WO2022170707A1 - Method for preparing site-directed modified long-chain dna - Google Patents

Abstract

Provided is a method for preparing a long-chain DNA, comprising: a synthesis step, an annealing step, and a ligation step. In the method, DNA fragments in a first strand and a second strand are designed to realize chemical modification of any precise site in a long-chain DNA, such that the long-chain DNA can achieve properties such as increased stability and improved immunogenicity. According to the method, a double-stranded DNA assembly formed by complementation of a continuous single-stranded DNA and a fragmented single-stranded DNA can be obtained, and a single-stranded long-chain DNA can be obtained only by simple denaturation of the double-stranded DNA assembly, thus effectively simplifying present long-chain DNA synthesis steps, improving synthesis efficiency, and facilitating industrial large-scale preparation.

Description

A method for preparing site-directed modified long-chain DNA technical field

The present disclosure belongs to the fields of molecular biology and synthetic biology, and in particular, the present disclosure relates to a method for preparing long-chain DNA and the prepared long-chain DNA.

Background technique

As the carrier of genetic information, DNA molecules play a vital role in the field of life sciences. The vast majority of biological research and bioengineering require the participation of DNA molecules of different lengths, including oligonucleotides and longer constructs, such as synthetic genes, chromosomes, etc. ^[1,2] . In addition, DNA molecules can also be used in supramolecular polymerization ^[3] , nanotechnology ^[4] and information storage ^[5] and other fields. Therefore, the cost-effective synthesis of DNA molecules is an important issue in the field of life sciences.

Most of the current commercial DNA synthesis is based on solid-phase phosphoramidite synthesis ^[6,7] , which consists of four steps of deprotection, coupling, capping and oxidation. By adding four different monomers, a single strand of DNA with a specific sequence can be obtained. However, due to the limitation of chemical reaction efficiency, the synthesis yield of DNA will decrease with the increase of the number of bases, and when the number of bases is large, the flexibility of the DNA chain will increase, which will lead to entanglement of the strands, which further reduces the synthesis efficiency. The current limit of solid-phase phosphoramidite synthesis is 200-300 bases ^[8] . In addition, this method takes a long time, and each additional base needs to go through four steps of deprotection, coupling, capping and oxidation, and the reaction of each step takes about 10 minutes.

In order to realize the synthesis of long DNA chains, scientists have developed two commonly used methods: one is to synthesize long DNA chains through the amplification of related polymerases, such as polymerase chain reaction (PCR) ^[9] , which uses a single Using stranded or double-stranded DNA as a template, it can rapidly amplify and synthesize double-stranded DNA, but it cannot synthesize DNA with customized sequence depending on the sequence of the template. Another example is rolling circle amplification (RCA) ^[10] , which can rapidly synthesize base Single-stranded DNA with tens of thousands of bases, but can only synthesize long DNA chains with repetitive sequences, and the length of the synthesized sequences is not uniform and the sequence is uncontrollable; the second is to synthesize long-chain DNA by extracellular assembly, which mainly relies on restrictions Restriction endonucleases, ligases and polymerases with complementary terminal sequences are used for assembly. Restriction endonuclease-based methods such as iBrick ^[11] and BglBrick ^[12] are very difficult to assemble multiple DNA fragments. It is difficult to find a suitable enzyme cleavage site, and base residues will be introduced, making it difficult to obtain a completely correct base sequence; the ligase-based method can splicing short-chain DNA into long-chain DNA by step-by-step splicing ^[13,14] , This kind of method needs to be carried out in multiple steps, and needs to be purified before each splicing, which is complicated, expensive and small in yield; another method based on ligase is ligase chain reaction (LCR) ^[15] , It relies on a relatively expensive heat-resistant DNA ligase, and the product drag is more serious, and the target DNA double-strand needs to be amplified by PCR; in addition, polymerase-based assembly methods include overlap extension polymerase chain reaction (OE-PCR). ) ^[16–18] , polymerase stepwise assembly (PCA) ^[19] and circular polymerase extension method (CPEC) ^[20] to prepare long double-stranded DNA, through the polymerase assembly reaction in order to ensure the correctness of the target sequence , generally rely on high-fidelity DNA polymerases. In addition, the design of primers will greatly affect the fidelity of the target sequence. If the denaturation of the DNA strand is not complete, the DNA amplification is prone to errors, and the This method cannot achieve precise modification of specific sites, which limits the universality of its application.

