WO2022189775A1 - Peptide citrulliné ou analogque glutamine pour utilisation dans la prévention ou le traitement de la polyarthrite rheumatoïde - Google Patents

Peptide citrulliné ou analogque glutamine pour utilisation dans la prévention ou le traitement de la polyarthrite rheumatoïde Download PDF

Info

Publication number
WO2022189775A1
WO2022189775A1 PCT/GB2022/050593 GB2022050593W WO2022189775A1 WO 2022189775 A1 WO2022189775 A1 WO 2022189775A1 GB 2022050593 W GB2022050593 W GB 2022050593W WO 2022189775 A1 WO2022189775 A1 WO 2022189775A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
seq
peptides
sequence
amino acids
Prior art date
Application number
PCT/GB2022/050593
Other languages
English (en)
Inventor
Bhargavi DUVVURI
Derek Allan HAALAND
Margaret Jean LARCHÉ
Mark LARCHÉ
Elena Tonti
Original Assignee
Adiga Life Sciences Inc.
Avidity Ip Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Adiga Life Sciences Inc., Avidity Ip Limited filed Critical Adiga Life Sciences Inc.
Publication of WO2022189775A1 publication Critical patent/WO2022189775A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/36—Blood coagulation or fibrinolysis factors
    • A61K38/363—Fibrinogen
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0008—Antigens related to auto-immune diseases; Preparations to induce self-tolerance
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/577—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 tolerising response

