subject.
  • the recombinant cell further includes a second nucleic acid molecule as disclosed herein, wherein the first nucleic acid molecule and the second nucleic acid molecule do not have the same sequence.
  • the recombinant cell further includes a second chimeric polypeptide as disclosed herein, wherein the first chimeric polypeptide and the second chimeric polypeptide do not have the same sequence.
  • the first chimeric polypeptide modulates the expression and/or activity of the second chimeric polypeptide.
  • the recombinant cell further includes an expression cassette encoding a protein of interest operably linked to a promoter, wherein expression of the protein of interest is modulated by the transcriptional regulator encoded by the chimeric receptor.
  • the protein of interest is heterologous to the recombinant cell. In principle, there are no particular limitations with regard to selecting proteins to target for modulation of expression by the transcriptional regulator encoded by the chimeric receptor.
  • Non-limiting examples of proteins suitable for the regulation by the compositions and methods disclosed herein include cytokines, cytotoxins, chemokines, immunomodulators, pro-apoptotic factors, anti-apoptotic factors, hormones, differentiation factors, dedifferentiation factors, immune cell receptors, or reporter genes.
  • the immune cell receptor comprises a T-cell receptor (TCR).
  • TCR generally comprises two polypeptides (e.g ., polypeptide chains), such as an a-chain of a TCR, a b-chain of a TCR, a g-chain of a TCR, a d-chain of a TCR, or a combination thereof.
  • polypeptide chains of TCRs are known in the art.
  • the immune cell receptor comprises a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • Methods for CAR design, delivery and expression in T cells, and the manufacturing of clinical-grade CAR-T cell populations are known in the art. See, for example, Lee etal, Clin Cancer Res (2012) 18(10):2780-90, hereby incorporated by reference in its entirety.
  • the expression cassette encoding the protein of interest is incorporated into the same nucleic acid molecule that encodes the chimeric receptor of the disclosure.
  • the expression cassette encoding the protein of interest is incorporated into a second expression vector that is separate from the nucleic acid molecule encoding the chimeric receptor of the disclosure.
  • various cell cultures including at least one recombinant cell as disclosed herein, and a culture medium.
  • the culture medium can be any one of suitable culture media for the cell cultures described herein. Techniques for transforming a wide variety of the above-mentioned host cells and species are known in the art and described in the technical and scientific literature. Accordingly, cell cultures including at least one recombinant cell as disclosed herein are also within the scope of this application. Methods and systems suitable for generating and maintaining cell cultures are known in the art.
  • nucleic acids, and recombinant cells of the disclosure can be incorporated into compositions, including pharmaceutical compositions.
  • Such compositions generally include the nucleic acids, and/or recombinant cells, and a pharmaceutically acceptable excipient, e.g ., a carrier.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM. (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS).
  • the composition should be sterile and should be fluid to the extent that it can be administered by syringe. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants, e.g, sodium dodecyl sulfate.
  • surfactants e.g, sodium dodecyl sulfate.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, and/or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the chimeric polypeptides and SynRIPRs of the disclosure can also be administered by transfection or infection using methods known in the art, including but not limited to the methods described in McCaffrey et al. ( Nature (2002) 418:6893), Xia et al. (Nature Biotechnol (2002) 20:1006-10), or Putnam (Am J Health Syst Pharm (1996) 53:151-60, erratum at Am J Health Syst Pharm (1996) 53:325).
  • nucleic acids, recombinant cells, and pharmaceutical compositions can be used to treat individuals having a disease, such as cancers and chronic infections.
  • nucleic acids, recombinant cells, and pharmaceutical compositions are incorporated into therapeutic compositions for use in methods of treating an individual who has, who is suspected of having, or who may be at high risk for developing one or more autoimmune disorders or diseases associated with checkpoint inhibition.