Most of the above-mentioned methods for preparing long-chain DNA are related to methods for synthesizing long DNA double-strands, and the methods for synthesizing long single-strand DNAs with customized sequences are relatively limited. However, they all have certain defects. There are three main methods: one is to combine streptavidin-modified magnetic beads with biotin-modified DNA single-stranded ^[21] , and to obtain complementary single-stranded DNA by denaturation. The method is generally suitable for obtaining short single-stranded DNA. The binding constant of biotin-modified long double-stranded DNA and magnetic beads will be significantly reduced, which will significantly increase the amount of magnetic beads, and long double-stranded DNA is easy to renature, resulting in purification efficiency. ^The second is to introduce a primer whose 5' end has been modified with phosphoric acid in PCR amplification, and then use Lambda exonuclease to selectively digest a 5' phosphoric acid-modified single-stranded DNA in the double-stranded DNA. , and obtain the complementary single-stranded DNA without phosphate modification ^[23] , but this method has the disadvantage of incomplete digestion of single-stranded DNA, and it will become more serious with the increase of DNA chain length; third, through denaturing polypropylene Amide gel electrophoresis (PAGE) is used for gel cutting purification. In this method, one primer is modified during double-stranded amplification, such as the introduction of cleavable ribose residues and pH-unstable clips, etc. The strands run at different speeds during electrophoresis, allowing for gel excision; however, this approach makes denaturation of the duplex more difficult as the length of the DNA strand increases, and the resolution of PAGE for both strands decreases. It is difficult to obtain high-purity DNA single-stranded. In addition, all of the methods described above are difficult to introduce modifications at specific positions on either the DNA single strand or the DNA double strand.

There are many kinds of DNA modifications, generally including modifications to bases, phosphodiester bonds and deoxyribose ^[24-29] ; at present, for DNA modified at specific sites, it is generally only possible to introduce modified monomers through chemical synthesis. It is suitable for modifying short-chain DNA. Therefore, how to efficiently synthesize single-stranded long-chain DNA and further perform precise modification of long-chain DNA at any site is a technical problem that needs to be solved urgently in the art.

Citation:

[1]Gibson D G, Glass J I, Lartigue C, et al. Creation of a bacterial cell controlled by a chemically synthesized genome[J]. Science, 2010, 329(5987): 52–56.

[2] Richardson S M, Mitchell L A, Stracquadanio G, et al. Design of a synthetic yeast genome[J]. Science, 2017, 355(6329): 1040–1044.

[3] Shi J, Jia H, Chen H. Concentration Insensitive Supramolecular Polymerization Enabled by Kinetically Interlocking Multiple-Units Strategy[J]. CCS Chemistry, 2019(1):296–303.

[4]Seeman NC, Sleiman H F.DNA nanotechnology[J].Nature Reviews Materials,2017,3.

[5]Ceze L,Nivala J,Strauss K.Molecular digital data storage using DNA[J].Nature Reviews Genetics,Springer US,2019,20(8):456–466.

[6] Horvath S J, Firca J R, Hunkapiller T, et al. An Automated DNA Synthesizer Employing Deoxynucleoside 3′-Phosphoramidites[J]. Methods in Enzymology, 1987, 154(C):314–326.

[7] Gerald Z, Kathleen A.G, Carrie J.S. Analytical studies of "mixed sequence" oUgodeoxyribonudeotides synthesized by competitive coupling of either methyl-or0-cyajwethyl-A^-diisopropylamlno phosphoramidite reagents, including 2'-deoxyinosine[J].Nucleic Acresearch , 1985, 13:8181–8196.

[8] Caruthers M H. The chemical synthesis of DNA/RNA: Our gift to science [J]. Journal of Biological Chemistry,

2013 ASBMB. Currently published by Elsevier Inc; originally published by American Society for Biochemistry and Molecular Biology., 2013, 288(2):1420–1427.

[9] Saiki R K, Scharf S, Faloona F, et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.[J].Science,1992,230(4732):1350– 1354.

[10] Amiram M, Quiroz F G, Callahan DJ, et al. A highly parallel method for synthesizing DNA repeats enables the discovery of smartg protein polymers [J]. Nature Materials, Nature Publishing Group, 2011, 10(2): 141–148.

[11] Liu J K, Chen W H, Ren S X, et al. IBrick: A new standard for iterative assembly of biological parts with homing endonucleases [J]. PLoS ONE, 2014, 9(10): 1–10.

[12] Anderson J C, Dueber J E, Leguia M, et al. BglBricks: A flexible standard for biological part assembly[J]. Journal of Biological Engineering, 2010, 4:1–12.

[13] Hamblin G D, Rahbani J F, Sleiman H F.Sequential growth of long DNA strands with user-defined patterns for nanostructures and scaffolds[J].Nature Communications,Nature Publishing Group,2015,6:7065.

[14] Khorana H G, Agarwal K L, Büchi H, et al.Total synthesis of the structural gene for an alanine transfer ribonucleic acid from yeast[J].Nature,1972,227:27–34.

[15] Au L C, Yang F Y, Yang W J, et al. Gene synthesis by a LCR-based approach: High-level production of leptin-L54 using synthetic gene in Escherichia coli[J].Biochemical and Biophysical Research Communications , 1998, 248(1):200–203.