Definitions

  • RA rheumatoid arthritis
  • NSAIDs nonsteroidal anti-inflammatory drugs
  • DMARDs disease-modifying anti-rheumatic drugs
  • methotrexate leflunomide
  • sulfasalazine hydroxychloroquine
  • steroid hormones and the like.
  • these therapeutic agents cause serious side effects if taken for a long time.
  • the new peptides include SEQ ID NO’s 1 to 65 and their functional analogues, and within that group there is a preferred population of peptides that include SEQ ID NO’s 1 to 29 and their functional homologues.
  • the invention also provides mimics of the citrullinated peptides in which glutamine replaces citrulline (termed glutamine analogue peptides herein). These include SEQ ID NO’s 75 to 139, and the preferred population of SEQ ID NO’s 75 to 103 and their functional homologues. A specific in silico screening method as well as choice of patients to be studied assisted in identifying this new class of peptides.
  • the new peptides avoid many of the side effects and problems that occur with long term use of the existing therapies.
  • the peptides are also particularly suited for the groups of patients that are most vulnerable to RA, for example due to their HLA types.
  • different peptides of the invention are used together as a ‘panel’ or ‘mix’, there is the further technical advantage that they target the breadth of the damaging T cell response that occurs in RA.
  • the invention provides therapeutic peptides and nucleic acids for immunotherapy of RA, which in particular are able to cause a beneficial immune tolerization which targets damaging T cell responses.
  • One advantage of the invention over existing therapies for RA is that it is “curative”, whereas this is not the case with the existing therapies listed above, except in rare cases where early disease is treated with anti-TNF biologics which can apparently lead to long-term remission.
  • the invention includes a citrullinated peptide for use in preventing or treating rheumatoid arthritis by tolerization in an individual, wherein said peptide comprises sequence that can bind HLA-DRA/HLA- DRB1, is 9 to 30 amino acids in length and wherein said peptide: (i) has or comprises the sequence of any of SEQ ID NO’s 1 to 65; and/or (ii) comprises a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 65.
  • the invention includes a glutamine analogue peptide for use in preventing or treating rheumatoid arthritis by tolerization in an individual, wherein said peptide comprises sequence that can bind HLA- DRA/HLA-DRB1, is 9 to 30 amino acids in length and wherein said peptide: (i) has or comprises the sequence of any of SEQ ID NO’s 75 to 139; and/or (ii) comprises a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 75 to 139.
  • the invention also provides a nucleic acid for use in preventing or treating rheumatoid arthritis by tolerization in an individual, wherein said nucleic acid leads to generation of a citrullinated peptide or glutamine analogue in the individual and said generated peptide causes said tolerization, wherein: (i) said peptide is a citrullinated or glutamine analogue peptide as defined above; and/or (ii) said peptide comprises the sequences of at least 2 to 8 different citrullinated or glutamine analogue peptides defined above.
  • the invention further provides an in vitro method of determining whether an individual has or is at risk of rheumatoid arthritis, the method comprising testing whether the individual has T cells which respond to a peptide as defined above, thereby determining whether the individual has or is at risk of the condition.
  • Figure 1 shows an example of how citrullination may occur, and this is a preferred method of citrullination for the invention, in particular for aspects where a peptide is generated in vivo by nucleic acids of the invention.
  • Figure 2 shows proteins from which preferred peptides of the invention may be derived. These were studied for the present work.
  • Figure 3 shows in silico epitope prediction.
  • TEPITOPE Shared Epitope
  • Net-MHC Net-MHC
  • Figure 4 shows the results of in silico prediction, providing 96 potential peptides to be evaluated in in vivo systems.
  • Figure 5 shows results of in vivo testing of citrullinated peptides.41 candidate peptides, predicted (based on their glutamine surrogates) to bind to DRB1*0401, were investigated in DRB1*0401 transgenic (DR4 tg) mice for induction of CD4+ T cell responses.60 nmol ( ⁇ 100ug) citrullinated peptide in Complete Freund’s Adjuvant (CFA) was administered subcutaneously in 100 ul to DR4 tg mice (expressing the human antigen-binding domains of HLA-DRA and HLA-DRB1*0401).
  • CFA Complete Freund’s
  • CFA Adjuvant
  • IFN ⁇ ELISPOT was carried out using splenocytes from the mice.
  • 41 candidate peptides 5 had synthesis issues, 3 had solubility issues, 33 were tested with 21 being unresponsive and 12 being positive.
  • Each dot indicates a mouse.
  • Figure 6 shows that the T cell response in the in vivo work is specific for the citrullinated form of the peptide.
  • Figure 7 shows further in vivo work, and that subcutaneous Immunization with citrullinated peptides induces T and B cell responses but not signs of arthritis.
  • mice were primed at day zero with citrullinated peptide mixtures: 60 nmol/each peptide + CFA in 100ul subcutaneously; the first peptide mixture (MIX#1) was administered in the right inner thigh; the second peptide mixture (MIX#2) was administered in the left inner thigh.
  • the peptide composition of each mixture is shown in Figure 7a.
  • Boost was at 60 days with citrullinated peptide mixtures: 60 nmol/each peptide + IFA in 100ul subcutaneously; MIX#1 – Right base of tail; MIX#2 – Left base of tail.
  • B cell responses are represented by the presence of anti-citrullinated protein antibodies (ACPAs), detected in the murine blood by ELISA.
  • Figure 8 shows the experimental design of in vivo testing where there is clinical manifestation of arthritis in DR4-transgenic mice immunized with citrullinated T cell epitopes and boosted with intra-articular injection. All immunizations were performed in complete (for the priming injection, CFA) or incomplete (for the subsequent boosts, IFA) Freund’s adjuvant.
  • mice were primed with citrullinated peptide mixtures: 60 nmol/each peptide + CFA in 100ul subcutaneously; MIX#1 – Right inner thigh; MIX#2 – Left inner thigh. The mice were boosted after 3 weeks: Citrullinated peptide mixtures; 60 nmol/each peptide + IFA in 100ul subcutaneously; MIX#1 – Right base of tail; MIX#2 – Left base of tail.
  • FIG. 11 shows the arthritis severity score from the work described in Figure 8.
  • the vertical axis shows the average arthritis score.
  • Figures 13 and 14 show results from ex-vivo testing of the 96 candidate citrullinated peptides on PBMC from RA patients ( Figure 13) or healthy controls ( Figure 14).
  • the 96 candidate peptides identified in the in silico analysis were divided in 23 groups of up to 4 peptides (based on solubility, protein of origin, affinity and binding characteristics) and screened as mixtures for T cells responses using an IFN ⁇ ELISPOT assay. Table 3 shows the results of this step.
  • Results were considered positive (open circles) if the number of spots in the assay was at least 2 times the media alone. Each circle indicates a subject.
  • a subject was considered SE+ if the HLA DNA typing showed the presence of at least one of the following SE alleles: DRB1*- 01:01, 01:02, 01:05 - 04:01, 04:04, 04:05, 04:08, 04:09, 04:10, 04:13, 04:16, 04:19, 04:21 - 10:01 - 14:02, 14:06, 14:09, 14:13, 14:17, 14:19, 14:20, 14:21.
  • SEQ ID NO’s 1 to 65 and 75 to 139 Specific preferred peptides of the invention are defined by SEQ ID NO’s 1 to 65 and 75 to 139. In some of the tables provided herein there are numbered rows. However the numbered rows are not intended to correspond to the SEQ ID NO’s.
  • Table 1 shows SEQ ID NO’s 1 to 65 and their properties. The number indicated in the boxes for the human experiments shows the number of positive subjects. The HLA binding results show the results from the in silico work.
  • Table 2 shows SEQ IDNO’s 1 to 29 and their properties and this shows much of the data again of table 1.
  • Group 1 corresponds to: more than 3 subjects (RA SE+/- or HC SE+) are positive or mouse positivity + 1 human positive subject or peptide is used in the RA mouse model.
  • Group 2 corresponds to: at least 1 subject (RA SE+ or HC SE+) is positive or mouse positivity with no human positive subjects.
  • Table 3 shows the results from the ex-vivo screening of the 96 candidate peptides identified in the in- silico analysis. The 96 peptides were divided in 23 groups of up to 4 peptides (based on solubility, protein of origin, affinity and binding characteristics) and screened as mixtures for T cells responses using an IFN ⁇ ELISPOT assay. Peptide mixtures were considered to give a positive response (green boxes) if the number of spots was more than 2x media alone average.
  • the first set of columns shows the results in RA subjects expressing a shared epitope (SE) allele
  • the types of subjects for subsequent columns (Table 3b) are shown in the box above the columns.
  • Table 4 shows the types of HLA shared epitope alleles of the recruited study population.
  • Description of SEQ ID NO’s SEQ ID NO’s 1 to 65 provide the sequences of citrullinated peptides of the invention.
  • SEQ ID NO: 66 provides the coding sequence for human fibrinogen alpha chain (FGA).
  • SEQ ID NO: 67 provides the coding sequence for human fibrinogen beta chain (FGB).
  • SEQ ID NO: 68 provides the coding sequence for human fibrinogen gamma chain (FGG).
  • SEQ ID NO: 69 provides the coding sequence for human vimentin (VIM).
  • SEQ ID NO: 70 provides the coding sequence for human aggrecan (ACAN).
  • SEQ ID NO: 71 provides the coding sequence for human serpin family C member 1 (SERPINC1).
  • SEQ ID NO: 72 provides the coding sequence for human H4 clustered histone 15 (H4C15).
  • SEQ ID NO: 73 provides the coding sequence for human chitinase 3 like 1 (CHI3L1).
  • SEQ ID NO: 74 provides the coding sequence for human collagen type I alpha 1 chain (COL1A1).
  • SEQ ID NO’s 75 to 139 provide the sequences of the glutamine analogue peptides of the invention.
  • HLA molecules will be understood to encompass equivalent MHC molecules in non- human species, for example when the invention is being applied to therapy and diagnosis of non- humans.
  • References to ‘T cells’ will generally be understood as a T cell that is responsible for a deleterious effect in RA, for example as part of the mechanism of causing RA.
  • Such a T cell may be a CD4 T cell and/or may recognise a protein relevant to RA (for example as disclosed herein) and/or may recognise a peptide of the invention and/or may be tolerized by a peptide of the invention.
  • references to the peptide population of SEQ ID NO’s 1 to 65 may be replaced with references to any other group of peptides mentioned herein, preferably the population defined by SEQ ID NO’s 1 to 29. It is to be understood that any aspect of the invention can be defined with reference to any of the following preferred SEQ ID NO’s: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29. It is to be understood that references to the peptide population of SEQ ID NO’s 75 to 139 may be replaced with references to any other group of peptides mentioned herein, preferably the population defined by SEQ ID NO’s 75 to 103.
  • any aspect of the invention can be defined with reference to any of the following preferred SEQ ID NO’s: 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102 or 103.
  • SEQ ID NO’s 75 to 139 have the same sequence as SEQ ID NO’s 1 to 65 respectively, apart from replacement of the citrulline with glutamine.
  • References to peptides of the invention include peptides defined by SEQ ID NO’s and those which are defined as having some level of sequence identity to SEQ ID NO’s.
  • nucleic acids of the invention define a further set of peptides which can be expressed in vivo. These preferably comprise one or more sequences of the peptides of the invention in a longer peptide, for example a string of epitopes. Thus the length restrictions mentioned herein for the peptides of the invention will not always apply to the peptides generated by the nucleic acids of the invention.
  • nucleic acids of the invention are preferably citrullinated
  • the peptides that are encoded by the nucleic acids for such citrullinated peptides may be an equivalent form made of the standard unmodified amino acids, and typically has the same sequence as a citrullinated peptide of the invention apart from replacement of the citrulline with another amino acid that can be modified/changed to citrulline, such as glutamine or arginine.