  • Exemplary autoimmune disorders and diseases can include, without limitation, celiac disease, type 1 diabetes, Graves’ disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, and systemic lupus erythematosus.
  • a target cell in an individual comprising the step of administering to the individual a first therapy including one or more of the nucleic acids, recombinant cells, and pharmaceutical compositions provided herein, wherein the first therapy inhibits an activity of the target cell.
  • a first therapy including one or more of the nucleic acids, recombinant cells, and pharmaceutical compositions provided herein, wherein the first therapy inhibits an activity of the target cell.
  • an activity of the target cell may be inhibited if its proliferation is reduced, if its pathologic or pathogenic behavior is reduced, if it is destroyed or killed, or the like.
  • Inhibition includes a reduction of the measured quantity of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
  • the methods include administering to the individual an effective number of the recombinant cell as disclosed herein, wherein the recombinant cell inhibits the target cell in the individual.
  • the target cell of the disclosed methods can be any cell such as, for example an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B- cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a liver cancer cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T-cell lymphoma cell, a renal cancer cell, a sarcoma cell, a stomach cancer cell, a carcinoma cell, a me
  • methods of treating a disease in an individual in need thereof comprising a step of administering to the individual a first therapy including one or more of chimeric polypeptides, SynRIPRs, nucleic acids, recombinant cells, or pharmaceutical compositions provided herein, wherein the first therapy treats the disease in the individual.
  • the methods include administering to the individual a first therapy including an effective number of the recombinant cells provided herein, wherein the recombinant cells treat the disease.
  • methods for assisting in the treatment of a disease in an individual in need thereof comprising the steps of administering to the individual a first therapy comprising one or more recombinant nucleic acids, recombinant cells, or pharmaceutical compositions as disclosed herein, and administering to the individual a second therapy, wherein the first and second therapies together treat the disease in the individual.
  • the methods include administering to the individual a first therapy including an effective number of the recombinant cells as disclosed herein, wherein the recombinant cells treat the disease.
  • the methods involve administering an effective amount or number of the recombinant cells of the disclosure to an individual who is in need of such method.
  • This administering step can be accomplished using any method of implantation known in the art.
  • the recombinant cells of the disclosure can be injected directly into the individual’s bloodstream by intravenous infusion or otherwise administered to the individual.
  • the terms “administering”, “introducing”, and “transplanting” are used interchangeably herein to refer to methods of delivering recombinant cells expressing the chimeric receptors provided herein to an individual.
  • the methods comprise administering recombinant cells to an individual by a method or route of administration that results in at least partial localization of the introduced cells at a desired site such that a desired effect(s) is/are produced.
  • the recombinant cells or their differentiated progeny can be administered by any appropriate route that results in delivery to a desired location in the individual where at least a portion of the administered cells or components of the cells remain viable.
  • the period of viability of the cells after administration to an individual can be as short as a few hours, e.g ., twenty-four hours, to a few days, to as long as several years, or even long-term engraftment for the life time of the individual.
  • the recombinant cells described herein are administered to an individual in advance of any symptom of a disease or condition to be treated. Accordingly, in some embodiments the prophylactic administration of a recombinant stem cell population serves to prevent the occurrence of symptoms of the disease or condition.
  • recombinant stem cells are provided at (or after) the onset of a symptom or indication of a disease or condition, e.g. , upon the onset of disease or condition.