[16]Borovkov A Y, Loskutov A V., Robida M D, et al. High-quality gene assembly directly from unpurified mixtures of microarray-synthesized oligonucleotides [J]. Nucleic Acids Research, 2010, 38(19).

[17] Stemmer WP C, Crameri A, Ha K D, et al.Single-step assembly of a gene and entire plasma from large numbers of oligodeoxyribonucleotides[J].Gene,1995,164(1):49–53.

[18]Xiong A S, Yao Q H, Peng R H, et al.A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences.[J].Nucleic acids research, 2004, 32(12).

[19] Kodumal S J, Patel K G, Reid R, et al.Total synthesis of long DNA sequences: Synthesis of a contiguous 32-kb polyketide synthase gene cluster[J].Proceedings of the National Academy of Sciences of the United States of America, 2004, 101(44):15573–15578.

[20]Quan J, Tian J.Circular polymerase extension cloning of complex gene libraries and paths[J].PLoS ONE,2009,4(7).

[21]Wilson R.Preparation of single-stranded DNA from PCR products with streptavidin magnetic beads[J].Nucleic Acid Therapeutics,2011,21(6):437–440.

[22] Holmberg A, Blomstergren A, Nord O, et al. The biotin-streptavidin interaction can be reversibly broken using water at elevated temperatures[J]. Electrophoresis, 2005, 26(3): 501–510.

[23] Kujau M J,

S.Efficient Preparation of Single-Stranded DNA for in Vitro Selection[J].Applied Biochemistry and Biotechnology-Part B Molecular Biotechnology,1997,7(3):333–335.

[24] Ratel D, Ravanat J L, Berger F, et al. N6-methyladenine: The other methylated base of DNA [J]. BioEssays, 2006, 28(3): 309–315.

[25].Barciszewski J, Barciszewska M Z, Siboska G, et al. Some unusual nucleic acid bases are products of hydroxyl radical oxidation of DNA and RNA[J].Molecular Biology Reports,1999,26(4):231-238 .

[26]Shin Y A,Eichhorn G L.Formation ofΨ(+)andΨ(-)DNA[J].Biopolymers,1984,23:325–335.

[27] Janulaitis A,

S,

M,et al.Cytosine modification in DNA by BcnI methylase yields N4-methylcytosine[J].FEBS Letters,1983,161(1):131–134.

[28] Taylor J W, Schmidt W, Cosstick R, et al. The use of phospborothioate-modifled DNA in restriction enzyme reactions to prepare nicked DNA [J]. Nucleic Acids Research, 1985, 13:8749–8764.

[29] Rozners E,Moulder J.Hydration of short DNA,RNA and 2’-Ome oligonucleotides determined by osmotic stressing[J].Nucleic Acids Research,2004,32(1):248–254.

SUMMARY OF THE INVENTION

Invention to solve problem

In view of the problems existing in the prior art, for example, the method for synthesizing long-chain DNA based on solid-phase synthesis has low yield, high cost, and high error rate when the chain length is long, and the synthesis of long-chain DNA based on DNA polymerase relies on The problem of high-fidelity polymerase and the inability to achieve precise modification of specific bases.

In some embodiments, the present disclosure provides a method for preparing long-chain DNA, which is independent of DNA polymerase and capable of synthesizing long-chain DNA with arbitrary sequences.

In other embodiments, the method provided by the present disclosure is suitable for precise modification of specific sites of long-chain DNA, and has the advantages of low synthesis difficulty, high accuracy and low cost.

In other embodiments, the method provided by the present disclosure can obtain single-stranded long-chain DNA modified at any site, and the long-chain DNA has high synthesis efficiency and high purity, and is suitable for 60 nt or more, especially in the range of 60-1000 nt. synthesis of single-stranded DNA.

solution to the problem

The present disclosure provides a method for preparing long-chain DNA, including the following steps:

Synthesis step: synthesizing the first-strand DNA fragment group and the second-strand DNA fragment group, the first-strand DNA fragment group including DNA fragment n _i and DNA fragment n _i+1 , the second-strand DNA fragment group The group includes DNA fragment m _i ; i is selected from a positive integer of 1 or more; wherein, the 5'-end sequence of the DNA fragment _mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3' end sequence of the DNA fragment mi The end sequence and the 3' end sequence of the DNA fragment n _i are complementary sequences;

Annealing step: mixing the DNA fragment group of the first strand and the DNA fragment group of the second strand in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein, the first strands are adjacent to each other. There is a connection port between the two DNA fragments of The junctions with the adjacent DNA fragments in the DNA fragment group of the second strand are staggered from each other;

Connecting step: connecting the connection port of any single-stranded DNA in the first strand and the second strand to obtain a double-stranded DNA assembly formed by the complementation of the continuous single-stranded DNA and the fragmented single-stranded DNA.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure further comprises the following steps:

Denaturation step: denaturation of the double-stranded DNA assembly to obtain continuous single-stranded DNA;

Optionally, the method further includes a purification step: purifying the continuous single-stranded DNA from the reaction system.

