WO2022188871A1

WO2022188871A1 - Genetically modified non-human animal with human or chimeric siglec15

Info

Publication number: WO2022188871A1
Application number: PCT/CN2022/080427
Authority: WO
Inventors: Lei Zhao; Huilin LI; Suman ZHAO; Shuaishuai LIU; Maopeng TIAN
Original assignee: Biocytogen Pharmaceuticals (Beijing) Co., Ltd.
Priority date: 2021-03-12
Filing date: 2022-03-11
Publication date: 2022-09-15
Also published as: CN114751973A; CN114751973B

Abstract

Provided is genetically modified animal expressing human or chimeric (e.g., humanized) SIGLEC15, and methods of use thereof.

Description

GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC SIGLEC15

CLAIM OF PRIORITY

This application claims the benefit of Chinese Patent Application No. 202110267425.9, filed on March 12, 2021 and Chinese Patent Application No. 202110476149.7, filed on April 29, 2021. The entire contents of the foregoing are incorporated herein by reference.

TECHNICAL FIELD

This disclosure relates to a genetically modified animal expressing human or chimeric (e.g., humanized) SIGLEC15, and methods of use thereof.

BACKGROUND

SIGLEC15 (Sialic acid-binding immunoglobulin-like lectin 15) belongs to the SIGLEC family and is a type I transmembrane protein. It is rarely expressed in most normal human tissues and immune cell subsets, but has relatively high expression in macrophages. In 2007, Japanese scientist Takashi Angata first discovered that this protein can recognize sialic acid, so it was classified as the SIGLEC family. By regulating innate and adaptive immune responses, SIGLEC15 plays an important role in autoimmune diseases, inflammatory responses and tumors.

Considering the important role of SIGLEC15 in autoimmune diseases, inflammatory responses and tumors, there is a need to develop an animal model with humanized SIGLEC15.

SUMMARY

This disclosure is related to an animal model with human SIGLEC15 or chimeric SIGLEC15. The animal model can express human SIGLEC15 or chimeric SIGLEC15 (e.g., humanized SIGLEC15) protein in its body. It can be used in the studies on the function of SIGLEC15 gene, and can be used in the screening and evaluation of various drugs.

In one aspect, the disclosure is related to a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric Sialic acid-binding immunoglobulin-like lectin 15 (SIGLEC15) .

In some embodiments, the sequence encoding the human or chimeric SIGLEC15 is operably linked to an endogenous regulatory element at the endogenous SIGLEC15 gene locus in the at least one chromosome.

In some embodiments, the sequence encoding the human or chimeric SIGLEC15 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to SEQ ID NO: 10.

In some embodiments, the sequence encoding the human or chimeric SIGLEC15 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.

In some embodiments, the animal is a mammal, e.g., a monkey, a rodent or a mouse.

In some embodiments, the animal is a mouse or a rat.

In some embodiments, the animal does not express endogenous SIGLEC15 or expresses a decreased level of endogenous SIGLEC15 as compared to that of an animal without genetic modification.

In some embodiments, the animal has one or more cells expressing human or chimeric SIGLEC15.

In some embodiments, the sequence encoding the human or chimeric SIGLEC15 comprises a part ofexon 2, the entire exon 3 and a part of exon 4 of the human SIGLEC15 nucleotide sequence.

In some embodiments, the part of exon 2 comprises at least 10 bp of the human SIGLEC15 nucleotide sequence, and the part of exon 4 comprises at least 200 bp of the human SIGLEC15 nucleotide sequence.

In some embodiments, the human or chimeric SIGLEC15 protein comprises an amino acid sequence that is identical to SEQ ID NO: 10.

In some embodiments, the sequence encoding the human or chimeric SIGLEC15 comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%%, 97%, 98%or at least 99%identical to the nucleotide sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 12.

In some embodiments, the human or chimeric SIGLEC15 gene further comprises exon 1, a part of exon 2, a part of exon 4, exon 5 and exon 6 of the non-human animal's endogenous SIGLEC15 gene.

In one aspect, the disclosure is related to a genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous SIGLEC15 with a sequence encoding a corresponding region of human SIGLEC15 at an endogenous SIGLEC15 gene locus.

In some embodiments, the sequence encoding the corresponding region of human SIGLEC15 is operably linked to an endogenous regulatory element at the endogenous SIGLEC15 locus, and one or more cells of the animal expresses a chimeric SIGLEC15.

In some embodiments, the sequence encoding the corresponding region of human SIGLEC15 is under the control of the endogenous SIGLEC15 regulatory element.

In some embodiments, the animal has one or more cells expressing a chimeric SIGLEC15 having a humanized extracellular region, transmembrane region, and/or cytoplasmic region. In some embodiments, the humanized extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the corresponding extracellular region of human SIGLEC15.

In some embodiments, the human or chimeric SIGLEC15 comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to SEQ ID NO: 10.

In some embodiments, the genome of the animal comprises at least SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to the nucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11 or SEQ ID NO: 12.

In some embodiments, the animal further comprising a deletion of one or more nucleotide from the endogenous SIGLEC15 gene.

In some embodiments, the animal further comprises an endogenous SIGLEC15 gene 5'-UTR, and/or an endogenous SIGLEC15 gene 3'-UTR.

In some embodiments, the animal is heterozygous or homozygous with respect to the replacement at the endogenous SIGLEC15 gene locus.

In one aspect, the disclosure is related to a method for making a genetically-modified non-human animal, the method comprising: replacing in at least one cell of the animal, at an endogenous SIGLEC15 gene locus, a sequence encoding a region of an endogenous SIGLEC15 with a sequence encoding a corresponding region of human SIGLEC15.

In some embodiments, the sequence encoding the corresponding region of human SIGLEC15 gene comprises exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6, or a part thereof, of a human SIGLEC15 gene.

In some embodiments, the sequence encoding the corresponding region of human SIGLEC15 gene encodes a sequence that is at least 90%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.

In some embodiments, the sequence encoding the corresponding region of human SIGLEC15 gene is at least 90%identical to SEQ ID NO: 5.

In some embodiments, the sequence encoding a region of human SIGLEC15 gene is identical to SEQ ID NO: 5.

In some embodiments, the method further comprises deleting one or more nucleotides of the endogenous SIGLEC15 gene.

In some embodiments, a part of exon 2, exon 3, and a part of exon 4 of the endogenous SIGLEC15 are replaced.

In some embodiments, the sequence encoding a region of the endogenous SIGLEC15 is replaced by a part of exon 2, exon 3, and a part of exon 4 of the human SIGLEC15 gene.

In some embodiments, the part of exon 2 of the human SIGLEC15 gene comprises at least 10bp contiguous human nucleotides. In some embodiments, the part of exon 4 of the human SIGLEC15 gene comprises at least 200bp contiguous human nucleotides.

In one aspect, the disclosure is related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a humanized SIGLEC15 polypeptide wherein the humanized SIGLEC15 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human SIGLEC15. In some embodiments, the animal expresses the humanized SIGLEC15.

In some embodiments, the humanized SIGLEC15 polypeptide has at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human SIGLEC15 extracellular region.

In some embodiments, the humanized SIGLEC15 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.

In some embodiments, the nucleotide sequence is operably linked to an endogenous SIGLEC15 regulatory element of the animal (e.g., 5'-UTR) .

In some embodiments, the humanized SIGLEC15 polypeptide comprises a humanized extracellular region, an endogenous SIGLEC15 transmembrane region and/or an endogenous SIGLEC15 cytoplasmic region.

In some embodiments, the nucleotide sequence is integrated to an endogenous SIGLEC15 gene locus of the animal.

In one aspect, the disclosure is related to a method of making a genetically-modified mouse cell that expresses a chimeric SIGLEC15, the method comprising: replacing at an endogenous mouse SIGLEC15 gene locus, a nucleotide sequence encoding a region of mouse SIGLEC15 with a nucleotide sequence encoding a corresponding region of human SIGLEC15, thereby generating a genetically-modified mouse cell that includes a nucleotide sequence that encodes the chimeric SIGLEC15. In some embodiments, the mouse cell expresses the chimeric SIGLEC15.

In some embodiments, the chimeric SIGLEC15 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.

In some embodiments, the chimeric SIGLEC15 comprises: the extracellular region of human or humanized SIGLEC15; and the transmembrane region and/or the cytoplasmic region of mouse SIGLEC15.

In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein.

In some embodiments, the additional human or chimeric protein is PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, or IL10.

In some embodiments, the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.

In one aspect, the disclosure is related to a method of determining effectiveness of a therapeutic agent targeting SIGLEC15 for the treatment of an immune-related disease, comprising: administering the therapeutic agent targeting SIGLEC15 to the animal described herein, wherein the animal has an immune-related disease; and determining the effects of the therapeutic agent targeting SIGLEC15 to the immune-related disease of the animal.

In some embodiments, the immune-related disease is an autoimmune disease.

In some embodiments, determining the effects of the therapeutic agent targeting SIGLEC15 to the immune-related disease of the animal comprises measuring the T cell proliferation, cytokine secretion and killing capacity.

In some embodiments, determining the effects of the therapeutic agent targeting SIGLEC15 to the immune-related disease of the animal further comprises assessing individual body weight, fat mass, activation pathway, neuroprotective activity, or metabolic changes, and the metabolic changes include changes in food consumption or water consumption.

In one aspect, the disclosure is related to a method of determining effectiveness of a human or humanized antibody for the treatment of a disease, comprising administering the antibody to the animal described herein; and determining the effects of the antibody on the disease.

In some embodiments, the disease is a tumor.

In some embodiments, the animal further comprises a sequence encoding a human or chimeric PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, or IL10.

In some embodiments, the antibody is an anti-SIGLEC15 antibody.

In one aspect, the disclosure is related to a method of determining effectiveness of an anti-SIGLEC15 antibody for the treatment of cancer, comprising: administering the anti- SIGLEC15 antibody to the animal described herein, wherein the animal has a tumor; and determining the inhibitory effects of the anti-SIGLEC15 antibody to the tumor.

In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal.

In some embodiments, determining the inhibitory effects of the anti-SIGLEC15 antibody to the tumor comprises measuring the tumor volume in the animal.

In some embodiments, the tumor cells are breast cancer cells, colon cancer cells, or lung cancer cells.

In one aspect, the disclosure is related to a protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:

an amino acid sequence set forth in SEQ ID NO: 10;

an amino acid sequence that is at least 90%identical to SEQ ID NO: 10;

an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10;

an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and

an amino acid sequence that comprises a substitution, a deletion and/or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 10.

In one aspect, the disclosure is related to A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:

a sequence that encodes the protein described herein;

SEQ ID NO: 5;

SEQ ID NO: 9;

a sequence that is at least 90%identical to SEQ ID NO: 5 or SEQ ID NO: 9;

a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5; and

a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 9.

In one aspect, the disclosure is related to a cell comprising the protein described herein and/or the nucleic acid described herein.

In one aspect, the disclosure is related to an animal comprising the protein described herein and/or the nucleic acid described herein.

In one aspect, the disclosure relates to a method for making a genetically-modified, non-human animal, comprising: inserting at an endogenous SIGLEC15 gene locus, a sequence encoding a human SIGLEC15 or chimeric SIGLEC15. In some embodiments, the method further comprises deleting one or more nucleotides of the endogenous SIGLEC15 gene.

In addition, the animal models prepared by the methods described herein can be used in drug screening, pharmacodynamics studies, testing treatments for SIGLEC15 related diseases. The disclosure also provides a powerful tool for studying the function of SIGLEC15 protein and a platform for screening drugs.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic diagram of the comparison between (1) mouse SIGLEC15 gene and (2) human SIGLEC15 gene locus (not to scale) .

FIG. 2 is a schematic diagram of the humanization of mouse SIGLEC15 gene (not to scale) .

FIG. 3 is a schematic diagram of SIGLEC15 gene targeting strategy and targeting vector design (not to scale) .

FIG. 4 is a schematic diagram of SIGLEC15 gene targeting strategy and targeting vector design (not to scale) .

FIG. 5 shows the detected activities of sgRNA1-sgRNA16. Con is a negative control and PC is a positive control.

FIGS. 6A-6B show the PCR genotype identification results of SIGLEC15 humanized mice (F0 generation) prepared according to Example 1. WT means wild type control. H ₂O means water control. F0-01, F0-02, F0-03, F0-04 and F0-05 are mouse numbers.

FIGS. 7A-7B show the PCR genotype identification results of SIGLEC15 humanized mice (F1 generation) prepared according to Example 1. WT means wild type control. H ₂O means water control. PC means positive control. F1-01, F1-02, F1-03, and F1-04 are mouse numbers.

FIG. 8 shows the Southern Blot results of SIGLEC15 humanized mice (F1 generation) prepared according to Example 1. WT is the wild-type control. F1-01, F1-02, F1-03, F1-04, F1-05, F1-06 and F1-074 are mouse numbers.

FIGS. 9A-9C shows the detection results of humanized SIGLEC15 mRNA. +/+ is a wild-type C57BL/6 mouse. H/H is a SIGLEC15 humanized homozygous mouse. H ₂O means water control.

FIG. 10 shows the PCR genotyping results of SIGLEC15 knockout mice. WT means wild type control. H ₂O means water control. KO-01 is mouse number.

FIGS. 11A-11I show the flow cytometry detection results on SIGLEC15 protein. ISO is isotype control (human IgG1) . A, B and C are SIGLEC15 humanized mice. D, E and F are SIGLEC15 knockout mice. G, H and I are wild-type C57BL/6 mice.