  • an effective amount of recombinant cells as disclosed herein can be at least 10 2 cells, at least 5 c 10 2 cells, at least 10 3 cells, at least 5 c 10 3 cells, at least 10 4 cells, at least 5 c 10 4 cells, at least 10 5 cells, at least 2 c
  • the recombinant cells can be derived from one or more donors or can be obtained from an autologous source (i.e., the human subject being treated). In some embodiments, the recombinant cells are expanded in culture prior to administration to an individual in need thereof.
  • the delivery of a composition comprising recombinant cells into an individual by a method or route results in at least partial localization of the cell composition at a desired site.
  • a cell composition can be administered by any appropriate route that results in effective treatment in the individual, e.g., administration results in delivery to a desired location in the individual where at least a portion of the composition delivered, e.g ., at least 1 c 10 4 cells, is delivered to the desired site for a period of time.
  • Modes of administration include injection, infusion, instillation, and the like.
  • injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracap sular, intraorbital, intracardiac, intradermal, intrap eritoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrastemal injection and infusion.
  • the route is intravenous.
  • administration by injection or infusion can be made.
  • the recombinant cells are administered systemically, in other words a population of recombinant cells are administered other than directly into a target site, tissue, or organ, such that it enters, instead, the individual’s circulatory system and, thus, is subject to metabolism and other like processes.
  • the efficacy of a treatment with a composition for the treatment of a disease or condition can be determined by the skilled clinician. However, one skilled in the art will appreciate that a treatment is considered effective treatment if any one or all of the signs or symptoms or markers of disease are improved or ameliorated. Efficacy can also be measured by failure of an individual to worsen as assessed by hospitalization or need for medical interventions (e.g, progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
  • Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting disease progression, e.g, arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g, causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.
  • a therapeutically effective amount includes an amount of a therapeutic composition that is sufficient to promote a particular effect when administered to an individual, such as one who has, is suspected of having, or is at risk for a disease.
  • an effective amount includes an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.
  • the efficacy of a treatment including a disclosed therapeutic composition for the treatment of disease can be determined by the skilled clinician.
  • Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; (2) relieving the disease, e.g, causing regression of symptoms; or (3) preventing or reducing the likelihood of the development of symptoms.
  • the individual is a mammal. In some embodiments, the mammal is human. In some embodiments, the individual has or is suspected of having a disease associated with inhibition of cell signaling mediated by a cell surface ligand or antigen.
  • the diseases suitable for being treated by the compositions and methods of the disclosure include, but are not limited to, cancers, autoimmune diseases, inflammatory diseases, and infectious diseases. In some embodiments, the disease is a cancer or a chronic infection.
  • the engineered CARs may be introduced into cells, e.g., T cells, using retroviruses, which efficiently and stably integrate a nucleic acid sequence encoding the chimeric antigen receptor into the target cell genome.
  • An exemplary method is described in Examples 4 and 7 below.
  • lentiviral transduction e.g., lentiviral transduction, transposon-based systems, direct RNA transfection, and CRISPR/Cas systems (e.g, type I, type II, or type III systems using a suitable Cas protein).
  • CRISPR/Cas systems e.g, type I, type II, or type III systems using a suitable Cas protein.
  • a recombinant adeno-associated virus (AAV) vector can be used for delivery.
  • Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from ( e.g ., not in) the rAAV genome, and helper virus functions.