In some embodiments, according to the method for preparing long-chain DNA described in the present disclosure, the 3'-end sequence of the DNA fragment n _i+1 and the 3'-end sequence of the other DNA fragments of the second strand are complementary sequence;

Optionally, the sequence at the 3' end of the DNA fragment n _i+1 and the sequence at the 3' end of the DNA fragment m _i+1 are complementary sequences, and the sequence at the 5' end of the DNA fragment m _i+1 is the same as the sequence at the 3' end of the DNA fragment m i+1. The other DNA fragments of the set of DNA fragments of one strand are either complementary sequences or unpaired sequences.

In some embodiments, according to the method for preparing long-chain DNA described in the present disclosure, the length of the continuous single-stranded DNA is 60nt or more, preferably 80nt or more, preferably 100nt or more, more preferably 60-1000nt, more Preferably 80-600nt, more preferably 100-400nt, most preferably 120-360nt.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein the length of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group is 8- 120nt, preferably 10-80nt, more preferably 15-40nt, most preferably 20-30nt.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein the 5'-end sequence of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group The length is 4nt or more, preferably 4-50nt, more preferably 6-30nt, most preferably 10-20nt; or,

The length of the 3'-end sequence of any DNA fragment in the DNA fragment group of the first strand and the DNA fragment group of the second strand is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, most preferably 10- 20nt.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein any DNA fragment in the set of DNA fragments of the first strand comprises a phosphate group at the 5' end, and a phosphate group at the 3' end In the connecting step, the phosphoric acid groups and hydroxyl groups on both sides of the connecting port are connected as phosphodiester bonds;

Optionally, adjacent phosphate groups and hydroxyl groups in the first strand are linked as phosphodiester bonds by enzymatic or chemical linkage.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein any DNA fragment in the group of DNA fragments of the second strand comprises a phosphate group at the 5' end, and a phosphate group at the 3' end In the connecting step, the phosphoric acid groups and hydroxyl groups on both sides of the connecting port are connected as phosphodiester bonds;

Optionally, adjacent phosphate groups and hydroxyl groups in the second strand are linked as phosphodiester bonds by enzymatic or chemical linkage.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein one or more of any DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group comprising a modified base at the position, and the base at the position immediately adjacent to the junction is an unmodified base;

Optionally, the modification is selected from m ⁶ A, Ψ, m ¹ A, m ⁵ A, ms ² i ⁶ A, i ⁶ A, m ³ C, m ⁵ C, ac ⁴ C, m ⁷ G, m 2 ,2G, ^m2G , ^m1G , Q, ^m5U , ^mcm5U , ^ncm5U , ^ncm5Um , D, ^mcm5s2U , ^Inosine (I), ^hm5C , ^s4U , s ² U, azobenzene, Cm, Um, Gm, t ⁶ A, yW, ms ² t ⁶ A or derivatives thereof.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein one or more of any DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group comprising modified deoxyribose at the position, and the deoxyribose at the position immediately adjacent to the junction is unmodified deoxyribose;

Optionally, the modification is selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F or 2'-OBn (2'-O-benzyl group) or derivatives thereof.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein one or more of any DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group comprising a modified phosphodiester bond at the position, and the phosphodiester bond at the position immediately adjacent to the connecting port is an unmodified phosphodiester bond;

Optionally, the modification is selected from phosphorothioate (PS).

In some embodiments, according to the method for preparing long-chain DNA according to the present disclosure, wherein, in the annealing step, after incubating the DNA fragment group of the first strand and the DNA fragment group of the second strand, Cooling to form an assembly precursor of double-stranded DNA;

Optionally, the incubation temperature is any temperature of 0-100°C, preferably any temperature of 10-85°C, more preferably any temperature of 20-65°C, and the incubation time is any desired time;

The speed of the cooling can be any speed, and the temperature can be any temperature at which the DNA fragments in the reaction system are hybridized to form an assembly precursor of double-stranded DNA.

In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein, in the annealing step, the first-strand DNA fragment group and the second-strand DNA fragment group are dissolved in the same solvent to obtain the reaction system.

In some embodiments, according to the method for preparing long-chain DNA described in the present disclosure, wherein, the pH of the reaction system is 3-11, preferably pH 4-10, more preferably pH 5-9, most preferably pH 6- 8.

In some embodiments, according to the method for preparing long-chain DNA described in the present disclosure, wherein, in the reaction system, any two DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group The molar ratio is 1:(0.1-10), preferably 1:(0.5-1), most preferably 1:1.

