WO2022186648A1 - 쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도 - Google Patents

쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2022186648A1
WO2022186648A1 PCT/KR2022/003072 KR2022003072W WO2022186648A1 WO 2022186648 A1 WO2022186648 A1 WO 2022186648A1 KR 2022003072 W KR2022003072 W KR 2022003072W WO 2022186648 A1 WO2022186648 A1 WO 2022186648A1
Authority
WO
WIPO (PCT)
Prior art keywords
eimeria
ppm
coumaric acid
coccidiosis
acid
Prior art date
Application number
PCT/KR2022/003072
Other languages
English (en)
French (fr)
Inventor
손규열
박민아
이경민
김휘재
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2023519072A priority Critical patent/JP2023545650A/ja
Priority to CN202280006974.3A priority patent/CN116528847A/zh
Priority to EP22763629.7A priority patent/EP4302608A1/en
Priority to BR112023007086A priority patent/BR112023007086A2/pt
Publication of WO2022186648A1 publication Critical patent/WO2022186648A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/111—Aromatic compounds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K50/00—Feeding-stuffs specially adapted for particular animals
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K50/00—Feeding-stuffs specially adapted for particular animals
    • A23K50/70—Feeding-stuffs specially adapted for particular animals for birds
    • A23K50/75—Feeding-stuffs specially adapted for particular animals for birds for poultry
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/04—Amoebicides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/50—Livestock or poultry management
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S426/00—Food or edible material: processes, compositions, and products
    • Y10S426/807—Poultry or ruminant feed