FIG. 12 shows the average body weight of mice in each group measured during the experimental period. SIGLEC15 humanized homozygous mice were subcutaneously inoculated with mouse colon cancer cells MC38 overexpressing human SIGLEC15 protein, and administered with anti-human SIGLEC15 antibody AB1 or anti-mouse PD-1 antibody AB2.

FIG. 13 shows the average tumor volume of mice in each group measured during the experimental period. SIGLEC15 humanized homozygous mice were subcutaneously inoculated with mouse colon cancer cells MC38 overexpressing human SIGLEC15 protein, and administered with anti-human SIGLEC15 antibody AB1 or anti-mouse PD-1 antibody AB2.

FIG. 14 shows the average body weight of mice in each group measured during the experimental period. SIGLEC15 humanized homozygous mice were subcutaneously inoculated with mouse colon cancer cells MC38 overexpressing human SIGLEC15 protein, and administered with anti-human SIGLEC15 antibody Ab1 or Ab2.

FIG. 15 shows the average tumor volume of mice in each group measured during the experimental period. SIGLEC15 humanized homozygous mice were subcutaneously inoculated with mouse colon cancer cells MC38 overexpressing human SIGLEC15 protein, and administered with anti-human SIGLEC15 antibody Ab1 or Ab2.

FIG. 16 shows flow cytometry results of leukocyte subsets in the spleen of C57BL/6 wild-type mice and SIGLEC15 homozygous mice.

FIG. 17 shows flow cytometry results of T cell subsets in the spleen of C57BL/6 wild-type mice and SIGLEC15 homozygous mice.

FIG. 18 shows flow cytometry results of leukocyte subsets in the lymph nodes of C57BL/6 wild-type mice and SIGLEC15 homozygous mice.

FIG. 19 shows flow cytometry results of T cell subsets in the lymph nodes of C57BL/6 wild-type mice and SIGLEC15 homozygous mice.

FIG. 20 shows flow cytometry results of leukocyte subsets in the blood of C57BL/6 wild-type mice and SIGLEC15 homozygous mice.

FIG. 21 shows flow cytometry results of T cell subsets in the blood of C57BL/6 wild-type mice and SIGLEC15 homozygous mice.

FIG. 22A shows the schematic analysis flow chart for the analysis of leukocytes cell subpopulation.

FIG. 22B shows the schematic analysis flow chart for the analysis of leukocytes cell subpopulation.

FIG. 23 shows the alignment between mouse SIGLEC15 amino acid sequence (NP_001094508.1; SEQ ID NO: 1) and human SIGLEC15 amino acid sequence (NP_998767.1; SEQ ID NO: 2) .

FIG. 24 shows the alignment between rat SIGLEC15 amino acid sequence (NP_001178871.1; SEQ ID NO: 57) and human SIGLEC15 amino acid sequence (NP_998767.1; SEQ ID NO: 2) .

DETAILED DESCRIPTION

This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) SIGLEC15, and methods of use thereof.

The present disclosure provides a genetically modified animal expressing human or chimeric (e.g., humanized) SIGLEC15, and methods of use thereof and demonstrates that the genetically modified animals as described herein can be properly used in drug screening. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug testing at animal levels.

SIGLEC15

Siglecs constitute a family of cell surface proteins with an important role in the regulation of immune homeostasis. The dysregulation of these proteins has been associated with multiple diseases ranging from autoimmunity to infections and cancer. They are type I transmembrane proteins with one V-set immunoglobulin (Ig) domain containing the sialic acid-binding site and one or more C2-set Ig domains in their extracellular region. The majority of Siglecs, including CD22 (Siglec-2) and most CD33 (Siglec-3) -related Siglecs, have immunoreceptor tyrosine-based inhibitory motifs (ITIM) and/or ITIM-like motifs in their cytoplasmic domain and mediate inhibitory receptor signaling. Each Siglec preferentially recognizes a different kind of sialic acids, a group of sugars that are expressed on all mammalian cells as a mechanism to discriminate between self and nonself. But some pathogens can utilize inhibitory Siglecs to dampen the immune response and benefit their survival. Although most Siglecs work as receptors, some Siglecs can serve as functional ligands, such as Siglec-1. Siglec expression has been found mainly on hematopoietic cells (mostly on myeloid cell and B cells) or nonhematopoietic cells such as neurons. Among the Siglec family, Siglec-15 has been identified as a very unique member, selectively expressed on myeloid cells and osteoclasts (a bone-specific myeloid lineage) and generally absent in other immune cells and tissues.

The amino acid sequence alignment between human and mouse Siglec-15 shows 83%identity, and unlike other Siglecs that reside within Chromosome 19 or 1, Siglec-15 gene resides within Chromosome 18. Early studies suggested that Siglec-15 contains a conserved arginine (R143) motif in the membrane distal IgV domain, which is critical for sialic acid binding. Siglec-15 preferentially binds to Sialyl-Tn (Neu5Ac alpha 2-6GalNAc) , a short O-glycan with a sialic acid residue whose neo-or over-expression is associated with various types of epithelial cancers. Importantly, as opposed to the majority of the Siglecs that contain one IgV domain and multiple “tandem repeats” of IgC2 domains in the extracellular region, Siglec-15 displays only one IgV and one IgC2 domain, which is commonly seen in B7 family members. There is high structural homology between Siglec-15 and PD-L1, and the protein sequence of Siglec-15's extracellular domain exhibits 20%-30%identity to B7 family, similar to the identity among B7 family members. These distinctive molecular features highlight the unique nature of Siglec-15 and suggest a possible link with B7 immune modulatory molecules.

Unlike the majority of Siglec members, Siglec-15 does not have typical ITIMs or ITIM-like motifs in its intracellular domain that mediate inhibitory signaling. Instead, it was reported to be associated with signaling adaptor DNAX-activating protein of 12 kDa (DAP12) and DAP10 that contain an immunoreceptor tyrosine-based activation motif (ITAM) , through a positively charged lysine residue (K273 in mouse Siglec-15; K274 in human Siglec-15) in its transmembrane domain. The association with DAP12 and/or DAP10 is a typical feature of some Siglecs with activating signaling, such as Siglec-14 and Siglec-16, which is possibly achieved through the recruitment of spleen tyrosine kinase (SYK) and ZAP70 among others.

Siglec-15 has been identified as an important regulator in osteoclast differentiation and function. Yoshiharu and colleagues, in an attempt to identify regulators for osteoclast-like giant cell tumors, discovered that Siglec-15 was upregulated on osteoclasts upon stimulation by receptor activator of nuclear factor-κB ligand. Knockdown of Siglec-15 by shRNA or treatment with polyclonal antibodies against Siglec-15 inhibits osteoclast differentiation and bone resorption. Sialyl-acid/Siglec-15 axis may constitute a functional loop for osteoclast differentiation-removal of sialyl acids by sialidase or disruption of sialylated glycan binding by R143 mutation impaired osteoclast development. DAP12 may be needed for Siglec-15 function in osteoclasts, as the K273 mutation that disrupted the DAP12 association with Siglec-15 led to the function loss of Siglec-15 in osteoclasts. However, it is still unclear whether Siglec-15 mainly serves as a receptor or ligand, and how important DAP-12 and DAP-10 association is for Siglec-15′s osteoclast function.

Given its structural similarities with B7 family and dominant expression pattern on myeloid cells, it was hypothesized that Siglec-15 might be involved in the regulation of immunity. In early 2010, using the TCAA screening platform, one group observed inhibition of NFκB reporter activity in Jurkat T cells by HEK-293T cells expressing Siglec-15. In addition, Siglec-15 ectodomain fusion protein either coated on plates or supplied in soluble form, robustly inhibited anti-CD3 (OKT3) induced human T-cell proliferation. In line with this, Siglec-15 expression on artificial APCs suppressed mouse T-cell proliferation, cytokine secretion, and killing capacity. These in vitro data suggested a ligand-like function of Siglec-15 that suppresses human or mouse T cells through unknown receptor (s) signaling. In vivo function of Siglec-15 on T cells was subsequently validated using an experimental autoimmune encephalomyelitis (EAE) mouse model. It was found that EAE was significantly aggravated in Siglec-15 deficient mice or by injecting Siglec-15 ectodomain fusion protein, and T-cell response was remarkably amplified in comparison with control groups. In addition, it was observed that Siglec-15 affects antigen-specific T-cell responses-Siglec-15-deficient mice showed a much higher OT-I T-cell expansion in the blood and spleen compared with WT mice upon OVA peptide stimulation, which resembles the phenotype in PD-L1 KO mice. In this process, IL10 might be an important factor since Siglec15-deficient mice showed decreased IL10 levels in serum compared with WT, and anti-IL10 mAbs abrogated the differences in OT-I T-cells expansion between WT and Siglec-15-deficient mice.

Meta-analysis of the TCGA database indicated that, while limited expression was found in most normal tissues, Siglec-15 mRNA is broadly upregulated across many different tumor types. Further analysis by IHC in a tissue microarray of 241 human non-small cell lung cancer (NSCLC) samples confirmed Siglec-15 protein expression in 25.7%of samples. Siglec-15 can be detected not only on tumor stroma including tumor-associated macrophages (TAM) but also on human cancer cells, as well as several human tumor cell lines. In addition to Siglec-15′s unique induction mechanism by M-CSF, we demonstrated that IFNγ, the major inducer of PD-L1, significantly suppresses Siglec-15 expression on macrophages. Thus, Siglec-15 may exhibit a complementary expression profile to PD-L1. It was observed that the expression of Siglec-15 and PD-L1 shows a mutually exclusive pattern in NSCLC TME. Moreover, there is higher Siglec-15 expression in EGFR-mutant lung cancers.

On the basis of the preclinical functional activity and expression pattern of Siglec-15, the safety of a humanized anti-Siglec-15 mAb, named NC318, is being evaluated in a first-in-human phase I clinical trial in advanced solid tumors (NCT03665285) . NC318 was derived from B-cell hybridoma screening (clone 5G12) , which specifically binds to both mouse and human Siglec-15 (Wang J, Sun J, Liu LN, Flies DB, Nie X, Toki M, et al Siglec-15 as an immune suppressor and potential target for normalization cancer immunotherapy. Nat Med 2019; 25: 656-66) . This mAb can efficiently restore T-cell function in vitro and inhibit tumor growth in preclinical models (Liu L, Wang J, Sun J, Flies D, Song C, Zarr M, et alAbstract: targeting Siglec-15 with NC318, a novel therapeutic antibody to enhance anti-tumor immunity. The Society for Immunotherapy of Cancer (SITC) Annual Meeting. 2018 (P678) ) .

A detailed review of SIGLEC15 and its functions can be found in Sun, Jingwei, et al. “Siglec-15 as an emerging target for next-generation cancer immunotherapy. ” Clinical Cancer Research 27.3 (2021) : 680-688, which is incorporated by reference in its entirety.

The mouse SIGLEC15 gene (Gene ID: 620235) is located in Chromosome 18 of the mouse genome, and corresponds to nucleotide 78042493 to 78057441 of NC_000084.6 (GRCm38. p6 (GCF_000001635.26) ) . The 5'UTR is from 78, 057, 395 to 78, 057, 270, exon 1 is from 78, 057, 395 to 78, 057, 217, the first intron is from 78, 057, 216 to 78, 049, 290, exon 2 is from 78, 049, 289 to 78, 049, 230, the second intron is from 78, 049, 229 to 78, 048, 873, exon 3 is from 78, 048, 872 to 78, 048, 489, the third intron is from 78, 048, 488 to 78, 047, 586, exon 4 is from 78, 047, 585 to 78, 047, 211, the fourth intron is from 78, 047, 210 to 78, 046, 157, exon 5 is from 78, 046, 156 to 78, 046, 126, the fifth intron is from 78, 046, 125 to 78, 043, 741, exon 6 is from 78, 043, 740 to 78, 043, 614, base on transcript NM_001101038.2. All relevant information for mouse SIGLEC15 locus can be found in the NCBI website with Gene ID: 620235, which is incorporated by reference herein in its entirety. The location for each exon and each region in mouse SIGLEC15 nucleotide sequence and amino acid sequence is listed below:

Table 1

The human SIGLEC15 gene (Gene ID: 284266) is located in Chromosome 18 of the human genome, which is located from 45825675 to 45844094 of NC_000018.10 (GRCh38. p13 (GCF_000001405.39) ) . The5'-UTR is from 45, 825, 675 to 45, 825, 728, exon 1 is from 45, 825, 675 to 45, 825, 780, the first intron is from 45, 825, 781 to 45, 837, 028, exon 2 is from 45, 837, 029 to 45, 837, 088, the second intron is from 45, 837, 089 to 45, 837, 512 , exon 3 is from 45, 837, 513 to 45, 837, 896, the third intron is from 45, 837, 897 to 45, 838, 717, exon 4 is from 45, 838, 718 to 45, 839, 095, the fourth intron is from 45, 839, 096 to 45, 840, 210, exon 5 is from 45, 840, 211 to 45, 840, 241, the fifth intron is from 45, 840, 242 to 45, 842, 105, exon 6 is from 45, 842, 106 to 45, 844, 094, the 3'-UTR is from 45, 843, 187 to 45, 844, 094, base on transcript NM_213602.3. All relevant information for human SIGLEC15 locus can be found in the NCBI website with Gene ID: 284266, which is incorporated by reference herein in its entirety. The location for each exon and each region in the human SIGLEC15 nucleotide sequence and amino acid sequence is listed below:

Table 2

SIGLEC15 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for SIGLEC15 in Rattus norvegicus is 498888, the gene ID for SIGLEC15 in Macaca mulatta (Rhesus monkey) is 700656, the gene ID for SIGLEC15 in Canis lupus familiaris (dog) is 100855945, the gene ID for SIGLEC15 in Pan troglodytes (chimpanzee) is 455394, the gene ID for SIGLEC15 in Bos taurus (cattle) is 522776, and the gene ID for SIGLEC15 in Gallus gallus (chicken) is 770432. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety.