  • References to defined ‘groups’ of peptides can be understood with reference to any embodiment of the invention, and therefore any defined group of peptides can be used in any manner discussed herein, including being generated together by nucleic acids of the invention.
  • the groups of peptides may be together in the same composition or they may be together in the form of different compositions, for example in a kit. They may be administered to an individual together or separately. References to any level of sequence identity (such as at least 70% identity) may be replaced with any other level of identity, preferably a higher level of sequency identity, for example at least 80%, 90% or 95%. It may also be replaced with a reference to a specific number of amino acid differences between the sequences, preferably with ‘less than 3, 5, 8, 10 modifications which can each be substitutions, additions or deletions’.
  • contiguous amino acids has a specialist meaning in this specification where this sequence can have certain defined properties, such as being an epitope and/or binding an HLA molecule and/or being recognised by a T cell.
  • first peptide such as one defined by a SEQ ID NO
  • second peptide such as a functional analogue
  • the second peptide preferably has a sequence which relates to the contiguous peptide sequence by level of identify and/or activity (such as binding the same HLA molecule and/or being recognised by the same T cell).
  • the contiguous amino acids in the first peptide and the equivalent sequence in the second peptide tolerize the same T cell response in RA (for example a deleterious T cell response).
  • the contiguous amino acids in the first peptide and the equivalent sequence in the second peptide comprise at least one citrulline.
  • the contiguous amino acids in the first peptide and the equivalent sequence in the second peptide comprise at least one glutamine. References to ‘different peptides’ can be interpreted in the usual sense of there being at least one difference in amino acid between the two or more peptides this applies to.
  • each peptide might have less than 50% sequence identity with all other peptides in the group, such as less than 40%, 30% or 20% identity.
  • sequence identity For aspects of the invention relating to nucleic acids it is to be understood that where specific coding sequences are mentioned and the DNA sequence is given, then this sequence is to be understood as relating to the equivalent RNA sequence in as far as it applies to the RNA aspects of the invention, including where mRNA is provided in vivo or administered to the individual.
  • any specific DNA sequence disclosed herein is understood as relating to the equivalent nucleic acid based on a different codon set for aspects of the invention where a different codon set is used (for example where a codon encodes citrulline).
  • Relevant Immunology T cells recognise antigen in the form of short peptides bound to molecules encoded by the genes of the Major Histocompatibility Complex (MHC). These gene products are the same molecules that give rise to "tissue types" used in transplantation and are also referred to as Human Leukocyte Antigen molecules (HLAs) which terms may be used interchangeably. Individual MHC molecules possess peptide binding grooves which, due to their shape and charge are only capable of binding a limited group of peptides.
  • MHC Major Histocompatibility Complex
  • the peptides bound by one MHC molecule may not necessarily be bound by other MHC molecules.
  • a protein molecule such as an antigen or allergen is taken up by antigen presenting cells such as B lymphocytes, dendritic cells, monocytes and macrophages
  • the molecule is enzymatically degraded within the cell. The process of degradation gives rise to peptide fragments of the molecule which, if they are of the appropriate size, charge and shape, may then bind within the peptide binding groove of certain MHC molecules and be subsequently displayed upon the surface of antigen presenting cells.
  • the HLA class II molecules which the peptide of the invention binds is generally composed of two chains; a monomorphic alpha (A) chain, and the polymorphic beta (B) chain.
  • the peptide binding groove is a product of both chains.
  • the peptides of the invention may be defined by comprising sequences that bind particular HLA molecules and/or possession of particular T cell epitopes and/or by ability to tolerize against a specific T cell response.
  • the peptides of the invention have a length that allows them to induce an appropriate tolerizing response. If the peptides are too large, or if the whole antigen is introduced into an individual, there is the risk of inducing adverse reactions.
  • the peptides of the invention have been selected to retain T cell specificity whilst being small enough in size to not possess significant tertiary structure that would cause deleterious effects. Such structure could for example enable them to retain the conformation of an IgG or IgA binding epitope of the whole molecule.
  • the peptides of the invention therefore do not induce significant crosslinking of adjacent specific IgG or IgA molecules bound to Fc receptors on the surface of relevant cells. Such crosslinking could trigger a pro-inflammatory signal in the cell, for example in an antigen presenting cell.
  • Definitions of the Peptide of the Invention The invention provides a citrullinated peptide as defined by any of SEQ ID NO’s 1 to 65 and also analogues of the peptide, which preferably have the same tolerization activity as the original peptide of which it is an analogue.
  • the invention provides a glutamine analogue peptide as defined by any of SEQ ID NO’s 75 to 139 and also analogues of the peptide, which preferably have the same tolerization activity as the original peptide of which it is an analogue.
  • the peptide of the invention is typically 9 to 30 amino acids in length.
  • the peptide may be used in therapy of RA, preferably by tolerization, where such tolerization is typically of a T cell that recognises the peptide.
  • the peptide may bind a MHC class II molecule, such as HLA-DRA/HLA-DRB1.
  • the peptide may comprise a sequence which has the same function or activity as a sequence within any of SEQ ID NO’s 1 to 65 or SEQ ID NO’s 75 to 139, such as a MHC molecule binding activity and/or a tolerizing activity and/or recognition by a T cell.
  • a sequence may be the ‘contiguous amino acids’ mentioned herein, and may be the same as or similar to a stretch of amino acids in any of SEQ ID NO’s 1 to 65 or SEQ ID NO’s 75 to 139, for example to at least a length of 9, 10, 11, 12 contiguous amino acids in any of SEQ ID NO’s 1 to 65 or SEQ ID NO’s 75 to 139.
  • a peptide of the invention comprises a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 65 or SEQ ID NO’s 75 to 139.
  • a peptide of the invention comprises a sequence of 9 contiguous amino acids that differs from any of SEQ ID NO’s 1 to 65 or SEQ ID NO’s 75 to 139 by 1, 2, 3 or 4 amino acids.
  • the contiguous amino acids may retain the amino acids which are anchor points for binding to a MHC class II molecule (such as any such molecule mentioned herein), and such anchor point amino acids are preferably citrulline.
  • the invention includes a citrullinated peptide for use in preventing or treating rheumatoid arthritis by tolerization in an individual, wherein said peptide has a length of 9 to 30 amino acids and comprises the sequence of any of SEQ ID NO’s 1 to 65.
  • the invention also provides a glutamine analogue peptide for use in preventing or treating rheumatoid arthritis by tolerization in an individual, wherein said peptide has a length of 9 to 30 amino acids and comprises the sequence of any of SEQ ID NO’s 75 to 139.
  • One Type of Peptide Group The peptides of the invention are being defined based on SEQ ID NO’s 1 to 65 or SEQ ID NO’s 75 to 139.
  • Preferred peptides are those which are defined by SEQ ID NO’s 1 to 29 and functional analogues of these SEQ ID NO’s.
  • Other groups include: SEQ ID NO’s 1 to 10; SEQ ID NO’s 11 to 20; SEQ ID NO’s 21 to 30; SEQ ID NO’s 31 to 40; SEQ ID NO’s 41 to 50; and SEQ ID NO’s 51 to 65.
  • Preferred groups include SEQ ID NO’s 1 to 5; SEQ ID NO’s 6 to 10; SEQ ID NO’s 11 to 15; SEQ ID NO’s 16 to 20; SEQ ID NO’s 21 to 25; and SEQ ID NO’s 26 to 29.
  • the peptides of the invention are advantageous in that upon administration to an individual they are presented to T cells in a quiescent manner causing tolerization of the T cells. Preferably the peptides are administered in an appropriate dosage and by a route that assists tolerization, for example in a manner that cause systemic distribution of the peptide.
  • the peptides of the invention will generally comprise sequence that binds to at least one type of HLA Class II molecule.
  • the peptide of the invention preferably comprises a sequence that binds to a HLA molecule whose HLA- DR ⁇ chain comprises the “shared epitope” (SE) five amino acid sequence motif, preferably in positions 70–74 of the HLA-DR ⁇ chain.
  • SE shared epitope
  • the peptides may bind to MHC molecules with any of the following HLA-DRB1 chains (shown with the corresponding SE motif): *0401: Q-K-RAA *1303: D-K-RAA *0101, *0102, *0404, *0405, *0408: Q-R-RAA *1001, *1402, *1406: R-R-RAA *1501, *1502, *1503: Q-A-RAA *0103, *0402, *1102, *1103, *1301, *1302: D-E-RAA *1202, *16: D-R-RAA
  • One advantage in using a panel of peptides is the different peptides will bind different HLA molecules.
  • the peptides of the invention preferably comprise sequence that binds to at least on HLA Class II molecule present in the individual to be treated, for example HLA-DRB1 or any other HLA molecule mentioned herein.
  • the peptides of the invention preferably comprise sequence which is recognised by a T cell, for example a T cell that: - recognises a peptide as defined by any one of SEQ ID NO’s 1 to 65; and/or - causes a deleterious immune response in RA.
  • the peptides of the invention preferably comprise sequence which is recognised by a T cell that: - recognises a peptide as defined by any one of SEQ ID NO’s 75 to 139; and/or - causes a deleterious immune response in RA.
  • the peptide of the invention is preferably 9 to 30 amino acids in length. It may have a length of 9 to 20 or 13 to 17 amino acids in length
  • the peptide may have the sequence of any of SEQ ID NO’s 1 to 65 and/or may be functional analogue of such a peptide.
  • the peptide may have the sequence of any of SEQ ID NO’s 75 to 139 and/or may be functional analogue of such a peptide.
  • the functional analogue may have any property of the specific peptide of which is it is an analogue, including for example being able to bind the same HLA molecule and/or T cell.
  • a peptide of the invention may comprise a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 65. These contiguous amino acids may represent or comprise a MHC binding peptide and/or a T cell epitope.
  • the peptide of the invention may comprise or have the sequence of any of SEQ ID NO’s 1 to 29; and/or may comprise or have a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 29.
  • a peptide of the invention may comprise a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 75 to 139.
  • These contiguous amino acids may represent or comprise a MHC binding peptide and/or a T cell epitope.
  • the peptide of the invention may comprise or have the sequence of any of SEQ ID NO’s 75 to 103; and/or may comprise or have a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 103.
  • These contiguous amino acids may have a length of at least 9, 10, 11, 12, 13, 14, 15, 16, 20, 24, 26 or 28 amino acids.
  • the contiguous amino acids of the peptide being defined by SEQ ID NO may bind to HLA- DRB1 or any other MHC class II molecule, for example as mentioned herein.
  • the contiguous amino acids of the peptide being defined by sequence identity may bind to HLA-DRB1 or any other MHC class II molecule, for example as mentioned herein, such as the same HLA class II molecule as for the peptide being defined with a SEQ ID NO.
  • the peptide of the invention may have at least 70% sequence identity to any of SEQ ID NO’s 1 to 65.
  • the peptide of the invention may have at least 70% sequence identity to any of SEQ ID NO’s 1 to 29.
  • the peptide of the invention may have at least 80, 90 or 95% sequence identity to any of SEQ ID NO’s 1 to 65.
  • the peptide of the invention may have at least 80, 90 or 95%% sequence identity to any of SEQ ID NO’s 1 to 29.
  • the peptide of the invention may have at least 70% sequence identity to any of SEQ ID NO’s 75 to 139.
  • the peptide of the invention may have at least 70% sequence identity to any of SEQ ID NO’s 75 to 103.
  • the peptide of the invention may have at least 80, 90 or 95% sequence identity to any of SEQ ID NO’s 1 to 65.
  • the peptide of the invention may have at least 80, 90 or 95% sequence identity to any of SEQ ID NO’s 75 to 103.