  • the AAV rep and cap genes can be from any AAV serotype for which recombinant virus can be derived, and can be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13 and AAV rh.74. Production of pseudotyped rAAV is disclosed in, for example, international patent application publication number WO 01/83692.
  • the CAR-T cells once they have been expanded ex vivo in response to, for example, an autoimmune disease antigen, can be reinfused into the subject in a therapeutically effective amount.
  • the precise amount of CAR T cells to be administered can be determined by a physician with consideration of individual differences in age, weight, extent of disease and condition of the subject.
  • T cell therapies may be defined by number of total cells per infusion or number of cells per kilogram of body weight, especially for pediatric subjects (e.g., patients). As T cells replicate and expand after transfer, the administered cell dose may not resemble the final steady-state number of cells.
  • a pharmaceutical composition including the CAR T cells of the present disclosure may be administered at a dosage of 10 4 to 10 10 total cells.
  • a pharmaceutical composition including the CAR T cells of the present disclosure may be administered at a dosage of 10 3 to 10 8 cells/kg body weight, including all integer values within those ranges.
  • compositions including the CAR T cells of the present disclosure may also be administered multiple times at these dosages.
  • the cells can be administered by using infusion techniques that are known in the art (see, for example, Rosenberg et al, New Engl JMed , (1988) 319: 1676).
  • the optimal dosage and treatment regimen for a particular subject can be determined by one skilled in the art by monitoring the subject for signs of disease and adjusting the treatment accordingly.
  • the recombinant cells, and pharmaceutical compositions described herein can be administered in combination with one or more additional therapeutic agents such as, for example, chemotherapeutics or anti-cancer agents or anti-cancer therapies.
  • Administration “in combination with” one or more additional therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
  • the one or more additional therapeutic agents, chemotherapeutics, anti-cancer agents, or anti-cancer therapies is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery.
  • “Chemotherapy” and “anti-cancer agent” are used interchangeably herein.
  • Various classes of anti-cancer agents can be used.
  • Non-limiting examples include: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxin, antibodies (e.g. , monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone treatments, soluble receptors and other antineoplastics.
  • alkylating agents include: antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxin, antibodies (e.g. , monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone treatments, soluble receptors and other antineoplastics.
  • the methods of the disclosure include administration of a composition disclosed herein to a subject individually as a single therapy (e.g, monotherapy).
  • a composition of the disclosure is administered to a subject as a first therapy in combination with a second therapy.
  • the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery.
  • the first therapy and the second therapy are administered concomitantly.
  • the first therapy is administered at the same time as the second therapy.
  • the first therapy and the second therapy are administered sequentially.
  • the first therapy is administered before the second therapy.
  • the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and/or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in rotation. In some embodiments, the first therapy and the second therapy are administered together in a single formulation.
  • kits for modulating an activity of a cell include: (a) providing a recombinant cell of the disclosure, and (b) contacting it with a selected ligand, wherein binding of the selected ligand to the extracellular binding domain induces cleavage of a ligand-inducible proteolytic cleavage site and releases the transcriptional regulator, wherein the released transcriptional regulator modulates an activity of the recombinant cell.
  • a selected ligand wherein binding of the selected ligand to the extracellular binding domain induces cleavage of a ligand-inducible proteolytic cleavage site and releases the transcriptional regulator, wherein the released transcriptional regulator modulates an activity of the recombinant cell.