The present disclosure provides human or chimeric (e.g., humanized) SIGLEC15 nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, signal peptide, extracellular region, transmembrane region, and/or cytoplasmic region are replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, signal peptide, extracellular region, transmembrane region, and/or cytoplasmic region are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 500, or 600 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, signal peptide, extracellular region, transmembrane region, or cytoplasmic region. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6 are replaced by the human exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6 sequence.

In some embodiments, the present disclosure also provides a chimeric (e.g., humanized) SIGLEC15 nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse SIGLEC15 gene, mouse SIGLEC15 amino acid sequence (e.g., SEQ ID NO: 1) , or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human SIGLEC15 gene sequence, human SIGLEC15 amino acid sequence (e.g., SEQ ID NO: 2) , or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6) .

In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse SIGLEC15 promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.

In some embodiments, the nucleic acids as described herein are operably linked to a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) . In some embodiments, the nucleic acids as described herein are operably linked to a polyA (polyadenylation) signal sequence.

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire mouse SIGLEC15 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse SIGLEC15 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from a portion of or the entire human SIGLEC15 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human SIGLEC15 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse SIGLEC15 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 or SEQ ID NO: 1) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse SIGLEC15 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 or SEQ ID NO: 1) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human SIGLEC15 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or SEQ ID NO: 2) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human SIGLEC15 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or SEQ ID NO: 2) .

The present disclosure also provides a humanized SIGLEC15 mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

a) an amino acid sequence shown in SEQ ID NO: 10;

b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 10;

c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 10 under a low stringency condition or a strict stringency condition;

d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 10;

e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

f) an amino acid sequence that comprises a substitution, a deletion and /or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 10.

The present disclosure also relates to a SIGLEC15 nucleic acid (e.g., DNA, RNA or mRNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) a nucleic acid sequence as shown in SEQ ID NO: 9, or a nucleic acid sequence encoding a homologous SIGLEC15 amino acid sequence of a humanized mouse;

b) a nucleic acid sequence that is shown in SEQ ID NO: 9;

c) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 9 under a low stringency condition or a strict stringency condition;

d) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 9;

e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 10;

f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 10;

g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or

h) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and /or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 10.

The present disclosure further relates to a SIGLEC15 genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by a reverse transcription of the mRNA sequence homologous to the sequence shown in SEQ ID NO: 9.

The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 10, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 10 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 10 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 9, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 9 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.

In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g. leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.

Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) SIGLEC15 from an endogenous SIGLEC15 locus.

Genetically modified animals

As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal's genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, a macrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous SIGLEC15 locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wildtype nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wildtype amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be e.g., a human exon or a chimeric exon.

In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized SIGLEC15 gene or a humanized SIGLEC15 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human SIGLEC15 gene, at least one or more portions of the gene or the nucleic acid is from a non-human SIGLEC15 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes a SIGLEC15 protein. The encoded SIGLEC15 protein is functional or has at least one activity of the human SIGLEC15 protein or the non-human SIGLEC15 protein, e.g., binding with sialic acid.

In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized SIGLEC15 protein or a humanized SIGLEC15 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human SIGLEC15 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human SIGLEC15 protein. The humanized SIGLEC15 protein or the humanized SIGLEC15 polypeptide is functional or has at least one activity of the human SIGLEC15 protein or the non-human SIGLEC15 protein.

The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129/SvEv-and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) .

In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized SIGLEC15 animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and/or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, IL2Rγ knockout mice, NOD/SCID/γc ^null mice (Ito, M. et al., NOD/SCID/γc ^null mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) : 3175-3182, 2002) , nude mice, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human SIGLEC15 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, IL-2Rγ knockout mice, NOD/SCID/γc ^null mice, nude mice, Rag1 and/or Rag2 knockout mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature SIGLEC15 coding sequence with the corresponding human mature SIGLEC15 coding sequence or an insertion of human mature SIGLEC15 coding sequence or chimeric SIGLEC15 coding sequence.

Genetically modified non-human animals that comprise a modification of an endogenous non-human SIGLEC15 locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature SIGLEC15 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the mature SIGLEC15 protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous SIGLEC15 locus in the germline of the animal.

Genetically modified animals can express a human SIGLEC15 and/or a chimeric (e.g., humanized) SIGLEC15 from endogenous loci, wherein the endogenous mouse SIGLEC15 gene has been replaced with a human SIGLEC15 gene and/or a nucleotide sequence that encodes a region of human SIGLEC15 sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human SIGLEC15 sequence. In various embodiments, an endogenous non-human SIGLEC15 locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature SIGLEC15 protein.

In some embodiments, the genetically modified animals (e.g., mice) can express a human SIGLEC15 and/or a chimeric (e.g., humanized) SIGLEC15.

In some embodiments, the genetically modified mice express the human SIGLEC15 and/or chimeric SIGLEC15 (e.g., humanized SIGLEC15) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human SIGLEC15 or chimeric SIGLEC15 (e.g., humanized SIGLEC15) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human SIGLEC15 or the chimeric SIGLEC15 (e.g., humanized SIGLEC15) expressed in animal can maintain one or more functions of the wildtype mouse or human SIGLEC15 in the animal. For example, human or non-human SIGLEC15 ligands (e.g., sialic acid) can bind to the expressed SIGLEC15. Furthermore, in some embodiments, the animal does not express endogenous SIGLEC15. As used herein, the term “endogenous SIGLEC15” refers to SIGLEC15 protein that is expressed from an endogenous SIGLEC15 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human SIGLEC15 (SEQ ID NO: 2) .

The genome of the genetically modified animal can comprise a replacement at an endogenous SIGLEC15 gene locus of a sequence encoding a region of endogenous SIGLEC15 with a sequence encoding a corresponding region of human SIGLEC15. In some embodiments, the sequence that is replaced is any sequence within the endogenous SIGLEC15 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, 5'-UTR, 3'-UTR, the first intron, the second intron, the third intron, the fourth intron, the fifth intron, the sixth intron, the extracellular region, the cytoplasmic region, etc. In some embodiments, the sequence that is replaced is a part of exon 2, exon 3 and a part of exon 4 of the endogenous SIGLEC15 gene.

In some embodiments, a sequence that encodes an amino acid sequence (e.g., human SIGLEC15 or chimeric SIGLEC15) is inserted after 5'-UTR (e.g., immediately after 5'-URT) , or immediately before the start codon (e.g., within 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleic acids) . The start codon is the first codon of a messenger RNA (mRNA) transcript translated by a ribosome. The start codon always codes for methionine in eukaryotes and a modified Met (fMet) in prokaryotes. The most common start codon is ATG (or AUG in mRNA) .

In some embodiments, the inserted sequence further comprises a stop codon (e.g., TAG, TAA, TGA) . The stop codon (or termination codon) is a nucleotide triplet within messenger RNA that signals a termination of translation into proteins. Thus, the endogenous sequence after the stop codon will not be translated into proteins. In some embodiments, at least one exon of (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6) of the endogenous SIGLEC15 gene are not translated into proteins.

The genetically modified animal can have one or more cells expressing a human or chimeric SIGLEC15 (e.g., humanized SIGLEC15) having an extracellular region and a cytoplasmic region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to one of the extracellular regions of human SIGLEC15. In some embodiments, the extracellular region of the humanized SIGLEC15 has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 amino acids (e.g., contiguously or non-contiguously) that are identical to one of the extracellular regions of human SIGLEC15. In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to part or the entire sequence of exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6 of human SIGLEC15, or part or the entire sequence of the extracellular region of human SIGLEC15 (with or without signal peptide) .

In some embodiments, the non-human animal can have, at an endogenous SIGLEC15 gene locus, a nucleotide sequence encoding a chimeric human/non-human SIGLEC15 polypeptide, wherein a human portion of the chimeric human/non-human SIGLEC15 polypeptide comprises a portion of the human SIGLEC15 extracellular region, and wherein the animal expresses a functional SIGLEC15 on a surface of a cell of the animal. The human portion of the chimeric human/non-human SIGLEC15 polypeptide can comprise a portion of exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6 of human SIGLEC15. In some embodiments, the human portion of the chimeric human/non-human SIGLEC15 polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99%identical to SEQ ID NO: 2.

In some embodiments, the non-human animal genome also includes other genetic modifications. In some embodiments, the other genes include one or more of human PD-1, PD-L1, CTLA4, LAG3, IL4, IL6, and CCR4 genes. In some embodiments, the other genes include one or more of H2-D, B2M, PD-1, PD-L1, CTLA4, B7H3, B7H4, CD47 and IL23A. In some embodiments, the other genes include one or more of PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, and IL10.

In some embodiments, the nucleotide sequence of the humanized SIGLEC15 includes one of the following groups:

(1) all or part of the nucleotide sequence shown in SEQ ID NO: 9;

(2) at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%identity with the nucleotide sequence shown in SEQ ID NO: 9, 94%, 95%, 96%, 97%, 98%or at least 99%;

(3) no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide difference from the nucleotide sequence shown in SEQ ID NO: 9; or

(4) the nucleotide sequence shown in the nucleotide sequence shown in SEQ ID NO: 9, including substitution, deletion and/or insertion of one or more nucleotides.

In some embodiments, the humanized SIGLEC15 gene further comprises an auxiliary sequence, which is connected after the human SIGLEC15 gene. Further preferably, the auxiliary sequence is selected from a stop codon, a flip sequence or a knockout sequence. More preferably, the auxiliary sequence is 3'UTR and/or polyA of a non-human animal.

In some embodiments, the non-human animal can have transcribed mRNA sequence including one of the following groups:

(1) all or part of the nucleotide sequence shown in SEQ ID NO: 9;

In some embodiments, the humanized SIGLEC15 gene also includes a specific inducer or repressor. Further preferably, the specific inducer or repressor can be a conventional inducing or repressing substance.

In a specific embodiment of the present invention, the specific inducer is selected from the tetracycline system (Tet-Off System/Tet-On System) or the tamoxifen system (Tamoxifen System) .

In some embodiments, the non-human portion of the chimeric human/non-human SIGLEC15 polypeptide comprises the transmembrane and/or cytoplasmic region of an endogenous non-human SIGLEC15 polypeptide.

Furthermore, the genetically modified animal can be heterozygous with respect to the replacement or insertion at the endogenous SIGLEC15 locus, or homozygous with respect to the replacement or insertion at the endogenous SIGLEC15 locus.

In some embodiments, the genetically modified animal (e.g., a rodent) comprises a humanization of an endogenous SIGLEC15 gene, wherein the humanization comprises a replacement at the endogenous rodent SIGLEC15 locus of a nucleic acid comprising an exon of a SIGLEC15 gene with a nucleic acid sequence comprising at least one exon of a human SIGLEC15 gene to form a modified SIGLEC15 gene.

In some embodiments, the genetically modified animal (e.g., a rodent) comprises an insertion at the endogenous rodent SIGLEC15 locus of a nucleic acid sequence comprising at least one exon of a human SIGLEC15 gene to form a modified SIGLEC15 gene.

In some embodiments, the expression of the modified SIGLEC15 gene is under control of regulatory elements at the endogenous SIGLEC15 locus. In some embodiments, the modified SIGLEC15 gene is operably linked to a WPRE element.

In some embodiments, the humanized SIGLEC15 locus lacks a human SIGLEC15 5'-UTR. In some embodiment, the humanized SIGLEC15 locus comprises a rodent (e.g., mouse) 5'-UTR. In some embodiments, the humanization comprises a human 3'-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human SIGLEC15 genes appear to be similarly regulated based on the similarity of their 5'-flanking sequence. As shown in the present disclosure, humanized SIGLEC15 mice that comprise an insertion at an endogenous mouse SIGLEC15 locus, which retain mouse regulatory elements but comprise a humanization of SIGLEC15 encoding sequence, do not exhibit obvious pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized SIGLEC15 are grossly normal.

The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) .

In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

In some embodiments, the non-human mammal expresses a protein encoded by a humanized SIGLEC15 gene.

In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized SIGLEC15 in the genome of the animal.

In some embodiments, the non-human mammal comprises the genetic construct as described herein (e.g., gene construct as shown in FIGS. 1-4) . In some embodiments, a non-human mammal expressing human or humanized SIGLEC15 is provided. In some embodiments, the tissue-specific expression of human or humanized SIGLEC15 protein is provided.

In some embodiments, the expression of human or humanized SIGLEC15 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance.

Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a rodent, e.g., a mouse.

Genetic, molecular and behavioral analyses for the non-human mammals described above can performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human SIGLEC15 protein or chimeric SIGLEC15 protein can be detected by a variety of methods.

There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized SIGLEC15 protein.