Definitions

  • the present application relates to a composition for anticoccidium containing coumaric acid and/or a salt thereof, and a use thereof.
  • Coccidiosis is an intestinal-related disease caused by a protozoan parasite belonging to the phylum apicomplexan called Eimeria .
  • Eimeria a protozoan parasite belonging to the phylum apicomplexan called Eimeria .
  • Williams RB A compartmentalized model for the estimation of the cost of coccidiosis to the world's chicken production industry. Int J Parasitol. 1999; 29(8):1209-1229).
  • antibiotics accumulated in animals due to the misuse of antibiotics are a serious problem as humans consume antibiotics through meat. Therefore, there is an urgent need to develop and research alternatives to existing anticoccidial agents that exhibit side effects such as the emergence of strains resistant to the drug and the problem of residual in the body.
  • An example of the present application provides the use of coumaric acid and/or a salt thereof for preventing, improving, and/or treating coccidiosis.
  • Another example of the present application provides a feed composition for preventing or improving coccidiosis, comprising coumaric acid and/or a salt thereof as an active ingredient.
  • Another example of the present application provides a pharmaceutical composition for preventing or treating coccidiosis, comprising coumaric acid and/or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another example of the present application provides the use of coumaric acid and/or a salt thereof for the preparation of a composition (eg, a feed composition, a pharmaceutical composition) for preventing, ameliorating, and/or treating coccidiosis.
  • a composition eg, a feed composition, a pharmaceutical composition
  • Another example of the present application includes the step of administering the composition (eg, the feed composition, the pharmaceutical composition, and/or the anti-antigen composition) to an animal other than a human, preventing, improving, and / or provide a method of treatment.
  • the composition eg, the feed composition, the pharmaceutical composition, and/or the anti-antigen composition
  • Another example of the present application is coumarin acid and / or salts thereof to the antigens of the genus Aimeria protozoa (for example, killing the protozoa of the genus Eimeria; and / or inhibition of cell penetration and / or proliferation of the protozoa of the genus Eimeria) It provides a purpose for use.
  • Another example of the present application provides an antiprotozoal composition for protozoa of the genus Aimeria, comprising coumaric acid and/or a salt thereof as an active ingredient.
  • Another example of the present application provides the use of coumaric acid and/or a salt thereof for use in the preparation of an antiprotozoal composition against the genus Eimeria protozoa.
  • coumaric acid and/or a salt thereof is administered to an animal (eg, a subject in need of protozoan control, or an animal other than a human), preventing, improving, and/or It provides a method of treatment, or a method of controlling protozoa of the genus Aymeria.
  • the control of protozoa refers to the antiprotozoal action inclusively, for example, it may mean the killing of the protozoa of the genus Aimeria, and/or inhibition of cell penetration and/or proliferation of the protozoa of the genus Eimeria. It is not limited.
  • the coumarin acid may have a structure of Formula 1 below.
  • a composition comprising coumaric acid and/or a salt thereof according to an embodiment may have excellent anti-coccidial activity and/or anti-protozoal activity against protozoa inducing coccidiosis.
  • excellent anticoccidium efficacy is at least one selected from the group consisting of the following (1) to (5) (for example, one or more, two or more, three or more, four) above, or all 5 types):
  • ACI Anticoccidial index
  • control group is a negative control group (either no treatment group or water, and/or buffer treatment group) and/or a conventionally known anticoccidial agent (eg, diclazuril, gallic acid). ), and/or a positive control comprising salinomycin).
  • negative control group either no treatment group or water, and/or buffer treatment group
  • anticoccidial agent eg, diclazuril, gallic acid
  • positive control comprising salinomycin
  • composition according to an example is at least one selected from the group consisting of the following (1) to (6) (eg, 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, or 6) all), and its properties may be superior to those of the control group:
  • composition according to an embodiment has excellent acid resistance and/or heat resistance, so that it can be administered into the body to maintain excellent anticoccidial activity for a long period of time, has excellent in vivo stability, and has excellent anticoccidium activity even in environments of various temperatures and/or pH ranges. It can be maintained, can be applied to various products (eg, feed additives), and can have excellent storage stability.
  • composition according to one embodiment is not absorbed into other tissues and organs (eg, blood, liver, kidney, and/or spleen, etc.) other than the intestine when administered in the body, so that the amount remaining in the body is small, so that the in vivo safety may be excellent.
  • tissues and organs eg, blood, liver, kidney, and/or spleen, etc.
  • the excellent effect of improving the weight gain may mean that the effect of being administered to an individual to increase the weight of the individual is excellent. It may be an object that has been
  • composition according to one embodiment comprises a conventionally known anticoccidial agent (for example, a sulfa agent such as sulfaquinoxaline, sulfachloropyrazine, and sulfamethazine, a polyether ionophore antibiotic such as salinomycin and monensin sodium, Amphurolium, diclazuril, and/or toltrazuril) exhibits superior anticoccidium activity equal to or higher than that of coumarin acid and/or its salt, which is a substance that naturally participates in metabolism during the metabolic process as an active ingredient. It does not induce drug resistance and/or does not absorb into the body, so it is safe for long-term use.
  • a conventionally known anticoccidial agent for example, a sulfa agent such as sulfaquinoxaline, sulfachloropyrazine, and sulfamethazine, a polyether ionophore antibiotic such as salinomycin and monen
  • the composition according to one embodiment is resistant or does not remain in the body, so it can be used as a material for preventing, improving, and/or treating coccidium in laying hens as well as broilers.
  • the composition according to an embodiment can significantly reduce the amount of oscitosis from an individual infected with anticoccidium-inducing protozoa, thereby reducing the rate of contamination and/or secondary infection of the barn.
  • prevention refers to any action that suppresses or delays the onset of a disease by administration of the composition according to an embodiment
  • treatment refers to an individual suspected and onset of a disease by administration of the composition according to an embodiment.
  • improvement means any action that at least reduces a parameter related to a condition in which the disease is treated by administration of the composition according to an example, for example, at least the degree of the symptom can do.
  • the disease may refer to coccidiosis.
  • One aspect may provide a feed composition for preventing or improving coccidiosis, including coumaric acid and/or a salt thereof (coumaric acid, a salt of coumaric acid, or a combination thereof).
  • the 'coumaric acid' is a kind of hydroxycinnamic acid, which is a hydroxy derivative of cinnamic acid, and in one example, the coumaric acid is p - coumaric acid, m -coumarin Acid ( m -coumaric acid), and o -coumaric acid ( o -coumaric acid) may be at least one selected from the group consisting of.
  • the coumarin acid may be in a trans (trnas) type and/or a cis (cis) type.
  • the p -coumaric acid may be trans- p -coumaric acid and/or cis- p - coumaric acid
  • the m -coumaric acid is trans- p -coumaric acid.
  • trans- m -coumaric acid trans- m -coumaric acid
  • cis- m -coumaric acid cis- m -coumaric acid
  • the o -coumaric acid is trans- o -coumaric acid (trans- o- ) coumaric acid) and/or cis- o - coumaric acid.
  • the p -coumaric acid is '4-hydroxycinnamic acid', ' p -hydroxycinnamic acid ( p -Hydroxycinnamic acid), or 2-(4-hydroxyphenyl)acrylic acid (2-( 4-hydroxyphenyl)acrylic acid), and may have a molecular formula of C 9 H 8 O 3 .
  • the p -coumaric acid may be represented by the following Formula 1 or Formula 2 or a mixture thereof (a compound represented by Formula 1 and a compound represented by Formula 2).
  • the Cas number of the p -coumarin acid is Cas No. 501-98-4, Cas No. 7400-08-0, and/or Cas No. 4501-31-9.
  • the m -coumaric acid is '3-hydroxycinnamic acid', ' m -hydroxycinnamic acid ( m -Hydroxycinnamic acid), or '3-(3-hydroxyphenyl)acrylic acid (3- (3-Hydroyphenyl)acrylic acid)', and may have a molecular formula of C 9 H 8 O 3 .
  • the m -coumaric acid may be represented by the following Chemical Formula 3 or Chemical Formula 4, or a mixture thereof (a compound represented by Chemical Formula 3 and a compound represented by Chemical Formula 4).
  • the Cas number of the m -coumarin acid is Cas No. 14755-02-3, Cas No. 25429-38-3, and/or Cas No. It can be 588-30-7.
  • the o -coumaric acid may be named as '2-hydroxycinnamic acid' or '2-hydroxycinnamate', and has a molecular formula of C 9 H 8 O 3 can
  • the o -coumaric acid may be represented by the following Chemical Formula 5 or Chemical Formula 6 or a mixture thereof (a compound represented by Chemical Formula 5 and a compound represented by Chemical Formula 6).
  • the Cas number of the o -coumaric acid is Cas No. 614-60-8 and/or Cas No. 495-79-4.
  • the coumaric acid and / or its salt (the salt of the coumarin acid) is obtained by extraction and separation from a natural product (eg, plant) and / or strain, or prepared by a conventional organic synthesis method, or a manufacturer in the art It can be obtained from, but is not limited thereto.
  • salt of coumarin acid may mean a physiologically acceptable salt among salts that are substances in which cations and anions are combined by electrostatic attraction
  • pharmaceutically acceptable salt is a pharmaceutical It may mean a salt in a form that can be used as, for example, a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, and the like.
  • the metal salt may be an alkali metal salt (sodium salt, potassium salt, etc.), alkaline earth metal salt (calcium salt, magnesium salt, barium salt, etc.), aluminum salt, etc.;
  • Salts with organic bases include triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylenediamine salts with, etc.
  • salts with inorganic acids may be salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, and the like;
  • Salts with organic acids may be salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic
  • coccidiosis refers to a protozoan coccidiosis (a protozoan capable of inducing coccidiosis, for example, a protozoa coccidiosis of the genus Eimeria) parasitizing in the cytoplasm of submucosal tissue in the epithelium of the digestive tract and destroying the epithelium. It is a protozoal disease that causes economic damage by lowering the weight gain rate and extending the shipping date due to soft stool, diarrhea and bloody stool in broiler farms, etc.
  • Coccidiosis can be expressed not only in broilers, but also in birds, fish, reptiles and mammals, and specifically, the coccidiosis can be infected with cattle, rabbits, goats, dogs, cats, mice, experimental animals, rats, etc., especially chickens , can cause fatal damage to poultry such as ducks, geese, turkeys, quails and pheasants.
  • the coccidiosis may include acute type coccidiosis, subacute type coccidiosis, and chronic type coccidiosis.
  • the acute type coccidiosis shows bloody stool, loss of energy, and anemia within 48 hours after infection, and the infected individual may die, the subacute type coccidiosis may exhibit bloody diarrhea and/or anemia symptoms after infection, and the chronic type Coccidiosis may present with diarrhea followed by soft stools and/or weight loss for 1 to 2 days after infection.
  • Oocysts (cysts, eggs) of the Coccidium protozoan species are infectious when they mature into sporulated oocysts at high humidity and temperature. If it is excreted, it is easily spread and the life cycle of the ostrich is repeated.
  • the ocysts (cysts) of the Coccidium protozoan species are highly resistant to the external environment, and the cyst wall consists of two layers, inside and outside.
  • the outer layer of the cyst wall is a gelatinous material that strongly resists physical external pressure, and the inner layer is rich in nuclear proteins, so it can strongly resist chemical stimuli, for example, disinfectants.
  • the osspores of the Coccidium protozoan species may include four sporocysts, and the sporocysts may each include two sporozoites, and after infection in an animal in the form of an oste, the sporangia and sporozoite form
  • the sporozoites that are released and proliferate in cells, and undergo sexual and/or asexual reproduction may form an ocyst and be excreted in feces.
  • sporozoites may be used in the same sense as protozoa, and the sporozoites (protozoa) may cause lesions.
  • the coccidiosis may be induced by a protozoa of the genus Eimeria sp.
  • the protozoa of the genus Eimeria are Eimeria acervulina ( Eimeria acervulina ), Eimeria tenella ( Eimeria tenella : chicken cephalus), Eimeria maxima ( Eimeria maxima: maximacocephalus), Eimeria necatrix (Eimeria necatrix), Eimeria brunetti (Eimeria brunetti), Eimeria hagani ( Eimeria hagani : Eimeria mitis), Eimeria mitis : Eimeria praecox), Eimeria praecox ( Eimeria praecox ), Eimeria mivati ( Eimeria mivati : Mibathocephalus ), Eimeria aurati, Eimeria baueri ), Eimeria lepidosirenis , Eimeria leucisci , Eimeria aurati, E
  • composition according to an example is induced by one or more (eg, one or more, two or more, three or more, or four or more) protozoa selected from the group consisting of protozoa of the genus Eimeria described in Table 1 below.
  • the preventive, ameliorating, and/or therapeutic effects of coccidiosis may be excellent, and the protozoa of the genus Eimeria listed in Table 1 below may each induce coccidiosis in the animals listed in Table 1.
  • Eimeria acervulina Chicken Gallus gallus domesticus 2 Eimeria tenella Chicken ( Gallus gallus domesticus ) 3 Eimeria maxima ( Eimeria maxima ) Chicken ( Gallus gallus domesticus ) 4 Eimeria necatrix Chicken ( Gallus gallus domesticus ) 5 Eimeria brunetti Chicken ( Gallus gallus domesticus ) 6 Eimeria hagani Chicken ( Gallus gallus domesticus ) 7 Eimeria mitis Chicken ( Gallus gallus domesticus ) 8 Eimeria praecox Chicken ( Gallus gallus domesticus ) 9 Eimeria mivati Chicken ( Gallus gallus domesticus ) 10 Aimeria Aurati ( Eimeria aurati ) Goldfish ( Carassius auratus ) 11 Eimeria baueri crucian carp ( Carassius carassius ) 12 Eimeria lepidosirenis South American lungfish ( Lepidosiren paradoxa ) 13 Eimeria leucisci barbel ( Barbus barbus boc
  • Eimeria yemenensae rainbow agama (rock agama ( Agama yemenensis )) 19 Eimeria adenoeides turkey ( Meleagris gallopavo ) 20 Eimeria colchici pheasant (common pheasant ( Phasianus colchicus )) 21 Aymeria Culvata ( Eimeria curvata ) Gray-headed ground dove (ruddy ground dove ( Columbina talpacoti )), scaled dove ( Scardafella squammata )) 22 Eimeria dispersa turkey ( M.
  • Eimeria phasiani pheasant P.
  • Eimeria hircus 37 Eimeria arundeli Baby wombat (common wombat ( Vombatus ursinus )) 38 Eimeria bakuensis Sheep ( O. aries ) 39 Eimeria bovis Cattle ( B. taurus ) 40 Eimeria cameli camels (camels ( Camelus bactrianus , Camelus dromedarius )) 41 Eimeria caprina goat ( C. hircus ) 42 Eimeria caprovina ( Eimeria caprovina ) goat ( C. hircus ) 43 Eimeria christenseni goat ( C.
  • Eimeria clethrionomyis Eimeria clethrionomyis
  • red-backed vole Clethrionomys gapperi
  • Eimeria coecicola rabbit Oryctolagus cuniculus
  • Eimeria contorta mouse Mus musculus
  • Eimeria couesii rice rat Oryzomys couesi
  • Eimeria crandalis Eimeria crandallis Sheep ( O.
  • Eimeria dammahensis Scimitar-homed oryx Oryx dammah ) 50 Eimeria dowleri eastern red bat ( Lasiurus borealis ) 51 Eimeria exigua rabbit ( Rabbit ( O. cuniculus )) 52 Eimeria falciformis ) mouse ( M. musculus ) 53 Eimeria farasanii mountain gazelle ( Gazella gazelle farasani ) 54 Eimeria ferrisi mouse ( M. musculus ) 55 Aimeria Flavescenes ( Eimeria flavescens ) rabbit ( Rabbit ( O.
  • Eimeria larimerensis Uinta ground squirrel ( Spermophilus armatus ) 65 Aimeria makusaniensis ( Eimeria macusaniensis ) llamas ( Lama glama ), guanacos ( Lama guanicoe ), alpacas ( Vicugna pacos ), vicunas ( Vicugna vicugna )) 66 Aymeria Magna ( Eimeria magna ) rabbit ( Rabbit ( O. cuniculus )) 67 Eimeria marconii red-backed vole ( Clethrionomys gapperi ) 68 Eimeria media rabbit ( Rabbit ( O.
  • Eimeria melanuri Glass dormouse Eliomys quercinus
  • Eimeria myoxi Spectacled dormouse Eliomys quercinus
  • Eimeria nagpurensis Eimeria nagpurensis
  • Rabbit O. cuniculus
  • 72 Eimeria nieschulzi brown rat ( R. norvegicus )
  • Eimeria ninakohlyakimovae goat C. hircus
  • Eimeria ovinoidalis Sheep O. aries )
  • Eimeria pallida goat C.
  • Eimeria phocae Sable Island harbor seals Phoca vitulina
  • Eimeria pileata red-backed vole Clethrionomys gapperi
  • Eimeria pipistrellus Eimeria pipistrellus
  • Kuhl's pipistrelle Pipistrellus kuhlii
  • Eimeria piriformis Eimeria piriformis
  • Rabbit O.
  • Eimeria prionotemni Red-necked wallaby (Bennett's wallaby ( Macropus rufogriseus ))
  • Eimeria procyonis raccoon Procyon lotor )
  • Eimeria punctate goat C. hircus
  • Eimeria roobroucki rabbit Rabbit ( O. cuniculus )
  • Eimeria saudiensis Arabian oryx Oryx leucoryx
  • Eimeria sealanderi eastern red bat ( Lasiurus borealis )
  • Eimeria separata mouse M.
  • composition according to one embodiment may be excellent in preventing, improving, and/or treating coccidiosis induced by A. tenella, A. acebulina, and/or A. maxima.
  • the prevention or improvement of coccidiosis means one or more (eg, one or more, two or more, three or more, or all four) selected from the group consisting of the following (1) to (4).
  • one or more selected from the group consisting of the following (1) to (4) than the control may be decreased, inhibited, and / or increased:
  • lesion score eg, cecal lesion score
  • fecal oste excretion e.g., fecal oste excretion
  • the lesion scoring method for determining the lesion score is described in Johnson JK & Reid WM (1970) (Joyce Johnson, W. Malcolm Reid, Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens, Experimental parasitology). , 1970), and the lesion score may be on a scale of 0 to 4.
  • the lesion score may refer to a lesion score measured in the cecum, duodenum, and/or jejunum, and is calculated as the sum of respective lesion scores measured in each organ (caecum, duodenum, and/or jejunum).
  • the amount of fecal oscosis excretion may be measured using a microscope or a counting chamber (eg, McMaster chamber) by collecting feces discharged from the subject.
  • a microscope or a counting chamber eg, McMaster chamber
  • the mortality rate may mean the mortality rate of the animal subject in which coccidiosis is induced, and the number of subjects who died due to causes other than coccidiosis may be excluded by performing a post-mortem autopsy.
  • an individual with coccidiosis induced may lose weight more than an individual without coccidiosis, and the composition according to an embodiment may inhibit weight loss due to induction of coccidiosis.
  • the anticoccidium composite index may be calculated by Equation 1 below, and the lesion score in Equation 1 may be calculated as described above.
  • Composite anticoccidium index (ACI) (survival rate (%) after challenge inoculation) + (daily weight gain (%) compared to negative control group) - (lesion score x 10) - (fecal oscist discharge index)
  • the aggressive inoculation may refer to administration of protozoa capable of inducing coccidiosis (eg, oral inoculation, etc.).
  • the survival rate may be the survival rate measured at 5 to 10 days, 7 to 10 days, 8 to 10 days, 7 to 9 days, 7 to 8 days, or 7 days after challenge inoculation, by performing post-mortem autopsy
  • the survival rate can be measured by excluding the number of individuals who died from causes other than coccidiosis.
  • the amount of gain compared to the negative control may be a value calculated as a percentage calculated based on the value of the negative control (eg, a negative control uninfected with coccidium protozoa).
  • Equation 1 The lesion score in Equation 1 is as described above.
  • the fecal oscosis excretion index is calculated as a percentage based on the value of a negative control (eg, a negative control infected with protozoa), and if the calculated result is at a level of 0 to 1%, 0, 1 % or more and less than 26% may be 5, 26% or more to less than 51% is 10, 51% or more to less than 76% is 20, and 76% or more to 100% or less is 40.
  • a negative control eg, a negative control infected with protozoa
  • the coumaric acid and / or its salt is less than 1w / w%, less than 1w / w%, 10 -1 w / w% or less, 5 x 10 -2 w / w% or less, 2.5 x in the feed composition 10 -2 w/w% or less, 2 x 10 -2 w/w% or less, 1.25 x 10 -2 w/w% or less, 10 -2 w/w% or less, 9 x 10 -3 w/w% or less , 8 x 10 -3 w/w% or less, 6.25 x 10 -3 w/w% or less, 7 x 10 -3 w/w% or less, 6 x 10 -3 w/w% or less, 5 x10 -3 w/w% or less, 4 x 10 -3 w/w% or less, 10 -7 w/w% or more, 10 -6 w/w% or more, 10 -5 w/w%
  • the coumaric acid and / or its salt is 1000ppm or less, 500ppm or less, 400ppm or less, 300ppm or less, 250ppm or less, 200ppm or less, 125ppm or less, 125ppm or less, 100ppm or less, 90ppm or less, 80ppm or less, 70ppm or less in the feed composition or less, 65ppm or less, 62.5ppm or less, 60ppm or less, 50ppm or less, 0.1ppm or more, 1ppm or more, 5ppm or more, 10ppm or more, 15ppm or more, 20ppm or more, 30ppm or more, 40ppm or more, 50ppm or more, 62.5ppm or more, 0.1 to 1000ppm , 0.1 to 500 ppm, 0.1 to 400 ppm, 0.1 to 300 ppm, 0.1 to 250 ppm, 0.1 to 200 ppm, 0.1 to 125 ppm, 0.1 to 100 ppm, 0.1 to 90 ppm or less
  • feed may mean any natural or artificial diet, meal meal, etc. or a component of the meal meal for or suitable for the animal to eat, ingest, and digest.
  • the feed composition according to an example may further include a concentrated feed and/or a special feed.
  • the rich feed includes seed fruits including grains such as wheat, oats, and corn, bran, beans, fluid, sesame, linseed, coco palm, etc.
  • Fish-Soluble (a by-product obtained from oil extraction), which is obtained by concentrating fresh liquids obtained from fish meal, fish waste, fish meal Animal feed such as dried whey, yeast, chlorella, and/or seaweed, etc. can
  • the feed composition according to an example may refer to a feed in the form of a final ingested animal, a dietary supplement that can be formulated in the feed, and/or a feed additive.
  • the dietary supplement is, for example, an agent-containing composition that provides a therapeutic agent or a digestive agent to an animal, and is not usually a source of caloric intake of a living body, that is, an energy source, but may refer to a composition that is ingested in addition to a normal animal feed.
  • the feed additive is a material added to the feed for the purpose of various effects, such as nutrient supplementation and weight loss prevention, improvement of digestibility of fiber in feed, improvement of oil quality, prevention of reproductive disorders and improvement of fertility, prevention of high temperature stress in summer. . In one example, it may refer to a substance added for the purpose of preventing, improving, or treating coccidiosis.
  • the feed composition may be a feed additive, and when the feed additive according to an example is formulated in a feed (eg, a compound feed and/or a simple feed that is finally consumed by an animal), Based on the total feed weight, 0.001% or more, 0.005% or more, 0.01% or more, 0.05% or more, 0.1% or more, 0.5% or more, 1% or less, 0.5% or less, 0.1% or less, 0.05% or less, 0.01% or less, 0.005% or less, 0.001 to 1%, 0.001 to 0.5%, 0.001 to 0.1%, 0.001 to 0.05%, 0.001 to 0.01%, 0.001 to 0.005%, 0.005 to 1%, 0.005 to 0.5%, 0.005 to 0.1%, 0.005 to 0.05%, 0.005 to 0.01%, 0.01 to 1%, 0.01 to 0.5%, 0.01 to 0.1%, 0.01 to 0.05%, 0.05 to 1%, 0.05 to 0.5%, 0.05 to 0.1%, 0.1 to
  • Another aspect may provide a pharmaceutical composition for preventing or treating coccidiosis, including coumaric acid and/or a salt thereof, and for the above-described salt of coumaric acid and/or coumaric acid included in the pharmaceutical composition like a bar
  • the pharmaceutical composition according to an embodiment may be used as a single agent, and may be prepared and used as a combination, further including a pharmaceutical composition known to have a recognized preventive or therapeutic effect on coccidiosis.
  • a pharmaceutical unit dosage form may be formulated by adding a pharmaceutically acceptable carrier, excipient, or diluent.
  • the pharmaceutical composition comprising a pharmaceutically acceptable carrier is a tablet, pill, powder, granule, capsule, suspension, internal solution, emulsion, syrup, sterile aqueous solution, non-aqueous solution, suspension, emulsion, It may have any one formulation selected from the group consisting of freeze-dried formulations and suppositories.
  • the pharmaceutical composition may be in various oral or parenteral formulations.
  • it can be prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. commonly used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc.
  • lubricants such as magnesium stearate, talc and the like may also be used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have.
  • Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the pharmaceutical composition is in various forms, such as oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and injections of sterile injection solutions, according to conventional methods for each purpose of use. It can be formulated and used orally or administered through various routes including intravenous, intraperitoneal, subcutaneous, rectal, topical administration, and the like.
  • the pharmaceutical composition may further include a carrier, excipient or diluent, and the like, and examples of suitable carriers, excipients or diluents that may be included include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, Maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a fragrance, an emulsifier, a preservative, and the like.
  • the effective amount of the active ingredient (coumarin acid and/or its salt) in the pharmaceutical composition may vary depending on the age, sex, and weight of the patient (individual), and generally 0.0001 to 0.001 mg/kg of body weight kg, 0.0001 to 0.01 mg/kg, 0.0001 to 0.1 mg/kg, 0.0001 to 1 mg/kg, 0.0001 to 10 mg/kg, 0.0001 to 100 mg/kg, 0.0001 to 231 mg/kg, 0.0001 to 250 mg/kg, 0.0001 to 500 mg/kg kg, 0.0001 to 1000 mg/kg, 0.001 to 0.01 mg/kg, 0.001 to 0.1 mg/kg, 0.001 to 1 mg/kg, 0.001 to 10 mg/kg, 0.001 to 100 mg/kg, 0.001 to 231 mg/kg, 0.001 to 250 mg/kg kg, 0.001 to 500 mg/kg, 0.001 to 1000 mg/kg, 0.01 to 0.1 mg/kg, 0.01 to 1 mg/kg, 0.001 to 10 mg/kg,
  • the dosage is not intended to limit the scope of the present invention in any way.
  • the composition when administered intraperitoneally, it may be administered in an amount of 0.001 to 250 mg/kg or 0.001 to 231 mg/kg.
  • the dosage of the pharmaceutical composition may vary depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease.
  • the coumaric acid and / or its salt is less than 1w / w%, less than 1w / w%, 10 -1 w / w% or less, 5 x 10 -2 w / w% or less, 2.5 x in the pharmaceutical composition 10 -2 w/w% or less, 2 x 10 -2 w/w% or less, 1.25 x 10 -2 w/w% or less, 10 -2 w/w% or less, 9 x 10 -3 w/w% or less , 8 x 10 -3 w/w% or less, 6.25 x 10 -3 w/w% or less, 7 x 10 -3 w/w% or less, 6 x 10 -3 w/w% or less, 5 x10 -3 w/w% or less, 4 x 10 -3 w/w% or less, 10 -7 w/w% or more, 10 -6 w/w% or more, 10 -5 w/w%
  • the coumaric acid and / or its salt is 1000ppm or less, 500ppm or less, 400ppm or less, 300ppm or less, 250ppm or less, 200ppm or less, 125ppm or less, 125ppm or less, 100ppm or less, 90ppm or less, 80ppm or less, 70ppm or less in the pharmaceutical composition or less, 65ppm or less, 60ppm or less, 62.5ppm or less, 50ppm or less, 0.1ppm or more, 1ppm or more, 5ppm or more, 10ppm or more, 15ppm or more, 20ppm or more, 30ppm or more, 40ppm or more, 50ppm or more, 62.5ppm or more, 0.1 to 1000ppm , 0.1 to 500 ppm, 0.1 to 400 ppm, 0.1 to 300 ppm, 0.1 to 250 ppm, 0.1 to 200 ppm, 0.1 to 125 ppm, 0.1 to 100 ppm, 0.1 to 90 ppm or less
  • the pharmaceutical composition may be administered to a subject through various routes.
  • the administration may mean providing a predetermined substance to an individual (patient) by any suitable method, and the administration route of the pharmaceutical composition is oral administration and/or through any general route as long as it can reach the target tissue. It may be administered parenterally.
  • parenteral administration topical skin application, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, and/or intrathoracic injection may be selected.
  • the composition according to an embodiment may be administered using any device capable of delivering an active ingredient to a target cell.
  • Another aspect may provide an antiprotozoal composition for the protozoa of the genus Eimeria, comprising coumaric acid and/or a salt thereof.
  • Another aspect is a method of preventing, ameliorating, and/or treating coccidiosis, comprising administering coumaric acid and/or a salt thereof to an animal (eg, a subject in need of protozoan control, or an animal other than a human), or A method for controlling protozoa of the genus Aimeria is provided.
  • control of protozoa refers to the antiprotozoal action inclusively, for example, it may mean the killing of the protozoa of the genus Aimeria, and/or inhibition of cell penetration and/or proliferation of the protozoa of the genus Eimeria. It is not limited.
  • the coumaric acid, the salt of coumaric acid and/or the protozoa of the genus Aimeria are the same as described above.
  • the excellent antiprotozoal activity (effect, efficacy) against the protozoa of the genus Eimeria may mean the characteristics of the following (1) and/or (2), for example, a control (negative control and/or positive control), and may exhibit the following characteristics (1) and/or (2):
  • the coumaric acid, and / or a salt of coumarin acid may be included in the antiprotozoal composition in the concentration range as described above in the feed composition and / or pharmaceutical composition.
  • the composition comprising the active ingredient in the above-mentioned concentration range may have superior anti-protozoal activity than when it is included in a range outside the concentration range.
  • Another aspect includes administering the composition (eg, the feed composition, the feed additive, the pharmaceutical composition, and/or the anti-antigen composition) to an animal (eg, an animal other than a human) , a method for preventing, ameliorating, or treating coccidiosis.
  • the method may further include identifying (selecting) an individual (patient) in need of prevention, improvement, or treatment of the coccidiosis.
  • the composition and coccidiosis are as described above.
  • the step of identifying the individual may include detecting an ossist of a protozoan capable of inducing coccidium in feces separated from the individual.
  • the method of administering the composition, the route of administration, and/or the dosage are as described above.
  • the composition may be administered in a pharmaceutically effective amount.
  • a 'pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level refers to the type, severity, activity of the drug, and the drug Sensitivity to, administration time, administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field.
  • the composition may be administered as an individual therapeutic agent or may be administered in combination with other anticoccidial agents, may be administered simultaneously, separately, or sequentially with a conventional therapeutic agent, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the subject to which the method for preventing, ameliorating, or treating coccidiosis is applied means an animal that has or can invent coccidiosis, and the animal includes humans, horses, cattle, mice, rats, dogs, cats, etc. birds, including mammals, poultry (eg, breeders, broilers, and/or laying hens, etc.), fish, amphibians, and/or reptiles.
  • the animal includes humans, horses, cattle, mice, rats, dogs, cats, etc. birds, including mammals, poultry (eg, breeders, broilers, and/or laying hens, etc.), fish, amphibians, and/or reptiles.
  • the animal to which the method for preventing, improving, or treating coccidiosis is applied is at least one selected from the group consisting of animals listed in Table 1 (eg, at least one, two or more, or three or more).
  • animals listed in Table 1 can be, for example, humans, chickens, ducks, geese, turkeys, quails, pheasants, pigeons, parrots, cows, pigs, goats, sheep, horses, antelopes, oryx, monkeys, cats, dogs, mice, rats, rabbits, At least one selected from the group consisting of raccoon, squirrel, bat, guinea pig, camel, lima, alpaca, wombat, lizard, goldfish, crucian carp, tilapia, barbell, lungfish, and European chub (for example, one or more species, 2 more than one species, or three or more).
  • the animal may be an animal other than a human.
  • a composition comprising coumaric acid and/or a salt thereof according to an embodiment has an excellent effect of inhibiting cell infiltration of protozoa capable of inducing coccidiosis and/or of inhibiting proliferation of the protozoa in cells, and preventing, improving, and improving coccidiosis in vivo, and It has excellent therapeutic effect and can reduce secondary coccidiosis infection by remarkably reducing the amount of oocyst in feces.
  • ACI anticoccidium composite index
  • Example 1-1 Experimental facility and research design
  • Korean feed A1-choi product Korean feed A1-choi product was used, and each material (salinomycin (Jeil Salino-60 product, Jeil Bio), VantiPEAL (Kemin, Cozante, main material: Gallic acid), p -coumaric acid was used in the feed. ( p -coumaric acid, CAS No. 501-98-4; sigma)) was added at the concentrations shown in Table 3 below and self-mixed. Antibiotics and supplements were not used in general feeds and formulated feeds, and no anticoccidial agents were added to each material. The broilers were fed ad libitum throughout the duration of the experiment.
  • Coccidiosis induction was carried out by oral inoculation (challenge inoculation) of 10,000 ocysts per individual in 21-day-old broilers with oocysts of Aimeria tenella, which were more than 90% mature (sporulation).
  • the feed formulation administered to the control group (negative control group or positive control group) and the test group and whether coccidiosis was induced by A. tenella were described in Table 3 below.
  • Six 1-day-old broilers were bred in cages randomly placed for each control or test group, and after feeding the general feed for 14 days, the formulated feed prepared above was separately consumed for each control or test group.
  • NC army process uninfected negative control
  • PC general feed Infected negative control
  • Coumarin acid intake group 1 Aymeria tenella infection + + p -coumaric acid (sigma) formulated feed containing 125ppm
  • the anticoccidium efficacy for each test group designed in Example 1-2 was expressed as an anticoccidial index (ACI), and the anticoccidium composite index was calculated by Equation 2 below.
  • ACI score is out of 200 points, and the higher the ACI score, the better the anticoccidial ability. It is judged to be excellent, and if the score is 160 or higher, it is judged that the anticoccidial effect is very good (Luis Miguel De Pablos et al., Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens, Parasitol Res, 2010).
  • Anticoccidium Composite Index (survival rate (%) after challenge inoculation) + (daily weight gain (RWG,%) compared to negative control group) - (lesion score x 10) - (fecal oscosis discharge index)
  • the daily gain (ADG, g/d) and the daily gain (RWG, %) compared to the negative control group in each control and test group are shown in Table 4 below.
  • Lesion scoring On the 9th day after challenge inoculation, 4 broilers per cage were necropsied and the intestines were incised open. A score was scored for each coccidial lesion in the cecal region of broilers. The lesion scoring method was performed with reference to Johnson JK & Reid WM (1970) literature (Joyce Johnson, W. Malcolm Reid, Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens, Experimental parasitology, 1970). Lesion score has a scale of 0-4, with 0 being normal cecum, 1 being mild infection, 2 being moderate infection, 3 being severe infection, and 4 being very severe infection. It applies to cases that show symptoms or cause death. The cecal lesion scores measured in each control group and test group are shown in Table 4 below. The measured cecal lesion score was multiplied by 10 to obtain a lesion index, which was used to calculate the anticoccidium composite index.
  • Fecal oscary discharge All feces from the 6th to 9th days of challenge inoculation were collected by cage and mixed evenly, and then randomly sampled 3 times, 1g each. After floating the ocysts in 1 g of feces using brine, the oste emissions were measured using a McMaster chamber, and the results are shown in Table 4 below.
  • the amount of osteous discharge for each group was divided by that of the negative infected control group and multiplied by 100 to calculate the amount of osteous discharge (%) compared to the negative infected control group.
  • the amount of oscitosis output is 0 to less than 1%, 5 for 1% to less than 26%, 10 for 26% to less than 51%, 20, 76 for more than 51% and less than 76%.
  • % or more to 100% or less was 40 to calculate the oscit emission index, and this was used to calculate the anticoccidium composite index.
  • Group control test group Compounds NC PC Salinomycin VantiPEARL p -coumaric acid conc (ppm) 60 125 125 broiler chicken 18 18 18 18 18 ADG after attack (g/d) 55 37 45 49 52 RWG(%) 100 67.3 81.8 89.1 94.5 Survival rate (%) 100 100 100 100 100 appendix lesion score 0 3.37 2.27 2.17 2.5 appendix lesion index - 33.7 22.7 21.7 25 Osist Emissions (Oocyst/chicken) 0 1.3x10 8 6.3x10 7 8x10 7 5.7x10 7 Oocyst index 0 40 10 20 10 ACI 200 94 149 147 160
  • the negative control group (PC) infected with Aymeria tenella developed coccidiosis compared to the non-infected negative control group (NC), resulting in a decrease in weight gain, and an increase in lesion score and ocyst (egg) discharge.
  • the salinomycin-administered group which was used as the anticoccidial control group, increased the body weight and decreased the lesion score and ocyst discharge compared to the infected negative control group (PC).
  • the VantiPEARL-administered group which is a control group for natural anticoccidium, also increased the weight gain and decreased egg discharge and lesion index compared to the PC group.
  • the p -coumaric acid administration group increased the amount of weight gain compared to the PC group, and decreased the lesion score and ocyst discharge.
  • the p -coumaric acid administered group 125ppm scored 160 points, and the anticoccidium efficacy was superior to the positive control groups, Salinomycin (149 points) and VantiPEAL (147 points).
  • Example 3 Aimeria of coumarin acid ( Eimeria ) Inhibitory effect of cell penetration and proliferation against protozoa
  • a certain amount of each Aymeria tenella and Aymeria acebulina is placed in a tube containing glass beads and pulverized, and then the percoll density gradient is used to remove the crushed cell wall and other debris. to purify internal sporocysts, and wash with PBS solution.
  • the sporangia of A. acebulina and A. tenella were treated with a reagent containing sodium taurocholic acid (Sigma aldrich, USA) and trypsin (trypsin, Gibco, USA), respectively. After incubation, it was washed once with a PBS solution, and protozoa was obtained.
  • Example 3-2 Inhibitory effect of protozoan cell infiltration and intracellular protozoan proliferation by coumaric acid treatment
  • Protozoa of A. tenella and A. acebulina were obtained by the method of Example 3-1. 2x10 5 sporozoites per well were added to the wells lined with MDBK cells (purchased from ATCC) as a monolayer and each Material ( p -coumaric acid; sigma, CAS No. 501-98-4, and anticoccidial gallic acid; sigma, CAS No. 149-91-7, salinomycin; CAS No. sigma, 53003-10-4, Diclazuril; sigma, CAS No.
  • DNA is extracted from the cells using a DNA extract kit (Intron Biotechnology), and E.tenella ITS-1 (Internal transcribed spacer-1) gene or E. acervulina ACE gene Real-time PCR was performed using specific primers. The sequences of the primers used are shown in Table 5 below.
  • a protozoan of A. tenella was obtained similarly to the method of Example 3-1. 2x10 5 sporozoites per well were added to wells lined with MDBK cells (purchased from ATCC) as a monolayer and incubated for 24 hours at a temperature of 40° C. washed. Each Materials ( p -coumaric acid, gallic acid, an anticoccidial agent, salinomycin: 10 ppm and diclazuril: 1 ppm) were treated with the cells, and further cultured at a temperature of 40° C. for 24 hours.
  • a negative control is MDBK cells infected with protozoa
  • a positive control refers to a group incubated with a solution of salinomycin, gallic acid, or diclazuril and protozoa. After removing the cells and proliferating protozoa through pipetting, DNA was extracted from the cells using a DNA extract kit (Intron Biotechnology), and PCR was performed using E.tenella ITS-1 specific primers. The primer sequences used are shown in Table 5 above.
  • diclazuril is effective in inhibiting proliferation of protozoa in cells
  • gallic acid is effective only in infiltrating protozoa cells
  • coumaric acid is infiltrating Aymeria tenella protozoa and intracellular protozoa. All of the proliferation (propagation) was inhibited, and the degree was superior to that of the positive control group.
  • the cell penetration inhibitory efficacy against Eimeria acebulina in the coumarin acid-treated group was superior to all the positive controls (diclazuril, gallic acid, and salinomycin).
  • Example 4-1 Aimeria ( Eimeria ) direct killing effect on protozoa
  • the inner sporocysts are purified using the Percoll density gradient and , washed with PBS solution.
  • A. tenella sporangia was treated with a reagent containing sodium taurocholic acid (sigma aldirich, USA) and trypsin (Trypsin, Ginco, USA), respectively, and incubated with PBS After washing once with the solution, protozoa were obtained.
  • m -coumaric acid showed a direct killing effect on the protozoa of the genus Eimeria significantly superior to Caffeic acid and Ferulic acid.
  • Example 3-2 0.1% DMSO, p -coumaric acid (sigma, CAS No. 501-98-4), m -coumaric acid (sigma, 14755-02-3), and o -coumaric acid in a manner similar to Example 3-2 (sigma, 614-60-8) was treated at a concentration of 10 ppm, respectively, to measure cell invasion inhibition against A. tenella protozoa, and the results are shown in Table 9.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Animal Husbandry (AREA)
  • Birds (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Fodder In General (AREA)
  • Detergent Compositions (AREA)