  • Activities of a cell that can be modulated using a method of the present disclosure include, but are not limited to, expression of a selected gene of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, dedifferentiation of the cell, migration of the cell, secretion of a molecule from the cell, cellular adhesion of the cell, and cytolytic activity of the cell.
  • the released transcriptional regulator modulates expression of a gene product of the cell. In some embodiments, the released transcriptional regulator modulates expression of a heterologous gene product in the cell.
  • a heterologous gene product is one that is not normally produced by the cell.
  • the cell can be genetically modified with a nucleic acid comprising a nucleotide sequence encoding the heterologous gene product.
  • the heterologous gene product is a secreted gene product.
  • the heterologous gene product is a cell surface gene product.
  • the heterologous gene product is a cytoplasmic gene product.
  • the released transcriptional regulator simultaneously modulates expression of two or more heterologous gene products in the cell.
  • the heterologous gene product in the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen derived protein, a proliferation inducer, a receptor, an RNA guided nuclease, a site-specific nuclease, a T cell receptor (TCR), a chimeric antigen receptor (CAR), a toxin, a toxin-derived protein, a transcriptional regulator, a transcriptional activator, a transcriptional repressor, a translation regulator, a translational activator, a translational repressor, an activating immuno-receptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T-cell receptor, an immuno-activator, an immuno
  • the released transcriptional regulator modulates differentiation of the cell, and wherein the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.
  • the chimeric receptors of the disclosure provide a higher degree of expression than a standard SynNotch receptor, when using identical binding domains and ICDs.
  • the SynRIPR of the disclosure can provide expression enhancement of about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% higher than a corresponding SynNotch receptor.
  • the chimeric receptors of the disclosure can provide transcriptional regulation that responds to the degree of T cell activation, independent of ligand binding. This permits additional flexibility in use, for example in cases where it is desired to enhance or suppress a T cell response when activated despite the absence of the chimeric receptor ligand.
  • kits including the chimeric polypeptides, SynRIPRs, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions provided and described herein as well as written instructions for making and using the same.
  • systems and/or kits that include one or more of: a chimeric polypeptide as described herein, a SynRIPR as described herein, a recombinant nucleic acids as described herein, a recombinant cell as described herein, or a pharmaceutical composition as described herein.
  • kits of the disclosure further include one or more syringes (including pre-filled syringes) and/or catheters (including pre-filled syringes) used to administer one any of the provided chimeric polypeptides, SynRIPRs, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions to an individual.
  • a kit can have one or more additional therapeutic agents that can be administered simultaneously or sequentially with the other kit components for a desired purpose, e.g ., for modulating an activity of a cell, inhibiting a target cancer cell, or treating a disease in an individual in need thereof.
  • any of the above-described systems and kits can further include one or more additional reagents, where such additional reagents can be selected from: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negative control polypeptides, positive control polypeptides, reagents for in vitro production of the chimeric receptor polypeptides.
  • additional reagents can be selected from: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negative control polypeptides, positive control polypeptides, reagents for in vitro production of the chimeric receptor polypeptides.
  • the components of a system or kit can be in separate containers. In some other embodiments, the components of a system or kit can be combined in a single container.
  • a system or kit can further include instructions for using the components of the kit to practice the methods.
  • the instructions for practicing the methods are generally recorded on a suitable recording medium.
  • the instructions can be printed on a substrate, such as paper or plastic, and the like.
  • the instructions can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging), and the like.