  • the N and/or C terminus of the peptide may be a hydrophilic amino acid, such as lysine.
  • Citrullinated Peptides The peptides of the invention preferably comprise at least one or more citrullines as an amino acid in their sequence.
  • citrullines may comprise 1 to 4 citrullines. At least one citrulline may be present in the peptide within a contiguous amino acid sequence as defined herein, for example as part of the sequence that binds the HLA molecule, for example at the P4 or P6 anchor position of this binding sequence
  • Peptides that have more than one citrullinated residue are preferably able to bind to the same HLA molecule in different registers. Preferably a single peptide may be able to bind in different registers to different MHC molecules with shared epitope alleles.
  • Glutamine Analogue Peptides Some of the peptides of the invention are glutamine analogue peptides. They have a glutamine instead of citrulline.
  • At least one glutamine in the peptide is at a position in which a glutamine would not be present in the naturally occurring sequence.
  • the glutamine is preferably at a position in which a citrulline would be present once the naturally occurring sequence undergoes citrullination.
  • the glutamine analogue peptides of the invention preferably comprise at least one or more glutamines as an amino acid in their sequence. They may comprise 1 to 4 glutamines. At least one glutamine may be present in the peptide within a contiguous amino acid sequence as defined herein, for example as part of the sequence that binds the HLA molecule, for example at the P4 or P6 anchor position of this binding sequence.
  • Peptides that have more than one glutamine residue are preferably able to bind to the same HLA molecule in different registers. Preferably a single peptide may be able to bind in different registers to different MHC molecules with shared epitope alleles.
  • the invention includes peptides which are both citrullinated and glutamine analogue peptides. Properties and Sequences of Functional Analogues of Peptides Defined Using SEQ ID NO’s The peptides which are functional analogues of a specific SEQ ID NO will preferably have the same tolerization activity as the SEQ ID NO, i.e.
  • the analogue will be able to tolerize against the same T cell response that the SEQ ID NO tolerizes against (for example binding the same HLA molecule and/or being recognised by the same T cell).
  • the analogue will have the same therapeutic activity for RA and be able to cause the same immunotherapeutic effect.
  • Functional analogues of the peptides can be defined by level of sequence identity as discussed above. They may comprise sequence which is a fragment of any of SEQ ID NO’s 1 to 65 or 75 to 139. They can be derived by truncation of such a SEQ ID NO, for example by removal of 1, 2, 3, 4 or more amino acids from the N and/or C-terminal ends of the sequence.
  • Fragments may also be generated by one or more internal deletions, preferably with the contiguous 9 amino acids that makes up the T cell epitope not being substantially disrupted.
  • the analogue may have amino acids extending beyond the end(s) of the SEQ ID NO.
  • the analogue may include a combination of deletions and additions, for example as discussed above. For example, amino acids may be deleted from one end, but additional amino acids may be added at the other end of the SEQ ID NO.
  • the analogue may include one or more amino acid substitutions compared to the SEQ ID NO.
  • the analogue may have at least 70% sequence identity to at least 9 or more contiguous amino acids of any of SEQ ID NO’s 1 to 65 or 75 to 139.
  • sequence identity may be across any section of the peptide, although it is preferably at the core region encompassing the epitope.
  • the level of amino acid identity is over at least 9 contiguous amino acids, but it may be over at least 10, 11, 12, 13, 14, 15 or at least 16 or 17 amino acids, depending on the size of the peptides. Accordingly, any of the above- specified levels of identity may be across the entire length of sequence.
  • sequence identity preferably refers to sequences which have the stated value when assessed using ClustalW (Thompson et al., 1994, Nucleic Acids Res.
  • An analogue may comprise 1, 2, 3, 4, 5 or more, or up to 10 amino acid substitutions from any of SEQ ID NO’s 1 to 65 or 75 to 139.
  • Substitution variants preferably involve the replacement of one or more amino acids with the same number of amino acids and making conservative amino acid substitutions.
  • an amino acid may be substituted with an alternative amino acid having similar properties, for example, another basic amino acid, another acidic amino acid, another neutral amino acid, another charged amino acid, another hydrophilic amino acid, another hydrophobic amino acid, another polar amino acid, another aromatic amino acid or another aliphatic amino acid.
  • analogues include those in which instead of the naturally occurring amino acid the amino acid which appears in the sequence is a structural analogue thereof. Amino acids used in the sequences may also be modified, e.g. labelled, providing the function of the peptide is not significantly adversely affected.
  • the technical information provided in the following documents is incorporated into the present specification through reference and provides features that can be used to describe peptides (including analogues) of the invention: Sidney J, Becart S, Zhou M, et al. Citrullination only infrequently impacts peptide binding to HLA class II MHC. Goldberg AC, ed.
  • peptide includes not only molecules in which amino acid residues are joined by peptide (-CO- NH-) linkages but also molecules in which the peptide bond is reversed.
  • retro-inverso peptidomimetics may be made using methods known in the art, for example such as those described in Meziere et al. (1997), J. Immunol.159, 3230-3237. This approach involves making pseudopeptides containing changes involving the backbone, and not the orientation of side chains. Meziere et al. (1997) show that, at least for MHC class II and T helper cell responses, these pseudopeptides are useful.
  • Retro- inverse peptides which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.
  • the peptide bond may be dispensed with altogether provided that an appropriate linker moiety which retains the spacing between the carbon atoms of the amino acid residues is used; it is particularly preferred if the linker moiety has substantially the same charge distribution and substantially the same planarity as a peptide bond. It will also be appreciated that the peptide may conveniently be blocked at its N-or C-terminus so as to help reduce susceptibility to exoproteolytic digestion.
  • N-terminal amino group of the peptides may be protected by reacting with a carboxylic acid and the C-terminal carboxyl group of the peptide may be protected by reacting with an amine.
  • modifications include glycosylation and phosphorylation.
  • Another potential modification is that hydrogens on the side chain amines of R or K may be replaced with methylene groups (-NH(Me) or -N(Me)2).
  • Analogues may also include peptide variants that increase or decrease the peptide's half-life in vivo.
  • analogues capable of increasing the half-life of peptides used according to the invention include peptoid analogues of the peptides, D-amino acid derivatives of the peptides, and peptide- peptoid hybrids.
  • a further embodiment of the variant peptides used according to the invention comprises D-amino acid forms of the peptide.
  • the preparation of peptides using D-amino acids rather than L- amino acids greatly decreases any unwanted breakdown of such an agent by normal metabolic processes, decreasing the amounts of agent which needs to be administered, along with the frequency of its administration.
  • the peptides of the invention may be covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid.
  • Combinations of Peptides in the Panels/Mixes Groups of peptides of the invention may be used together, for example as a panel or mix of peptides, preferably for therapy or diagnosis of an individual. They may be present together in a composition or in a kit in the form of different compositions.
  • the composition may comprise at least 2 to 30 different peptides of the invention, for example 3 to 25 such peptides, 4 to 20 such peptides, 5 to 15 such peptides, 6 to 12 such peptides or 8 to 10 such peptides.
  • the composition comprises no other such peptides apart from these stated ranges and/or the composition comprise no other type of peptide.
  • the composition comprises 2 to 8 different peptides of the invention that each optionally comprise a sequence which binds to HLA-DRB1.
  • 2 to 8 of the different peptides in the composition comprise sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids from different peptides selected from SEQ ID NO’s 1 to 65 or 75 to 139.
  • Preferably 2 to 8 of the different peptides in the composition comprise sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids from different peptides selected from SEQ ID NO’s 1 to 29 or 75 to 103.
  • the composition may comprise at least 1, 3, 5, or 8 peptides that have at least 80%, 90% or 95% sequence identity to at least 9 contiguous amino acids in the amino acid sequences of any of SEQ ID NO’s 1 to 65 or 75 to 139.
  • the composition may comprise at least 1, 3, 5, or 8 peptides that have at least 80%, 90% or 95% sequence identity to at least 9 contiguous amino acids in the amino acid sequences of any of SEQ ID NO’s 1 to 29 or 75 to 103.
  • At least 1, 3, 5, 8 or all the peptides of the composition may comprise sequence that binds the MHC class II molecule HLA-DRA/HLA-DRB1, preferably where HLA-DRB1 is *0401, *1303, *0101, *0102, *0404, *0405, *0408, *1001, *1402, *1406, *1501, *1502, *1503, *0103, *0402, *1102, *1103, *1301, *1302, *1202 and *16.
  • Activity of the Peptides of the Invention Peptides of the invention may have particular properties, such as being able to activate stimulating or tolerizing activities in T cells relating the therapeutic and diagnostic aspects of the invention.
  • nucleic acids of the Invention The invention provides a nucleic acid for use in preventing or treating rheumatoid arthritis by tolerization in an individual.
  • nucleic acid leads to generation of one or more citrullinated or glutamine analogue peptides of the invention in the individual and said generated peptide(s) cause said tolerization.
  • the nucleic acid may lead to generation of a peptide that comprises the sequences of one or more peptides of the invention present within a larger peptide.
  • the nucleic acid may generate any number or combination of (i) peptides of the invention or (ii) sequences within a ‘larger peptide’, for example as disclosed herein in terms of numbers or specific groups of peptides.
  • the nucleic acid generates least 2 to 8 different peptides of the invention or sequences within a larger peptide.
  • the nucleic acid may encode a non-citrullinated peptide which is converted to the citrullinated peptide in vivo, for example encoding a peptide which is the same as a citrullinated peptide apart from replacement of the citrullinated peptide with lysine or arginine. Therefore typically in this aspect a non- citrullinated peptide is translated and this is subsequently modified to the citrullinated peptide.
  • a means to citrullinate a peptide expressed from the nucleic acid is also delivered to the individual.
  • Such means is preferably an enzyme, and may optionally be a peptidyl-arginine-deiminase, which typically converts arginine to citrulline
  • the nucleic acid may encode the peptide of the invention using an artificial codon reading system, for example where at least one codon encodes citrulline and this is read by an appropriate artificial translation means that adds a citrulline to the peptide when translating the codon. Therefore in this aspect a citrullinated peptide is translated from the nucleic acid of the invention, and post- translational modification is not required.
  • Any suitable translation system can be used, for example one that is based on artificial tRNA’s.
  • nucleic acid of the invention may thus be administered together with a means to translate a codon to citrulline, for example such means as described in either of these papers.
  • nucleic acid More than one nucleic acid may be administered, with each nucleic acid preferably generating in vivo at least one different peptide of the invention or at least one different ‘larger peptide’ comprising sequences of the peptides of the invention.
  • Preferred Nucleic Acids of the Invention SEQ ID NO’s 66 to 74 show the coding sequences of the human full length proteins fibrinogen alpha chain (FGA), fibrinogen beta chain (FGB), fibrinogen gamma chain (FGG), vimentin (VIM), aggrecan (ACAN), serpin family C member 1 (SERPINC1), H4 clustered histone 15 (H4C15), chitinase 3 like 1 (CHI3L1) and collagen type I alpha 1 chain (COL1A1).