In some embodiments, the humanized SIGLEC15 protein comprises all or part of the amino acid sequence encoded by exons 1 to 6 of the human SIGLEC15 gene. In some embodiments, the humanized SIGLEC15 protein comprises all or part of the human SIGLEC15 amino acid sequence encoded by any one, two, three or more, two consecutive or three or more consecutive exons of the human SIGLEC15 gene. In some embodiments, the humanized SIGLEC15 protein comprises the entire amino acid sequence encoded by exons 1-6 of the human SIGLEC15 gene.

In some embodiments, the humanized SIGLEC15 protein comprises the amino acid sequence encoded by a part of exon 2, all of exon 3 and a part of exon 4 of the human SIGLEC15 gene. In some embodiments, the part of exon 2 of the human SIGLEC15 gene contains at least the start codon to the last nucleotide of exon 2. In some embodiments, the part of exon 2 contains at least 10bp (for example, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 bp) nucleotides. In some embodiments, the part of exon 2 contains 22bp nucleotides. In some embodiments, the part of exon 4 contains at least from the first nucleotide of exon 4 to the stop codon. In some embodiments, the part of exon 4 contains at least 200bp (for example, 200, 210, 220, 230, 240, 241, 242, 243, 244, 245, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 378bp) nucleotides. In some embodiments, the part of the exon 6 contains 242bp nucleotides.

In some embodiments, the signal peptide, the transmembrane region and the cytoplasmic region of the humanized SIGLEC15 protein are derived from non-human animals. In some embodiments, the extracellular region of at most 30 amino acids is derived from the extracellular region of the non-human animal SIGLEC15 protein. In some embodiments, the extracellular region of the humanized SIGLEC15 protein comprises 0-10 amino acids of the extracellular region of non-human animal SIGLEC15 protein at the N-terminal and/or 0-20 amino acids of the extracellular region of non-human animal SIGLEC15 protein at the C-terminal.

In some embodiments, the construction method comprises using a signal peptide, a transmembrane region, a cytoplasmic region and/or an extracellular region encoding the human SIGLEC15 protein. The whole or part of the nucleotide sequence is introduced into the non-human animal SIGLEC15 locus; preferably, the whole or part of the nucleotide sequence comprising the extracellular region encoding the human SIGLEC15 protein is introduced into the non-human animal SIGLEC15 locus; A nucleotide sequence encoding at least 100 amino acid sequences of the extracellular region of human SIGLEC15 protein is introduced into the non-human animal SIGLEC15 locus; An amino acid sequence of %, 95%or at least 99%identity or comprising an amino acid sequence identical to positions 31-246 of SEQ ID NO: 2 is introduced into the non-human animal SIGLEC15 locus. In some embodiments, the humanized SIGLEC15 protein comprises at least the amino acid sequence encoded by SEQ ID NO: 10, or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to that encoded by SEQ ID NO: 10.

In some embodiments, the SIGLEC15 humanized animal comprises all or part of exons 1 to 6 of the human SIGLEC15 gene. In some embodiments, the SIGLEC15 humanized animal comprises all or part of any one, two, three or more, two consecutive or three or more consecutive exons of the human SIGLEC15 gene. In some embodiments, the SIGLEC15 humanized animal comprises the entire exons 1-6 of the human SIGLEC15 gene.

In a specific embodiment of the present invention, the humanized SIGLEC15 gene comprises a part of exon 2, all of exon 3, and a part of exon 4 of the human SIGLEC15 gene. In some embodiments, the part of exon 2, the whole of exon 3, and the part of exon 4 have at least 70%, 75%, 80%, 85%, 90%or at least 95%sequence identity to all or part of the corresponding exons 1 to 6 of human SIGLEC15 gene. In some embodiments, the part of exon 2, all of exon 3, and the part of exon 4 of the human SIGLEC15 gene are identical to all or part of the corresponding exons 1 to 6 of human SIGLEC15 gene.

In a specific embodiment of the present invention, the humanized SIGLEC15 gene comprises at least the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4, or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identity to the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

In another specific embodiment of the present invention, the humanized SIGLEC15 gene comprises at least the nucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12, or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identity to the nucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12.

In some embodiments, the humanized SIGLEC15 gene comprises at least SEQ ID NO: 5, or nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to SEQ ID NO: 5.

In some embodiments, the humanized SIGLEC15 gene further includes all of exon 1, part of exon 2, part of exon 4, all of exon 5 and all of exon 6 of the non-human animal SIGLEC15 gene. In some embodiments, the all of exon 1, part of exon 2, part of exon 4, all of exon 5 and all of exon 6 of the non-human animal SIGLEC15 gene have at least 70%, 75%, 80%, 85%, 90%or at least 95%identity to the corresponding exon 1, exon 2, exon 4, exon 5 and exon 6 of the mouse SIGLEC15 gene.

Vectors

The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5' end of a region to be altered (5' arm) , which is selected from the SIGLEC15 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3' end of the region to be altered (3' arm) , which is selected from the SIGLEC15 gene genomic DNAs in the length of 100 to 10,000 nucleotides.

In some embodiments, a) the DNA fragment homologous to the 5' end of a conversion region to be altered (5' arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000084.6; c) the DNA fragment homologous to the 3' end of the region to be altered (3' arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000084.6.

In some embodiments, a) the DNA fragment homologous to the 5' end of a region to be altered (5' arm) is selected from the nucleotides from the position 78049252-78053412 of the NCBI accession number NC_000084.6 (SEQ ID NO: 3) ; c) the DNA fragment homologous to the 3' end of the region to be altered (3' arm) is selected from the nucleotides from the position 78042522-78046612 of the NCBI accession number NC_000084.6 (SEQ ID NO: 4) .

In some embodiments, a) the DNA fragment homologous to the 5' end of a region to be altered (5' arm) is selected from the nucleotides from the position 78049252-78050600 of the NCBI accession number NC_000084.6 (SEQ ID NO: 11) ; c) the DNA fragment homologous to the 3' end of the region to be altered (3' arm) is selected from the nucleotides from the position 78046002-78047346 of the NCBI accession number NC_000084.6 (SEQ ID NO: 12) .

In some embodiments, the targeting vector comprises a 5' arm that is a 100-10,000 nucleotide long nucleotide sequence of the non-human animal's SIGLEC15 gene. In some embodiments, the 5' arm has at least 90%homology with the NCBI accession number NC_000084.6. In some embodiments, the 5' arm sequence has at least 90%homology with SEQ ID NO: 3 or 11. In some embodiments, the targeting vector comprises a 3' arm that is a 100-10000 nucleotide long nucleotide sequence of the non-human animal's SIGLEC15gene. In some embodiments, the 3' arm has at least 90%homology with the NCBI accession number NC_000084.6. In some embodiments, the 3' arm sequence has at least 90%homology with SEQ ID NO: 4 or 12.

In some embodiments, the targeting vector further comprises a 5' arm, which is selected from the 100-10,000-length nuclei of the non-human animal SIGLEC15 genomic DNA. nucleotide; preferably, the 5' arm and the NCBI accession number are nucleotides with at least 90%homology; further preferably, the 5' arm sequence and SEQ ID NO: 3 or 11 At least 90%homology, or as shown in SEQ ID NO: 3 or 11; and/or, the targeting vector further comprises a 3' arm, which is selected from 100-10000 of the genomic DNA of the non-human animal SIGLEC15 gene A length of nucleotides; preferably, the 3' arm has at least 90%homology with the NCBI accession number NC_000084.6; further preferably, the 3' arm sequence and SEQ ID NO: 4 or 12 has at least 90%homology, or as shown in SEQ ID NO: 4 or 12.

In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 1kb, about 2 kb, about 3 kb, or about 5 kb.

In some embodiments, the region to be altered is exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6 of SIGLEC15 gene.

The targeting vector can further include a selection gene marker.

In some embodiments, the sequence of the 5' arm is shown in SEQ ID NO: 3 or 11; and the sequence of the 3' arm is shown in SEQ ID NO: 4 or 12.

In some embodiments, the sequence is derived from human. For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human SIGLEC15 or a chimeric SIGLEC15. In some embodiments, the nucleotide sequence of the humanized SIGLEC15 encodes the entire or the part of human SIGLEC15 protein (SEQ ID NO: 2) .

The disclosure also relates to a cell comprising the targeting vectors as described above.

In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell.

Methods of making genetically modified animals

Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., “Delivery technologies for genome editing, ” Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous SIGLEC15 gene locus, a sequence encoding a region of an endogenous SIGLEC15 with a sequence encoding a corresponding region of human SIGLEC15, a sequencing encoding human SIGLEC15, or a sequencing encoding chimeric SIGLEC15.

In some embodiments, the disclosure provides inserting in at least one cell of the animal, at an endogenous SIGLEC15 gene locus, a sequence encoding a human SIGLEC15 or a chimeric SIGLEC15.

In some embodiments, the genetic modification occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

In some embodiments, the disclosure provides inserting or replacing all or part of a combination of any one, two, three or more, two consecutive or three or more consecutive exons of exons 1 to 6 of the human SIGLEC15 gene into the non-human animal SIGLEC15 locus. In some embodiments, a part of exon 2, all of exon 3, and a part of exon 4 of the human SIGLEC15 gene is inserted or replaced into a non-human animal SIGLEC15 locus. In some embodiments, the part of exon 2 of the human SIGLEC15 gene contains at least the start codon to the last nucleotide of exon 2. In some embodiments, the part of exon 2 contains at least 10bp (for example, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 bp) nucleotides. In some embodiments, the part of exon 2 contains 22bp nucleotides. In some embodiments, the part of exon 4 contains at least from the first nucleotide of exon 4 to the stop codon. In some embodiments, the part of exon 4 contains at least 200bp (for example, 200, 210, 220, 230, 240, 241, 242, 243, 244, 245, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 378bp) nucleotides. In some embodiments, the part of the exon 6 contains 242bp nucleotides. In some embodiments, the inserted sequence includes from the start codon to the stop codon of the human SIGLEC15 gene. In some embodiments, the inserted sequence includes a coding region (CDS) of the human SIGLEC15 gene.

In some embodiments, the method comprises using a signal peptide, a transmembrane region, a cytoplasmic region and/or an extracellular region encoding the human SIGLEC15 protein. In some embodiments, the whole or part of the human SIGLEC15 nucleotide sequence is introduced into the non-human animal's SIGLEC15 locus. In some embodiments, the whole or part of the nucleotide sequence encoding the extracellular region of the human SIGLEC15 protein is introduced into the non-human animal's SIGLEC15 locus. In some embodiments, a nucleotide sequence encoding at least 100 amino acids of the extracellular region of human SIGLEC15 protein is introduced into the non-human animal's SIGLEC15 locus. In some embodiments, a nucleotide sequence encoding an amino acid sequence that is 90%, 95%or at least 99%identical to positions 31-246 of SEQ ID NO: 2 is introduced into the non-human animal SIGLEC15 locus. In some embodiments, the humanized SIGLEC15 protein comprises the amino acid sequence encoded by SEQ ID NO: 10, or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to that encoded by SEQ ID NO: 10.

In a specific embodiment of the present invention, the construction method comprises inserting or replacing the cDNA sequence of human SIGLEC15 into the non-human animal locus. In some embodiments, the construction method comprises inserting or replacing the nucleotide sequence comprising SEQ ID NO: 5 into the non-human animal's endogenous SIGLEC15 gene locus.

In some embodiments, the construction method comprises replacing all or part of exons 2 to 4 of the non-human animal SIGLEC15 nucleotide sequence with a cDNA sequence comprising human SIGLEC15 gene sequence. In some embodiments, the construction method comprises using a cDNA sequence comprising SEQ ID NO: 5 into the non-human animal's endogenous SIGLEC15 gene locus to replace a part of exon 2, all of exon 3 and a part of exon 4 of the endogenous non-human animal SIGLEC15 nucleotide sequence. In some embodiments, the replaced sequence includes introns 2-3 of a non-human animal's endogenous SIGLEC15 gene. In some embodiments, the part of exon 2 of the non-human animal's endogenous SIGLEC15 gene includes at least the start codon of the non-human animal SIGLEC15 gene to the last nucleotide of exon 2.

FIG. 3 shows an exemplary humanization strategy for a mouse SIGLEC15 locus. In FIG. 3, the targeting strategy involves a vector comprising the 5' end homologous arm, human SIGLEC15 gene fragment or chimeric SIGLEC15 gene fragment, 3' homologous arm. The process can involve inserting a human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strand breaks, and the homologous recombination is used to insert the human SIGLEC15 sequence. In some embodiments, a sequence encoding the human or chimeric SIGLEC15 gene is used to replace a part of exon 2, all of exon 3 and a part of exon 4 of the endogenous mouse SIGLEC15 gene. In some embodiments, the sequence encoding the human or chimeric SIGLEC15 gene comprises a part of exon 2, all of exon 3, and a part of exon 4 of the human SIGLEC15 gene. In some embodiments, the sequence encoding the human or chimeric SIGLEC15 gene further comprises a polyA sequence. In some embodiments, the sequence encoding the human or chimeric SIGLEC15 gene further comprises a Neo cassette. In some embodiments, the SIGLEC15 humanized animal comprises all of exon 1, a part of exon 2, a part of exon 4, all of exon 5, and all of exon 6 of the endogenous SIGLEC15 gene. In some embodiments, the sequence of the 5' homology arm is shown in SEQ ID NO: 3 and the sequence of the 3' homology arm is shown in SEQ ID NO: 4. In some embodiments, the donor sequence is shown in SEQ ID NO: 5.