The present disclosure also provides a long-chain DNA, wherein the long-chain DNA is prepared by the method according to the present disclosure, and the long-chain DNA is a single-stranded long-chain DNA;

Preferably, the long strand of DNA comprises modified base, ribose or phosphodiester linkages at one or more positions.

effect of invention

In some embodiments, the method for preparing long-chain DNA provided by the present disclosure can prepare long-chain DNA of any sequence, and realize precise modification of any site in the long-chain DNA, and the preparation method of long-chain DNA uses raw materials DNA is a template, does not rely on exogenous DNA, and does not rely on DNA polymerase, etc., has the advantages of low cost, low synthesis difficulty, high yield, and high sequence accuracy, and is suitable for large-scale popularization.

In some embodiments, the present disclosure provides a method for preparing long-stranded DNA by preparing an assembly of double-stranded DNA formed by complementation of continuous single-stranded DNA and fragmented single-stranded DNA, and the assembly of double-stranded DNA is only The target long-chain DNA can be obtained by simple denaturation treatment. Compared with the double-stranded DNA formed by two continuous single strands, the denaturation difficulty of the double-stranded DNA assembly in the present disclosure is low; and, for non-targeted DNA The single-stranded DNA is dispersed in the reaction system as DNA fragments after the preparation is completed, and it does not need to be sheared or reprocessed, which effectively simplifies the preparation steps of single-stranded long-chain DNA, and improves the preparation efficiency and efficiency. Synthetic purity of single-stranded long-chain DNA.

In some embodiments, the method for preparing long-chain DNA provided by the present disclosure, in which precise insertion of modified bases at any site is achieved, solves the problem that the current long-chain DNA synthesis method cannot achieve precise modification of specific sites. question.

In some embodiments, the long-chain DNA provided by the present disclosure is a single-stranded long-chain DNA prepared by the above-mentioned preparation method, and its sequence accuracy is high, and can be modified at any site to obtain improved stability, immunity and immunity. It has a wide range of application prospects in drug research and development, clinical treatment, etc.

Description of drawings

Figure 1 shows a schematic diagram of the process of preparing long-chain DNA;

Figure 2 shows a schematic diagram of the assembly of DNA 100/80bp;

Figure 3 shows the results of gradient native polyacrylamide gel electrophoresis characterization results of DNA 100/80bp assemblies;

Figure 4 shows the characterization results of denaturing polyacrylamide gel electrophoresis of 100nt DNA single strands;

Figure 5 shows the comparison of the characterization results of native and denaturing polyacrylamide gel electrophoresis of DNA 100/80bp assemblies without ligation;

Figure 6 shows the characterization results of non-denaturing polyacrylamide gel electrophoresis and fragment analyzer characterization results of length-extended double-stranded DNA assemblies.

Detailed ways

Hereinafter, the content of the present disclosure will be described in detail. The description of the technical features described below is based on typical embodiments and specific examples of the present disclosure, but the present disclosure is not limited to these embodiments and specific examples. It should be noted:

In the present disclosure, the numerical range represented by "numerical value A to numerical value B" refers to the range including the numerical values A and B at the endpoints.

In the present disclosure, unless otherwise stated, "multiple" in "multiple", "plurality", "plurality", etc. means a numerical value of 2 or more.

In the present disclosure, the "substantially", "substantially" or "substantially" means that the error is less than 5%, or less than 3% or less than 1% compared to the relevant perfect standard or theoretical standard.

In the present disclosure, unless otherwise specified, "%" refers to mass percentage.

In the present disclosure, the meaning expressed by "may" includes both meanings of performing certain processing and not performing certain processing.

In this disclosure, although the content of the disclosure supports that the terms "or" and "or" are defined as only alternatives and "and/or", unless it is expressly stated that the terms are only alternatives or mutually exclusive between alternatives, the claims The terms "or" and "or" in , mean "and/or".

In this disclosure, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

As used in this disclosure, "water" includes tap water, deionized water, distilled water, double-distilled water, purified water, ion-exchanged water, and the like, any practicable water.

In the present disclosure, "double-stranded DNA assembly" and "double-stranded DNA" have the same meaning and can be substituted for each other.

In the present disclosure, the "connection port" is also called a nick, which exists between two adjacent deoxyribonucleotides in single-stranded DNA because the gap between the two adjacent deoxyribonucleotides is Produced without the formation of phosphodiester bonds.

first

A first aspect of the present disclosure provides a method for preparing long-chain DNA, as shown in FIG. 1 , which includes the following steps:

Synthesis step: synthesizing the first-strand DNA fragment group and the second-strand DNA fragment group, the first-strand DNA fragment group including DNA fragment n _i and DNA fragment n _i+1 , the second-strand DNA fragment group The group includes DNA fragment m _i ; i is selected from a positive integer of 1 or more; wherein, the 5'-end sequence of the DNA fragment _mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3' end sequence of the DNA fragment mi The end sequence and the 3' end sequence of the DNA fragment n _i are complementary sequences;

Annealing step: mixing the DNA fragment group of the first strand and the DNA fragment group of the second strand in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein, the first strands are adjacent to each other. There is a connection port between the two DNA fragments of The junctions with the adjacent DNA fragments in the DNA fragment group of the second strand are staggered from each other;

Connecting step: connecting the connection port of any single-stranded DNA in the first strand and the second strand to obtain a double-stranded DNA assembly formed by the complementation of the continuous single-stranded DNA and the fragmented single-stranded DNA.