Abstract

본 출원은 쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도에 관한 것으로, 일 예에 따른 쿠마린산 및/또는 이의 염을 포함하는 조성물은 콕시듐증을 유도할 수 있는 원충의 세포 침투 억제 효과 및/또는 세포 내 상기 원충 증식 억제 효과가 우수하고, 생체 내 콕시듐증 예방, 개선, 및 치료 효과가 우수하며, 분변 내 오시스트 배출량을 현저히 감소시켜 2차 콕시듐증 감염을 낮출 수 있다.

Description

쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도
관련 출원(들)과의 상호 인용
본 출원은 2021년 03월 05일자 대한민국 특허출원 제10-2021-0029733호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
본 출원은 쿠마린산 및/또는 이의 염을 포함하는 항콕시듐용 조성물 및 이의 용도에 관한 것이다.
콕시듐증은 아이메리아 (Eimeria) 라고 하는 첨복포자충문 (phylum apicomplexan)에 속하는 원생동물 기생충에 의해 초래되는 장 관련 질환으로서, 콕시듐증에 감염되면 소화장애, 설사, 체중 감소의 증상을 나타내고 더 나아가 가축 폐사까지 일으키며 전세계 농가에 경제적으로 큰 영향을 미친다 (Williams RB. A compartmentalised model for the estimation of the cost of coccidiosis to the world’s chicken production industry. Int J Parasitol. 1999; 29(8):1209-1229).
지난 몇 년간 많은 연구진들에 의하여, 콕시듐증을 치료하기 위한 치료제로서 오시스트 세포벽 형성 혹은 원충의 무성 및 유성생식을 막을 수 있는 아이노포어(ionophore) 또는 화학적 합성제제 (chemically synthetic coumpounds)와 같은 항콕시듐제들이 개발이 되었다. 그러나, 아이노포어와 화학적 합성제제를 번갈아 처리하는 셔틀프로그램 (shuttle program)의 장기적인 사용으로 인한 약제 내성을 지닌 원충 등이 출현하는 등 부작용이 발생하였다.
특히, 항생제의 오남용으로 인해 동물에 축적된 항생제는 육류를 통해 인간이 항생제를 섭취하게 되어 심각한 문제가 되고 있으며, 축산물 내 항생제 잔류 문제로 세계 각국에서 항생제 투약을 금지하고 있는 추세이다. 따라서 약제에 내성을 갖는 균주의 출현 및 체내 잔류 문제 등의 부작용을 나타내는 기존의 항콕시듐제의 대체제에 대한 개발 및 연구가 시급한 실정이다.
선행기술문헌
특허문헌
미국 공개특허 제2003-0091589호
본 출원의 일 예는, 쿠마린산(coumaric acid) 및/또는 이의 염의 콕시듐증 예방, 개선, 및/또는 치료에 사용하기 위한 용도를 제공한다.
본 출원의 다른 예는 쿠마린산 및/또는 이의 염을 유효성분으로 포함하는, 콕시듐증 예방, 또는 개선용 사료 조성물을 제공한다.
본 출원의 또 다른 예는 쿠마린산 및/또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 콕시듐증 예방, 또는 치료용 약학 조성물을 제공한다.
본 출원의 또 다른 예는 쿠마린산 및/또는 이의 염의 콕시듐증 예방, 개선, 및/또는 치료용 조성물 (예를 들면, 사료 조성물, 약학 조성물)의 제조에 사용하기 위한 용도를 제공한다.
본 출원의 또 다른 예는 상기 조성물(예를 들면, 상기 사료 조성물, 상기, 약학 조성물, 및/또는 상기 항원충용 조성물)을 인간을 제외한 동물에 투여하는 단계를 포함하는, 콕시듐증 예방, 개선, 및/또는 치료 방법을 제공한다.
본 출원의 또 다른 예는 쿠마린산 및/또는 이의 염의 아이메리아 속 원충에 대한 항원충 (예를 들면, 아이메리아 속 원충 사멸; 및/또는 아이메리아 속 원충의 세포 침투 및/또는 증식 억제)에 사용하기 위한 용도를 제공한다.
본 출원의 또 다른 예는 쿠마린산 및/또는 이의 염을 유효성분으로 포함하는, 아이메리아 속 원충에 대한 항원충용 조성물을 제공한다.
본 출원의 또 다른 예는, 쿠마린산 및/또는 이의 염의 아이메리아 속 원충에 대한 항원충용 조성물의 제조에 사용하기 위한 용도를 제공한다.
본 출원의 또 다른 예는, 쿠마린산 및/또는 이의 염을 동물(예컨대, 원충 방제를 필요로 하는 대상, 또는 인간을 제외한 동물)에게 투여하는 단계를 포함하는, 콕시듐증 예방, 개선, 및/또는 치료 방법, 또는 아이메리아 속 원충의 방제 방법을 제공한다. 본 명세서에서 원충의 방제는 항원충 작용을 포괄적으로 의미하는 것으로, 예를 들면, 아이메리아 속 원충 사멸, 및/또는 아이메리아 속 원충의 세포 침투 및/또는 증식 억제 등을 의미할 수 있으나, 이에 제한되는 것은 아니다.
일 예에서, 상기 쿠마린산은 하기 화학식 1의 구조를 가질 수 있다.
[화학식 1]
Figure PCTKR2022003072-appb-img-000001
일 예에 따른 쿠마린산(coumaric acid) 및/또는 이의 염을 포함하는 조성물은 항콕시듐 활성 및/또는 콕시듐증을 유도하는 원충에 대한 항원충 활성이 우수할 수 있다.
본 출원에서, 항콕시듐 효능 (활성, 효과)이 우수한 것은 하기 (1) 내지 (5)로 이루어지는 군 중에서 선택된 1종 이상 (예를 들면, 1종이상, 2종 이상, 3종 이상, 4종 이상, 또는 5종 모두)을 의미하는 것일 수 있다:
(1) 항콕시듐 종합지수(Anticoccidial index; ACI)가 대조군 대비 높음;
(2) 콕시듐증이 유도된 동물 개체에 투여되어 대조군 대비 폐사율, 병변 스코어(lesion score), 및/또는 분변 오시스트(oocyst) 배출양을 감소시킴;
(3) 콕시듐증 유도에 의한 체중 감소를 억제함;
(4) 대조군 대비 콕시듐증을 유도하는 원충에 대한 살충 활성이 높음; 및
(5) 대조군 대비 콕시듐증을 유도하는 원충의 세포 침투 및/또는 세포 내 상기 원충의 증식 억제 효과가 높음.
본 출원에서, 대조군은 음성 대조군(아무것도 처리하지 않은 군이거나 물, 및/또는 버퍼 처리군) 및/또는 기존의 공지된 항콕시듐제(예를 들면, 디클라주릴(diclazuril), 갈산(galic acid), 및/또는 살리노마이신(salinomycin))를 포함하는 양성 대조군을 의미할 수 있다.
일 예에 따른 조성물은 하기 (1) 내지 (6)으로 이루어진 군 중에서 선택된 1종 이상(예를 들면, 1종이상, 2종 이상, 3종 이상, 4종 이상, 5종 이상, 또는 6종 모두)의 특성을 가질 수 있고, 이의 특성은 대조군 보다 우수한 것일 수 있다:
(1) 항콕시듐 활성 우수;
(2) 콕시듐증을 유도하는 원충에 대한 항원충 효과 우수;
(3) 내산성 우수;
(4) 내열성 우수;
(5) 생체 내 안정성 및/또는 안전성 우수; 및
(6) 증체량 개선 효과 우수.
일 예에 따른 조성물은 내산성 및/또는 내열성이 우수하여 체내에 투여되어 우수한 항콕시듐 활성을 장기간 유지할 수 있고, 생체 내 안정성이 우수하며, 다양한 온도 및/또는 pH 범위의 환경에서도 우수한 항콕시듐 활성을 유지할 수 있고, 다양한 제품(예를 들면, 사료 첨가제)에 적용이 가능하며, 보관 안정성이 우수할 수 있다.
일 예에 따른 조성물은 체내 투여시 장 외의 다른 조직 및 장기(예를 들면, 혈액, 간, 신장, 및/또는 비장 등) 등에 흡수되지 아니하여 체내 잔류량이 적어 생체 내 안전성이 우수할 수 있다.
일 예에서, 증체량 개선 효과가 우수하다는 것은 개체에 투여되어 개체의 체중을 증가시키는 효과가 우수한 것을 의미할 수 있고, 일 예에서 상기 증체량은 일당 증체량을 의미할 수 있고, 상기 개체는 콕시듐증이 유도된 개체일 수 있다.
일 예에 따른 조성물은 기존의 공지된 항콕시듐제(예를 들면, 설파퀴녹살린, 설파클로로피라진, 및 설파메타진과 같은 설파제, 살리노마이신 및 모넨신소듐과 같은 폴리에테르 이오노포어 항생물질, 암푸로륨, 디클라주릴, 및/또는 톨트라주릴) 보다 동등 이상의 우수한 항콕시듐 활성을 나타내면서도, 대사 과정 중 자연스럽게 대사에 참여하는 물질인 쿠마린산 및/또는 이의 염을 유효성분으로 포함하므로 부작용이나 약물 내성을 유발하지 않고/않거나 체내 흡수가 되지 아니하여 장기간 사용해도 안전하다. 일 예에 따른 조성물은 내성이나 체내에 잔류되지 아니하여 육계뿐만 아니라 산란계에서 콕시듐 예방, 개선, 및/또는 치료용 물질로 활용될 수 있다. 일 예에 따른 조성물은 항콕시듐을 유발하는 원충에 감염된 개체로부터의 오시스트 배출량을 현저히 감소시킬 수 있어, 축사 오염 및/또는 2차 감염 비율을 감소시킬 수 있다.
본 출원에서, "예방"이란 일 예에 따른 조성물의 투여에 의해 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미하고, "치료"란 일 예에 따른 조성물의 투여에 의해 질환의 의심 및 발병 개체의 증상이 호전되거나 이롭게 변경되는 모든 행위를 의미하며, "개선"이란, 일 예에 따른 조성물의 투여로 질환이 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다. 상기 질환은 콕시듐증을 의미할 수 있다.
일 양상은 쿠마린산(coumaric acid) 및/또는 이의 염(쿠마린산, 쿠마린산의 염, 또는 이의 조합)을 포함하는, 콕시듐증 예방, 또는 개선용 사료 조성물을 제공할 수 있다.
상기 ‘쿠마린산’은 신남산 (cinnamic acid)의 히드록시 유도체인 히드록시 신남산(hydroxycinnamic acid)의 일종으로, 일 예에서, 상기 쿠마린산은 p-쿠마린산(p-coumaric acid), m-쿠마린산(m-coumaric acid), 및 o-쿠마린산(o-coumaric acid)로 이루어진 군에서 선택된 1종 이상일 수 있다.
일 예에서, 상기 쿠마린산은 트랜스(trnas) 형 및/또는 시스(cis) 형일 수 있다. 예를 들면, 상기 p-쿠마린산은 트랜스-p-쿠마린산(trans-p-coumaric acid) 및/또는 시스-p-쿠마린산(cis-p-coumaric acid)일 수 있고, 상기 m-쿠마린산은 트랜스-m-쿠마린산(trans-m-coumaric acid) 및/또는 시스-m-쿠마린산(cis-m-coumaric acid)일 수 있으며, 상기 o-쿠마린산은 트랜스-o-쿠마린산(trans-o-coumaric acid) 및/또는 시스-o-쿠마린산(cis-o-coumaric acid)일 수 있다.
상기 p-쿠마린산은 ‘4-히드록시 신남산(4-Hydroxycinnamic acid)’, ‘p-히드록시 신남산(p-Hydroxycinnamic acid), 또는 2-(4-히드록시페닐)아크릴 산(2-(4-hydroxyphenyl)acrylic acid)으로 명명될 수 있고, C9H8O3의 분자식을 갖는 것일 수 있다. 일 예에서, 상기 p-쿠마린산은 다음의 화학식 1 또는 화학식 2로 표시되거나 이(화학식 1 로 표시되는 화합물 및 화학식 2로 표현되는 화합물)의 혼합물일 수 있다. 일 예에서 상기 p-쿠마린산의 Cas 번호는 Cas No. 501-98-4, Cas No. 7400-08-0, 및/또는 Cas No. 4501-31-9일 수 있다.
[화학식 1]
Figure PCTKR2022003072-appb-img-000002
[화학식 2]
Figure PCTKR2022003072-appb-img-000003
상기 m-쿠마린산은 ‘3-히드록시 신남산(3-Hydroxycinnamic acid)’, ‘m-히드록시 신남산(m-Hydroxycinnamic acid), 또는 ‘3-(3-히드록시페닐)아크릴 산(3-(3-Hydroyphenyl)acrylic acid)’으로 명명될 수 있고, C9H8O3의 분자식을 갖는 것일 수 있다. 일 예에서, 상기 m-쿠마린산은 다음의 화학식 3 또는 화학식 4로 표시되거나 이(화학식 3으로 표시되는 화합물 및 화학식 4로 표현되는 화합물)의 혼합물일 수 있다. 일 예에서 상기 m-쿠마린산의 Cas 번호는 Cas No. 14755-02-3, Cas No. 25429-38-3, 및/또는 Cas No. 588-30-7 일 수 있다.
[화학식 3]
Figure PCTKR2022003072-appb-img-000004
[화학식 4]
Figure PCTKR2022003072-appb-img-000005
상기 o-쿠마린산은 ‘2-히드록시 신남산(2-Hydroxycinnamic acid)’또는 ‘2-히드록시신나메이트(2-hydroxycinnamate)’로 명명될 수 있고, C9H8O3의 분자식을 갖는 것일 수 있다. 일 예에서, 상기 o-쿠마린산은 다음의 화학식 5 또는 화학식 6으로 표시되거나 이(화학식 5로 표시되는 화합물 및 화학식 6으로 표현되는 화합물)의 혼합물일 수 있다. 일 예에서, 상기 o-쿠마린산의 Cas 번호는 Cas No. 614-60-8 및/또는 Cas No. 495-79-4일 수 있다.
[화학식 5]
Figure PCTKR2022003072-appb-img-000006
[화학식 6]
Figure PCTKR2022003072-appb-img-000007
상기 쿠마린산 및/또는 이의 염(상기 쿠마린산의 염)은 천연물(예를 들면, 식물) 및/또는 균주에서 추출 및 분리하여 얻거나, 통상적인 유기합성 방법으로 제조하거나, 당업계의 제조업자로부터 수득할 수 있으나 이에 한정되지 않는다.
본 출원에서, “쿠마린산의 염”은 양이온과 음이온이 정전기적 인력에 의해 결합하고 있는 물질인 염 중에서 본 생리학상 허용되는 염을 의미할 수 있고, “약학적으로 허용 가능한 염”은 약제학적으로 사용될 수 있는 형태의 염을 의미할 수 있으며, 예를 들면, 금속염, 유기 염기와의 염, 무기산과의 염, 유기산과의 염, 염기성 또는 산성 아미노산과의 염 등이 될 수 있다. 일 예에서, 상기 금속염으로는 알칼리 금속염(나트륨염, 칼륨염 등), 알칼리 토금속염(칼슘염, 마그네슘염, 바륨염 등), 알루미늄염 등이 될 수 있고; 유기 염기와의 염으로는 트리에틸아민, 피리딘, 피콜린, 2,6-루티딘, 에탄올아민, 디에탄올아민, 트리에탄올아민, 시클로헥실아민, 디시클로헥실아민, N,N-디벤질에틸렌디아민 등과의 염이 될 수 있으며; 무기산과의 염으로는 염산, 브롬화수소산, 질산, 황산, 인산 등과의 염이 될 수 있고; 유기산과의 염으로는 포름산, 아세트산, 트리플루오로아세트산, 프탈산, 푸마르산, 옥살산, 타르타르산, 말레인산, 시트르산, 숙신산, 메탄술폰산, 벤젠술폰산, p-톨루엔술폰산 등과의 염이 될 수 있으며; 염기성 아미노산과의 염으로는 아르기닌, 라이신, 오르니틴 등과의 염이 될 수 있고; 산성 아미노산과의 염으로는 아스파르트산, 글루탐산 등과의 염이 될 수 있다.
본 출원에서, "콕시듐증(coccidiosis, 콕시디아증)"은 콕시듐 원충 (콕시듐증을 유도할 수 있는 원충, 예를 들면 아이메리아 속 콕시듐 원충)이 소화관 상피에서 점막 밑 조직의 세포질 내에 기생하며 상피를 파괴시키고 장염을 일으키는 질환으로서, 육계농장 등에서 연변, 설사 및 혈변으로 증체율 저하와 출하일령의 연장으로 경제적 피해를 야기하는 원충성 질병이다. 콕시듐증은 육계뿐 아니라 조류, 어류, 파충류 및 포유동물에서도 발현될 수 있고, 구체적으로 상기 콕시듐증은 소, 토끼, 염소, 개, 고양이, 실험동물인 마우스, 및 랫트 등에도 감염될 수 있으며, 특히 닭, 오리, 거위, 칠면조, 메추라기, 꿩 등 가금류에 치명적인 손상을 입힐 수 있다. 일 예에서, 상기 콕시듐증은 급성형 콕시듐증, 아급성형 콕시듐증, 및 만성형 콕시듐증 등을 포함할 수 있다. 상기 급성형 콕시듐증은 감염 후 48시간 이내에 혈변, 원기소실, 빈혈을 나타내며, 감염된 개체가 폐사할 수 있고, 상기 아급성형 콕시듐증은 감염 후 혈액성 설사 및/또는 빈혈 증상을 나타낼 수 있고, 상기 만성형 콕시듐증은 감염 후 1~2일간 설사후 연변 및/또는 체중 감소의 증상을 나타낼 수 있다.
콕시듐 원충 종의 오시스트(Oocyst, 낭포, 충란)가 높은 습도와 온도에서 포자충(Sporulated Oocyst)으로 성숙될 경우 감염성이 있으며, 개체의 체내에서 일정한 생활사(life cycle)를 거친 후 분변으로 오시스트를 배설하면 쉽게 전파가 이루어지고 오시스트 생활사가 되풀이된다. 콕시듐 원충 종의 오시스트(낭포)는 외부 환경에 대해 저항성이 크며, 낭포벽은 내외의 2층으로 구성된 것으로 알려져 있다. 낭포벽의 외층은 젤라틴 물질로서 물리적인 외압에 강하게 저항하고 내층은 핵단백이 풍부하여 화학적 자극, 예를 들면 소독제에 강하게 저항할 수 있다. 콕시듐 원충 종의 오시스트는 4개의 포자낭(sporocysts)을 포함할 수 있고, 상기 포자낭은 각 2개의 포자소체(sporozoites)를 포함할 수 있으며, 오시스트 형태로 동물에 감염 후 포자낭과 포자소체 형태로 방출되어 세포 내에서 증식하고, 유성생식 및/또는 무성생식을 거친 포자소체는 오시스트를 형성하여 분변으로 배출될 수 있다. 일 예에서, 포자소체는 원충과 동일한 의미로 사용될 수 있고, 상기 포자소체(원충)는 병변을 일으킬 수 있다.
일 예에 따르면, 상기 콕시듐증은 아이메리아 속(Eimeria sp.) 원충에 의해 유도되는 것일 수 있다. 일 예에서, 상기 아이메리아 속 원충은 아이메리아 아세불리나(Eimeria acervulina: 모래구포자충), 아이메리아 테넬라(Eimeria tenella: 닭맹장구포자충), 아이메리아 맥시마(Eimeria maxima: 맥시마구포자충), 아이메리아 네카트릭스(Eimeria necatrix: 네카트르구포자충), 아이메리아 브루네티(Eimeria brunetti: 브루네트구포자충), 아이메리아 하가니(Eimeria hagani: 하가니구포자충), 아이메리아 미티스(Eimeria mitis: 미티스구포자충), 아이메리아 프래콕스(Eimeria praecox: 이른구포자충), 아이메리아 미바티(Eimeria mivati: 미바트구포자충), 아이메리아 아우라티(Eimeria aurati), 아이메리아 바루에리(Eimeria baueri), 아이메리아 레피도시레니스(Eimeria lepidosirenis), 아이메리아 류시스시 (Eimeria leucisci), 아이메리아 루틸리 (Eimeria rutile), 아이메리아 바나시(Eimeria vanasi), 아이메리아 앰피스배니아룸(Eimeria amphisbaeniarum), 아이메리아 윗처리 (Eimeria witchery), 아이메리아 예메낸새(Eimeria yemenensae), 아이메리아 아데노에이데스(Eimeria adenoeides), 아이메리아 콜치씨(Eimeria colchici), 아이메리아 컬바타(Eimeria curvata), 아이메리아 디스펄사(Eimeria dispersa), 아이메리아 두오데나리스(Eimeria duodenalis), 아이메리아 프라터큘래(Eimeria fraterculae), 아이메리아 갈로파보니스(Eimeria gallopavonis), 아이메리아 이노쿠아(Eimeria innocua), 아이메리아 멜레그리디스(Eimeria meleagridis), 아이메리아 멜레그리미티스(Eimeria meleagrimitis), 아이메리아 파시아니(Eimeria phasiani), 아이메리아 프로쎄라(Eimeria procera), 아이메리아 펄퓨어이쎄팔리(Eimeria purpureicephali), 아이메리아 아사타(Eimeria ahsata), 아이메리아 알바멘시스(Eimeria alabamensis), 아이메리아 알리제비(Eimeria alijevi), 아이메리아 아스퍼로니카(Eimeria aspheronica), 아이메리아 아를로인지(Eimeria arloingi), 아이메리아 아룬델리(Eimeria arundeli), 아이메리아 바쿠엔시스(Eimeria bakuensis), 아이메리아 보비스(Eimeria bovis), 아이메리아 카멜리(Eimeria cameli), 아이메리아 카프리나(Eimeria caprina), 아이메리아 카프로비나(Eimeria caprovina), 아이메리아 크리스텐세니(Eimeria christenseni), 아이메리아 클레트리오노미스(Eimeria clethrionomyis), 아이메리아 코에씨콜라(Eimeria coecicola), 아이메리아 콘토르타(Eimeria contorta), 아이메리아 코우에씨(Eimeria couesii), 아이메리아 크랜달리스(Eimeria crandallis), 아이메리아 다마헨시스(Eimeria dammahensis), 아이메리아 도우레리(Eimeria dowleri), 아이메리아 엑시구아(Eimeria exigua), 아이메리아 팔씨포르미스(Eimeria falciformis), 아이메리아 파라사니(Eimeria farasanii), 아이메리아 페리시(Eimeria ferrisi), 아이메리아 플라베씬스(Eimeria flavescens), 아이메리아 갈라티(Eimeria gallatii), 아이메리아 그래눌로사(Eimeria granulosa), 아이메리아 히르씨(Eimeria hirci), 아이메리아 인테스트이날리스(Eimeria intestinalis), 아이메리아 이레시두아(Eimeria irresidua), 아이메리아 인트리카타(Eimeria intricata), 아이메리아 졸치제비(Eimeria jolchijevi), 아이메리아 크링즈마니(Eimeria krijgsmanni), 아이메리아 래리머렌시스(Eimeria larimerensis), 아이메리아 마쿠사니엔시스(Eimeria macusaniensis), 아이메리아 마그나(Eimeria magna), 아이메리아 마르코니(Eimeria marconii), 아이메리아 메디아(Eimeria media), 아이메리아 멜라누리(Eimeria melanuri), 아이메리아 미옥시(Eimeria myoxi), 아이메리아 나그푸렌시스(Eimeria nagpurensis), 아이메리아 니에스쿨지(Eimeria nieschulzi), 아이메리아 니나콜야키모배(Eimeria ninakohlyakimovae), 아이메리아 오비노달리스(Eimeria ovinoidalis), 아이메리아 팔리다(Eimeria pallida), 아이메리아 팔루스트리스(Eimeria palustris), 아이메리아 파필라타(Eimeria papillata), 아이메리아 퍼르포란스(Eimeria perforans), 아이메리아 포캐(Eimeria phocae), 아이메리아 필레타(Eimeria pileata), 아이메리아 피피스트렐루스(Eimeria pipistrellus), 아이메리아 피리포르미스(Eimeria piriformis), 아이메리아 프리오노템니(Eimeria prionotemni), 아이메리아 프로시오니스(Eimeria procyonis), 아이메리아 펀크타타(Eimeria punctate), 아이메리아 루브루키(Eimeria roobroucki), 아이메리아 사우디엔시스(Eimeria saudiensis), 아이메리아 시란데리(Eimeria sealanderi), 아이메리아 세파라타(Eimeria separata), 아이메리아 스티에대(Eimeria stiedae), 아이메리아 우르시니(Eimeria ursini), 아이메리아 베르미포르미스(Eimeria vermiformis), 아이메리아 웨이브리드젠시스(Eimeria weybridgensis), 아이메리아 우바티(Eimeria wobati), 및 아이메리아 주에르니(Eimeria zuernii)로 이루어진 군 중에서 선택되는 1종 이상(예를 들면, 1종 이상, 2종 이상, 3종 이상, 또는 4종 이상)일 수 있다.