  • nucleic acid comprises a sequence of length 18 to 90 bases which encodes a peptide of the invention, including citrullinated peptides which are formed by translation or which are citrullinated after translation.
  • such a nucleic acid does not comprise a sequence encoding more than 30 amino acids from any human protein (for example any of fibrinogen alpha chain (FGA), fibrinogen beta chain (FGB), fibrinogen gamma chain (FGG), vimentin (VIM), aggrecan (ACAN), serpin family C member 1 (SERPINC1), H4 clustered histone 15 (H4C15), chitinase 3 like 1 (CHI3L1) and collagen type I alpha 1 chain (COL1A1)), and optionally does not comprise a fragment of any of SEQ ID NO’s 66 to 74 which is longer than 90 bases.
  • FGA fibrinogen alpha chain
  • FGB fibrinogen beta chain
  • FGG fibrinogen gamma chain
  • VIM vimentin
  • ACAN aggrecan
  • SEPINC1 serpin family C member 1
  • H4C15 H4 clustered histone 15
  • CHI3L1 chitinase 3 like 1
  • COL1A1
  • the nucleic acid does not comprise sequence which encodes more than a 50 amino acid fragment from any of fibrinogen alpha chain (FGA), fibrinogen beta chain (FGB), fibrinogen gamma chain (FGG), vimentin (VIM), aggrecan (ACAN), serpin family C member 1 (SERPINC1), H4 clustered histone 15 (H4C15), chitinase 3 like 1 (CHI3L1) and collagen type I alpha 1 chain (COL1A1).
  • the nucleic acid does not comprise a fragment of any of SEQ ID NO’s 66 to 74 which is longer than 150 bases.
  • the nucleic acid may preferably comprise different sequences which each encode a different peptide of the invention, and may comprise at least 2, 3, 5, 8 or 10 such sequences.
  • the nucleic acid may comprise at least 2, 3, 5, 8 or 10 different sequences that together encode different fragments of length 9 to 30 amino acids in length from at least 2, 3, 4 or more different proteins chosen from fibrinogen alpha chain (FGA), fibrinogen beta chain (FGB), fibrinogen gamma chain (FGG), vimentin (VIM), aggrecan (ACAN), serpin family C member 1 (SERPINC1), H4 clustered histone 15 (H4C15), chitinase 3 like 1 (CHI3L1) and collagen type I alpha 1 chain (COL1A1), and preferably chosen from the specific protein sequences of these proteins shown in the Appendix.
  • FGA fibrinogen alpha chain
  • FGB fibrinogen beta chain
  • FGG fibrinogen gamma chain
  • VIM vimentin
  • ACAN aggrecan
  • the nucleic acid may comprise sequence which encodes at least 10, 15, 20, 25 or all of the peptides corresponding to SEQ ID NO’s 1 to 29, for example where the encoded sequence can be translated into the non-citrullinated form of the sequence, for example as shown by underlining in the protein sequences in the Appendix.
  • the nucleic acid may be capable of expressing these encoded peptides.
  • the nucleic acid may comprise sequence which encodes at least 10, 15, 20, 25 or all of the peptides corresponding to SEQ ID NO’s 75 to 103.
  • the nucleic acid may be capable of expressing these encoded peptides.
  • the nucleic acid may comprise sequence which encodes at least 10, 15, 20, 2, 30, 35, 40, 45, 50, 60 or all of the peptides corresponding to SEQ ID NO’s 1 to 65, for example where the encoded sequence can be translated into the non-citrullinated sequence, preferably as shown by underlining of protein sequences in the Appendix.
  • the nucleic acid may be capable of expressing these encoded peptides.
  • the nucleic acid may comprise sequence which encodes at least 10, 15, 20, 2, 30, 35, 40, 45, 50, 60 or all of the peptides corresponding to SEQ ID NO’s 75 to 139.
  • the nucleic acid may be capable of expressing these encoded peptides.
  • nucleic acid is preferably a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogues thereof.
  • the nucleic acid may be DNA or RNA, and is preferably mRNA.
  • a nucleic acid of the invention may be provided in isolated or purified form.
  • a nucleic acid sequence which "encodes" a selected peptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a peptide in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • nucleic acid sequences can include, but are not limited to, cDNA from viral, prokaryotic or eukaryotic mRNA, genomic sequences from viral or prokaryotic DNA or RNA, and even synthetic DNA sequences.
  • a transcription termination sequence may be located 3’ to the coding sequence.
  • the polynucleotide molecules of the present invention may be provided in the form of an expression cassette which includes control sequences operably linked to the inserted sequence, thus allowing for expression of the peptide of the invention in vivo in a targeted subject.
  • These expression cassettes are typically provided within vectors (e.g., plasmids, recombinant viral vectors or lipid nanoparticles) which are suitable for use as reagents for nucleic acid immunization.
  • Such an expression cassette may be administered directly to a host subject.
  • a vector comprising a polynucleotide of the invention may be administered to a host subject.
  • the polynucleotide is prepared and/or administered using a genetic vector.
  • a suitable vector may be any vector which is capable of carrying a sufficient amount of genetic information, and allowing expression of a peptide of the invention.
  • the vector has a different codon usage to the human codon usage to allow citrullinated peptides to be encoded.
  • Expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for expression of a peptide of the invention.
  • Other suitable vectors would be apparent to persons skilled in the art.
  • a peptide of the invention may be provided by delivering such a vector to a cell and allowing transcription from the vector to occur.
  • a nucleic acid of the invention or for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
  • operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • a given regulatory sequence, such as a promoter operably linked to a nucleic acid sequence is capable of effecting the expression of that sequence when the proper enzymes are present.
  • the promoter need not be contiguous with the sequence, so long as it functions to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between the promoter sequence and the nucleic acid sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
  • a number of expression systems have been described in the art, each of which typically consists of a vector containing a gene or nucleotide sequence of interest operably linked to expression control sequences. These control sequences include transcriptional promoter sequences and transcriptional start and termination sequences.
  • the vectors of the invention may be for example, plasmid, virus or phage vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
  • a "plasmid” is a vector in the form of an extrachromosomal genetic element.
  • the vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a resistance gene for a fungal vector.
  • Vectors may be used in vitro, for example for the production of DNA or RNA or used to transfect or transform a host cell, for example, a mammalian host cell.
  • the vectors may also be adapted to be used in vivo, for example to allow in vivo expression of the peptide.
  • nucleic acids of the invention maybe expressed in a suitable manner to allow presentation of a peptide of the invention by an MHC class II molecule at the surface of an antigen presenting cell.
  • a polynucleotide, expression cassette or vector of the invention may be targeted to antigen presenting cells, or the expression of encoded peptide may be preferentially stimulated or induced in such cells.
  • the nucleic acid molecule can be introduced directly into the recipient subject, such as by standard intramuscular or intradermal injection; intra-articular injection; transdermal particle delivery; inhalation; topically, or by oral, intranasal or mucosal modes of administration.
  • the molecule alternatively can be introduced ex vivo into cells that have been removed from a subject.
  • a polynucleotide, expression cassette or vector of the invention may be introduced into APCs of an individual ex vivo. Cells containing the nucleic acid molecule of interest are re-introduced into the subject such that an immune response can be mounted against the peptide encoded by the nucleic acid molecule.
  • nucleic acid vaccines The nucleic acid molecules used in such immunization are generally referred to herein as "nucleic acid vaccines.”
  • the peptides, nucleic acids, vectors or cells of the invention may be present in a substantially isolated form. They may be mixed with carriers or diluents which will not interfere with their intended use and still be regarded as substantially isolated. They may also be in a substantially purified form, in which case they will generally comprise at least 90%, e.g. at least 95%, 98% or 99%, of the proteins, polynucleotides, cells or dry mass of the preparation.
  • the invention encompasses the use in vitro of a method of producing a population of APCs that present the peptides of the invention on their surface, that may be subsequently used in therapy. Such a method may be carried out ex vivo on a sample of cells that have been obtained from a patient.
  • the APCs produced in this way therefore form a pharmaceutical agent that can be used in the treatment or prevention of RA by tolerization.
  • the cells should be accepted by the immune system of the individual because they derive from that individual. Delivery of cells that have been produced in this way to the individual from whom they were originally obtained, thus forms a therapeutic embodiment of the invention.
  • peptides, nucleic acid, vectors and cells of the invention may be provided to an individual either singly or in combination.
  • Each molecule or cell of the invention may be provided to an individual in an isolated, substantially isolated, purified or substantially purified form.
  • a peptide of the invention may be provided to an individual substantially free from the other peptides. Whilst it may be possible for the peptides, nucleic acids or compositions according to the invention to be presented in raw form, it is preferable to present them as a pharmaceutical formulation.
  • the present invention provides a pharmaceutical formulation for use in preventing or treating RA by tolerization comprising a composition, vector or product according to the invention together with one or more pharmaceutically acceptable carriers or diluents and optionally one or more other therapeutic ingredients.
  • the carrier (s) must be 'acceptable' in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
  • carriers for injection, and the final formulation are sterile and pyrogen free.
  • Formulation of a composition comprising the peptide, nucleic acid or cells of the invention can be carried out using standard pharmaceutical formulation chemistries and methodologies all of which are readily available to the reasonably skilled artisan.
  • compositions containing one or more molecules or cells of the invention can be combined with one or more pharmaceutically acceptable excipients or vehicles.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like, may be present in the excipient or vehicle.
  • excipients, vehicles and auxiliary substances are generally pharmaceutical agents that do not induce an immune response in the individual receiving the composition, and which may be administered without undue toxicity.
  • Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethyleneglycol, hyaluronic acid, glycerol and ethanol.
  • compositions may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration.
  • injectable compositions may be prepared, packaged, or sold in unit dosage form, such as in ampoules or in multi- dose containers containing a preservative.
  • compositions include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such compositions may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
  • the active ingredient is provided in dry (for e.g., a powder or granules) form for reconstitution with a suitable vehicle (e. g., sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
  • a suitable vehicle e. g., sterile pyrogen-free water
  • the pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution.
  • This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example.
  • a non-toxic parenterally-acceptable diluent or solvent such as water or 1,3-butane diol, for example.
  • Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono-or di-glycerides.
  • compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
  • pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
  • the peptides or nucleic acids of the present invention may be encapsulated, adsorbed to, or associated with, particulate carriers.