FIG. 4 shows an exemplary humanization strategy for a mouse SIGLEC15 locus. In FIG. 8, the targeting strategy involves a vector comprising the 5' end homologous arm, human SIGLEC15 gene fragment or chimeric SIGLEC15 gene fragment, 3' homologous arm. The process can involve inserting a human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strand breaks, and the homologous recombination is used to insert the human SIGLEC15 sequence. In some embodiments, a sequence encoding the human or chimeric SIGLEC15 gene is used to replace a part of exon 2, all of exon 3, and a part of exon 4 of the endogenous mouse SIGLEC15 gene. In some embodiments, the sequence encoding the human or chimeric SIGLEC15 gene comprises a part of exon 2, all of exon 3, and a part of exon 4 of the human SIGLEC15 gene. In some embodiments, the SIGLEC15 humanized animal comprises all of exon 1, a part of exon 2, a part of exon 4, all of exon 5 and all of exon 6 of the endogenous SIGLEC15 gene. In some embodiments, the sequence of the 5' homology arm is shown in SEQ ID NO: 11 and the sequence of the 3' homology arm is shown in SEQ ID NO: 12. In some embodiments, the donor sequence is shown in SEQ ID NO: 5.

Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of inserting at an endogenous SIGLEC15 locus (or site) , a sequence encoding a human SIGLEC15 or a chimeric SIGLEC15. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 of a human SIGLEC15 gene. In some embodiments, the sequence includes a region of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 of a human SIGLEC15 gene (e.g., SEQ ID NO: 2) . In some embodiments, the endogenous SIGLEC15 locus is exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6 of mouse SIGLEC15 (e.g., SEQ ID NO: 1) .

In some embodiments, the methods of modifying a SIGLEC15 locus of a mouse to express a chimeric human/mouse SIGLEC15 peptide can include the steps of replacing at the endogenous mouse SIGLEC15 locus a nucleotide sequence encoding a mouse SIGLEC15 with a nucleotide sequence encoding a human SIGLEC15, thereby generating a sequence encoding a chimeric human/mouse SIGLEC15.

The present disclosure further provides a method for establishing a SIGLEC15 gene humanized animal model, involving the following steps:

(a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;

(b) culturing the cell in a liquid culture medium;

(c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

(d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 mouse) .

In some embodiments, the non-human mammal in step (c) is a female with pseudo pregnancy (or false pregnancy) .

In some embodiments, the fertilized eggs for the methods described above are C57BL/6 fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB/N fertilized eggs, BALB/c fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.

Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.

In some embodiments, the method for making the genetically modified animal comprises:

(1) providing a plasmid comprising a human SIGLEC gene fragment, flanked by a 5' homology arm and a 3' homology arm, wherein the 5' and 3' homology arms target an endogenous SIGLEC15 gene;

(2) providing two small guide RNAs (sgRNAs) that target the endogenous SIGLEC15 gene;

(3) modifying genome of a fertilized egg or an embryonic stem cell by using the plasmid of step (1) , the sgRNAs of step (2) , and Cas9;

(4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudopregnant female mouse or transplanting the embryonic stem cell obtained in step (3) into a blastocyst which is then transplanted into the oviduct of a pseudopregnant female mouse to produce a child mouse that functionally expresses a humanized SIGLEC15 protein; and

(5) mating the child mouse obtained in step (2) to obtain a homozygote mouse,

In some embodiments, the fertilized egg is modified by CRISPR with sgRNAs that target a 5’-terminal targeting site selected from the group consisting of SEQ ID NO: 13-20 and a 3'-terminal targeting site selected from the group consisting of SEQ ID NO: 21-28.

In some embodiments, the humanized SIGLEC15 protein comprises SEQ ID NO: 10.

In some embodiments, the 5'-terminal targeting site is SEQ ID NO: 14 and the 3’-terminal targeting site is SEQ ID NO: 24.

In some embodiments, the sequence encoding the humanized SIGLEC15 protein is operably linked to an endogenous regulatory element at the endogenous SIGLEC15 gene locus.

In some embodiments, the genetically-modified animal does not express an endogenous SIGLEC15 protein.

Methods of using genetically modified animals

Insertion of human genes in a non-human animal at the endogenous non-human locus and under control of endogenous promoters and/or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and/or protein assay and/or functional assay. Inclusion in the human transgene of upstream and/or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and/or regulation of the transgene.

In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.

Genetically modified animals that express human or humanized SIGLEC15 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or the efficacy of these human therapeutics in the animal models.

In various aspects, genetically modified animals are provided that express human or humanized SIGLEC15, which are useful for testing agents that can decrease or block the interaction between SIGLEC15 and SIGLEC15 ligands (e.g., sialic acid) or the interaction between SIGLEC15 and anti-human SIGLEC15 antibodies, testing whether an agent can increase or decrease the SIGLEC15 pathway activity, and/or determining whether an agent is an SIGLEC15 agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout) . In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, such as a human solid tumor or a blood cell tumor (e.g., a lymphocyte tumor, e.g., a B or T cell tumor) .

In some embodiments, the genetically modified animals can be used for determining effectiveness of a SIGLEC15 targeting agent for the treatment of autoimmune diseases. The methods involve administering the agent (e.g., anti-human SIGLEC15 antibody) to the animal as described herein, wherein the animal has an autoimmune disease; and determining the efficacy. In some embodiments, the agent is an anti-human SIGLEC15 antibody.

In some embodiments, the genetically modified animals can be used for determining whether an agent (e.g., an anti-SIGLEC15 antibody or a fusion protein) is a SIGLEC15 agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the agent (e.g., anti-SIGLEC15 antibodies) on SIGLEC15, e.g., whether the agent can change the SIGLEC15 mediated signal transduction of the genetically modified animals. In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., metabolic disorders.

In some embodiments, the agent is designed for treating various immune-related diseases. Thus, the methods as described herein can be used to determine the effectiveness of an agent targeting SIGLEC15 (e.g., anti-SIGLEC15 antibody) in treating the immune-related diseases. The immune-related diseases include but are not limited to allergies, asthma, dermatitis, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, and primary thrombocytopenia Purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc.

“Autoimmune disease” refers to a class of diseases in which a subject’s own antibodies react with host tissue or in which immune effector T cells are autoreactive to endogenous self-peptides and cause destruction of tissue. Thus an immune response is mounted against a subject's own antigens, referred to as self-antigens. A “self-antigen” as used herein refers to an antigen of a normal host tissue. Normal host tissue does not include neoplastic cells.

Accordingly, in some embodiments, the autoimmune diseases to be evaluated using the genetically modified animals described herein, include, but are not limited to: rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, primary sclerosing cholangitis, systemic lupus erythematosus (SLE) , autoimmune encephalomyelitis, myasthenia gravis (MG) , Hashimoto's thyroiditis, Goodpasture's syndrome, pemphigus (e.g., pemphigus vulgaris) , Grave's disease, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, scleroderma with anti-collagen antibodies, mixed connective tissue disease, polymyositis, pernicious anemia, idiopathic Addison's disease, autoimmune-associated infertility, Kawasaki's disease, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis) , bullous pemphigoid, Sjogren's syndrome, insulin resistance, and autoimmune diabetes mellitus (type 1 diabetes mellitus; insulin-dependent diabetes mellitus) . Autoimmune disease has been recognized also to encompass atherosclerosis and Alzheimer's disease. In one embodiment of the aspects described herein, the autoimmune disease is selected from the group consisting of multiple sclerosis, type-I diabetes, Hashinoto's thyroiditis, Crohn's disease, rheumatoid arthritis, systemic lupus erythematosus, gastritis, autoimmune hepatitis, hemolytic anemia, autoimmune hemophilia, autoimmune lymphoproliferative syndrome (ALPS) , autoimmune uveoretinitis, glomerulonephritis, Guillain-Barre syndrome, psoriasis and myasthenia gravis.

In some embodiments, the genetically modified animals can be used for determining effectiveness of a drug for the treatment of cancer. In some embodiments, the methods involve administering a drug to the animal as described herein, wherein the animal has a tumor; and determining the inhibitory effects of the drug to the tumor.

The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT.

In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the drug is an SIGLEC15 antibody.

The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGITV) . The tumor growth inhibition rate can be calculated using the formula TGITV (%) = (1-TVt/TVc) x 100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

In some embodiments, the drug is an SIGLEC15 antibody. In some embodiments, the dosage of the drug is equal to or more than 1 mg/kg, 2 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 40 mg/kg or 50 mg/kg. In some embodiments, the dosage of the drug is equal to or less than 1 mg/kg, 2 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 40 mg/kg or 50 mg/kg. In some embodiments, the dosage of the drug is 1-5 mg/kg, 1-10 mg/kg, 1-20 mg/kg, 1-30 mg/kg, 1-50 mg/kg, 2-5 mg/kg, 2-10 mg/kg, 2-20 mg/kg, 2-30 mg/kg, 2-50 mg/kg, 5-10 mg/kg, 5-20 mg/kg, 5-30 mg/kg, 5-50 mg/kg, 10-20 mg/kg, 10-30 mg/kg or 10-50 mg/kg.

In some embodiments, the drug can reduce the tumor volume in the SIGLEC15 humanized animal as compared with the SIGLEC15 humanized animal treated with control. In some embodiments, the TGITV%in the treatment group is more than 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%. In some embodiments, the TGITV%in the treatment group is less than 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%. In some embodiments, the TGITV%in the treatment group is 5%-10%, 5%-20%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 10%-20%, 10%-30%, 10%-40%, 10%-50%, 10%-60%, 20%-30%, 20%-40%, 20%-50%, 20%-60%, 30%-40%, 30%-50%or 30%-60%.

In some embodiments, the p value of body weight change in the treatment group is equal to or more than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1. In some embodiments, the p value of body weight change in the treatment group is equal to or more than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1. . In some embodiments, the p value of body weight change in the treatment group is 0.01-0.1, 0.01-0.2, 0.01-0.5, 0.01-1, 0.05-0.1, 0.05-0.2, 0.05-0.5, 0.05-1, 0.1-0.2, 0.1-0.5, or 0.1-1.

In some embodiments, the p value of tumor volume change in the treatment group is equal to or more than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1. In some embodiments, the p value of tumor volume change in the treatment group is equal to or more than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.. In some embodiments, the p value of tumor volume change in the treatment group is 0.01-0.1, 0.01-0.2, 0.01-0.5, 0.01-1, 0.05-0.1, 0.05-0.2, 0.05-0.5, 0.05-1, 0.1-0.2, 0.1-0.5, or 0.1-1.

In some embodiments, the drug is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.

In some embodiments, the drug is designed for treating melanoma (e.g., advanced melanoma) , non-small cell lung carcinoma (NSCLC) , small cell lung cancer (SCLC) , B-cell non-Hodgkin lymphoma, bladder cancer, and/or prostate cancer (e.g., metastatic hormone-refractory prostate cancer) . In some embodiments, the drug is designed for treating hepatocellular, ovarian, colon, or cervical carcinomas. In some embodiments, the drug is designed for treating advanced breast cancer, advanced ovarian cancer, and/or advanced refractory solid tumor. In some embodiments, the drug is designed for treating metastatic solid tumors, NSCLC, melanoma, non-Hodgkin lymphoma, colorectal cancer, and multiple myeloma. In some embodiments, the drug is designed for treating melanoma, pancreatic carcinoma, mesothelioma, hematological malignancies (e.g., Non-Hodgkin's lymphoma, lymphoma, chronic lymphocytic leukemia) , or solid tumors (e.g., advanced solid tumors) . In some embodiments, the drug is designed for treating carcinomas (e.g., nasopharynx carcinoma, bladder carcinoma, cervix carcinoma, kidney carcinoma or ovary carcinoma) .

In some embodiments, the present disclosure provides a tumor-bearing or inflammation model in the evaluation of a treatment of immune-related diseases, tumors and/or inflammation.

The present disclosure also provides a method for screening a specific modulator. The screening method includes applying the modulator to an individual implanted with tumor cells to detect tumor suppressive properties; wherein, the individual is selected from the aforementioned non-human animal, the non-human animal obtained by the aforementioned construction method, or the aforementioned tumor-bearing or metabolic disease model. In some embodiments, the modulator is a modulator targeting SIGLEC15.

In some embodiments, the modulator is selected from CAR-T and drugs. Further preferably, the drug is an antibody or a small molecule drug.

In some embodiments, the modulator is a monoclonal antibody or a bispecific antibody or a combination of two or more drugs.

In some embodiments, the detection includes determining the size and/or proliferation rate of tumor cells.

In some embodiments, the detection method includes vernier caliper measurement, flow cytometry detection and/or in vivo animal imaging detection.

In some embodiments, the detection includes assessing individual body weight, fat mass, activation pathway, neuroprotective activity, or metabolic changes, and the metabolic changes include changes in food consumption or water consumption.

In some embodiments, the tumor cells are derived from human or non-human animals.

In some embodiments, the screening method for the modulator is not a treatment method. This screening method is used to screen or evaluate drugs, test and compare the efficacy of candidate drugs to determine which candidate drugs can be used as drugs and which cannot be used as drugs, or to compare the sensitivity of different drugs, that is, the therapeutic effect is not inevitable and is just a possibility.

The present disclosure also provides methods of determining toxicity of a drug (e.g., a drug that targets SIGLEC15) . The methods involve administering the drug to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin. In some embodiments, the drug can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40%smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody) .