일 예에 따른 조성물은 하기 표 1에 기재된 아이메리아 속 원충으로 이루어진 군에서 선택된 1종 이상(예를 들면, 1종 이상, 2종 이상, 3종 이상, 또는 4종 이상)의 원충으로 인해 유도된 콕시듐증의 예방, 개선, 및/또는 치료 효과가 우수한 것일 수 있고, 하기 표 1에 기재된 아이메리아 속 원충은 각각 표 1에 기재된 동물의 콕시듐증을 유도하는 것일 수 있다.
species 호스트(host) 동물
1 아이메리아 아세불리나 (Eimeria acervulina) 닭 (Gallus gallus domesticus)
2 아이메리아 테넬라(Eimeria tenella) 닭 (Gallus gallus domesticus)
3 아이메리아 맥시마(Eimeria maxima) 닭 (Gallus gallus domesticus)
4 아이메리아 네카트릭스 (Eimeria necatrix) 닭 (Gallus gallus domesticus)
5 아이메리아 브루네티 (Eimeria brunetti) 닭 (Gallus gallus domesticus)
6 아이메리아 하가니(Eimeria hagani) 닭 (Gallus gallus domesticus)
7 아이메리아 미티스(Eimeria mitis) 닭 (Gallus gallus domesticus)
8 아이메리아 프래콕스 (Eimeria praecox) 닭 (Gallus gallus domesticus)
9 아이메리아 미바티(Eimeria mivati) 닭 (Gallus gallus domesticus)
10 아이메리아 아우라티
(Eimeria aurati)		 금붕어 (goldfish (Carassius auratus))
11 아이메리아 바루에리(Eimeria baueri) 붕어 (crucian carp (Carassius carassius))
12 아이메리아 레피도시레니스(Eimeria lepidosirenis) 남아메리카폐어(South American lungfish (Lepidosiren paradoxa))
13 아이메리아 류시스시(Eimeria leucisci) 바벨 (common barbel (Barbus barbus bocagei))
14 아이메리아 루틸리
(Eimeria rutile)		 유럽산 처브 (European chub (Leuciscus cephalus cabeda)), 이베리아 코 잉어 (Iberian nase (Chondrostoma polylepis polylepis))
15 아이메리아 바나시
(Eimeria vanasi)		 블루 틸라피아 (blue tilapia (Oreochromis aureus))
16 아이메리아 앰피스배니아룸(Eimeria amphisbaeniarum) 웜도마뱀 (Mann's worm lizard (Amphisbaena manni))
17 아이메리아 윗처리(Eimeria witchery) 웜도마뱀 (Mann's worm lizard (A. manni))
18 아이메리아 예메낸새(Eimeria yemenensae) 무지개 아가마 (rock agama (Agama yemenensis))
19 아이메리아 아데노에이데스(Eimeria adenoeides) 칠면조 (turkey (Meleagris gallopavo))
20 아이메리아 콜치씨(Eimeria colchici) 꿩 (common pheasant (Phasianus colchicus))
21 아이메리아 컬바타
(Eimeria curvata)		 회색머리땅비둘기 (ruddy ground dove (Columbina talpacoti)), 비늘작은비둘기 (scaled dove (Scardafella squammata))
22 아이메리아 디스펄사(Eimeria dispersa) 칠면조 (turkey (M. gallopavo)), 메추라기 (bobwhite quail (Colinus virginianus))
23 아이메리아 두오데나리스(Eimeria duodenalis) 꿩 (common pheasant (Phasianus colchicus))
24 아이메리아 프라터큘래(Eimeria fraterculae) 아틀란틱 퍼핀 (Atlantic puffin (Fratercula arctica))
25 아이메리아 갈로파보니스(Eimeria gallopavonis) 칠면조 (turkey (M. gallopavo))
26 아이메리아 이노쿠아(Eimeria innocua) 칠면조 (turkey (M. gallopavo))
27 아이메리아 멜레그리디스(Eimeria meleagridis) 칠면조 (turkey (M. gallopavo))
28 아이메리아 멜레그리미티스(Eimeria meleagrimitis) 칠면조 (turkey (M. gallopavo))
29 아이메리아 파시아니(Eimeria phasiani) 꿩 (pheasant (P. colchicus))
30 아이메리아 프로쎄라(Eimeria procera) 유럽반시 (grey partridges (Perdix perdix))
31 아이메리아 펄퓨어이쎄팔리(Eimeria purpureicephali) 보석앵무 (red-capped parrot (Purpureicephalus spurius))
32 아이메리아 아사타(Eimeria ahsata) 염소 (goat (Capra hircus)), 양 (sheep (Ovis aries))
33 아이메리아 알바멘시스(Eimeria alabamensis) 소 (cattle (Bos taurus))
34 아이메리아 알리제비(Eimeria alijevi) 염소 (goat (C. hircus))
35 아이메리아 아스퍼로니카(Eimeria aspheronica) 염소 (goat (C. hircus))
36 아이메리아 아를로인지(Eimeria arloingi) 염소 (goat (C. hircus))
37 아이메리아 아룬델리(Eimeria arundeli) 애기 웜뱃 (common wombat (Vombatus ursinus))
38 아이메리아 바쿠엔시스(Eimeria bakuensis) 양 (sheep (O. aries))
39 아이메리아 보비스(Eimeria bovis) 소 (cattle (B. taurus))
40 아이메리아 카멜리(Eimeria cameli) 낙타 (camels (Camelus bactrianus, Camelus dromedarius))
41 아이메리아 카프리나(Eimeria caprina) 염소 (goat (C. hircus))
42 아이메리아 카프로비나(Eimeria caprovina) 염소 (goat (C. hircus))
43 아이메리아 크리스텐세니(Eimeria christenseni) 염소 (goat (C. hircus))
44 아이메리아 클레트리오노미스(Eimeria clethrionomyis) 대륙밭쥐속 (red-backed vole (Clethrionomys gapperi))
45 아이메리아 코에씨콜라(Eimeria coecicola) 토끼 (rabbit (Oryctolagus cuniculus))
46 아이메리아 콘토르타(Eimeria contorta) 마우스 (mouse (Mus musculus))
47 아이메리아 코우에씨(Eimeria couesii) 쌀쥐 (rice rat (Oryzomys couesi))
48 아이메리아 크랜달리스(Eimeria crandallis) 양 (sheep (O. aries))
49 아이메리아 다마헨시스(Eimeria dammahensis) 긴칼뿔오릭스 (scimitar-homed oryx (Oryx dammah))
50 아이메리아 도우레리(Eimeria dowleri) 붉은나무박쥐(eastern red bat (Lasiurus borealis))
51 아이메리아 엑시구아(Eimeria exigua) 토끼 (rabbit (O. cuniculus))
52 아이메리아 팔씨포르미스(Eimeria falciformis) 마우스 (mouse (M. musculus))
53 아이메리아 파라사니(Eimeria farasanii) 마운틴 가젤 (mountain gazelle (Gazella gazelle farasani))
54 아이메리아 페리시(Eimeria ferrisi) 마우스 (mouse (M. musculus))
55 아이메리아 플라베씬스
(Eimeria flavescens)		 토끼 (rabbit (O. cuniculus))
56 아이메리아 갈라티(Eimeria gallatii) 대륙밭쥐속(red-backed vole (Clethrionomys gapperi))
57 아이메리아 그래눌로사(Eimeria granulosa) 염소 (goat (C. hircus))
58 아이메리아 히르씨(Eimeria hirci) 염소 (goat (C. hircus))
59 아이메리아 인테스트이날리스(Eimeria intestinalis) 토끼 (rabbit (O. cuniculus))
60 아이메리아 이레시두아(Eimeria irresidua) 토끼 (rabbit (O. cuniculus))
61 아이메리아 인트리카타(Eimeria intricata) 염소 (goat (C. hircus))
62 아이메리아 졸치제비(Eimeria jolchijevi) 염소 (goat (C. hircus))
63 아이메리아 크링즈마니(Eimeria krijgsmanni) 마우스 (mouse (M. musculus))
64 아이메리아 래리머렌시스(Eimeria larimerensis) 유인타땅다람쥐 (Uinta ground squirrel (Spermophilus armatus))
65 아이메리아 마쿠사니엔시스
(Eimeria macusaniensis)		 라마 (llamas (Lama glama)), 구아나코 (guanacos (Lama guanicoe)), 알파카 (alpacas (Vicugna pacos)), 비쿠냐 (vicunas (Vicugna vicugna))
66 아이메리아 마그나
(Eimeria magna)		 토끼 (rabbit (O. cuniculus))
67 아이메리아 마르코니(Eimeria marconii) 대륙밭쥐속 (red-backed vole (Clethrionomys gapperi))
68 아이메리아 메디아(Eimeria media) 토끼 (rabbit (O. cuniculus))
69 아이메리아 멜라누리(Eimeria melanuri) 안경겨울잠쥐(garden dormouse (Eliomys quercinus))
70 아이메리아 미옥시(Eimeria myoxi) 안경겨울잠쥐(garden dormouse (Eliomys quercinus))
71 아이메리아 나그푸렌시스(Eimeria nagpurensis) 토끼 (rabbit (O. cuniculus))
72 아이메리아 니에스쿨지(Eimeria nieschulzi) 시궁쥐 (brown rat (R. norvegicus))
73 아이메리아 니나콜야키모배(Eimeria ninakohlyakimovae) 염소 (goat (C. hircus))
74 아이메리아 오비노달리스(Eimeria ovinoidalis) 양 (sheep (O. aries))
75 아이메리아 팔리다(Eimeria pallida) 염소 (goat (C. hircus))
76 아이메리아 팔루스트리스(Eimeria palustris) 쌀쥐 (marsh rice rat (Oryzomys palustris))
77 아이메리아 파필라타(Eimeria papillata) 마우스 (mouse (M. musculus))
78 아이메리아 퍼르포란스(Eimeria perforans) 토끼 (rabbit (O. cuniculus))
79 아이메리아 포캐(Eimeria phocae) 사블섬 잔점박이물범 (Sable Island harbour seals (Phoca vitulina))
80 아이메리아 필레타(Eimeria pileata) 대륙밭쥐속 (red-backed vole (Clethrionomys gapperi))
81 아이메리아 피피스트렐루스(Eimeria pipistrellus) 쿨집박쥐 (Kuhl's pipistrelle (Pipistrellus kuhlii))
82 아이메리아 피리포르미스(Eimeria piriformis) 토끼 (rabbit (O. cuniculus))
83 아이메리아 프리오노템니(Eimeria prionotemni) 붉은목왈라비 (Bennett's wallaby (Macropus rufogriseus))
84 아이메리아 프로시오니스(Eimeria procyonis) 라쿤(raccoon (Procyon lotor))
85 아이메리아 펀크타타(Eimeria punctate) 염소 (goat (C. hircus))
86 아이메리아 루브루키(Eimeria roobroucki) 토끼 (rabbit (O. cuniculus))
87 아이메리아 사우디엔시스(Eimeria saudiensis) 아라비아 영양 (Arabian oryx (Oryx leucoryx))
88 아이메리아 시란데리(Eimeria sealanderi) 붉은나무박쥐 (eastern red bat (Lasiurus borealis))
89 아이메리아 세파라타(Eimeria separata) 마우스 (mouse (M. musculus)),랫트 (rat (Rattus rattus))
90 아이메리아 스티에대(Eimeria stiedae) 토끼 (rabbit (O. cuniculus))
91 아이메리아 우르시니(Eimeria ursini) 남방털코웜뱃 (southern hairy nosed wombat (Lasiorhinus latifrons))
92 아이메리아 베르미포르미스(Eimeria vermiformis) 마우스 (mouse (M. musculus))
93 아이메리아 웨이브리드젠시스(Eimeria weybridgensis) 양 (sheep (O. aries))
94 아이메리아 우바티(Eimeria wobati) 남장털코웜뱃 (southern hairy-nosed wombat (L. latifrons))
95 아이메리아 주에르니(Eimeria zuernii) 소 (cattle (B. taurus))
일 예에 따른 조성물은 아이메리아 테넬라, 아이메리아 아세불리나, 및/또는 아이메리아 맥시마에 의해 유도된 콕시듐증 예방, 개선, 및/또는 치료에 효과가 우수한 것일 수 있다.
일 예에서, 상기 콕시듐증 예방 또는 개선은 하기 (1) 내지 (4)로 이루어지는 군에서 선택된 1종 이상(예를 들면, 1종 이상, 2종 이상, 3종 이상, 또는 4종 모두)을 의미할 수 있고, 예를 들면, 대조군(음성 대조군 및/또는 양성 대조군) 보다 하기 (1) 내지 (4)로 이루어지는 군에서 선택된 1종 이상이 감소, 억제, 및/또는 증가된 것일 수 있다:
(1) 병변 스코어(예를 들면, 맹장 병변 스코어), 분변 오시스트 배출양, 및 폐사율로 이루어지는 군에서 선택된 1종 이상이 감소;
(2) 콕시듐증에 의한 체중 감소의 억제;
(3) 항콕시듐 종합지수(Anticoccidial index; ACI)가 증가; 및
(4) 아이메리아 속 원충의 세포 침투, 세포 내 상기 원충의 증식, 또는 이들 모두를 감소.
일 예에서, 상기 병변 스코어를 결정하는 병변 스코어링 방법은 Johnson JK & Reid WM(1970) 문헌(Joyce Johnson, W.Malcolm Reid, Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens, Experimental parasitology, 1970)을 참고하여 수행될 수 있으며, 상기 병변 스코어는 0 내지 4 등급일 수 있다. 일 예에서, 상기 병변 스코어는 맹장, 십이지장, 및/또는 공장에서 측정된 병변 스코어를 의미할 수 있으며, 각 기관 (맹장, 십이지장, 및/또는 공장)에서 측정된 각각의 병변 스코어의 합으로 계산될 수 있다.
일 예에서, 상기 분변 오시스트 배출양은 개체로부터 배출된 분변 수집하여 현미경을 이용하거나 카운팅 챔버(예를 들면, McMaster chamber) 등을 사용하여 측정될 수 있다.
일 예에서, 상기 폐사율은 콕시듐증이 유도된 동물 개체의 폐사율을 의미하는 것일 수 있고, 사후 부검을 수행하여, 콕시듐증 외의 원인으로 사망한 개체의 수는 제외할 수 있다.
일 예에서, 콕시듐증 유도된 개체는 콕시듐중이 유도되지 않은 개체 보다 체중이 감소할 수 있으며, 일 예에 따른 조성물은 콕시듐증이 유도에 의한 체중 감소를 억제할 수 있다.
일 예에서, 상기 항콕시듐 종합지수는 하기 수학식 1로 계산될 수 있고, 수학식 1에서 병변 스코어는 전술한 방법과 같이 계산될 수 있다.
(수학식 1)
항콕시듐 종합지수 (ACI) = (공격접종 이후 생존율 (%)) + (음성 대조군 대비 일당 증체량 (%)) - (병변 스코어 x 10) - (분변 오시스트 배출량 지수)
상기 공격접종은 콕시듐증을 유도할 수 있는 원충의 투여 (예를 들면, 구강 접종 등)를 의미할 수 있다. 일 예에서 상기 생존율은 공격접종 후 5 내지 10일차, 7 내지 10일차, 8 내지 10일차, 7 내지 9일차, 7 내지 8일차, 또는 7일차에 측정된 생존율일 수 있으며, 사후 부검을 수행하여 콕시듐증 외의 원인으로 사망한 개체의 수는 제외하고 생존율을 측정할 수 있다.
상기 수학식 1에서 음성 대조군 대비 증체량은 음성 대조군(예를 들면 콕시듐 원충이 비감염된 음성 대조군)의 값을 기준으로 계산된 백분율로 계산된 값일 수 있다.
상기 수학식 1에서의 병변 스코어는 전술한 바와 같다.
상기 수학식 1에서, 분변 오시스트 배출양 지수는 음성 대조군(예를 들면, 원충이 감염된 음성 대조군)의 값을 기준으로 백분율을 계산하여, 계산한 결과값이 0 내지 1% 미만 수준이면 0, 1% 이상 내지 26% 미만은 5, 26% 이상 내지 51% 미만은 10, 51% 이상 내지 76% 미만은 20, 76% 이상 내지 100% 이하는 40으로 수치화된 값일 수 있다.