It should be noted that it is generally considered that it is difficult to achieve one-pot assembly of a large number of different fragment mixtures in solution. Therefore, in current nucleic acid synthesis methods, DNA is often synthesized by solid-phase synthesis. There are also reports on the synthesis of long double-stranded DNA by means of short fragment annealing, nick ligation and PCR amplification, but its reliance on high-fidelity DNA polymerases easily leads to increased costs and increased error rates. Patent document CN102876658A invented a method for large-scale synthesis of long-chain nucleic acid molecules, and its specific steps include: the first step, the synthesis of short-chain nucleic acid molecule fragments; the second step, the chemical modification of the endpoint; the third step, the short chain The connection of nucleic acid molecule fragments; the fourth step, the purification of DNA double strands; the fifth step, the use of nucleic acid amplification technology to amplify and amplify the target long-chain DNA molecule. Although the above method can realize the synthesis of long-chain DNA, it relies on PCR for amplification and amplification, and the prepared long-chain DNA is a double-stranded DNA formed by the complementation of two continuous single-stranded DNAs. On the one hand, after the reaction process of PCR, the long-chain DNA cannot be modified at the entry site; It is difficult to denature double-stranded DNA formed by long chains, and it is difficult to obtain single-stranded long-chain DNA. Furthermore, even if the double-stranded long-stranded DNA is denatured, a reaction system in which two continuous single-stranded DNAs are mixed is obtained, which affects the recovery efficiency and recovery purity of the target single-stranded DNA. In addition, there may be unsuccessful ligation of multiple junction ports in the purified assembly, and only a small part of complete double-stranded DNA is formed, so the yield of double-stranded DNA is low.

The preparation method of the present disclosure divides the long-chain DNA into several short DNA fragments, which greatly reduces the difficulty of synthesizing the long-chain DNA. In the process of synthesizing long single-stranded DNA, it is not necessary to use DNA polymerase, which effectively reduces the difficulty of chemical synthesis of long single-stranded DNA, and can realize the synthesis of base, deoxyribose or phosphodiester at any position in the long single-stranded DNA. The modification of the bond has the advantages of low cost, high yield and high sequence accuracy.

In addition, the preparation method of the present disclosure only connects the junction of one DNA strand in the first strand and the second strand to obtain a double-stranded DNA assembly formed by the complementarity of the continuous single-stranded DNA and the fragmented single-stranded DNA . The preparation method also does not include an amplification step, and avoids connecting the junction of the fragmented single-stranded DNA in the double-stranded DNA assembly, thereby realizing the preparation of long-chain DNA independent of the PCR amplification step, and can obtain higher yield.

The assembly of double-stranded DNA can recover the target long-stranded DNA only by simple denaturation treatment. The preparation method does not include digestion and shearing of non-target single-stranded DNA, which effectively improves the single-stranded DNA. The preparation efficiency and purity of long-chain DNA are suitable for large-scale industrial applications.

<Sequence of dividing long-chain DNA>

Before preparing long-chain DNA, the sequence of the target long-chain DNA is first divided. FIG. 2 shows a double-stranded long-chain DNA structure. The double-stranded DNA is composed of at least partially complementary first and second strands, wherein the first or second strand is a target synthesized long-chain DNA. The nucleotide sequences of the first strand and the second strand are respectively divided, so that the nucleotide sequences of the first strand and the second strand are divided into DNA fragment sequences of several short strands.

Wherein, the DNA segment group of the first strand includes DNA segment n _i and DNA segment n _i+1 , and the DNA segment group of the second strand includes DNA segment _mi . The 5'-end sequence of the DNA fragment mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3'-end sequence of the DNA fragment _{mi and the 3'-end sequence of the DNA fragment n i are} complementary sequences. The 5'-end sequence of DNA fragment n _i and the 5'-end sequence of other DNA fragments of the second strand are complementary sequences or unpaired sequences, and the 3'-end sequence of DNA fragment n _i+1 is the same as that of other DNA fragments of the second strand. The 3'-end sequence is either a complementary sequence or an unpaired sequence. Through the sequence division of the DNA fragments of the first strand and the second strand, the sequence division of the double-stranded DNA containing the target long-chain DNA sequence is realized.

Further, the DNA segment group of the first strand may also include other DNA segments. Exemplarily, the DNA segment group of the first strand includes at least x DNA segments, where x is a positive integer greater than or equal to 2. For example, the value of x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. Not exhaustive.