The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processe of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the SIGLEC15 gene function, human SIGLEC15 antibodies, drugs for human SIGLEC15 targeting sites, the drugs or efficacies for human SIGLEC15 targeting sites, the drugs for metabolic disorders, the drugs for immune-related diseases and antitumor drugs.

Genetically modified animal model with two or more human or chimeric genes

The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric SIGLEC15 gene and a sequence encoding an additional human or chimeric protein.

In some embodiments, the additional human or chimeric protein can be cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , B And T Lymphocyte Associated (BTLA) , Glucagon-like peptide-1 (IgG) , CD27, CD28, CD40, CD47, CD137, CD154, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR- Related Protein (GITR) , TNF Receptor Superfamily Member 4 (TNFRSF4 or OX40) , programmed cell death protein 1 (PD-1) , or programmed cell death 1 ligand (PD-L1) .

The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

(a) using the methods of introducing human SIGLEC15 gene or chimeric SIGLEC15 gene as described herein to obtain a genetically modified non-human animal;

(b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric PD-1, CTLA-4, LAG-3, BTLA, CD27, CD28, CD40, CD47, CD137, CD154, TIGIT, TIM-3, GITR, SIRPa, or OX40. Some of these genetically modified non-human animals are described, e.g., in PCT/CN2017/090320, PCT/CN2017/099577, PCT/CN2017/099575, PCT/CN2017/099576, PCT/CN2017/099574, PCT/CN2017/106024, PCT/CN2017/110494, PCT/CN2017/110435, PCT/CN2017/120388, PCT/CN2018/081628, PCT/CN2018/081629; each of which is incorporated herein by reference in its entirety.

In some embodiments, the SIGLEC15 humanization is directly performed on a genetically modified animal having a human or chimeric CTLA-4, BTLA, CD27, CD28, CD40, CD47, CD137, CD154, TIGIT, TIM-3, GITR, or OX40 gene.

As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., a drug targeting SIGLEC15 and an additional therapeutic agent for the treatment of various disease. The methods include administering the drug targeting SIGLEC15 and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to CTLA-4, BTLA, CD27, CD28, CD40, CD47, CD137, CD154, TIGIT, TIM- 3, GITR, or OX40. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-PD-1 antibody, or an anti-CTLA4 antibody.

EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

In the following examples, equipment and materials were obtained from the companies indicated below:

BbsI, EcoRI, BamHI, BspHI, EcoNI enzymes were purchased from NEB, and the product numbers are R0539S, R0101M, R0136M, R0517L, R0521L respectively;

C57BL/6 mice and Flp tool mice were purchased from the National Rodent Laboratory Animal Seed Center, National Institutes for Food and Drug Control;

Ambion In Vitro Transcription Kit was purchased from Ambion, Cat. No. AM1354;

Cas9mRNA was purchased from SIGMA, Cat. No. CAS9MRNA-1EA;

The UCA kit was purchased from Biocytogen, Cat. No. BCG-DX-001;

Purified anti-mouse CD16/32 was purchased from B iolegend, Cat. No. 101302;

Fixable Viability Dye eFluor ^TM506 was purchased from eBioscience, Cat. No. 65-0866-14;

APC/Cy7 anti-mouse F4/80 was purchased from Biolegend, Cat. No. 123118;

V450 Rat Anti-mouse CD11b was purchased from BD Horizon, Cat. No. 560455;

Anti-mouse MHC II (I-A/I-E) Super Bright 600 was purchased from eBioscience, Cat. No. 63-5321-80;

Anti-Mo CD206 (MMR) eBioscience PE/Cyanine ^TM 7 was purchased from eBioscience, Cat. No. 25-2061-80;

Alexa

647-conjugated AffiniPure F (ab') 2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific was purchased from Jackson Immuno Research, Cat. No. 109-606-170;

Recombinant Murine M-CSF was purchased from PeproTech, Cat. No. 315-02;

Attune NxT Flow Cytometer was purchased from Thermo Fisher, model No. Attune NxT

Brilliant Violet 510 ^TM anti-mouse CD45 was purchased from Biolegend, Cat. No. 103138;

PerCP anti-mouse Ly-6G/Ly-6C (Gr-1) Antibody was purchased from Biolegend, Cat. No. 108426; Brilliant Violet 421 ^TM anti-mouse CD4 was purchased from Biolegend, Cat. No. 100438;

FITC anti-mouse F4/80 was purchased from Biolegend, Cat. No. 123108;

PE anti-mouse CD8a Antibody was purchased from Biolegend, Cat. No. 100708;

PE/Cy ^TM 7 Mouse anti-mouse NK1.1 was purchased from BD Pharmingen, Cat. No. 552878;

APC anti-mouse/rat Foxp3 was purchased from eBioscience, Cat. No. 17-5773-82;

FITC anti-Mouse CD19 was purchased from Biolegend, Cat. No. 115506;

PerCP/Cy5.5 anti-mouse TCRβ chain was purchased from Biolegend, Cat. No. 109228.

Example 1. Preparation of SIGLEC15 gene humanized mice

Mouse SIGLEC15 gene (NCBI Gene ID: 620235, Primarry source: MGI: 3646642, UniProt ID: A7E1W8, located at positions 78042493 to 78057441 of chromosome 18 NC_000084.6, corresponding to mRNA sequence NM_001101038.2 and protein sequence NP_001094508.1 (SEQ ID NO: 1) ) and the human SIGLEC15 gene (NCBI Gene ID: 284266, Primary source: HGNC: 27596, UniProt ID: Q6ZMC9, located at positions 45825675 to 45844094 of chromosome 18 NC_000018.10, corresponding to mRNA sequence NM_213602.3 and protein sequence NP_998767.1 (SEQ ID NO: 2) ) are shown in Fig. 1.

A nucleotide sequence encoding human SIGLEC15 protein was introduced into the mouse endogenous SIGLEC15 locus, so that the mouse expresses human or humanized SIGLEC15 protein. Specifically, the mouse SIGLEC15 gene sequence was replaced by the DNA sequence of the human SIGLEC15 gene at the mouse endogenous SIGLEC15 locus by gene editing technology. In some embodiments, a sequence of at least about 1.9 kb of the mouse SIGLEC15 gene was replaced with the corresponding human SIGLEC15 gene sequence. The DNA sequence was replaced to obtain the humanized SIGLEC15 locus (the schematic diagram is shown in Fig. 2) .

Targeting vector was designed based on the targeting strategy shown in Fig. 3. The targeting vector 1 in the figure contains a 5' homology arm, a 3' homology arm and an A fragment containing the human SIGLEC15 gene sequence. Among them, the 5' homology arm (SEQ ID NO: 3) is the same as nucleotide 78049252-78053412 of NCBI accession number NC_000084.6; the 3' homology arm (SEQ ID NO: 4) is the same as nucleotide 78042522-78046612 of the NCBI accession number NC_000084.6; the human SIGLEC15 gene (SEQ ID NO: 5) is the same as nucleotide 45837067-45838959 of NCBI accession number NC_000018.10. The connection between the human SIGLEC15 sequence in fragment A and the downstream mouse sequence is designed as 5'-ccgctacacgtgtacggccgccaacagcctgggcc gctcc

cagcgtctacctgttccgcttccacggcgcccccg-3' (SEQ ID NO: 6) , where the last “c” in the sequence “gctcc” is the last nucleotide of the human sequence, and the first “g” in the sequence “gaggc” is the first nucleotide of the mouse sequence.

Targeting vector 1 also includes a resistance gene as a positive screening marker, namely, the coding sequence Neo of neomycin phosphotransferase, and two site-specific Frt recombination sites arranged in the same direction on both sides of the resistance gene, forming a Neo cassette. The connection between the 5' end of the Neo cassette and the upstream mouse sequence is designed as 5'-ctggcctgggaacccaggttacttttagagtctca gtact

TGATATCGAATTCCGAAGTTCCTATTCTC TAGAAA-3' (SEQ ID NO: 7) , where the last “t” of the sequence “gtact” is the last nucleotide of the mouse sequence, and the first “A” of the sequence “AAGCT” is the first nucleotide of the Neo cassette. The connection between the 3' end of the Neo cassette with the downstream mouse sequence is designed as 5'-AGGTACATAATGGTGGATCCACTAGTTCTAGAGCG GCCGC

gctgctgtccctgaccttgatggg tcatctgctga-3' (SEQ ID NO: 8) , where the last “C” of the sequence “GCCGC” is the last nucleotide of the Neo cassette and the “t” of the sequence “tccaa” is the first nucleotide of the mouse sequence. In addition, a negative selection marker (the gene encoding the A subunit of diphtheria toxin (DTA) ) was added downstream of the 3' homology arm of the recombinant vector. The SIGLEC15 mRNA sequence of the SIGLEC15 humanized mouse is shown in SEQ ID NO: 9, and the expressed protein sequence is shown in SEQ ID NO: 10.

The construction of the targeting vector can be carried out by conventional methods, such as enzyme cleavage and ligation. The constructed targeting vector is preliminarily verified by enzyme digestion, and then sent to a sequencing company for sequencing verification. The target vector verified by sequencing was electroporated into embryonic stem cells of wild-type mice, and the obtained cells were screened using the positive screening marker. The integration of exogenous sequences was detected by PCR, and the correct ones were selected as positive clones. The screened correct positive cloned cells (black mice) were introduced into the isolated blastocysts (white mice) according to techniques known in the art, and the obtained chimeric blastocysts were transferred to a cell culture medium for a short-term culture and then transplanted to the oviduct of recipient female mice (white mice) to produce F0 generation chimeric mice (black and white) . The F0 generation chimeric mice and wild-type mice were backcrossed to obtain the F 1 generation mice, and then the F 1 generation heterozygous mice were mated to one another to obtain the F2 generation homozygous mice. Also, the positive mouse and the Flp tool mouse can be mated with the positive mice to remove the positive screening marker gene, and then the SIGLEC15 gene humanized homozygous mouse can be obtained by mating with each other.

In addition, the CRISPR/Cas system can also be used for gene editing to realize the humanization of the mouse SIGLEC15 gene. As shown in Fig. 4, the targeting vector 2 contains the upstream and downstream homology arm sequences of the mouse SIGLEC15 gene and the human SIGLEC15 gene sequence, wherein the upstream homology arm sequence (5' The homology arm, SEQ ID NO: 11) corresponds to nucleotide 78049252-78050600 of NCBI accession number NC_000084.6, and the downstream homology arm sequence (3' homology arm, SEQ ID NO: 12) corresponds to nucleotide 78046002-78047346 of NCBI accession number NC_000084.6; the human SIGLEC15 gene sequence is the same as the SIGLEC15 gene sequence of the A fragment in FIG. 3. The SIGLEC15 mRNA sequence and protein sequence of the SIGLEC15 humanized mouse are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

The construction of the targeting vector can be carried out by conventional methods, such as enzyme cleavage and ligation. The constructed targeting vector is preliminarily verified by enzyme digestion, and then sent to a sequencing company for sequencing verification. Sequencing-validated targeting vectors were used for subsequent experiments.

The target sequence determines the targeting specificity of the sgRNA and the efficiency of Cas9 cleavage. Therefore, target sequence selection and design are the prerequisites for constructing sgRNA expression vectors. sgRNA sequences that recognize target sequences are designed and synthesized. In this example, the target sequences are located on

exons

2 and 4 of the SIGLEC15 gene. The target sequences of each sgRNA on SIGLEC15 are as follows:

sgRNA1 target sequence (SEQ ID NO: 13) : 5'-CCCCTCGACTTCCGGAGGCAGGG-3'

sgRNA2 target sequence (SEQ ID NO: 14) : 5'-GGTAGTGTGGGTCACACGCCAGG-3'

sgRNA3 target sequence (SEQ ID NO: 15) : 5'-TCCCTGCCTCCGGAAGTCGAGGG-3'

sgRNA4 target sequence (SEQ ID NO: 16) : 5'-TGTGCTCCCCCATAACTAAAAGG-3'

sgRNA5 target sequence (SEQ ID NO: 17) : 5'-CCACTCCCCTCGACTTCCGGAGG-3'

sgRNA6 target sequence (SEQ ID NO: 18) : 5'-TTGGACAGTTTGTTTCATCCTGG-3'

sgRNA7 target sequence (SEQ ID NO: 19) : 5'-AAAGAGTTGCTGAGATGCTATGG-3'

sgRNA8 target sequence (SEQ ID NO: 20) : 5'-CCCGTATTACAAGATCCCTAAGG-3'

sgRNA9 target sequence (SEQ ID NO: 21) : 5'-TTGCCCGCGCTGACCCGCGACGG-3'

sgRNA10 target sequence (SEQ ID NO: 22) : 5'-GTGCACGGCGGCCAATAGCCTGG-3'

sgRNA11 target sequence (SEQ ID NO: 23) : 5'-TGGCCGCCGTGCACGTGTAGCGG-3'

sgRNA12 target sequence (SEQ ID NO: 24) : 5'-TGCACGGCGGCCAATAGCCTGGG-3'

sgRNA13 target sequence (SEQ ID NO: 25) : 5'-TCACCTGGTAGCCGTGACCCTGG-3'

sgRNA14 target sequence (SEQ ID NO: 26) : 5'-GCCTGGTCGGGTCCCGCCCCAGG-3'

sgRNA15 target sequence (SEQ ID NO: 27) : 5'-GCCTGGGGCGGGACCCGACCAGG-3'

sgRNA16 target sequence (SEQ ID NO: 28) : 5'-AGGGCAGCGGAGCTGTTGCCTGG-3'

Table 3 UCA test results

The activities of multiple sgRNAs were tested using the UCA kit. The results showed that the sgRNAs have different activities. The detection results are shown in Table 3 and Fig. 5. Based on the activity, target sequence position and sequence specificity of each sgRNA, sgRNA2 and sgRNA12 were selected for subsequent experiments. The forward strand and the reverse strand were obtained by adding restriction sites on the 5' end of the forward strand and the corresponding region on the reverse strand (see Table 4) . After annealing, the annealed products were ligated into the pT7-sgRNA plasmid (plasmid was first linearized with BbsI) to obtain the expression vectors pT7-SIGLEC15-2 and pT7-SIGLEC15-12.