일 예에서, 상기 쿠마린산 및/또는 이의 염은 사료 조성물에 1w/w% 이하, 1w/w% 미만, 10-1 w/w% 이하, 5 x 10-2 w/w% 이하, 2.5 x 10-2 w/w% 이하, 2 x 10-2 w/w% 이하, 1.25 x 10-2 w/w% 이하, 10-2 w/w% 이하, 9 x 10-3 w/w% 이하, 8 x 10-3 w/w% 이하, 6.25 x 10-3 w/w% 이하, 7 x 10-3 w/w% 이하, 6 x 10-3 w/w% 이하, 5 x10-3 w/w% 이하, 4 x 10-3 w/w% 이하, 10-7 w/w% 이상, 10-6 w/w% 이상, 10-5 w/w% 이상, 10-4 w/w% 이상, 5 x 10-4 w/w% 이상, 10-3 w/w% 이상, 1.5 x 10-3 w/w% 이상, 2 x 10-3 w/w% 이상, 3 x 10-3 w/w% 이상, 4 x 10-3 w/w% 이상, 5 x 10-3 w/w% 이상, 6.25 x 10-3 w/w% 이상, 10-7 내지 1w/w%, 10-7 내지 10-1w/w%, 10-7 내지 5 x 10-2 w/w%, 10-7 내지 10-2 w/w%, 10-7 내지 5 x 10-3 w/w%, 10-7 내지 4 x 10-3 w/w%, 10-7 내지　 10-3 w/w%, 10-7 내지 5 x 10-4 w/w%, 10-7 내지 10-4 w/w%, 10-7 내지 10-5 w/w%, 10-6 내지 1w/w%, 10-6 내지 10-1w/w%, 10-6 내지 5 x 10-2 w/w%, 10-6 내지 10-2 w/w%, 10-6 내지 5 x 10-3 w/w%, 10-6 내지 4 x 10-3 w/w%, 10-6 내지 10-3 w/w%, 10-6 내지 5 x 10-4 w/w%, 10-6 내지 10-4 w/w%, 10-6 내지 10-5 w/w%, 10-5 내지 1w/w%, 10-5 내지 10-1w/w%, 10-5 내지 5 x 10-2 w/w%, 10-5 내지 10-2 w/w%, 10-5 내지 5 x 10-3 w/w%, 10-5 내지 4 x 10-3 w/w%, 10-5 내지 10-3 w/w%, 10-5 내지 5 x 10-4 w/w%, 10-5 내지 10-4 w/w%, 10-4 내지 1w/w%, 10-4 내지 10-1w/w%, 10-4 내지 5 x 10-2 w/w%, 10-4 내지 10-2 w/w%, 10-4 내지 5 x 10-3 w/w%, 10-4 내지 4 x 10-3 w/w%, 10-4 내지　 10-3 w/w%, 10-4 내지 5 x 10-4 w/w%, 10-3 내지 1w/w%, 10-3 내지 10-1w/w%, 10-3 내지 5 x 10-2 w/w%, 10-3 내지 10-2 w/w%, 10-3 내지 5 x 10-3 w/w%, 10-3 내지 4 x 10-3 w/w%, 10-3 내지 2 x 10-3 w/w%, 또는 10-3 내지 1.5 x 10-3 w/w%로 포함될 수 있다. 일 예에서 상기 사료 조성물은 상기 유효성분을 전체 중량 기준으로 상기 범위로 포함하는 사료(예를 들면, 동물에 최종적으로 섭취되는 배합사료 및/또는 단미사료)일 수 있다.
일 예에서, 상기 쿠마린산 및/또는 이의 염은 사료 조성물에 1000ppm 이하, 500ppm 이하, 400ppm 이하, 300ppm 이하, 250ppm 이하, 200ppm　 이하, 125ppm 이하, 125ppm 미만, 100ppm 이하, 90ppm 이하, 80ppm 이하, 70ppm 이하, 65ppm이하, 62.5ppm이하, 60ppm 이하, 50ppm 이하, 0.1ppm 이상, 1ppm 이상, 5ppm이상, 10ppm 이상, 15ppm이상, 20ppm 이상, 30ppm이상, 40ppm 이상, 50ppm이상, 62.5ppm이상, 0.1 내지 1000ppm, 0.1 내지 500ppm, 0.1 내지 400ppm, 0.1 내지 300ppm, 0.1 내지 250ppm, 0.1 내지 200ppm, 0.1 내지 125ppm, 0.1 내지 100 ppm, 0.1 내지 90ppm, 0.1 내지 80ppm, 0.1 내지 70ppm, 0.1 내지 65ppm, 0.1 내지 60ppm, 0.1 내지 50ppm, 1 내지 1000ppm, 1 내지 500ppm, 1 내지 400ppm, 1 내지 300ppm, 1 내지 250ppm, 1 내지 200ppm, 1 내지 125ppm, 1 내지 100 ppm, 1 내지 90ppm, 1 내지 80ppm, 1 내지 70ppm, 1 내지 65ppm, 1 내지 60ppm, 1 내지 50ppm, 5 내지 1000ppm, 5 내지 500ppm, 5 내지 400ppm, 5 내지 300ppm, 5 내지 250ppm, 5 내지 200ppm, 5 내지 125ppm, 5 내지 100 ppm, 5 내지 90ppm, 5 내지 80ppm, 5 내지 70ppm, 5 내지 65ppm, 5 내지 60ppm, 5 내지 50ppm, 10 내지 1000ppm, 10 내지 500ppm, 10 내지 400ppm, 10 내지 300ppm, 10 내지 250ppm, 10 내지 200ppm, 10 내지 125ppm, 10 내지 100 ppm, 10 내지 90ppm, 10 내지 80ppm, 10 내지 70ppm, 10 내지 65ppm, 10 내지 60ppm, 10 내지 50ppm, 20 내지 1000ppm, 20 내지 500ppm, 20 내지 400ppm, 20 내지 300ppm, 20 내지 250ppm, 20 내지 200ppm, 20 내지 125ppm, 20 내지 100 ppm, 20 내지 90ppm, 20 내지 80ppm, 20 내지 70ppm, 20 내지 65ppm, 20 내지 60ppm, 20 내지 50ppm, 30 내지 1000ppm, 30 내지 500ppm, 30 내지 400ppm, 30 내지 300ppm, 30 내지 250ppm, 30 내지 200ppm, 30 내지 125ppm, 30 내지 100 ppm, 30 내지 90ppm, 30 내지 80ppm, 30 내지 70ppm, 30 내지 65ppm, 30 내지 60ppm, 30 내지 50ppm, 40 내지 1000ppm, 40 내지 500ppm, 40 내지 400ppm, 40 내지 300ppm, 40 내지 250ppm, 40 내지 200ppm, 40 내지 125ppm, 40 내지 100 ppm, 40 내지 90ppm, 40 내지 80ppm, 40 내지 70ppm, 40 내지 65ppm, 40 내지 60ppm, 40 내지 50ppm, 50 내지 1000ppm, 50 내지 500ppm, 50 내지 400ppm, 50 내지 300ppm, 50 내지 250ppm, 50 내지 200ppm, 50 내지 125ppm, 50 내지 100 ppm, 50 내지 90ppm, 50 내지 80ppm, 50 내지 70ppm, 50 내지 65ppm, 또는 50 내지 60ppm 의 농도로 포함될 수 있다.
본 출원에서, "사료"란, 동물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한끼식의 성분을 의미할 수 있다. 일 예에 따른 사료 조성물에는 농후사료, 및/또는 특수사료가 추가로 포함될 수 있다. 상기 농후사료는 밀, 귀리, 옥수수 등의 곡류를 포함하는 종자 열매류, 곡물을 정제하고 얻는 부산물로서 쌀겨, 밀기울, 보릿겨 등을 포함하는 겨류, 콩, 유체, 깨, 아마인, 코코야자 등을 채유하고 얻는 부산물인 깻묵류와 고구마, 감자 등에서 녹말을 뺀 나머지인 녹말 찌꺼기의 주성분인 잔존 녹말질류 등의 찌꺼기류, 어분, 물고기찌꺼기, 어류에서 얻은 신선한 액상물을 농축시킨 것인 피시솔루블(fish soluble), 육분, 혈분, 우모분, 탈지분유, 우유에서 치즈, 탈지유에서 카세인을 제조할 때의 잔액인 훼이(whey)를 건조한 건조훼이 등의 동물질사료, 효모, 클로렐라, 및/또는 해조류 등일 수 있다.
일 예에 따른 사료 조성물은 최종적으로 동물이 섭취하는 형태의 사료, 사료에 배합될 수 있는 식이 보조제, 및/또는 사료 첨가제를 의미할 수 있다. 상기 식이 보조제란, 예를 들어 치료제 또는 소화제를 동물에 제공하는 제제 함유 조성물로, 통상 생체의 열량 섭취 공급원, 즉 에너지 공급원은 아니지만, 통상의 동물 사료에 추가하여 섭취되는 조성물을 의미할 수 있다. 상기 사료 첨가제란, 영양소 보충 및 체중감소 예방, 사료 내 섬유소의 소화 이용성 증진, 유질개선, 번식장애 예방 및 수태율 향상, 하절기 고온 스트레스 예방 등 다양한 효과를 목적으로 사료에 첨가하는 물질을 의미할 수 있다. 일 예에서, 콕시듐증 예방, 개선, 또는 치료를 목적으로 첨가되는 물질을 의미할 수 있다.
일 예에서, 상기 사료 조성물은 사료 첨가제일 수 있고, 일 예에 따른 사료 첨가제가 사료(예를 들면, 동물에 최종적으로 섭취되는 배합사료 및/또는 단미사료)에 배합될 때, 전체 사료 중량을 기준으로 0.001% 이상, 0.005% 이상, 0.01% 이상, 0.05% 이상, 0.1% 이상, 0.5% 이상, 1% 이하, 0.5% 이하, 0.1% 이하, 0.05% 이하, 0.01% 이하, 0.005% 이하, 0.001 내지 1%, 0.001 내지 0.5%, 0.001 내지 0.1%, 0.001 내지 0.05%, 0.001 내지 0.01%, 0.001 내지 0.005%, 0.005 내지 1%, 0.005 내지 0.5%, 0.005 내지 0.1%, 0.005 내지 0.05%, 0.005 내지 0.01%, 0.01 내지 1%, 0.01 내지 0.5%, 0.01 내지 0.1%, 0.01 내지 0.05%, 0.05 내지 1%, 0.05 내지 0.5%, 0.05 내지 0.1%, 0.1 내지 1%, 0.1 내지 0.5%, 또는 0.5 내지 1%의 중량으로 첨가되어 사료 원료, 보조 사료, 보조제, 및/또는 일 예에 따른 유효성분 외 다른 종류의 첨가제 등과 배합될 수 있다.
다른 양상은 쿠마린산(coumaric acid) 및/또는 이의 염을 포함하는, 콕시듐증 예방, 또는 치료용 약학 조성물을 제공할 수 있고, 약학 조성물에 포함되는 쿠마린산 및/또는 쿠마린산의 염에 대해서는 전술한 바와 같다.
일 예에 따른 약학 조성물은 단일제로도 사용할 수 있으며, 공인된 콕시듐증 예방 또는 치료 효과를 가진다고 알려진 약학 조성물을 추가로 포함하여 합제제로 제조하여 사용할 수 있다. 약학적으로 허용 가능한 담체, 부형제, 또는 희석제를 추가하여 약제학적 단위 투여형으로 제형화할 수 있다.
본 출원에서, "약학적으로 허용 가능한"이란, 생물체를 상당히 자극하지 않고 투여 활성 물질의 생물학적 활성 및 특성을 저해하지 않는 것을 의미한다. 일 예에 따라 약학적으로 허용 가능한 담체를 포함하는 상기 약학 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.
상기 약학 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함될 수 있다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
일 예에서, 상기 약학 조성물은 각각의 사용 목적에 맞게 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁제, 에멀젼, 시럽, 에어로졸 등의 경구 제형, 멸균 주사용액의 주사제 등 다양한 형태로 제형화하여 사용할 수 있으며, 경구 투여하거나 정맥 내, 복강 내, 피하, 직장, 국소 투여 등을 포함한 다양한 경로를 통해 투여될 수 있다.
일 예에서 상기 약학 조성물에는 추가적으로 담체, 부형제 또는 희석제 등이 더 포함될 수 있으며, 포함될 수 있는 적합한 담체, 부형제 또는 희석제의 예로는 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 자일리톨, 에리쓰리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로스, 메틸 셀룰로스, 비정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등을 들 수 있다. 또한, 상기 약학 조성물은 충전제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 더 포함할 수도 있다.
일 예에 따르면, 상기 약학 조성물 내 유효성분(쿠마린산 및/또는 이의 염)의 유효량은 환자(개체)의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 ㎏ 당0.0001 내지 0.001mg/kg, 0.0001 내지 0.01mg/kg, 0.0001 내지 0.1mg/kg, 0.0001 내지 1mg/kg, 0.0001 내지 10mg/kg, 0.0001 내지 100mg/kg, 0.0001 내지 231mg/kg, 0.0001 내지 250mg/kg, 0.0001 내지 500mg/kg, 0.0001 내지 1000mg/kg, 0.001 내지 0.01mg/kg, 0.001 내지 0.1mg/kg, 0.001 내지 1mg/kg, 0.001 내지 10mg/kg, 0.001 내지 100mg/kg, 0.001 내지 231mg/kg, 0.001 내지 250mg/kg, 0.001 내지 500mg/kg, 0.001 내지 1000mg/kg, 0.01 내지 0.1mg/kg, 0.01 내지 1mg/kg, 0.01 내지 10mg/kg, 0.01 내지 100mg/kg, 0.01 내지 250mg/kg, 0.01 내지 500mg/kg, 0.01 내지 1000mg/kg, 0.1 내지 1mg/kg, 0.1 내지 10mg/kg, 0.1 내지 100mg/kg, 0.1 내지 231mg/kg, 0.1 내지 250mg/kg, 0.1 내지 500mg/kg, 0.1 내지 1000mg/kg, 1 내지 10mg/kg, 1 내지 100mg/kg, 1 내지 231mg/kg, 1 내지 250mg/kg, 1 내지 500mg/kg, 1 내지 1000mg/kg, 10 내지 100mg/kg, 10 내지 231mg/kg, 10 내지 250mg/kg, 10 내지 500mg/kg, 10 내지 1000mg/kg, 100 내지 231mg/kg, 100 내지 250mg/kg, 100 내지 500mg/kg, 100 내지 1000mg/kg, 250 내지 500mg/kg, 또는 250 내지 1000mg/kg 을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나, 투여 경로, 질병의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다. 일 예에서, 상기 조성물이 복강 투여되는 경우 0.001 내지 250mg/kg 또는 0.001 내지 231mg/kg의 양으로 투여될 수 있다.
일 예에서 상기 약학 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양할 수 있다.
일 예에서, 상기 쿠마린산 및/또는 이의 염은 약학 조성물에 1w/w% 이하, 1w/w% 미만, 10-1 w/w% 이하, 5 x 10-2 w/w% 이하, 2.5 x 10-2 w/w% 이하, 2 x 10-2 w/w% 이하, 1.25 x 10-2 w/w% 이하, 10-2 w/w% 이하, 9 x 10-3 w/w% 이하, 8 x 10-3 w/w% 이하, 6.25 x 10-3 w/w% 이하, 7 x 10-3 w/w% 이하, 6 x 10-3 w/w% 이하, 5 x10-3 w/w% 이하, 4 x 10-3 w/w% 이하, 10-7 w/w% 이상, 10-6 w/w% 이상, 10-5 w/w% 이상, 10-4 w/w% 이상, 5 x 10-4 w/w% 이상, 10-3 w/w% 이상, 1.5 x 10-3 w/w% 이상, 2 x 10-3 w/w% 이상, 3 x 10-3 w/w% 이상, 4 x 10-3 w/w% 이상, 5 x 10-3 w/w% 이상, 6.25 x 10-3 w/w% 이상, 10-7 내지 1w/w%, 10-7 내지 10-1w/w%, 10-7 내지 5 x 10-2 w/w%, 10-7 내지 10-2 w/w%, 10-7 내지 5 x 10-3 w/w%, 10-7 내지 4 x 10-3 w/w%, 10-7 내지　 10-3 w/w%, 10-7 내지 5 x 10-4 w/w%, 10-7 내지 10-4 w/w%, 10-7 내지 10-5 w/w%, 10-6 내지 1w/w%, 10-6 내지 10-1w/w%, 10-6 내지 5 x 10-2 w/w%, 10-6 내지 10-2 w/w%, 10-6 내지 5 x 10-3 w/w%, 10-6 내지 4 x 10-3 w/w%, 10-6 내지 10-3 w/w%, 10-6 내지 5 x 10-4 w/w%, 10-6 내지 10-4 w/w%, 10-6 내지 10-5 w/w%, 10-5 내지 1w/w%, 10-5 내지 10-1w/w%, 10-5 내지 5 x 10-2 w/w%, 10-5 내지 10-2 w/w%, 10-5 내지 5 x 10-3 w/w%, 10-5 내지 4 x 10-3 w/w%, 10-5 내지 10-3 w/w%, 10-5 내지 5 x 10-4 w/w%, 10-5 내지 10-4 w/w%, 10-4 내지 1w/w%, 10-4 내지 10-1w/w%, 10-4 내지 5 x 10-2 w/w%, 10-4 내지 10-2 w/w%, 10-4 내지 5 x 10-3 w/w%, 10-4 내지 4 x 10-3 w/w%, 10-4 내지　 10-3 w/w%, 10-4 내지 5 x 10-4 w/w%, 10-3 내지 1w/w%, 10-3 내지 10-1w/w%, 10-3 내지 5 x 10-2 w/w%, 10-3 내지 10-2 w/w%, 10-3 내지 5 x 10-3 w/w%, 10-3 내지 4 x 10-3 w/w%, 10-3 내지 2 x 10-3 w/w%, 또는 10-3 내지 1.5 x 10-3 w/w%로 포함될 수 있다.
일 예에서, 상기 쿠마린산 및/또는 이의 염은 약학 조성물에 1000ppm 이하, 500ppm 이하, 400ppm 이하, 300ppm 이하, 250ppm 이하, 200ppm　 이하, 125ppm 이하, 125ppm 미만, 100ppm 이하, 90ppm 이하, 80ppm 이하, 70ppm 이하, 65ppm이하, 60ppm 이하, 62.5ppm이하, 50ppm 이하, 0.1ppm 이상, 1ppm 이상, 5ppm이상, 10ppm 이상, 15ppm이상, 20ppm 이상, 30ppm이상, 40ppm 이상, 50ppm이상, 62.5ppm 이상, 0.1 내지 1000ppm, 0.1 내지 500ppm, 0.1 내지 400ppm, 0.1 내지 300ppm, 0.1 내지 250ppm, 0.1 내지 200ppm, 0.1 내지 125ppm, 0.1 내지 100 ppm, 0.1 내지 90ppm, 0.1 내지 80ppm, 0.1 내지 70ppm, 0.1 내지 65ppm, 0.1 내지 60ppm, 0.1 내지 50ppm, 1 내지 1000ppm, 1 내지 500ppm, 1 내지 400ppm, 1 내지 300ppm, 1 내지 250ppm, 1 내지 200ppm, 1 내지 125ppm, 1 내지 100 ppm, 1 내지 90ppm, 1 내지 80ppm, 1 내지 70ppm, 1 내지 65ppm, 1 내지 60ppm, 1 내지 50ppm, 5 내지 1000ppm, 5 내지 500ppm, 5 내지 400ppm, 5 내지 300ppm, 5 내지 250ppm, 5 내지 200ppm, 5 내지 125ppm, 5 내지 100 ppm, 5 내지 90ppm, 5 내지 80ppm, 5 내지 70ppm, 5 내지 65ppm, 5 내지 60ppm, 5 내지 50ppm, 10 내지 1000ppm, 10 내지 500ppm, 10 내지 400ppm, 10 내지 300ppm, 10 내지 250ppm, 10 내지 200ppm, 10 내지 125ppm, 10 내지 100 ppm, 10 내지 90ppm, 10 내지 80ppm, 10 내지 70ppm, 10 내지 65ppm, 10 내지 60ppm, 10 내지 50ppm, 20 내지 1000ppm, 20 내지 500ppm, 20 내지 400ppm, 20 내지 300ppm, 20 내지 250ppm, 20 내지 200ppm, 20 내지 125ppm, 20 내지 100 ppm, 20 내지 90ppm, 20 내지 80ppm, 20 내지 70ppm, 20 내지 65ppm, 20 내지 60ppm, 20 내지 50ppm, 30 내지 1000ppm, 30 내지 500ppm, 30 내지 400ppm, 30 내지 300ppm, 30 내지 250ppm, 30 내지 200ppm, 30 내지 125ppm, 30 내지 100 ppm, 30 내지 90ppm, 30 내지 80ppm, 30 내지 70ppm, 30 내지 65ppm, 30 내지 60ppm, 30 내지 50ppm, 40 내지 1000ppm, 40 내지 500ppm, 40 내지 400ppm, 40 내지 300ppm, 40 내지 250ppm, 40 내지 200ppm, 40 내지 125ppm, 40 내지 100 ppm, 40 내지 90ppm, 40 내지 80ppm, 40 내지 70ppm, 40 내지 65ppm, 40 내지 60ppm, 40 내지 50ppm, 50 내지 1000ppm, 50 내지 500ppm, 50 내지 400ppm, 50 내지 300ppm, 50 내지 250ppm, 50 내지 200ppm, 50 내지 125ppm, 50 내지 100 ppm, 50 내지 90ppm, 50 내지 80ppm, 50 내지 70ppm, 50 내지 65ppm, 또는 50 내지 60ppm의 농도로 포함될 수 있다.
일 예에서 상기 약학 조성물은 다양한 경로를 통하여 대상에 투여될 수 있다. 상기 투여는 임의의 적절한 방법으로 개체(환자)에게 소정의 물질을 제공하는 것을 의미할 수 있고, 상기 약학 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 일반적인 모든 경로를 통하여 경구 투여 및/또는 비경구 투여될 수 있다. 비경구 투여시 피부 외용, 복강 내 주사, 직장 내 주사, 피하주사, 정맥주사, 근육 내 주사, 및/또는 흉부 내 주사를 선택할 수 있다. 또한, 일 예에 따른 조성물은 유효성분을 표적 세포로 전달할 수 있는 임의의 장치를 이용해 투여될 수도 있다.
또 다른 양상은 쿠마린산(coumaric acid) 및/또는 이의 염을 포함하는, 아이메리아 속 원충에 대한 항원충용 조성물을 제공할 수 있다. 또 다른 양상은 쿠마린산 및/또는 이의 염을 동물(예컨대, 원충 방제를 필요로 하는 대상, 또는 인간을 제외한 동물)에게 투여하는 단계를 포함하는, 콕시듐증 예방, 개선, 및/또는 치료 방법, 또는 아이메리아 속 원충의 방제 방법을 제공한다. 본 명세서에서 원충의 방제는 항원충 작용을 포괄적으로 의미하는 것으로, 예를 들면, 아이메리아 속 원충 사멸, 및/또는 아이메리아 속 원충의 세포 침투 및/또는 증식 억제 등을 의미할 수 있으나, 이에 제한되는 것은 아니다. 상기 쿠마린산, 쿠마린산의 염은 및/또는 아이메리아 속 원충에 대한 것은 전술한 바와 같다.