  • the instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g ., CD- ROM, diskette, flash drive, and the like.
  • the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g, via the internet), can be provided.
  • An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.
  • This Example describes the design and construction of a family of non-Notch regulated intramembrane proteolysis receptors (SynRIPRs) receptors.
  • Receptors were built by fusing the CD19 scFV (Porter et al., 2011) to an extracellular domain comprised of a truncated CD8a (P01732) hinge region (Thrl38 to Cysl64; SEQ ID NO: 158), a transmembrane domain (TMD) and intracellular juxtamembrane domain (STS as indicated below), and a transcriptional regulator.
  • the transcriptional regulator GAL4-VP64 used in these experiments contained a DNA domain from yeast GAL4 transcription factor fused to an activation domain VP64, which consists of a tetrameric repeat of the minimal activation domain (amino acids 437-447) of the herpes simplex protein VP 16.
  • All receptors contain an N-terminal CD8a signal peptide
  • DNA fragments coding for the amino acid sequences provided in the Sequence Listing were PCR amplified from synthesized gene fragments or plasmids containing DNA sequence for the indicated protein, and assembled using standard cloning techniques (e.g ., overhang PCR, fusion PCR, and In-fusion cloning) with flanking translation start and stop sequences, into a modified pHR’SIN:CSW vector (K.T. Roybal et al., Cell (2016) 167(2):419-32) containing a 3-phosphoglycerate kinase (PGK) promoter for all primary T cell experiments described below.
  • PGK 3-phosphoglycerate kinase
  • the pHR’SIN:CSW vector was also modified to produce the response element plasmids.
  • five copies of a target sequence for binding of GAL4 DBD domain (GGAGCACTGTCCTCCGAACG; SEQ ID NO: 164) were cloned 5' to a minimal synthetic pybTATA promoter.
  • a PGK promoter that either constitutively drives expression of a fluorophore (mCitrine or mCherry) to suitably identify transduced T cells or a SynRIPR for single vector experimentation.
  • a fluorophore mCitrine or mCherry
  • the CARs were tagged N-terminally with Flag-tag and were co induced with GFP using a T2A element. All induced elements were cloned via a BamHl site in the multiple cloning located 3’ to the Gal4 response elements. All constructs were cloned via In- Fusion® cloning (Takara # 638951) according to the manufacturer’s instructions.
  • This Example describes the isolation and culture of primary human T cells that were subsequently used in various cell transduction experiments described in Example 3 below.
  • primary CD4 + and CD8 + T cells were isolated from anonymous donor blood after apheresis and enriched by negative selection using human T-cell isolation kits (human CD4 + or CD8 + enrichment cocktail; STEMCELL Technologies Cat #15062 and 15063). Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board. T cells were cryopreserved in growth medium (RPMI- 1640, UCSF cell culture core) with 20% human AB serum (Valley Biomedical Inc., #HP1022) and 10% DMSO.
  • T cells were cultured in human T cell medium containing X- VIVOTM 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L- Cysteine (Sigma-Aldrich #A9165) supplemented with 30 units/mL IL-2 (NCI BRB Preclinical Repository) for all experiments.
  • Human T cells were stably transduced with lentiviral vectors
  • the Example describes a general protocol used for lentiviral transduction of human T cells.
  • VSV-G vesicular stomatitis virus envelope G protein
  • pantropic vectors lentiviral vectors pseudo-typed with vesicular stomatitis virus envelope G protein (VSV-G) (pantropic vectors) were produced via transfection of Lenti-XTM 293T cells (Clontech #1113 ID) with a pHR’ SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus TransIT®-Lenti (Mirus, #M1R 6606).
  • VSV-G vesicular stomatitis virus envelope G protein
  • T cells were thawed the same day and, after 24 hours in culture, were stimulated with beads having anti-CD3 and anti-CD28 antibodies bound to the surface (Human T-Activator CD3/CD28 Dynabeads®, Life Technologies #1113 ID) at a 1 :3 celkbead ratio.
  • beads having anti-CD3 and anti-CD28 antibodies bound to the surface (Human T-Activator CD3/CD28 Dynabeads®, Life Technologies #1113 ID) at a 1 :3 celkbead ratio.
  • viral supernatant was harvested and the primary T cells were exposed to the virus for 24 hours.
  • the beads were removed, and the T cells expanded until Day 14 when they were rested and could be used in assays.