Table 4 Forward and reverse strands of sgRNA2 and sgRNA12

The pT7-sgRNA vector was synthesized by a plasmid synthesis company. A fragment DNA (SEQ ID NO: 37) containing the T7 promoter and sgRNA scaffold was synthesized and ligated to the scaffold vector (source Takara, Cat. No. 3299) by enzyme digestion (EcoRI and BamHI) in turn. The vector was verified by sequencing at a sequencing company.

The fertilized eggs of C57BL/6 wild-type mice were taken. The in vitro transcription products of pT7-SIGLEC15-2 and pT7-SIGLEC15-12 plasmids (obtained using the Ambion in vitro transcription kit) , the targeting vector and Cas9 mRNA were pre-mixed and injected into the cytoplasm or nucleus of the mouse fertilized eggs using a microinjection device. The microinjection of the fertilized eggs was carried out according to the method in “Experimental Manual for Mouse Embryo Operation (Third Edition) ” (Andras Nagy, Chemical Industry Press, 2006) . The injected fertilized eggs were transferred to a cell culture medium for a short-term culture before being transplanted into the oviduct of the recipient female mouse. The obtained mice (F0 generation) were interbred to expand the population and establish a stable SIGLEC15 humanized mouse strain.

The genotypes ofF0 mouse somatic cells were determined by PCR primer pairs L-GT-F/L-GT-R and R-GT-F/R-GT-R (primer sequences and target fragment lengths are shown in Table 5) . The identification results of some F0 generation mice are shown in Fig. 6. The three mice numbered F0-01, F0-02, and F0-03 are positive mice without random insertion, which were further verified by sequencing.

Table 5 PCR detection primer sequences and target fragment length

The SIGLEC15 humanized F0 mice identified as positive were mated with C57BL/6 wild-type mice to obtain F 1 generation mice. F 1 generation mice were genotyped using PCR primer pairs WT-F/WT-R and WT-F/Mut-R (Table 5) . Exemplary results are shown in Fig. 7. As shown in Fig. 7, the mice numbered F1-01 to F1-04 were positive mice. Southern blot was performed on the four F 1 mice identified by PCR to be positive to check the presence of random insertions. genomic DNA was taken from the tails of the mice, and the DNA samples were digested with BspHI enzyme or EcoNI enzyme, transferred to membrane, and hybridized. The 5' Probe is located at the left side of the 5' homology arm and the 3' Probe is located in the human sequence. The lengths of the target fragments are shown in Table 6.

Table 6 Lengths of specific probes and target fragments

The probe sequences are as follows:

5'Probe-F (SEQ ID NO: 45) : 5'-TGGCCTGAACGCCTAATAACTCTCC-3'

5'Probe-R (SEQ ID NO: 46) : 5'-CATGGTCGCCAGCCTACTTTCACTT-3'

3'Probe-F (SEQ ID NO: 47) : 5'-CCACCCTGCTCTGCGACAATAATGG-3'

3'Probe-R (SEQ ID NO: 48) : 5'-GCACCGAGATGTTGACGATCCGC-3'

The results of Southern blot detection are shown in Fig. 8. Based on the results of 5'Probe and 3'Probe, and based on further verification by sequencing, the four mice numbered F1-01, F1-02, F1-03, and F1-04 did not have random insertions, confirming that these four mice were positive heterozygous mice with no random insertions. The obtained F1 generation positive heterozygous mice were crossed to obtain F2 generation SIGLEC15 humanized homozygous mice. Thus, the instant method was used to successfully obtain SIGLEC15 humanized genetically engineered mice that can be stably passaged and have no random insertions.

The humanized SIGLEC15 mRNA expression in the positive mice can be confirmed by conventional detection methods, such as RT-PCR. One female wild-type C57BL/6 mouse and one SIGLEC15 humanized homozygous mouse prepared in this example were selected. After euthanasia by cervical decapitation, ovarian tissues were collected to detect the expression of humanized SIGLEC15 mRNA. As shown in Fig. 9, only murine SIGLEC15 mRNA was detected in wild-type C57BL/6 mice (Fig. 9A) ; only humanized SIGLEC15 mRNA (no murine SIGLEC15 mRNA) was detected in SIGLEC15 humanized homozygous mice (Fig. 9B) .

RT-PCR detection primer sequence:

mSIGLEC15-F (SEQ ID NO: 49) : 5'-GAGAGTCGCCATGGGGTCCG-3'

mSIGLEC15-R (SEQ ID NO: 50) : 5'-GCTCGGAGCCTCTGTGAGCAG-3'

hSIGLEC15-F (SEQ ID NO: 51) : 5'-CGTCCATGACCGCTACGAGA-3'

hSIGLEC15-R (SEQ ID NO: 52) : 5'-TGACTAGATGGTGATGGCTGAGG-3'

GAPDH-F (SEQ ID NO: 53) : 5'-TCACCATCTTCCAGGAGCGAGA-3'

GAPDH-R (SEQ ID NO: 54) : 5'-GAAGGCCATGCCAGTGAGCTT-3'

In addition, due to the double-strand breaks of genomic DNA caused by Cas9 cleavage, random insertions/deletions may be generated by the DNA repair mechanism, which may lead to the gene knockout mice with loss of SIGLEC15 protein function. A pair of primers were designed to identify gene knockout mice. Wild-type mice should have no PCR band, and gene knockout mice should have one PCR band. The length of the PCR product should be about 569 bp. The results are shown in Fig. 10. The mouse numbered KO-01 was further verified by sequencing to be a SIGLEC15 knockout mouse. The primers are located on the left side of the 5' end of the target sequence and the right side of the 3' end of the target sequence, respectively. The primer sequences are as follows:

SEQ ID NO: 55: 5'-TTTGCCTCAACATCGCAGTTACTCCA-3'

SEQ ID NO: 56: 5'-CTCAAAATCCTTTGCAGAGCCACCA-3'

The expression of humanized SIGLEC15 protein in SIGLEC15 humanized mice and SIGLEC15 gene knockout mice can be determined by conventional methods, such as flow cytometry. A wild-type C57BL/6 mouse, a SIGLEC15 humanized homozygous mouse and a SIGLEC15 gene knockout mouse prepared in this example were selected. After euthanasia by cervical dislocation, bone marrow cells were taken and induced to differentiate into macrophages with M-CSF-containing medium, after lysis of red blood cells. Flow cytometry detection was performed using the blocking antibody purified anti-mouse CD16/32, the dead cell identification dye Fixable Viability Dye eFluor ^TM506, and the macrophage labeling antibodies V450 rat-anti-mouse CD11b and APC/Cy7 anti-mouse F4/80, M2 macrophage marker antibody Anti-Mo CD206 (MMR) eBioscience PE/Cyanine ^TM 7, M1 macrophage marker antibody eBioscience anti-mouse MHC II (IA/IE) Super Bright 600, primary antibody SIGLEC15-IgG1 (obtained by using conventional methods) cross-recognizing human and mouse SIGLEC15, and secondary antibody Alexa Fluor 647-conjugated AffiniPure Goat Anti-Human IgG. Human IgG1 was used as the isotype control. The detection results are shown in Fig. 11. As shown in Fig. 11, SIGLEC15 protein was not detected on the surface of the differentiated macrophages of SIGLEC15 knockout mice (Figs. 11D, 1iE, 11F) . By constrast, SIGLEC15 protein was found on the surface of differentiated macrophages from both the SIGLEC15 humanized homozygous mice (11A, 11B, 11C) and wild-type C57BL/6 mice (Figs. 11G, 11H, 11I) , and the SIGLEC15 expression in the M2 type macrophages was higher than that in the M1 type macrophages. Considering the RT-PCR detection results in Fig. 9, only humanized SIGLEC15 protein can be detected in SIGLEC15 gene homozygous mice, while only murine SIGLEC15 protein can be detected in wild-type C57BL/6 mice.

Example 2. Preparation of double humanized or multiple humanized mice

The method of Example 1 can be modified to prepare double or multiple humanized mouse models. For example, in the aforementioned Example 1, the embryonic stem cells used for blastocyst microinjection can be selected from mice containing PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, IL10, and other genetic modifications. The prepared SIGLEC15 gene humanized mouse model can also be used to prepare double or multiple humanized mouse models. For example, on the basis of the SIGLEC15 humanized mice, SIGLEC15 and other gene-modified double-gene or multi-gene-modified mouse models can be obtained using the isolation of mouse embryonic stem cells and gene recombination targeting technology. The homozygous or heterozygous SIGLEC15 humanized mouse obtained by this method can also be mated with other gene-modified homozygous or heterozygous mice, and the offspring are screened. According to Mendelian inheritance, there is a certain probability to obtain heterozygous mice containing both a humanized SIGLEC15 and one or more additional modified genes. The heterozygotes can be mated with each other to obtain double gene or multigene modified homozygotes. These double gene or multigene modified mice can be used to test the efficacy of human SIGLEC15 targeting drugs and drugs targeting other genes.

Example 3. Testing efficacy using the SIGLEC15 humanized mouse model

The 8-week-old female SIGLEC15 gene humanized homozygous mice obtained in Example 1 were selected and subcutaneously inoculated with mouse colon cancer cells MC38 (5 × 10 ⁵ cells) overexpressing human SIGLEC15 protein. After the tumor volume reached about 100 mm ³, the mice were divided into control group or treatment group (n=5/group) based on tumor volume. The control group were injected with phosphate buffered saline (PBS) , and the treatment group were given different doses of anti-human SIGLEC15 antibody AB1 or anti-mouse PD-1 antibody AB2 (both were obtained by immunizing mice using conventional methods, see Janeway's Immunobiology (9th Edition) ) . Treatment schedule was as follows: intraperitoneal injection (i.p. ) , starting on the day of group assignment, twice a week, for a total of 6 times. Tumor volume was measured twice a week, and a mouse was euthanized when the tumor volume in that mouse reached 3000 mm ³. The specific group assignment and dosage are shown in Table 7. The body weight and tumor volume measurements are shown in Fig. 12 and Fig. 13, respectively.

Table 7 Group assignment and dosage

Data and analysis results of each experiment are listed in Table 8, including tumor volume at the time of group assignment, 9 days after group assignment, and 20 days after group assignment, mouse survival, tumor-free mice, Tumor Growth Inhibition value (TGI _TV) and the statistical difference (P value) of tumor volume between the treatment group and the control group.

Table 8 Tumor volume, survival and tumor inhibition rate (TGI _TV)

Overall, the animals in each group were in good health during the experiment, and the body weights of all the treatment groups (G2, G3 and G4 groups) and the control group (G1) showed an increasing trend (Fig. 12) , indicating that the animals tolerated well the anti-human SIGLEC15 antibody AB1 and the anti-mouse PD-1 antibody AB2 (neither AB1 nor AB2 has obvious toxic effects on animals, and the safety is good) . Based on the results of tumor volume measurement, throughout the experiment, the tumor volume of the treatment group was always smaller than that of the control group (Fig. 13) ; on the 20th day after administration, the tumor volumes in the treatment groups G2, G3, and G4 (1643±278mm ³, 1398±168mm ³ and 1277±274mm ³) were all reduced compared with that in the control group G1 (1735±173mm ³) . Among them, the tumor volume of the anti-mouse PD-1 antibody AB2 treatment group (G4) was smaller than that of the anti-human SIGLEC15 antibody treatment group. It shows that different antibodies have different tumor suppressing effects in SIGLEC15 gene humanized mice. For the anti-human SIGLEC15 antibody AB1 treatment group, the tumor volume of the 30 mg/kg dose group (G3) was less than that of the 10 mg/kg dose group (G2) , indicating that different doses of AB1 have different tumor suppressive effects in SIGLEC15 gene humanized mice. The above experimental results showed that the SIGLEC15 gene humanized mice prepared by this method can be used to test the in vivo efficacy of anti-human SIGLEC15 antibodies, and can be used as an animal model to study human SIGLEC15 signaling pathway regulators.

Example 4. Testing efficacy using the SIGLEC15 humanized mouse model

The 8-week-old female SIGLEC15 gene humanized homozygous mice obtained in Example 1 were selected and subcutaneously inoculated with mouse colon cancer cells MC38 (5 × 10 ⁵ cells) overexpressing human SIGLEC15 protein. After the tumor volume reached about 100 mm ³, the mice were divided into control group or treatment group (n=5/group) based on tumor volume. The control group were injected with phosphate buffered saline (PBS) , and the treatment group were treated with different anti-human SIGLEC15 antibodies Ab1 or Ab2 (both were obtained by immunizing mice using conventional methods, see Janeway's Immunobiology (9th Edition) ) . Treatment schedule was as follows: i.p., starting on the day of group assignment, twice a week, 6 times in total. Tumor volume was measured twice a week, and a mouse was euthanized when the tumor volume of that mouse reached 3000 mm ³. The specific group assignment and dosage are shown in Table 9. The body weight and tumor volume measurement results are shown in Fig. 14 and Fig. 15, respectively.