In some embodiments, the set of DNA fragments of the first strand includes DNA fragment n _i , DNA fragment n _i+1 , DNA fragment n _i+2 . In some embodiments, the set of DNA fragments of the first strand includes DNA fragment _ni , DNA fragment _ni+1 , DNA fragment _ni+2 , DNA fragment _ni+3 . In some embodiments, the set of DNA fragments of the first strand includes DNA fragment _ni , DNA fragment _ni+1 , DNA fragment _ni+2 , DNA fragment _ni+3 , DNA fragment _ni+4 . By analogy, the DNA fragment group of the first strand may also include other numbers of DNA fragments, which are not exhaustive in the present disclosure.

Further, the DNA segment group of the second strand may also include other DNA segments. Exemplarily, the DNA segment group of the first strand includes at least y DNA segments, and y is a positive integer greater than 1. For example, the value of y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. This will not be exhaustive.

In some embodiments, the set of DNA fragments of the second strand includes DNA fragments _mi , DNA fragments _mi+1 . Wherein, the 5'-end sequence of the DNA fragment mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3'-end sequence of the DNA fragment _{mi and the 3'-end sequence of the DNA fragment n i are} complementary sequences; The sequence at the 3' end of the DNA fragment m _i +1 is complementary to the sequence at the 3' end of the DNA fragment n _i+1 , and the sequence at the 5' end of the DNA fragment m _i+1 is the same as the 5' end of the DNA fragment n _i+2 . The sequences are complementary or unpaired.

In some embodiments, the set of DNA fragments of the second strand includes DNA fragment _mi , DNA fragment _mi+1 , DNA fragment _mi+2 . Wherein, the 5'-end sequence of the DNA fragment mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3'-end sequence of the DNA fragment _{mi and the 3'-end sequence of the DNA fragment n i are} complementary sequences; The sequence at the 3' end of the DNA fragment m _i +1 is complementary to the sequence at the 3' end of the DNA fragment n _i+1 , and the sequence at the 5' end of the DNA fragment m _i+1 is the same as the 5' end of the DNA fragment n _i+2 . The sequence is a complementary sequence; the sequence at the 3' end of the DNA fragment mi+2 is a complementary sequence with the sequence at the 3' end of the DNA fragment n _{i+2 ,} and the sequence at the 5' end of the DNA fragment _mi+2 is the same as the sequence at the 5' end of the DNA fragment n _i+ The 5' sequence of ₃ is either a complementary sequence or an unpaired sequence.

In some embodiments, the set of DNA fragments of the second strand includes DNA fragment _mi , DNA fragment _mi+1 , DNA fragment _mi+2 , DNA fragment _mi+3 . Wherein, the 5'-end sequence of the DNA fragment mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3'-end sequence of the DNA fragment _{mi and the 3'-end sequence of the DNA fragment n i are} complementary sequences; The sequence at the 3' end of the DNA fragment m _i +1 is complementary to the sequence at the 3' end of the DNA fragment n _i+1 , and the sequence at the 5' end of the DNA fragment m _i+1 is the same as the 5' end of the DNA fragment n _i+2 . The sequence is a complementary sequence; the sequence at the 3' end of the DNA fragment mi+2 is a complementary sequence with the sequence at the 3' end of the DNA fragment n _{i+2 ,} and the sequence at the 5' end of the DNA fragment _mi+2 is the same as the sequence at the 5' end of the DNA fragment n _i+ The 5'-end sequence of ₃ is a complementary sequence; the 3'-end sequence of the DNA fragment mi+3 is a complementary sequence with the 3'-end sequence of the DNA fragment n _{i +3} , and the 5'-end sequence of the DNA fragment _mi+3 is the same as the The 5'-end sequence of the DNA fragment n _i+4 is a complementary sequence or an unpaired sequence. By analogy, the DNA fragment group of the second strand may also include other numbers of DNA fragments, which are not exhaustive in the present disclosure.

In the present disclosure, the 5'-end sequence and the 3'-end sequence refer to dividing the nucleotide fragment in the 5' to 3' direction, so that the nucleotide fragment is divided into two regions. Among them, a sequence in a region near the 5' end is referred to as a 5' end sequence, and a sequence in another region near the 3' end is referred to as a 3' end sequence.

In the present disclosure, the 5' terminus is a nucleotide in the 5' to 3' direction at the 5' endmost position in the nucleotide chain, which typically has a 5' terminus phosphate group. The 3' terminus is a nucleotide in the 5' to 3' direction at the 3' endmost position in the nucleotide chain, which typically has a 3' terminus hydroxyl group.