일 예에서, 상기 아이메리아 속 원충에 대한 항원충 활성(효과, 효능)이 우수한 것은 하기 (1) 및/또는 (2)의 특성을 의미할 수 있고, 예를 들면 대조군 (음성 대조군 및/또는 양성 대조군) 대비, 하기 (1) 및/또는 (2)의 특성을 나타내는 것일 수 있다:
(1) 아이메리아 속 원충을 사멸시키는 효과가 우수함; 및/또는
(2) 아이메리아 속 원충의 세포 침투 효과 및/또는 세포 내 상기 원충의 증식 효과 억제.
일 예에서, 상기 쿠마린산, 및/또는 쿠마린산의 염은 항원충용 조성물에 사료 조성물 및/또는 약학 조성물에서 전술한 바와 같은 농도 범위로 포함될 수 있다. 일 예에서 전술한 농도 범위로 유효성분을 포함하는 조성물은, 농도 범위 외의 범위로 포함하는 경우보다 항원충 활성이 우수한 것일 수 있다.
또 다른 양상은 상기 조성물(예를 들면, 상기 사료 조성물, 상기 사료 첨가제, 상기 약학 조성물, 및/또는 상기 항원충용 조성물)을 동물(예를 들면, 인간을 제외한 동물)에 투여하는 단계를 포함하는, 콕시듐증 예방, 개선, 또는 치료 방법을 제공할 수 있다. 일 예에서 상기 조성물을 투여하는 단계 이전에 상기 콕시듐증의 예방, 개선, 또는 치료를 필요로 하는 개체(환자)를 확인(선별)하는 단계를 추가로 포함할 수 있다. 상기 조성물 및 콕시듐증에 대해서는 전술한 바와 같다. 일 예에 따르면 상기 개체를 확인하는 단계는 개체로부터 분리된 분변에서 콕시듐을 유도할 수 있는 원충의 오시스트를 검출하는 단계를 포함할 수 있다. 일 예에 따른 콕시듐증 예방, 개선, 또는 치료 방법에서 상기 조성물의 투여방법, 투여경로, 및/또는 투여량에 대해서는 전술한 바와 같다.
일 예에 따르면, 상기 조성물은 약학적으로 유효한 양으로 투여할 수 있다. 본 출원에서 '약학적으로 유효한 양'은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 일 예에 따르면, 상기 조성물은 개별 치료제로 투여하거나 다른 항콕시듐제와 병용하여 투여될 수 있고 종래의 치료제와는 동시에, 별도로, 또는 순차적으로 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
일 예에서, 상기 콕시듐증 예방, 개선, 또는 치료 방법이 적용되는 대상은 콕시듐증이 발병하였거나 발명할 수 있는 동물을 의미하고, 상기 동물은 인간, 말, 소, 마우스, 랫트, 개, 고양이 등을 포함하는 포유류, 가금류(예를 들면, 종계, 육계, 및/또는 산란계 등) 등을 포함하는 조류, 어류, 양서류, 및/또는 파충류 등일 수 있다.　
일 예에서 상기 콕시듐증 예방, 개선, 또는 치료 방법이 적용되는 동물은 상기 표 1에 기재된 동물로 이루어지는 군에서 선택된 1종 이상(예를 들면, 1종 이상, 2종 이상, 또는 3종 이상)일 수 있고, 예를 들면 인간, 닭, 오리, 거위, 칠면조, 메추라기, 꿩, 비둘기, 앵무새, 소, 돼지, 염소, 양, 말, 영양, 오릭스, 원숭이, 고양이, 개, 마우스, 랫트, 토끼, 너구리, 다람쥐, 박쥐, 기니아피그, 낙타, 리마, 알파카, 웜벳, 도마뱀, 금붕어, 붕어, 틸라피아, 바벨, 폐어, 및 유럽산 처브로 이루어진 군에서 선택된 1종 이상(예를 들면, 1종 이상, 2종 이상, 또는 3종 이상)일 수 있다. 일 예에서 상기 동물은 인간을 제외한 동물일 수 있다.
일 예에 따른 쿠마린산 및/또는 이의 염을 포함하는 조성물은 콕시듐증을 유도할 수 있는 원충의 세포 침투 억제 효과 및/또는 세포 내 상기 원충 증식 억제 효과가 우수하고, 생체 내 콕시듐증 예방, 개선, 및 치료 효과가 우수하며, 분변 내 오시스트 배출량을 현저히 감소시켜 2차 콕시듐증 감염을 낮출 수 있다.
도 1은 콕시듐증을 유발할 수 있는 원충 접종시 쿠마린산의 항콕시듐 종합지수(ACI)를 나타낸다.
이하 본 발명을 다음의 실시예에 의하여 보다 구체적으로 설명하고자 한다. 그러나 이들은 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 제한되는 것은 아니다.
실시예 1. 쿠마린산의 생체 내( in vivo ) 항콕시듐 활성
실시예 1-1. 실험시설 및 연구 설계
미국에 위치한 전용 육계동물실험 시설에서 in vivo 효능 평가 시험을 수행하였다. 1일령 암컷 로스 (Ross) 육계의 체중을 개별적으로 측정하고 무작위로 군을 나누어 실험에 사용하였다.
실험 설계에 관한 사항 및 조건은 표 2에 기재하였다.
카테고리 실험변수
사육타입 케이지
육계 입식 일령 1일령
총 실험기간 30일
성별 암컷
케이지 별 육계 수 6마리
처리구 별 반복 수 3반복
처리구 수 5가지
육계의 총 수 90수
공격접종 원충의 종류 아이메리아 테넬라
공격접종 오시스트 수 10,000 오시스트 구강접종/마리
실시예 1-2. 실험 설계
일반 사료는 대한사료 A1-초이 제품을 사용하였고, 사료에 각 소재 (살리노마이신(제일바이오사 제일살리노-60 제품), VantiPEAL(Kemin, Cozante, 주요물질: Gallic acid), p-쿠마린산(p-coumaric acid, CAS No. 501-98-4; sigma))를 하기 표 3에 기재된 농도로 각각 첨가하여 자가배합하였다. 일반사료 및 배합된 사료에는 항생제와 보충제를 사용하지 않았으며, 각 소재 외에 항콕시듐제를 첨가하지 않았다. 실험 기간에 걸쳐 육계가 사료를 자유식으로 섭취하게 하였다.
콕시듐증 유도는 90% 이상 성숙된(sporulation) 아이메리아 테넬라의 오시스트(oocyst, 충란)를 21일령 육계에 개체 한 마리당 10,000개의 오시스트를 경구 튜브식으로 구강접종 (공격접종)하여 수행하였다.
대조군(음성 대조군 또는 양성 대조군) 및 시험군에 투여된 사료 포뮬레이션과 아이메리아 테넬라에 의한 콕시듐증 유도 여부는 하기 표 3에 기재하였다. 대조군 또는 시험군 별로 랜덤 배치된 케이지에 1일령 육계를 6두씩 넣어 사육하고, 일반 사료를 14일간 급이 후, 상기에서 제조한 배합사료를 대조군 또는 시험군 별로 구분하여 섭취하게 하였다.
군 처리
비감염된 음성 대조군 (NC) 일반 사료
감염된 음성 대조군(PC) 아이메리아 테넬라 감염 + 일반 사료
양성 대조군 1 아이메리아 테넬라 감염 + 살리노마이신 60ppm 포함 배합사료
양성 대조군 2 아이메리아 테넬라 감염 + VantiPEAL(Kemin) 125ppm 포함 배합사료
쿠마린산 섭취군 1 아이메리아 테넬라 감염 + + p-coumaric acid(sigma) 125ppm 포함 배합사료
실시예 1-3. 쿠마린산의 항콕시듐 활성 측정
상기 실시예 1-2에서 설계한 시험군 별 항콕시듐 효능은 항콕시듐 종합지수 (Anticoccidial index; ACI)로서 나타내었고, 항콕시듐 종합지수는 하기 수학식 2에 의해 계산하였다. ACI 점수는 200점 만점이고, ACI 점수가 높을수록 항콕시듐능이 우수한 것을 의미하며, 120점 이상 140점 미만이면 항콕시듐 소재로써 효과가 있다고 판단하고, 140점 이상 내지 160점 미만이면 항콕시듐 소재로써 우수하다고 판단하며, 160점 이상일 경우, 항콕시듐 효과가 매우 우수하다고 판단한다(Luis Miguel De Pablos et al., Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens, Parasitol Res, 2010).
(수학식 2)
항콕시듐 종합지수 (ACI) = (공격접종 이후 생존율(%)) + (음성 대조군 대비 일당 증체량(RWG,%)) - (병변 스코어 x 10) - (분변 오시스트 배출량 지수)
1) 생존율: 폐사 개체수를 매일 기록하고, 폐사의 원인을 파악하기 위해 사후 부검을 수행하여, 콕시듐증 외의 원인으로 사망한 개체의 수는 제외하였다. 공격 접종 후 8일차까지의 생존율(%)을 항콕시듐 종합지수 계산에 사용하였다.
2) 일당 증체량: 개체에 원충을 공격접종 하기 전과 공격접종 후 8일차까지의 체중을 케이지 별로 체중을 측정하고, 그 차이를 일수로 나누어 일당 증체량(ADG, g/d)을 계산하였다. 각 실험군의 일당 증체량(ADG, average daily gain; g/d)을 비감염된 음성 대조군의 증체량(ADG, g/d)으로 나누고 100을 곱하여 계산한 '음성 대조군 대비 일당 증체량(RWG, %)'을 항콕시듐 종합지수 계산에 사용하였다.
각 대조군 및 시험군에서 일당 증체량(ADG, g/d) 및 음성 대조군 대비 일당 증체량(RWG, %)을 하기 표 4에 나타내었다.
3) 병변 스코어링: 공격접종 후 9일차에 케이지 별로 육계를 4마리씩 부검하고 장을 절개 개방하였다. 육계의 맹장 부위에서 각각의 콕시듐 병변에 대해 스코어링하였다. 병변 스코어링 방법은 Johnson JK & Reid WM(1970) 문헌(Joyce Johnson, W.Malcolm Reid, Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens, Experimental parasitology, 1970)을 참고하여 수행하였다. 병변 스코어(Lesion score)는 0-4 등급이 있으며, 0점은 정상 맹장, 1점은 경미한 감염 증상, 2점은 중증도의 감염 증상, 3점의 경우 심각한 감염 증상, 및 4점은 매우 심각한 감염 증상을 보이거나 폐사를 일으킨 경우에 해당한다. 각 대조군 및 시험군에서 측정된 맹장 병변 스코어를 하기 표 4에 기재하였다. 측정된 맹장 병변 스코어에 10을 곱하여 병변 지수를 구하고, 이를 항콕시듐 종합지수 계산에 사용하였다.
4) 분변 오시스트 배출량: 공격접종 6 ~ 9일차의 전체 분변을 케이지 별로 수거하여 고르게 믹싱 후, 1g씩 총 3번에 걸쳐 랜덤으로 샘플링 진행하였다. 소금물을 이용하여 분변 1g 속에 있는 오시스트를 띄운 뒤, McMaster chamber를 사용하여 오시스트 배출량을 측정하고 그 결과를 하기 표 4에 기재하였다.
각 그룹별 오시스트 배출량을 감염된 음성 대조군의 오시스트 배출량으로 나누고 100을 곱하여, 감염된 음성 대조군 대비 오시스트 배출량(%)을 계산하였다. 계산한 감염된 음성 대조군 대비 오시스트 배출량이 0 ~ 1% 미만 수준이면 0, 1% 이상 ~ 26% 미만은 5, 26% 이상 ~ 51% 미만은 10, 51% 이상 ~ 76% 미만은 20, 76% 이상 ~ 100% 이하는 40으로 오시스트 배출량 지수를 산출하고, 이를 항콕시듐 종합지수 계산에 사용하였다.
Group 대조군 시험군
Compounds NC PC Salinomycin VantiPEARL p-coumaric acid
conc(ppm) 60 125 125
육계두수 18 18 18 18 18
공격접 후ADG(g/d) 55 37 45 49 52
RWG(%) 100 67.3 81.8 89.1 94.5
생존율(%) 100 100 100 100 100
맹장병변 스코어 0 3.37 2.27 2.17 2.5
맹장병변 지수 - 33.7 22.7 21.7 25
오시스트 배출량
(Oocyst/chicken)		 0 1.3x108 6.3x107 8x107 5.7x107
Oocyst index 0 40 10 20 10
ACI 200 94 149 147 160
표 4에서 나타난 바와 같이, 아이메리아 테넬라가 감염된 음성 대조군(PC) 은 비감염된 음성 대조군(NC) 대비 콕시듐증이 발생하여 증체량이 감소하고, 병변 스코어, 오시스트(충란) 배출량이 증가하였다. 항콕시듐제 대조군으로 사용된 살리노마이신 투여군은 감염된 음성 대조군(PC) 군에 비해 증체율이 증가하였으며, 병변 스코어와 오시스트 배출량이 감소하였다. 천연 항콕시듐제 대조군인 VantiPEARL 투여군도 PC 군에 비해 증체율이 증가하였으며 충란 배출량과 병변지수가 감소하였다.
p-쿠마린산 투여군은 PC군 대비 증체량이 증가하였으며 병변 스코어와 오시스트 배출량을 감소시켰다. 항콕시듐 종합 지표를 산출하여 비교한 결과 p-쿠마린산 125ppm 투여군은 160점으로 양성 대조군인 Salinomycin(149점)과 VantiPEAL(147점) 투여군 보다 항콕시듐 효능이 우수하였다.
실시예 3. 쿠마린산의 아이메리아( Eimeria ) 원충에 대한 세포 침투 및 증식 억제 효과
본 실시예에서 아이메리아 감염 및 증식이 된다고 알려져 있는 대표적인 동물세포 MDBK 세포주를 이용하여, 쿠마린산의 세포 내 원충 침투 및 세포 내 증식 억제능을 살펴보았다.
실시예 3-1. 원충 획득
각 아이메리아 테넬라 및 아이메리아 아세불리나의 오시스트 일정량을 유리 비즈가 담긴 튜브에 넣고 분쇄한 뒤, 파쇄된 오시스트 세포벽 및 기타 잔해를 제거하기 위하여, 퍼콜 비중차 원리(percoll density gradient)를 이용하여 내부 포자낭(sporocysts)을 정제하고, PBS 용액으로 세척하였다. 내부 원충의 탈낭을 위해, 아이메리아 아세불리나 및 아이메리아 테넬라의 포자낭에 각각 소듐 타우로콜산(sodium taurocholic acid, Sigma aldrich, USA) 및 트립신(trypsin, Gibco, USA)을 포함하는 시약을 처리하여 인큐베이션 후 PBS 용액으로 1회 세척하고, 원충을 수득하였다.
실시예 3-2. 쿠마린산 처리에 따른 원충의 세포 침투 억제 효과 및 세포내 원충 증식 억제 효과
상기 실시예 3-1의 방법으로 아이메리아 테넬라 및 아이메리아 아세불리나의 원충을 획득하였다. 웰 당 2x105개의 포자소체를 MDBK 세포(ATCC 구매)가 monolayer로 깔려있는 웰에 첨가하고 각각의 소재(p-쿠마린산; sigma, CAS No. 501-98-4, 및 항콕시듐제인 갈산; sigma, CAS No. 149-91-7, 살리노마이신; CAS No. sigma, 53003-10-4, 디클라주릴; sigma, CAS No. 101831-37-2, p-쿠마린산, 갈산, 살리노마이신은 10ppm으로 처리, 디클라주릴은 1ppm으로 처리)를 세포에 처리하여, 온도 40℃에서 24시간 동안 배양하였다. 음성 대조군은 원충으로 감염시킨 MDBK 세포이며, 양성 대조군은 갈산, 살리노마이신, 또는 디클라주릴 용액과 원충을 함께 인큐베이션한 그룹을 의미한다. 그 후 세포에 침습하지 않은 원충을 제거하기 위하여, PBS 용액을 이용하여 세포를 2회 세척하였다. 파이펫팅을 통하여 세포와 세포 안에 들어가 있는 원충을 떼어낸 후 DNA extract kit (인트론바이오테크놀로지)를 이용하여 세포로부터 DNA를 추출하고, E.tenella ITS-1(Internal transcribed spacer-1) 유전자 또는 E.acervulina ACE 유전자 특이적인 프라이머를 사용하여 실시간 PCR을 수행하였다. 사용한 프라이머의 서열은 하기 표 5에 기재하였다.
프라이머 염기서열(5'->3') 서열번호
E.tenella ITS-1 Forward TGGAGGGGATTATGAGAGGA 서열번호 1
Reverse CAAGCAGCATGTAACGGAGA 서열번호 2
E.acervulina ACE Forward GCAGTCCGATGAAAGGTATTTG 서열번호 3
Reverse GAAGCGAAATGTTAGGCCATCT 서열번호 4
소재 별로 세척 전/후 Ct값을 비교하고 음성 대조군의 △Ct값으로 보정하여 대조군 대비 각 시점에 대한 배수 변화(2-△Ct)를 계산하여 소재 처리를 통한 원충의 세포 침투 억제율(Invasion inhibition 또는 세포 침습 억제율; %)을 계산하고 그 결과를 표 6 및 표 7에 나타내었다. 표 6은 아이메리아 테넬라에 대한 결과를 나타내었고, 표 7은 아이메리아 아세불리나에 대한 결과를 나타내었다.
sample Invasion inhibition% Propagation inhibition %
NC 0.0 0.0
Diclazuril 6.3 52.9
Salinomycin 56.4 34.8
Gallic acid 90.1 0.0
p-coumaric acid 54.3 43.9
sample Invasion inhibition%
NC 0.0
Diclazuril 42.7
Salinomycin 59.4
Gallic acid 60.6
p-coumaric acid 82.6
상기 실시예 3-1의 방법과 유사하게 아이메리아 테넬라의 원충을 획득하였다. 웰 당 2x105 개의 포자소체를 MDBK 세포(ATCC 구매)가 monolayer로 깔려있는 웰에 첨가하고 온도 40℃에서 24시간 배양 후, 세포에 붙지 않은 원충을 제거하기 위하여 PBS 용액을 이용하여 세포를 2회 세척하였다. 각각의 소재(p-쿠마린산, 및 항콕시듐제인 갈산, 살리노마이신: 10ppm과 디클라주릴: 1ppm)를 세포에 처리하고, 온도 40℃에서 24시간 동안 추가 배양하였다.
음성 대조군은 원충으로 감염시킨 MDBK 세포이며, 양성 대조군은 살리노마이신, 갈산, 또는 디클라주릴 용액과 원충을 함께 인큐베이션한 그룹을 의미한다. 파이펫팅을 통하여 세포와 세포 안에서 증식한 원충을 떼어낸 후 DNA extract kit(인트론바이오테크놀로지)를 이용하여 세포로부터 DNA 를 추출하고, E.tenella ITS-1 특이적인 프라이머를 사용하여 PCR을 수행하였다. 사용한 프라이머 서열은 상기 표 5에 기재하였다. 음성대조군 대비 소재 처리군에서의 Ct값을 비교하여 대조군 대비 각 시점에 대한 배수 변화(2-△Ct)를 계산하여 소재 처리를 통한 세포 내 원충(포자소체) 증식 억제율(Propagation inhibition; %)을 계산하고, 그 결과를 상기 표 6에 나타내었다.
상기 표 6에 나타낸 바와 같이, 디클라주릴은 세포 내 원충 증식 억제에 효과 나타나고, 갈산은 원충의 세포 침투에만 효과를 나타내는 반면 쿠마린산은 아이메리아 테넬라 원충의 세포 침투(invasion) 및 세포 내 원충의 증식(propagation) 모두 억제하였고, 그 정도도 양성 대조군 보다 우수하였다. 또한 상기 표 7에 나타난 바와 같이, 쿠마린산 처리군에서 아이메리아 아세불리나에 대한 세포 침투 억제 효능이 모든 양성 대조군(디클라주릴, 갈산, 및 살리노마이신) 보다 우수하였다.
실시예 4. 다양한 쿠마린산 이성질체의 항콕시듐 효과
본 실시예에서 전세계적으로 가장 많이 감염되고 질병심각도가 높은 아이메리라 테넬라에 대해, 다양한 쿠마린산 이성질체의 원충(포자소체) 직접 사멸능을 평가하고, 아이메리아 감염이 된다고 알려져 있는 대표적인 동물세포 MDBK 세포주를 이용하여, 다양한 쿠마린산 이성질체의 세포 내 원충 침투 억제능을 살펴보았다.
실시예 4-1. 아이메리아( Eimeria ) 원충에 대한 직접 사멸 효과
원충의 오시스트 일정량을 유리 비즈가 담긴 튜브에 넣고 분쇄한 뒤, 파쇄되 오시스트 세포벽 및 기타 잔해를 제거하기 위하여, 퍼콜 비중차 원리(Percoll density gradient)를 이용하여 내부 포자낭(sporocysts)을 정제하고, PBS 용액으로 세척하였다. 내부 포자소체(sporozoites)의 탈낭을 위해 아이메리아 테넬라 포자낭에 각각 소듐 타우로콜산(sodium taurocholic acid, sigma aldirich, USA) 및 트립신(Trypsin, Ginco, USA)을 포함하는 시약을 처리하여 인큐베이션 후 PBS 용액으로 1회 세척하고 원충을 수득하였다.
0.1% DMSO, m-coumaric acid(sigma, 14755-02-3), Caffeic acid(sigma, 331-39-5), Ferulic acid(sigma, 1135-24-6)를 각각 10ppm의 농도로 아이메리아 테넬라 원충과 반응시킨 뒤, 현미경 관찰을 통해 살아 있는 원충(포자소체)만을 카운팅 하였다. 이대 PBS를 처리한 음성 대조군 대비 각 소재 처리 시 원충의 사멸율(%)을 측정하고, 그 결과를 하기 표 8에 나타내었다.
sample Dose
(ppm)		 Killed sporozoites %
Cell only 0
0.1% DMSO 0
m-coumaric acid 10 10.7
Caffeic acid 10 0
Ferulic acid 10 0
표 8에 나타난 바와 같이, 동일 농도에서 m-coumaric acid는 Caffeic acid과 Ferulic acid 보다 현저히 우수하게 아이메리아 속 원충에 대한 직접 사멸 효과를 나타내었다.
실시예 4-2. 세포 내 원충 침투 억제능 확인
상기 실시예 3-2와 유사한 방법으로 0.1% DMSO, p-coumaric acid(sigma, CAS No. 501-98-4), m-coumaric acid(sigma, 14755-02-3), 및 o-coumaric acid(sigma, 614-60-8)를 각각 10ppm의 농도로 처리하여, 아이메리아 테넬라 원충에 대한 세포 침투 억제율(Invasion inhibition)을 측정하고, 그 결과를 표 9에 나타내었다.
sample Dose
(ppm)		 Invasion inhibition%
Cell only 0
0.1% DMSO 0
p-coumaric acid 10 7.98
m-coumaric acid 10 29.78
o-coumaric acid 10 39.57
표 9에 나타난 바와 같이, p-coumaric acid, m-coumaric acid, 및 o-coumaric acid은 모두 아이메리아 테넬라 원충의 세포 내 원충 침투 억제 효과를 나타내는 것을 확인할 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (9)