Table 9 Group assignment and dosage

The data and analysis results of each experiment are listed in Table 10, including tumor volume at the time of group assignment, 14 days after group assignment, and 25 days after group assignment, mouse survival, tumor-free mice, Tumor Growth Inhibition value (TGI _TV) and the statistical difference (P value) of tumor volume between the treatment group and the control group.

Table 10 Tumor volume, survival and tumor inhibition rate (TGI _TV)

Overall, the animals in each group were in good health during the experiment, and the body weights of animals in all treatment groups (G2, G3) and the control group (G1) showed an increasing trend (Fig. 14) , indicating that the animals tolerated well the anti-human SIGLEC15 antibodies Ab1 and Ab2 (neither Ab1 nor Ab2 had obvious toxic effects on the animals, and the safety is good) . Based on the results of tumor volume measurements, the tumor volume of the treatment group was smaller than that of the control group throughout the experiment (Fig. 15) ; on the 25th day after administration, the tumor volumes in the treatment groups G2 and G3 (1801± 181mm ³ and 1220±234mm ³) were reduced compared with that in the control group (2528±377mm ³) . Among them, the tumor volume of the Ab2 treatment group (G3) was smaller than that of the Ab 1 treatment group (G2) , indicating that the tumor inhibitory effect of Ab2 was better than that of Ab1.

The above results showed that the SIGLEC15 humanized mice prepared by the disclosed method can be used to determine the in vivo efficacy of different anti-human SIGLEC15 antibodies, and can be used as an animal model to study human SIGLEC15 signaling pathway regulators.

Example 5. Immunophenotyping of SIGLEC15 humanized mice

Flow cytometry was used to analyze the leukocytes of the SIGLEC15 humanized mice. Specifically, 3 wild-type C57BL/6 mice and 3 SIGLEC15 humanized homozygous mice prepared in Example 1 were selected, and spleen, lymph node and blood samples were taken after cervical euthanasia to prepare single-cell suspensions for flow cytometry detection. The analysis strategy is shown in Figs. 22A-22B. The detection results of leukocyte subtypes and T cell subtypes in the spleen are shown in Fig. 16 and Fig. 17, respectively. The detection results of leukocyte subtypes and T cell subtypes in the lymph nodes are shown in Fig. 18 and Fig. 19, respectively. The results of leukocyte subtypes and T cell subtypes in the blood are shown in Fig. 20 and Fig. 21, respectively. As shown in the figures, leukocyte subtypes such as T cells, B cells, NK cells, DC cells (Fig. 14) , granulocytes, monocytes, and macrophages in the spleen, lymph nodes and blood samples of SIGLEC15 humanized homozygous mice were consistent with leukocyte subtypes in C57BL/6 wild-type mice (Fig. 16, Fig. 18, Fig. 20) , and the percentages of T cell subtypes such as CD4+ T cells, CD8+ T cells and Tregs cells were similar to those of C57BL/6 wild-type mice (Fig. 17, Fig. 19, Fig. 21) , indicating that the humanization of the SIGLEC15 gene did not affect the differentiation, development and distribution of leukocytes.

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric Sialic acid-binding immunoglobulin-like lectin 15 (SIGLEC15) .
The animal of claim 1, wherein the sequence encoding the human or chimeric SIGLEC15 is operably linked to an endogenous regulatory element at the endogenous SIGLEC15 gene locus in the at least one chromosome.
The animal of claim 1 or 2, wherein the sequence encoding the human or chimeric SIGLEC15 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to SEQ ID NO: 10.
The animal of any one of claims 1-3, wherein the sequence encoding the human or chimeric SIGLEC15 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.
The animal of any one of claims 1-4, wherein the animal is a mammal, e.g., a monkey, a rodent or a mouse.
The animal of any one of claims 1-5, wherein the animal is a mouse or a rat.
The animal of any one of claims 1-6, wherein the animal does not express endogenous SIGLEC15 or expresses a decreased level of endogenous SIGLEC15 as compared to that of an animal without genetic modification.
The animal of any one of claims 1-7, wherein the animal has one or more cells expressing human or chimeric SIGLEC15.
The animal of any one of claims 1-8, wherein the sequence encoding the human or chimeric SIGLEC15 comprises a part of exon 2, the entire exon 3 and a part of exon 4 of the human SIGLEC15 nucleotide sequence.
The animal of claim 9, wherein the part of exon 2 comprises at least 10 bp of the human SIGLEC15 nucleotide sequence, and the part ofexon 4 comprises at least 200 bp of the human SIGLEC15 nucleotide sequence.
The animal of any one of claims 1-10, wherein the human or chimeric SIGLEC15 protein comprises an amino acid sequence that is identical to SEQ ID NO: 10.
The animal of any one of claims 1-11, wherein the sequence encoding the human or chimeric SIGLEC15 comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%%, 97%, 98%or at least 99%identical to the nucleotide sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 12.
The animal of any one of claim 1-12, wherein the human or chimeric SIGLEC15 gene further comprises exon 1, a part of exon 2, a part of exon 4, exon 5 and exon 6 of the non-human animal’s endogenous SIGLEC15 gene.
A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous SIGLEC15 with a sequence encoding a corresponding region of human SIGLEC15 at an endogenous SIGLEC15 gene locus.
The animal of claim 14, wherein the sequence encoding the corresponding region of human SIGLEC15 is operably linked to an endogenous regulatory element at the endogenous SIGLEC15 locus, and one or more cells of the animal expresses a chimeric SIGLEC15.
The animal of claim 14 or 15, wherein the animal does not express endogenous SIGLEC15 or expresses a decreased level of endogenous SIGLEC15 as compared to that of an animal without genetic modification.
The animal of any one of claims 14-16, wherein the sequence encoding the corresponding region of human SIGLEC15 is under the control of the endogenous SIGLEC15 regulatory element.
The animal of any one of claims 14-17, wherein the animal has one or more cells expressing a chimeric SIGLEC15 having a humanized extracellular region, transmembrane region, and/or cytoplasmic region, wherein the humanized extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the corresponding extracellular region of human SIGLEC15.
The animal of any one of claims 14-18, wherein the human or chimeric SIGLEC15 comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to SEQ ID NO: 10.
The animal of any one of claims 14-19, wherein the genome of the animal comprises at least SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to the nucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11 or SEQ ID NO: 12.
The animal of any one of claims 14-20, wherein the animal further comprising a deletion of one or more nucleotide from the endogenous SIGLEC15 gene.
The animal of any one of claims 14-21, wherein the animal further comprises an endogenous SIGLEC15 gene 5’-UTR, and/or an endogenous SIGLEC15 gene 3’-UTR.
The animal of any one of claims 14-22, wherein the animal is heterozygous or homozygous with respect to the replacement at the endogenous SIGLEC15 gene locus.
A method for making a genetically-modified non-human animal, the method comprising: replacing in at least one cell of the animal, at an endogenous SIGLEC15 gene locus, a sequence encoding a region of an endogenous SIGLEC15 with a sequence encoding a corresponding region of human SIGLEC15.
The method of claim 24, wherein the sequence encoding the corresponding region of human SIGLEC15 gene comprises exon 1, exon 2, exon 3, exon 4, exon 5, and/or exon 6, or a part thereof, of a human SIGLEC15 gene.
The method of claim 24 or 25, wherein the sequence encoding the corresponding region of human SIGLEC15 gene encodes a sequence that is at least 90%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.
The method of any one of claims 24-26, wherein the sequence encoding the corresponding region of human SIGLEC15 gene is at least 90%identical to SEQ ID NO: 5.
The method of any one of claims 24-27, wherein the sequence encoding a region of human SIGLEC15 gene is identical to SEQ ID NO: 5.
The method of any one of claims 24-28, wherein the method further comprises deleting one or more nucleotides of the endogenous SIGLEC15 gene.
The method of any one of claims 24-29, wherein a part ofexon 2, exon 3, and a part of exon 4 of the endogenous SIGLEC15 are replaced.
The method of claim 30, wherein the sequence encoding a region of the endogenous SIGLEC15 is replaced by a part of exon 2, exon 3, and a part of exon 4 of the human SIGLEC15 gene.
The method of claim 31, wherein the part of exon 2 of the human SIGLEC15 gene comprises at least 10bp contiguous human nucleotides, wherein the part of exon 4 of the human SIGLEC15 gene comprises at least 200bp contiguous human nucleotides.
A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a humanized SIGLEC15 polypeptide, wherein the humanized SIGLEC15 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human SIGLEC15, wherein the animal expresses the humanized SIGLEC15.
The animal of claim 33, wherein the humanized SIGLEC15 polypeptide has at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human SIGLEC15 extracellular region.
The animal of claim 33 or 34, wherein the humanized SIGLEC15 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.
The animal of any one of claims 33-35, wherein the nucleotide sequence is operably linked to an endogenous SIGLEC15 regulatory element of the animal (e.g., 5’-UTR) .
The animal of any one of claims 33-36, wherein the humanized SIGLEC15 polypeptide comprises a humanized extracellular region, an endogenous SIGLEC15 transmembrane region and/or an endogenous SIGLEC15 cytoplasmic region.
The animal of any one of claims 33-37, wherein the nucleotide sequence is integrated to an endogenous SIGLEC15 gene locus of the animal.
A method of making a genetically-modified mouse cell that expresses a chimeric SIGLEC15, the method comprising:

replacing at an endogenous mouse SIGLEC15 gene locus, a nucleotide sequence encoding a region of mouse SIGLEC15 with a nucleotide sequence encoding a corresponding region of human SIGLEC15, thereby generating a genetically-modified mouse cell that includes a nucleotide sequence that encodes the chimeric SIGLEC15, wherein the mouse cell expresses the chimeric SIGLEC15.
The method of claim 39, wherein the chimeric SIGLEC15 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 20-263 of SEQ ID NO: 2 or amino acids 31-246 of SEQ ID NO: 2.
The method of claim 39, wherein the chimeric SIGLEC15 comprises:

the extracellular region of human or humanized SIGLEC15; and

the transmembrane region and/or the cytoplasmic region of mouse SIGLEC15.
The animal of any one of claims 1-23 and 33-38, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.
The animal of claim 42, wherein the additional human or chimeric protein is PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, or IL10.
The method of any one of claims 24-32 and 39-41, wherein the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.
The method of claim 44, wherein the additional human or chimeric protein is PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, or IL10.
A method of determining effectiveness of a therapeutic agent targeting SIGLEC15 for the treatment of an immune-related disease, the method comprising:

administering the therapeutic agent targeting SIGLEC15 to the animal of any one of claims 1-23 and 33-38, wherein the animal has an immune-related disease; and

determining the effects of the therapeutic agent targeting SIGLEC15 to the immune-related disease of the animal.
The method of claim 46, wherein the immune-related disease is an autoimmune disease.
The method of claim 46, wherein determining the effects of the therapeutic agent targeting SIGLEC15 to the immune-related disease of the animal comprises measuring the T cell proliferation, cytokine secretion and killing capacity.
The method of claim 48, wherein determining the effects of the therapeutic agent targeting SIGLEC15 to the immune-related disease of the animal further comprises assessing individual body weight, fat mass, activation pathway, neuroprotective activity, or metabolic changes, and the metabolic changes include changes in food consumption or water consumption.
A method of determining effectiveness of a human or humanized antibody for the treatment of a disease, the method comprising

administering the antibody to the animal of any one of claims 1-23 and 33-38; and

determining the effects of the antibody on the disease.
The method of claim 50, wherein the disease is a tumor.
The method of claim 50, wherein the animal further comprises a sequence encoding a human or chimeric PD-1, PD-L1, IL6, TNF, 41BB, CD40, IL17, TNFR2, IL4, IL33, TIGIT, OX40, or IL10.
The method of claim 50, wherein the antibody is an anti-SIGLEC15 antibody.
A method of determining effectiveness of an anti-SIGLEC15 antibody for the treatment of cancer, the method comprising:

administering the anti-SIGLEC15 antibody to the animal of any one of claims 1-23 and 33-38, wherein the animal has a tumor; and

determining the inhibitory effects of the anti-SIGLEC15 antibody to the tumor.
The method of claim 54, wherein the tumor comprises one or more cancer cells that are injected into the animal.
The method of claim 54, wherein determining the inhibitory effects of the anti-SIGLEC15 antibody to the tumor comprises measuring the tumor volume in the animal.
The method of claim 54, wherein the tumor cells are breast cancer cells, colon cancer cells, or lung cancer cells.
A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:

(a) an amino acid sequence set forth in SEQ ID NO: 10;

(b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 10;

(c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10;

(d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and

(e) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 10.
A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:

(a) a sequence that encodes the protein of claim 58;

(b) SEQ ID NO: 5;

(c) SEQ ID NO: 9;

(d) a sequence that is at least 90%identical to SEQ ID NO: 5 or SEQ ID NO: 9;

(e) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5; and

(f) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 9.
A cell comprising the protein of claim 58 and/or the nucleic acid of claim 59.
An animal comprising the protein of claim 58 and/or the nucleic acid of claim 59.