  • Suitable particulate carriers include those derived from polymethyl methacrylate polymers, as well as PLG microparticles derived from poly(lactides) and poly(lactide-co- glycolides). See, e.g., Jeffery et al. (1993) Pharm. Res.10:362-368.
  • Other particulate systems and polymers can also be used, for example, polymers such as polylysine, polyarginine, polyornithine, spermine, spermidine, as well as conjugates of these molecules.
  • the formulation of any of the peptides, nucleic acids or cells mentioned herein will depend upon factors such as the nature of the substance and the method of delivery. Any such substance may be administered in a variety of dosage forms.
  • compositions of formulations of the invention will comprise a suitable concentration of each peptide/nucleic acid/cell to be effective without causing adverse reaction.
  • the concentration of each peptide in the composition will be in the range of 0.03 to 200 nmol/ml. More preferably in the range of 0.3 to 200 nmol/ml, 3 to 180 nmol/ml, 5 to 75 nmol/ml or 10 to 50 nmol/ml.
  • the composition or formulations should have a purity of greater than 95% or 98% or a purity of at least 99%.
  • Therapeutic Methods and the Individual to be Treated The individual to be treated by the therapeutic method of the invention is preferably a mammal or a bird, and most preferably a human or mouse. The individual may have a family history of RA.
  • the individual to be treated is preferably from a population that has MHC allele frequencies within the range of frequencies that are representative of the Caucasian population and thus HLA-DRB1 is preferably present in the population.
  • the individual may be of any background mentioned herein, such as Caucasian. Diagnostic Methods and Use of T cell Detection as a Biomarker
  • the invention also provides a method of detecting whether an individual has or is at risk of developing RA.
  • the invention also provides use of the detection of T cells specific for peptides of the invention as a biomarker which can be used as the basis for selecting individuals found to have such T cells, and for example providing them with a particular therapy, such as tolerization therapy as described herein using the peptides and nucleic acids of the invention.
  • the invention provides in vitro method of determining whether an individual has or is at risk of rheumatoid arthritis, the method comprising testing whether the individual has T cells which respond to or are specific for a citrullinated or glutamine analogue peptide of the invention, thereby determining whether the individual has or is at risk of the condition.
  • the presence of the T cell immune response to said citrullinated or glutamine analogue peptide may be measured by contacting the peptide with T cells in a sample taken from the subject, under conditions which allow the peptide and the T cells to interact; and detecting whether or not any of the T cells are stimulated and thereby determining whether or not a T cell immune response is present or absent.
  • Antigen presenting cells may also be present during said contacting of the peptide with T cells.
  • the T cells which respond to the peptide are generally T cells which have been pre-sensitised in vivo to antigen. These antigen-experienced T cells are generally present in the peripheral blood of an individual, i.e. within the population of peripheral blood mononuclear cells (PBMCs) in the individual.
  • PBMCs peripheral blood mononuclear cells
  • the T cells maybe CD4 T cells.
  • the T cells can be contacted with the peptide, preferably in vitro in a sample from the individual.
  • the T cells which are contacted in the method are taken from the individual in a blood sample or synovial fluid, although other types of samples which contain T cells can be used.
  • the sample may be added directly to the assay or may be processed first.
  • the processing may comprise standard techniques such as gradient centrifugation to separate the T cells, with resuspension in any suitable volume.
  • the processing may comprise diluting of the sample, for example with water, buffer or media.
  • the sample may be diluted from 1.5 to 100 fold, for example 2 to 50 or 5 to 10 fold.
  • the processing may comprise separation of components of the sample.
  • mononuclear cells (MCs) are separated from the samples.
  • the MCs will comprise the T cells and antigen presenting cells (APCs).
  • APCs antigen presenting cells
  • T cells such as only CD4 T cells
  • PBMCs, MCs and T cells can be separated from the sample using techniques known in the art.
  • the T cells used in the assay are in the form of unprocessed or diluted samples, are freshly isolated T cells (such as in the form of freshly isolated MCs or PBMCs) which are used directly ex vivo, i.e. they are not cultured before being used in the method, and thus the T cells can be fresh.
  • T cells are thawed cells (which were previously frozen).
  • the T cells can be cultured before use, for example in the presence of the antigen, and generally also exogenous growth promoting cytokines.
  • the allergen is typically present on the surface of APCs, such as the APC used in the method.
  • Pre-culturing of the T cells may lead to an increase in the sensitivity of the method.
  • the T cells can be converted into cell lines, such as short term cell lines.
  • the APC which is typically present in the method may come from the same individual as the T cell or from a different individual.
  • the APC may be a naturally occurring APC or an artificial APC.
  • the APC is a cell which is capable of presenting the antigen to a T cell. It is typically a B-cell, dendritic cell or macrophage. It is typically separated from the same sample as the T cell and is typically co-purified with the T cell.
  • the APC may be present in MCs or PBMCs.
  • the APC is typically a freshly isolated ex vivo cell or a cultured cell. It may be in the form of a cell line, such as a short term or immortalised cell line.
  • the APC may express empty MHC class II molecules on its surface.
  • the peptide or combination of the invention is added directly to an assay comprising T cells and APCs. As discussed above the T cells and APCs in such an assay could be in the form of MCs.
  • the peptide or combination of peptides is provided to the APC in the absence of the T cell. The APC is then provided to the T cell, typically after being allowed to present the allergen on its surface.
  • the peptide or combination of peptides may have been taken up inside the APC and presented, or simply be taken up onto the surface without entering inside the APC.
  • PBMCs are added to each assay.
  • the peptide or combination of peptides is added directly to the assay it is typically added as a peptide with a concentration from 10 -1 to 10 3 ⁇ g/ml, preferably 0.5 to 50 ⁇ g/ml or 1 to 10 ⁇ g/ml.
  • the length of time for which the T cells are incubated with the peptide or combination is from 4 to 24 hours (preferably 5 to 18 hours) for effector T cells or for more than 24 hours for central memory cells.
  • 5.0x106 PBMCs can be incubated in 10 ⁇ g/ml of peptide for 5 hours at 37 o C.
  • Proliferation of the incubated T cells may be measured by any suitable method. For example, this can be by flow cytometric measurement of incorporation of the fluorescent compound CFSE following incubation with peptide, or by measuring incorporation of the radiolabeled compound 3H-thymidine following incubation with peptide. Cytokine release may be measured by any suitable method such as ELISA assay as described above. Such methods are well known in the art.
  • Specific T cells can be detected based on their ability to recognise and/or bind a reagent that comprises a peptide of the invention, for example a MHC class II tetramer or multimer that comprises a peptide of the invention.
  • Combination Immunotherapy Therapy may be carried out using tolerance induced in an individual by a peptide antigen or antigen that can create in the individual a tolerogenic environment wherein inappropriate immune responses to other antigens can be downregulated in order to provide tolerance to other unrelated antigens. Delivery Methods Once formulated the compositions of the invention can be delivered to a subject in vivo using a variety of known routes and techniques, including sublingual, buccal or oral mucosal delivery.
  • compositions can be provided as an injectable solution, suspension or emulsion and administered via parenteral, subcutaneous, epidermal, intradermal, intramuscular, intra-articular, intraarterial, intraperitoneal, intravenous injection using a conventional needle and syringe, or using a liquid jet injection system.
  • Compositions can also be administered topically to skin or mucosal tissue, such as nasally, intratracheally, intestinal, rectally or vaginally, or provided as a finely divided spray suitable for respiratory or pulmonary administration.
  • Other modes of administration include oral administration, suppositories, sublingual administration, and active or passive transdermal delivery techniques.
  • a peptide of the invention is to be administered, it is preferred to administer the peptide to a site in the body where it will have the ability to contact suitable antigen presenting cells, and where it, or they, will have the opportunity to contact T cells of the individual.
  • an APC is to be administered, it is preferred to administer the APC to a site in the body where it will have the ability to contact, and activate, suitable T cells of the individual. Delivery regimes Administration of the peptides/polynucleotides/cells (such as the composition containing a plurality of peptides) may be by any suitable method as described above. Suitable amounts of the peptide may be determined empirically, but typically are in the range given below.
  • each peptide may be sufficient to have a beneficial effect for the patient, but it will be appreciated that it may be beneficial if the peptide is administered more than once, in which case typical administration regimes may be, for example, once or twice a week for 2-4 weeks every 6 months, or once a day for a week every four to six months. Preferably there are 4 administrations which are each 25 to 35 days apart.
  • each peptide or polynucleotide, or combination of peptides and/or polynucleotides may be administered to a patient singly or in combination. Dosages for administration will depend upon a number of factors including the nature of the composition, the route of administration and the schedule and timing of the administration regime.
  • kits of the Invention The invention also relates to a combination of components described herein suitable for use in a treatment of the invention which are packaged in the form of a kit in a container. Such kits may comprise a series of components to allow for a treatment of the invention.
  • a kit may comprise one or more different peptides, polynucleotides and/or cells of the invention, or one or more peptides, polynucleotides or cells of the invention and one or more additional therapeutic agents suitable for simultaneous administration, or for sequential or separate administration.
  • a citrullinated peptide for use in preventing or treating rheumatoid arthritis by tolerization in an individual wherein said peptide comprises sequence that can bind HLA-DRA/HLA-DRB1, is 9 to 30 amino acids in length and wherein said peptide: (i) has or comprises the sequence of any of SEQ ID NO’s 1 to 65; and/or (ii) comprises a sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 65; and/or (iii) comprises a sequence which is either the same as at least 9 or more contiguous amino acids in any of SEQ ID NO’s 1 to 65 or differs from said at least 9 or more contiguous amino acids by 1, 2, 3 or 4 amino acids.
  • a citrullinated peptide for use according to any one of the preceding aspects which is present in a composition which comprises at least 2 to 8 or more different citrullinated peptides as defined in aspect 1 or 2, and optionally wherein: (i) the composition comprises no further peptides, and/or (ii) the composition comprises 2 to 8 or more different peptides that comprise a sequence which binds to HLA-DRA/HLA-DRB1; and/or (iii) 2 to 8 of the different citrullinated peptides in the composition comprise sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids from different peptides selected from SEQ ID NO’s 1 to 65; and/or (iv) 2 to 8 of the different peptides in the composition comprise sequence which has at least 70% sequence identity to at least 9 or more contiguous amino acids from different peptides selected from SEQ ID NO’s 1 to 29.