  1. 쿠마린산(coumaric acid) 또는 이의 염을 유효성분으로 포함하는, 콕시듐증 예방, 또는 개선용 사료 조성물.
  2. 제1항에 있어서, 상기 콕시듐증은 아이메리아 속(Eimeria sp.) 원충에 의해 유도되는 것인, 사료 조성물.
  3. 제1항에 있어서, 상기 쿠마린산은 p-쿠마린산(p-coumaric acid), m-쿠마린산(m-coumaric acid), 및 o-쿠마린산(o-coumaric acid)로 이루어진 군에서 선택된 1종 이상인, 사료 조성물.
  4. 제1항에 있어서, 상기 콕시듐증 예방 또는 개선은 하기 (1) 내지 (4)로 이루어지는 군에서 선택된 1종 이상인, 사료 조성물:
    (1) 병변 스코어, 분변 오시스트 배출양, 및 폐사율로 이루어지는 군에서 선택된 1종 이상이 감소;
    (2) 콕시듐증에 의한 체중 감소의 억제;
    (3) 항콕시듐 종합지수(Anticoccidial index; ACI)가 증가; 및
    (4) 아이메리아 속 원충의 세포 침투, 세포 내 상기 원충의 증식, 또는 이들 모두를 감소.
  5. 제1항에 있어서, 상기 사료 조성물은 상기 유효성분을 전체 중량 기준으로 1%(w/w) 이하의 농도로 포함하는 사료인, 사료 조성물.
  6. 제1항 내지 제4항 중 어느 한 항에 있어서, 상기 사료 조성물은 사료 첨가제인, 사료 조성물.
  7. 쿠마린산(Coumaric acid) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 콕시듐증 예방, 또는 치료용 약학 조성물.
  8. 쿠마린산(Coumaric acid) 또는 이의 염을 유효성분으로 포함하는, 아이메리아 속 원충에 대한 항원충용 조성물.
  9. 제1항 내지 제5항 중 어느 한 항에 따른 사료 조성물, 제7항에 따른 약학 조성물, 및 제8항에 따른 항원충용 조성물로 이루어지는 군에서 선택된 조성물을 인간을 제외한 동물에 투여하는 단계를 포함하는, 콕시듐증 예방, 개선, 또는 치료 방법.
PCT/KR2022/003072 2021-03-05 2022-03-04 쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도 WO2022186648A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2023519072A JP2023545650A (ja) 2021-03-05 2022-03-04 クマル酸を含む抗コクシジウム用組成物およびその用途
CN202280006974.3A CN116528847A (zh) 2021-03-05 2022-03-04 包含香豆酸的抗球虫组合物及其用途
EP22763629.7A EP4302608A1 (en) 2021-03-05 2022-03-04 Anticoccidial composition comprising coumaric acid and use thereof
BR112023007086A BR112023007086A2 (pt) 2021-03-05 2022-03-04 Composição anticoccidiana compreendendo ácido cumárico e uso da mesma