  • T cells were sorted for assays with a Beckton Dickinson (BD Biosciences) FACSAriaTM II flow cytometer. Sorted T-cells were expanded until Day 10 for in vivo assays and until Day 14 for in vitro assays
  • This Example describes the generation of myelogenous leukemia “sender” cells expressing CD 19 at equivalent levels as Daudi tumors.
  • the cancer cell lines used were K562 myelogenous leukemia cells (ATCC #CCL-243) and Daudi B cell lymphoblasts (ATCC #CCL-213).
  • the K562 cells were lentivirally transduced to stably express human CD 19 at equivalent levels as Daudi tumors.
  • CD 19 levels were determined by staining the cells with a-CD19 APC (Biolegend ® #302212). All cell lines were sorted for expression of the transgenes.
  • This Example describes the generation of reporter Jurkat T cells that were subsequent used for the screening of various synthetic receptors containing non-Notch transmembrane domains (TMD) and/or stop-transfer sequences (STS).
  • TMD non-Notch transmembrane domains
  • STS stop-transfer sequences
  • E6-1 Jurkat T cells (ATCC# TIB-152) were lentivirally transduced with a reporter plasmid carrying an inducible Gal4-driven BFP reporter gene and a constitutive expressed mCitrine reporter gene, as described previously (K.T. Roybal et al., Cell, 164:1-10, 2016). Reporter-positive Jurkat cells were sorted for mCitrine positive expression using a Beckton Dickinson (BD Biosciences) FACSAriaTM II flow cytometer and expanded. [0189] Lentiviral particles were produced with the receptor transgene expression vector as described previously (L. Morsut et al., Cell (2016) 164:780-91).
  • the reference receptor was an optimized CD8a Notch receptor (HingeNotch) composed of a truncated CD8a extracellular domain (ECD), a transmembrane domain (TMD) of human Notchl, and a C-terminal juxtamembrane domain (JMD/STS) from Notchl.
  • ECD truncated CD8a extracellular domain
  • TMD transmembrane domain
  • JMD/STS C-terminal juxtamembrane domain
  • This Example describes experiments performed to illustrate that synthetic receptors can be assembled in a modular fashion by combining a ligand binding domain, an ECD, a TMD, a JMD, and a transcription factor.
  • this CD8a Hinge ECD was combined with the anti-CD 19 scFV, a variety of high-performing TMDs from previous screening, the Notchl JMD, and transcriptional regulator Gal4VP64.
  • T cells expressing these receptors were co-incubated with CD 19+ sender K562 cells for 48 hours and production of a BFP reporter was measured using flow cytometry.
  • the Notchl TMD and two TMD mutants were selected due to their low levels of ligand-independent signaling.
  • the optimized CD8a Hinge ECD was paired with the anti-CD 19 scFV, the Notchl TMD, a variety of JMDs, and transcriptional regulator Gal4VP64.
  • T cells expressing these receptors were co-incubated with CD 19+ sender K562 cells and production of a BFP reporter was measured using flow cytometry.
  • the Notchl, NRGl, and Notch2 JMDs were selected due to their variable output production levels allowing for signal tuning.
  • T cells expressing high-performing “SynRIPR BFP expression” circuits were co-incubated with sender cells for 48 hours. BFP output was measured using flow cytometry.
  • the experiments described herein illustrate that synthetic regulated intramembrane proteolysis receptor scaffolds suitable for clinical translation can be designed and assembled by choosing an ECD, TMD, and JMD for further testing.
  • Exemplary design criteria included robust expression, high ligand-dependent activation, and low ligand-independent activation under both basal and activated T cell conditions.
  • AAV Adeno- Associated Virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2022/021352 2021-03-23 2022-03-22 Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation Ceased WO2022204151A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US18/552,141 US20240181057A1 (en) 2021-03-23 2022-03-22 Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation
EP22776476.8A EP4314038A4 (en) 2021-03-23 2022-03-22 SYNTHETIC INTERMEMBRANE PROTEOLYSIS RECEPTORS FOR PERSONALIZED ANTIGEN-INDUCED TRANSCRIPTION REGULATION
AU2022244245A AU2022244245A1 (en) 2021-03-23 2022-03-22 Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation
CA3213044A CA3213044A1 (en) 2021-03-23 2022-03-22 Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation
JP2023558552A JP2024512573A (ja) 2021-03-23 2022-03-22 カスタム抗原誘導性転写制御のための合成膜間タンパク質分解受容体
CN202280032798.0A CN117255799A (zh) 2021-03-23 2022-03-22 用于定制抗原诱导的转录调控的合成膜间蛋白水解受体