  • a citrullinated peptide for use according to any one of preceding aspects which is in the form of a composition that comprises at least 1 to 8 or more different citrullinated peptides as defined in any one of the preceding aspects, wherein: (i) at least 1, 3, 5, or 8 of the peptides have at least 80%, 90% or 95% sequence identity to at least 9 contiguous amino acids in the amino acid sequences of any of SEQ ID NO’s 1 to 65; and/or (ii) at least 1, 3, 5, or 8 of the peptides have at least 80%, 90% or 95% sequence identity to at least 9 contiguous amino acids in the amino acid sequences of any of SEQ ID NO’s 1 to 29; and/or (iii) all the peptides of the composition comprise sequence that binds HLA-DRA/HLA-DRB1; and/or (iv) all of the peptides of the composition bind to HLA-DRA in combination with one or more of any of the following HLA-DRB
  • a citrullinated peptide for use according to any one of the preceding aspects wherein: (i) the peptide and/or each peptide in said composition is present at a concentration in the range of 0.005nmol/ml to 10mmol/ml, 0.5nmol/ml to 200nmol/ml or 10nmol/ml to 50nmol/ml in the composition which is administered, and/or (ii) 0.01 to 1 ⁇ mol of the peptide and/or each peptide is administered; and/or (iii) 10 to 200 ⁇ l of the composition comprising the peptide and/or each peptide is administered; and/or (iv) the peptide and/or each peptide are administered in the form of a solution and/or as nanoparticles and/or in the form of a hydrogel; and/or (v) the peptide and/or each composition is in form of a unit dosage which is to be administered to the individual, optionally in the form of a kit; and/or
  • a nucleic acid for use in preventing or treating rheumatoid arthritis by tolerization in an individual wherein said nucleic acid leads to generation of a citrullinated peptide in the individual and said generated peptide causes said tolerization, wherein: (i) said citrullinated peptide is a citrullinated peptide as defined in any one of the preceding aspects; and/or (ii) said citrullinated peptide comprises the sequences of at least 2 to 8 or more different citrullinated peptides defined in any one of the preceding aspects, wherein optionally the sequences of the at least 2 to 8 or more different citrullinated peptides correspond to any group of peptides present in a composition defined in any one of aspects 4 to 6.
  • a product comprising: (i) at least 2 to 8 peptides different citrullinated peptides as defined in any one of aspects 1 to 7, and/or (ii) at least 2 to 8 different nucleic acids as defined in any one of aspects 8 to 10 which each generates in vivo a different peptide as defined in any one of aspects 1 to 7; for simultaneous, separate or sequential use in the prevention or treatment of rheumatoid arthritis by tolerization in an individual, where optionally the different peptides of (i) or which are generated in (ii) are a group as defined by any one of aspects 4 or 5.
  • Aspect 13 Aspect 13
  • Aspect 14 An in vitro method of determining whether an individual has or is at risk of rheumatoid arthritis, the method comprising testing whether the individual has T cells which respond to or are specific for a citrullinated peptide as defined in any one of aspects 1 to 7 or 11, thereby determining whether the individual has or is at risk of rheumatoid arthritis.
  • Aspect 15 An in vitro method of determining whether an individual has or is at risk of rheumatoid arthritis, the method comprising testing whether the individual has T cells which respond to or are specific for a citrullinated peptide as defined in any one of aspects 1 to 7 or
  • the method comprises detecting whether said T cells are stimulated or activated by the said peptide to determine whether they are specific for the peptide; and/or (ii) the method is carried out to decide on the therapeutic approach for the individual and/or to identify the presence of T cells specific for the peptide as a
  • a method according to aspect 14 or 15 which further comprises administering to an individual determined to have or be at risk of rheumatoid arthritis a therapeutic agent for rheumatoid arthritis, wherein optionally said agent is (i) a citrullinated peptide for use according to any one of aspects 1 to 7 and 11, (ii) a nucleic acid for use according to any one of aspects 8 to 10, or (iii) a product for use according to aspect 12.
  • SEQ ID NO’s 1 to 65 (citrullinated peptides) ⁇ CIT ⁇ denotes citrulline in the following sequences: SEQ ID NO: 1 - LAEGGGV ⁇ CIT ⁇ GPRVVE ⁇ CIT ⁇ SEQ ID NO: 2 - VQHIQLLQKNV ⁇ CIT ⁇ AQL SEQ ID NO: 3 - IGTLDGFRH ⁇ CIT ⁇ HPDEA SEQ ID NO: 4 - DYSL ⁇ CIT ⁇ AVRMKIRPLV SEQ ID NO: 5 - SLRAVRMKI ⁇ CIT ⁇ PLVTQ SEQ ID NO: 6 - TQKKVE ⁇ CIT ⁇ KAPDAGGC SEQ ID NO: 7 - QNEANKYQISVNKY ⁇ CIT ⁇ SEQ ID NO: 8 - NKYQISVNKY ⁇ CIT ⁇ GTAG SEQ ID NO: 9 - WSLHP ⁇ CIT ⁇ NLILYFYAL SEQ ID NO: 10 - DAATLKS ⁇ CIT ⁇ KMLEEIMK SEQ ID NO:
  • Step 1 Identification of auto-antigen protein sequences The list of proteins involved in the pathogenesis of RA was compiled after a review of the current literature. Twelve proteins were considered in the analysis ( Figure 2). The native sequences for each protein were obtained from Uniprot.
  • Step 2 In silico analysis for epitope mapping using the TEPITOPE prediction tool The native sequence was submitted to the TEPITOPE prediction tool in the Immune Epitope Database (IEDB) to predict potential T cell epitopes binding to SE-HLA-DRB1 molecules.
  • IEDB Immune Epitope Database
  • TEPITOPE predictions were based on quantitative matrices built on experimental binding affinity data. By default, 15 amino acid peptide sequences overlapping by 14 amino acids were analyzed. Step 3: All R amino acid residues in the native protein sequences were changed to Q residues and the modified (i.e. quasi-citrullinated) sequences were resubmitted to TEPITOPE. Step 4: The lists of potential epitopes derived from the native and modified sequences were compared. Step 5: In silico analysis for epitope mapping using the NetMHC prediction tool To investigate the effects of peptide-flanking regions (PFRs) on binding affinity, steps 2 to 5 were repeated using the NetMHCII 2.2 and NetMHCIIpan 3.1 servers.
  • PFRs peptide-flanking regions
  • Step 6 Peptides were shortlisted as potential epitopes if their native form had an R in the 4th or 9th position of the peptide core, and the MHC class II SE+ binding affinity of the modified sequence (Q for R) was equivalent to, or greater than, the native sequence.
  • Step 7 TEPITOPE and NetMHCII based predictions were repeated for each of the DR alleles listed in Figure 4.
  • lysine (K) residues were added using the strategy explained in step 1 for a total of six residues on either side until the peptide was soluble. Cysteine (C) residues were always replaced with serine (S) to avoid disulfide linkages within peptides. Epitope variants were reanalysed through in silico analyses to ensure that peptides cores were not shifted and binding affinities were not negatively affected, specifically for the citrullinated peptides.
  • mice received a 2 ⁇ l intra-articular injection of 1.2nmols of peptide emulsified in CFA (right knee), or saline (left knee). Blood samples were collected the day before and after the intra-articular injection. Arthritis severity scores (5 point scale) were measured daily until day 182. Knee swelling was measured with digital micro-calipers weekly until day 182. Blood was taken monthly for measurement of ACPA and C-reactive protein (CRP).
  • CFP C-reactive protein
  • mice were euthanized. Knee joints were harvested and fixed for histology. Inguinal lymph nodes (LN) and spleen were harvested for the recovery of mononuclear cells for ELIspot measurement of the frequency of IFN ⁇ -secreting citrullinated peptide-specific T cells (see Figures 5 to 12).
  • Human PBMC Methods The immunological response to proteins implicated as target antigens in RA was investigated by stimulating peripheral blood mononuclear cells (PBMCs) with citrullinated and native peptides derived from target antigen proteins. Candidate peptides were identified using in silico epitope prediction approaches as described above.
  • RA immunomodulatory effects of medications used to treat RA
  • medications used to treat RA such as corticosteroids, disease-modifying anti-rheumatic drugs (DMARDs: e.g. methotrexate), and biologics (e.g. anti-TNF ⁇ monoclonal antibodies), which may have masked T cell responses to epitopes, newly diagnosed, treatment-naive RA patients were enrolled, and peripheral blood was drawn and processed to PBMC, using standard methods. T cell responses were quantified by IFN ⁇ ELIspot assays in which PBMC were cultured with citrullinated, or native sequence peptides for a period of 48 hrs.
  • DMARDs e.g. methotrexate
  • biologics e.g. anti-TNF ⁇ monoclonal antibodies
  • the frequency of antigen-specific T cells secreting IFN ⁇ was determined using image analysis to quantify the number of spots (representing IFN ⁇ -secreting cells) per one million PBMC.
  • Use of Glutamine Analogue Peptides The idea of using glutamine as a citrulline substitute in MHC binding prediction algorithms in silico was originally used in by Hill et al. (1). The reasoning is that glutamine (Gln) is the naturally coded amino acid electrostatically most similar to citrulline. Citrulline and glutamine share the same terminal group and chemical characteristics. In contrast to arginine, which is basic and positively charged, both glutamine and citrulline are polar, neutral, and uncharged.
  • NM_ 005141.5 Homo sapiens fibrinogen beta chain (FGB), transcript variant 1, mRNA) CDS 9-1484 ATGAAAAGGATGGTTTCTTGGAGCTTCCACAAACTTAAAACCATGAAACATCTATTATTGCTACTATTGT GTGTTTTTCTAGTTAAGTCCCAAGGTGTCAACGACAATGAGGAGGGTTTCTTCAGTGCCCGTGGTCATCG ACCCCTTGACAAGAAGAGAGAAGAGGCTCCCAGCCTGAGGCCTGCCCCACCGCCCATCAGTGGAGGTGGC TATCGGGCTCGTCCAGCCAAAGCAGCTGCCACTCAAAAGAAAGTAGAAAGAAAAGCCCCTGATGCTGGAG GCTGTCTTCACGCTGACCCAGACCTGGGGGTGTTGTGTCCTACAGGATGTCAGTTGCAAGAGGCTTTGCT ACAACAGGAAAGGCCAATCAGAAATAGTGTTGATGAGTTAAATAACAATGTGGAAGCTGTTTCCCAGACC TCCTCTTCTT
  • NM_021870.3 Homo sapiens fibrinogen gamma chain (FGG), transcript variant gamma-B, mRNA) CDS 48-1409 ATGAGTTGGTCCTTGCACCCCCGGAATTTAATTCTCTACTTCTATGCTCTTTTATTTCTCTCTTCAACAT GTGTAGCATATGTTGCTACCAGAGACAACTGCTGCATCTTAGATGAAAGATTCGGTAGTTATTGTCCAAC TACCTGTGGCATTGCAGATTTCCTGTCTACTTATCAAACCAAAGTAGACAAGGATCTACAGTCTTTGGAA GACATCTTACATCAAGTTGAAAACAAAACATCAGAAGTCAAACAGCTGATAAAAGCAATCCAACTCACTT ATAATCCTGATGAATCATCAAAACCAAATATGATAGACGCTGCTACTTTGAAGTCCAGGAAAATGTTAGA AGAAATTATGAAATATGAAGCATCGATTTTAACACATGACTCAAGTATTCGATATTTGCAGGAAATATAT AATTCAAATAATCAAAAG
  • NM_003380.5 Homo sapiens vimentin (VIM), mRNA
  • CDS 432-1832 ATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGC CGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAG CACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTG CGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACA CCGAGTTCAAGAACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTA CATCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGC CAAGGCAAGTCGCGCCTGGG
  • NM_013227.4 Homo sapiens aggrecan (ACAN), transcript variant 2, mRNA) CDS 382-7974 ATGACCACTTTACTCTGGGTTTTCGTGACTCTGAGGGTCATCACTGCAGCTGTCACTGTAGAAACTTCAG ACCATGACAACTCGCTGAGTGTCAGCATCCCCCAACCGTCCCCGCTGAGGGTCCTCCTGGGGACCTCCCT CACCATCCCCTGCTATTTCATCGACCCCATGCACCCTGTGACCACCGCCCCTTCTACCGCCCCACTGGCC CCAAGAATCAAGTGGAGCCGTGTGTCCAAGGAGAAGGAGGTAGTGCTGCTGGTGGCCACTGAAGGGCGCG TGCGGGTCAACAGTGCCTATCAGGACAAGGTCTCACTGCCCAACTACCCGGCCATCCCCAGTGACGCCAC CTTGGAAGTCCAGAGCCTGCTCCAATGACTCTGGGGTCTACCGCTGCGAGGTGATGCATGGCATCGAG GACAGCGAGGCCACCCTGGAAGT
  • NM_000488.4 Homo sapiens serpin family C member 1 (SERPINC1), transcript variant 1, mRNA) CDS 69-1463 ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAAGGAAGGTTTATCTTTTGTCCTTGCTGCTCA TTGGCTTCTGGGACTGCGTGACCTGTCACGGGAGCCCTGTGGACATCTGCACAGCCAAGCCGCGGGACAT TCCCATGAATCCCATGTGCATTTACCGCTCCCCGGAGAAGAAGGCAACTGAGGATGAGGGCTCAGAACAG AAGATCCCGGAGGCCACCAACCGGCGTGTCTGGGAACTGTCCAAGGCCAATTCCCGCTTTGCTACCACTT TCTATCAGCACCTGGCAGATTCCAAGAATGACAATGATAACATTTTCCTGTCACCCCTGAGTATCTCCAC GGCTTTTGCTATGACCAAGCTGGGTGCCTGTAATGACACCCTCCAGCAACTGATGGAGGTATTTAAGTTT GACACCATA
  • NM_001034077.4 Homo sapiens H4 clustered histone 15 (H4C15), transcript variant 1, mRNA
  • CDS 29-340 ATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGGGGCGCTAAGCGCCACCGCAAGGTCTTGA GAGACAACATTCAGGGCATCACCAAGCCTGCCATTCGGCGTCTAGCTCGGCGTGGCGGCGTTAAGCGGAT CTCTGGCCTCATTTACGAGGAGACCCGCGGTGTGCTGAAGGTGTTCCTGGAGAATGTGATTCGGGACGCA
  • P36222 CH3L1_HUMAN
  • NM_001276.4 Homo sapiens chitinase 3 like 1 (CHI3L1), mRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Rheumatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des peptides et des acides nucléiques pour le traitement de la polyarthrite rhumatoïde.
PCT/GB2022/050593 2021-03-08 2022-03-07 Peptide citrulliné ou analogque glutamine pour utilisation dans la prévention ou le traitement de la polyarthrite rheumatoïde WO2022189775A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB2103164.6A GB202103164D0 (en) 2021-03-08 2021-03-08 Therapy
GB2103164.6 2021-03-08