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0029733 2021-03-05
KR1020210029733A KR20220125628A (ko) 2021-03-05 2021-03-05 쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022186648A1 true WO2022186648A1 (ko) 2022-09-09

Family

ID=83154230

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/003072 WO2022186648A1 (ko) 2021-03-05 2022-03-04 쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도

Country Status (6)

Country Link
EP (1) EP4302608A1 (ko)
JP (1) JP2023545650A (ko)
KR (1) KR20220125628A (ko)
CN (1) CN116528847A (ko)
BR (1) BR112023007086A2 (ko)
WO (1) WO2022186648A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080160000A1 (en) 2006-10-31 2008-07-03 Marubeni Nisshin Feed Co., Ltd. Coccidiosis and clostridial disease prophylactic and/or therapeutic feed for coccidiosis and clostridial disease
KR20160145328A (ko) * 2015-06-10 2016-12-20 주식회사 케어사이드 닭 콕시듐 치료 또는 예방용 약학 조성물
KR20180083818A (ko) * 2017-01-12 2018-07-23 차장옥 콕시듐증 예방 또는 치료용 조성물, 이의 제조방법 및 이의 이용
WO2020152673A1 (en) * 2019-01-21 2020-07-30 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Anti-apicomplexan compositions
WO2021016141A1 (en) * 2019-07-20 2021-01-28 Academia Sinica Anti-coccidial phytogenic formulations

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1420804B1 (en) 2001-07-27 2007-08-01 Alltech, Inc. Methods and compositions for control of coccidiosis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080160000A1 (en) 2006-10-31 2008-07-03 Marubeni Nisshin Feed Co., Ltd. Coccidiosis and clostridial disease prophylactic and/or therapeutic feed for coccidiosis and clostridial disease
KR20160145328A (ko) * 2015-06-10 2016-12-20 주식회사 케어사이드 닭 콕시듐 치료 또는 예방용 약학 조성물
KR20180083818A (ko) * 2017-01-12 2018-07-23 차장옥 콕시듐증 예방 또는 치료용 조성물, 이의 제조방법 및 이의 이용
WO2020152673A1 (en) * 2019-01-21 2020-07-30 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Anti-apicomplexan compositions
WO2021016141A1 (en) * 2019-07-20 2021-01-28 Academia Sinica Anti-coccidial phytogenic formulations

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ABBAS ASGHAR, IQBAL ZAFAR, ABBAS RAO ZAHID, KHAN MUHAMMAD KASIB, KHAN JUNAID ALI, SINDHU ZIA UD DIN, MAHMOOD MUHAMMAD SHAHID, SALE: "In vivo anticoccidial effects of Beta vulgaris (sugar beet) in broiler chickens", MICROBIAL PATHOGENESIS, ACADEMIC PRESS LIMITED, NEW YORK, NY., US, vol. 111, 1 October 2017 (2017-10-01), US , pages 139 - 144, XP055962971, ISSN: 0882-4010, DOI: 10.1016/j.micpath.2017.07.052 *
CAS , no. 101831-37-2
CAS , no. 25429-38-3
CAS, no. 14755-02-3
JOYCE JOHNSONW.MALCOLM REID: "Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens", EXPERIMENTAL PARASITOLOGY, 1970
LUIS MIGUEL DE PABLOS ET AL.: "Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens", PARASITOL RES, 2010
WILLIAMS RB: "A compartmentalised model for the estimation of the cost of coccidiosis to the world's chicken production industry", INT J PARASITOL, vol. 29, no. 8, 1999, pages 1209 - 1229

Also Published As

Publication number Publication date
EP4302608A1 (en) 2024-01-10
CN116528847A (zh) 2023-08-01
KR20220125628A (ko) 2022-09-14
BR112023007086A2 (pt) 2023-10-10
JP2023545650A (ja) 2023-10-31

Similar Documents

Publication Publication Date Title
WO2018048056A1 (ko) 담팔수 추출물 또는 이의 분획물을 유효 성분으로 포함하는 알파 계열 허피스 바이러스 감염증의 예방 및 치료용 약제학적 조성물
US5135746A (en) Control of protozoal disease
US10568897B2 (en) Bidens pilosa and polyacetylenic compounds for prevention and treatment of coccidiosis
WO2022065914A1 (ko) 은행잎을 포함하는 항콕시듐용 조성물 및 이의 용도
US20210329946A1 (en) Berberine alkaloid formulations in the prevention and/or treatment of infectious disease
WO2022186648A1 (ko) 쿠마린산을 포함하는 항콕시듐용 조성물 및 이의 용도
Hu et al. Effect of anticoccidials and antibiotics on the control of blackhead disease in broiler breeder pullets
US6569843B1 (en) Steroidal sapogenins for the control of coccidiosis in animals
WO2022065912A1 (ko) 비올라세인을 포함하는 항콕시듐용 조성물 및 이의 용도
WO2022065911A1 (ko) 망고스틴을 포함하는 항콕시듐용 조성물 및 이의 용도
WO2022065910A1 (ko) 스틸벤계 화합물을 포함하는 항콕시듐증 조성물 및 이의 용도
US20220257684A1 (en) Anti-coccidial phytogenic formulations
WO2015065059A1 (ko) 감태 추출물을 포함하는 어류 바이러스성 출혈성 패혈증에 대한 예방 또는 치료용 조성물
Guang-Fu et al. RESISTANCE OF FIVE EI MERIA TENELLA ISOLATES TO FOUR ANTICOCCIDIOSIS DRUGS
KR100834444B1 (ko) 물푸레나무로부터 분리된 올레우로페인 화합물을 포함하는톡소플라즈마증 예방 및 치료용 약학조성물
KR20220134191A (ko) 베르베린(berberine)를 포함하는 콕시듐 예방 또는 치료용 조성물
KR20190050470A (ko) 봉독을 유효성분으로 포함하는 콕시듐증의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22763629

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 18024943

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2023519072

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202280006974.3

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023007086

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2022763629

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022763629

Country of ref document: EP

Effective date: 20231005

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112023007086

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230414