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163164995P 2021-03-23 2021-03-23
US63/164,995 2021-03-23

Publications (1)

Publication Number Publication Date
WO2022204151A1 true WO2022204151A1 (en) 2022-09-29

Family

ID=83397827

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/021352 Ceased WO2022204151A1 (en) 2021-03-23 2022-03-22 Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation

Country Status (7)

Country Link
US (1) US20240181057A1 (cg-RX-API-DMAC7.html)
EP (1) EP4314038A4 (cg-RX-API-DMAC7.html)
JP (1) JP2024512573A (cg-RX-API-DMAC7.html)
CN (1) CN117255799A (cg-RX-API-DMAC7.html)
AU (1) AU2022244245A1 (cg-RX-API-DMAC7.html)
CA (1) CA3213044A1 (cg-RX-API-DMAC7.html)
WO (1) WO2022204151A1 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024140778A1 (zh) * 2022-12-27 2024-07-04 科济生物医药(上海)有限公司 Nkg2d工程化细胞及其组合物
WO2024226827A3 (en) * 2023-04-25 2025-01-09 Arsenal Biosciences, Inc. Novel receptors for transcription regulation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020199218A1 (en) * 1999-08-19 2002-12-26 Daphne Goring Proline-rich extensin-like receptor kinases
US20180346543A1 (en) * 2016-01-11 2018-12-06 The Board Of Trustees Of The Leland Stanford Junior University Chimeric Proteins and Methods of Immunotherapy
US20190202918A1 (en) * 2016-08-23 2019-07-04 The Regents Of The University Of California Proteolytically cleavable chimeric polypeptides and methods of use thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102624023B1 (ko) * 2015-02-24 2024-01-11 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 결합-촉발된 전사 스위치 및 이들의 이용 방법
US12410417B2 (en) * 2016-10-24 2025-09-09 Northwestern University Modular extracellular sensor architecture for regulating genes
WO2019164979A1 (en) * 2018-02-21 2019-08-29 Cell Design Labs, Inc. Chimeric transmembrane receptors and uses thereof
WO2020014270A1 (en) * 2018-07-10 2020-01-16 The Regents Of The University Of California Biomolecule coated particles and films and uses thereof
CN114728174A (zh) * 2019-09-24 2022-07-08 加利福尼亚大学董事会 具有异源跨膜结构域的受体
AU2020355031A1 (en) * 2019-09-24 2022-05-19 The Regents Of The University Of California Notch receptors with hinge domain

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020199218A1 (en) * 1999-08-19 2002-12-26 Daphne Goring Proline-rich extensin-like receptor kinases
US20180346543A1 (en) * 2016-01-11 2018-12-06 The Board Of Trustees Of The Leland Stanford Junior University Chimeric Proteins and Methods of Immunotherapy
US20190202918A1 (en) * 2016-08-23 2019-07-04 The Regents Of The University Of California Proteolytically cleavable chimeric polypeptides and methods of use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP4314038A4 *
SEKI ET AL.: "Human ROBO1 is cleaved by metalloproteinases and gamma-secretase and migrates to the nucleus in cancer cells", FEBS LETT., vol. 584, no. 13, 2 July 2010 (2010-07-02), pages 2909 - 2915, XP071251771 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024140778A1 (zh) * 2022-12-27 2024-07-04 科济生物医药(上海)有限公司 Nkg2d工程化细胞及其组合物
WO2024226827A3 (en) * 2023-04-25 2025-01-09 Arsenal Biosciences, Inc. Novel receptors for transcription regulation

Also Published As

Publication number Publication date
CN117255799A (zh) 2023-12-19
EP4314038A1 (en) 2024-02-07
US20240181057A1 (en) 2024-06-06
CA3213044A1 (en) 2022-09-29
AU2022244245A1 (en) 2023-10-05
EP4314038A4 (en) 2025-01-29
JP2024512573A (ja) 2024-03-19

Similar Documents

Publication Publication Date Title
US11617766B2 (en) Notch receptors with hinge domain
US20220372101A1 (en) Novel receptors having a heterologous stop transfer sequence for ligand-dependent transcriptional regulation
US20220348677A1 (en) Receptors with heterologous transmembrane domain
CA3213189A1 (en) Hybrid receptors with multiple transcriptional regulators
US20240181057A1 (en) Synthetic intermembrane proteolysis receptors for custom antigen-induced transcriptional regulation
US20220340637A1 (en) Notch receptors with minimal linker
US20230174612A1 (en) Notch receptors with zinc finger-containing transcriptional effector
US20220356225A1 (en) Notch receptors with zinc finger-containing transcriptional effector
US20240262882A1 (en) Novel receptors for ligand-dependent transcriptional regulation
US20240299545A1 (en) Hybrid receptors with multiple transcriptional regulators
US20220348628A1 (en) Novel receptors having a fibronectin repeat for ligand-dependent transcriptional regulation
EA047690B1 (ru) Рецепторы notch с шарнирным доменом

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22776476

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022244245

Country of ref document: AU

Ref document number: AU2022244245

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 3213044

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023558552

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2022244245

Country of ref document: AU

Date of ref document: 20220322

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022776476

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 202280032798.0

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2022776476

Country of ref document: EP

Effective date: 20231023