Publications (1)

Publication Number Publication Date
WO2022189775A1 true WO2022189775A1 (fr) 2022-09-15

Family

ID=75472492

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2022/050593 WO2022189775A1 (fr) 2021-03-08 2022-03-07 Peptide citrulliné ou analogque glutamine pour utilisation dans la prévention ou le traitement de la polyarthrite rheumatoïde

Country Status (2)

Country Link
GB (1) GB202103164D0 (fr)
WO (1) WO2022189775A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024117967A1 (fr) * 2022-12-01 2024-06-06 Dubnovitsky Anatoly Mimétiques peptidiques et leur utilisation

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090010943A1 (en) * 2003-03-07 2009-01-08 Jonathan Hill Peptides associated with HLA-DR MHC class II molecule and involved in Rheumatoid arthritis
EP2332987A1 (fr) * 2009-12-10 2011-06-15 ModiQuest B.V. Agents anti-inflammatoires dirigés vers les épitopes citrullinés
US8207299B2 (en) * 2004-11-04 2012-06-26 Biomerieux Citrulline peptides derived from fibrin and recognized by rheumatoid arthritis specific autoantibodies, and the use thereof
WO2014160465A2 (fr) * 2013-03-13 2014-10-02 Cour Pharmaceuticals Development Company Particules de modification immunitaire pour le traitement d'inflammation
US9012405B2 (en) * 2007-04-30 2015-04-21 Consejo Superior De Investigaciones Cientificas Citrullinated fibrin-filaggrin chimeric polypeptide capable of detecting the antibodies generated in rheumatoid arthritis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090010943A1 (en) * 2003-03-07 2009-01-08 Jonathan Hill Peptides associated with HLA-DR MHC class II molecule and involved in Rheumatoid arthritis
US8207299B2 (en) * 2004-11-04 2012-06-26 Biomerieux Citrulline peptides derived from fibrin and recognized by rheumatoid arthritis specific autoantibodies, and the use thereof
US9012405B2 (en) * 2007-04-30 2015-04-21 Consejo Superior De Investigaciones Cientificas Citrullinated fibrin-filaggrin chimeric polypeptide capable of detecting the antibodies generated in rheumatoid arthritis
EP2332987A1 (fr) * 2009-12-10 2011-06-15 ModiQuest B.V. Agents anti-inflammatoires dirigés vers les épitopes citrullinés
WO2014160465A2 (fr) * 2013-03-13 2014-10-02 Cour Pharmaceuticals Development Company Particules de modification immunitaire pour le traitement d'inflammation

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
"Peptide Map Autoimmune Epitope Microarray 2.0", 1 January 2014 (2014-01-01), XP055193469, Retrieved from the Internet <URL:http://www.pepperprint.com/fileadmin/user_upload/MDS/Peptide_Map_Autoimmune_Epitope_Microarray_2.0.xlsx> [retrieved on 20150603] *
"Remington's Pharmaceutical Sciences", 1991, MACK PUB. CO.
"UniProt", Database accession no. P02679-1
BATES IRLIBICH DSWOOD DDMOSCARELLO MAHARAUZ G: "An Arg/Lys-->Gln mutant of recombinant murine myelin basic protein as a mimic of the deiminated form implicated in multiple sclerosis", PROTEIN EXPR PURIF, vol. 25, no. 2, 2002, pages 330 - 341
BENHAM HELEN ET AL: "Citrullinated peptide dendritic cell immunotherapy in HLA risk genotype-positive rheumatoid arthritis patients - SUPPLEMENTARY MATERIALS", SCIENCE TRANSLATIONAL MEDICINE, vol. 7, no. 290, 3 June 2015 (2015-06-03), XP055921013, ISSN: 1946-6234, DOI: 10.1126/scitranslmed.aaa9301 *
H. BENHAM ET AL: "Citrullinated peptide dendritic cell immunotherapy in HLA risk genotype-positive rheumatoid arthritis patients", SCIENCE TRANSLATIONAL MEDICINE, vol. 7, no. 290, 3 June 2015 (2015-06-03), pages 290ra87 - 290ra87, XP055433102, ISSN: 1946-6234, DOI: 10.1126/scitranslmed.aaa9301 *
HARAUZ GMUSSE AA: "A Tale of Two Citrullines-Structural and Functional Aspects of Myelin Basic Protein Deimination in Health and Disease", NEUROCHEM RES, vol. 32, no. 2, 2006, pages 137 - 158, XP019483188
HILL JASOUTHWOOD SSETTE AJEVNIKAR AMBELL DACAIRNS E: "Cutting edge: The conversion of arginine to citrulline allows for a high-affinity peptide interaction with the rheumatoid arthritis-associated HLA-DRB1*0401 MHC class II molecule", J IMMUNOL, vol. 171, no. 2, 2003, pages 538 - 541
HILL JASOUTHWOOD SSETTE AJEVNIKAR AMBELL DACAIRNS E: "Cutting edge: the conversion of arginine to citrulline allows for a high-affinity peptide interaction with the rheumatoid arthritis-associated HLA-DRB1*0401 MHC class II molecule", J IMMUNOL., vol. 171, no. 2, 15 July 2003 (2003-07-15), pages 538 - 41
JEFFERY ET AL., PHARM. RES., vol. 10, 1993, pages 362 - 368
JENSEN KAMILLA KJAERGAARD ET AL: "Improved methods for predicting peptide binding affinity to MHC class II molecules", IMMUNOLOGY, vol. 154, no. 3, 1 July 2018 (2018-07-01), GB, pages 394 - 406, XP055921339, ISSN: 0019-2805, Retrieved from the Internet <URL:http://tools.iedb.org/static/pdf/IMM-154-394.pdf> DOI: 10.1111/imm.12889 *
KATOH ET AL.: "Advances in in vitro genetic code reprogramming in 2014-2017", SYNTHETIC BIOLOGY, vol. 3, no. 1, 2018
LIANMING ZHANG ET AL: "TEPITOPEpan: Extending TEPITOPE for Peptide Binding Prediction Covering over 700 HLA-DR Molecules", PLOS ONE, vol. 7, no. 2, 23 February 2012 (2012-02-23), pages e30483, XP055256429, DOI: 10.1371/journal.pone.0030483 *
MEZIERE ET AL., J. IMMUNOL., vol. 159, 1997, pages 3230 - 3237
MONDAL ET AL.: "Site-specific incorporation of citrulline into proteins in mammalian cells", NATURE COMMUNICATIONS, vol. 12, 2021, pages 45, Retrieved from the Internet <URL:https://doi.org/10.1038/s41467-020-20279-w>
PEREZ M L ET AL: "Antibodies to citrullinated human fibrinogen synthetic peptides in diagnosing rheumatoid arthritis", JOURNAL OF MEDICINAL CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 50, no. 15, 26 July 2007 (2007-07-26), pages 3573 - 3584, XP003024771, ISSN: 0022-2623, DOI: 10.1021/JM0701932 *
SIDNEY JBECART SZHOU M ET AL.: "PLoS ONE", vol. 12, 2017, article "Citrullination only infrequently impacts peptide binding to HLA class II MHC", pages: e0177140

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024117967A1 (fr) * 2022-12-01 2024-06-06 Dubnovitsky Anatoly Mimétiques peptidiques et leur utilisation

Also Published As

Publication number Publication date
GB202103164D0 (en) 2021-04-21

Similar Documents

Publication Publication Date Title
US20200407424A1 (en) Novel complexes of types of mhc class ii that bind to collagen type ii peptides and their use on diagnosis and treatment
US9340580B2 (en) Peptide with multiple epitopes
Wang et al. Immunogenic HLA-DR-presented self-peptides identified directly from clinical samples of synovial tissue, synovial fluid, or peripheral blood in patients with rheumatoid arthritis or lyme arthritis
KR20210041559A (ko) 다발경화증에서의 면역우세 단백질 및 단편
WO2022189775A1 (fr) Peptide citrulliné ou analogque glutamine pour utilisation dans la prévention ou le traitement de la polyarthrite rheumatoïde
US20230340061A1 (en) Peptides and methods for the treatment of multiple sclerosis
US20190336589A1 (en) Immunizing peptide, method for producing immunizing peptide, pharmaceutical composition for immune disease containing same, and method for treating immune disease
Zhao et al. Vaccination with a novel antigen-specific tolerizing DNA vaccine encoding CCOL2A1 protects rats from experimental rheumatoid arthritis
CN117693521A (zh) 新的肽模拟物及其用途
WO2009095646A2 (fr) Peptides du facteur viii
US20230348562A1 (en) Proinsulin Peptides for Type I Diabetes
Im et al. Protective molecular mimicry in experimental myasthenia gravis
Kela-Madar et al. Autoimmune spread to myelin is associated with experimental autoimmune encephalomyelitis induced by a neuronal protein, β-Synuclein
Liem et al. Vries-Bouwstra
WO2015000014A1 (fr) Diagnostic et traitement de maladies autoimmunes
CN118678966A (zh) 用于治疗或预防成人t细胞白血病的医药组合物
Attenuates Immune Tolerance Induction with
WO2011071039A1 (fr) Identification de l&#39;epitope hla-dr4 et utilisation pour le traitement de l&#39;arthrite

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22710709

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22710709

Country of ref document: EP

Kind code of ref document: A1