In addition, the number of DNA fragments in the DNA fragment group of the first strand or the DNA fragment group of the second strand can also be increased or decreased according to actual needs. The division of DNA strands of different lengths can be achieved by increasing or decreasing the above-mentioned DNA fragments. Specifically, whether the DNA fragment group of the first strand or the DNA fragment group of the second strand includes other DNA fragments, and the number of other DNA fragments included are determined by the sequence of the target long-chain DNA to be synthesized. Through the above design, long-chain DNAs of any of the stated lengths and desired sequences can be synthesized.

Further, after the nucleotide sequences of the first strand and the second strand are divided, there will be a junction between the two connected DNA fragments. For example, there is a junction between the DNA fragment n _i and the DNA fragment n _i+1 in the first strand, and there is a junction between the DNA fragment mi and the DNA fragment m _{i +1} in the second strand. In order to make the double-stranded DNA assembly precursor obtained after annealing have relatively good stability, when the target long-chain DNA is sequenced, the adjacent DNA fragments in the first-strand DNA fragment group are The junctions are staggered from the junctions between adjacent DNA fragments in the DNA fragment group of the second strand.

Further, when the target long-chain DNA is sequenced, the melting temperature (T _m ) of the DNA fragments in the DNA fragment group of the first strand and the DNA fragment group of the second strand should be as close as possible, and the chain should be avoided. The presence of complex higher-order structures within to reduce the difficulty of annealing DNA fragments to form precursors of double-stranded DNA assemblies.

In some specific embodiments, the length of the 5'-end sequence of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, Most preferably 10-20nt. For example, the 5' end sequence of any DNA fragment is 4nt, 6nt, 8nt, 10nt, 12nt, 14nt, 16nt, 18nt, etc. in length.

In some specific embodiments, the length of the 3'-end sequence of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, Most preferably 10-20nt. For example, the 3' end sequence of any DNA fragment is 4nt, 6nt, 8nt, 10nt, 12nt, 14nt, 16nt, 18nt, etc. in length.

In some specific embodiments, the length of the continuous single-stranded DNA is 60nt or more, preferably 80nt or more, preferably 100nt or more, more preferably 60-1000nt, more preferably 80-600nt, more preferably 100-400nt, most preferably 120-nt 360nt. For example, the length of any single-stranded DNA is 60nt, 80nt, 90nt, 100nt, 120nt, 140nt, 160nt, 180nt, 200nt, 220nt, 240nt, 250nt, 260nt, 267nt, 270nt, 300nt, 320nt, 340nt, 360nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, etc.

In a specific embodiment, the present disclosure describes a method for preparing long-chain DNA, comprising the following steps:

Synthesis step: synthesizing the first-strand DNA fragment group and the second-strand DNA fragment group, the first-strand DNA fragment group including DNA fragment n _i and DNA fragment n _i+1 , the second-strand DNA fragment group The group includes DNA fragment m _i ; i is selected from a positive integer of 1 or more; wherein, the 5' end sequence of the DNA fragment _mi and the 5' end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3' end sequence of the DNA fragment mi The end sequence and the 3' end sequence of the DNA fragment n _i are complementary sequences;

Annealing step: mixing the DNA fragment group of the first strand and the DNA fragment group of the second strand in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein, the first strands are adjacent to each other. There is a connection port between the two DNA fragments of The junctions with the adjacent DNA fragments in the DNA fragment group of the second strand are staggered from each other;

Connecting step: connecting the junction of any single-stranded DNA in the first strand and the second strand to obtain a double-stranded DNA assembly formed by the complementation of the continuous single-stranded DNA and the fragmented single-stranded DNA.

Denaturation step: denaturation of the double-stranded DNA assembly to obtain continuous single-stranded DNA.

<Synthetic DNA Fragment>

After the sequence division of the target long-chain DNA is completed, the desired sequence and the stated number of DNA fragments are synthesized. The method for synthesizing the DNA fragment can be a DNA synthesis method commonly used in the art, for example, chemical synthesis. The short-chain DNA fragments can be prepared on a large scale by chemical synthesis, and the sequence accuracy of the DNA fragments can be guaranteed.

In some specific embodiments, the length of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group is 8-120nt, preferably 10-80nt, more preferably 15-40nt, most preferably 20-nt 30nt. For example, DNA fragments are 22nt, 24nt, 26nt, 28nt, 30nt, 40nt, 50nt, 60nt, 70nt, 80nt, 90nt, 100nt, etc. in length. The length of the DNA fragment determines the difficulty and cost of its synthesis. Controlling the length of the DNA fragment at 20-30 nt can effectively reduce the difficulty of DNA fragment synthesis and control the synthesis cost.

In some specific embodiments, the set of DNA fragments of the first strand and the set of DNA fragments of the second strand comprise modified bases at one or more positions of any of the DNA fragments. For example, modified bases are included at 1, 2, 3, 4, etc. positions of the DNA fragment. The method of base modification can adopt methods commonly used in the art, for example, introducing modified bases in the process of chemically synthesizing short-chain DNA fragments. Introducing modified bases in the process of synthesizing DNA fragments can realize base modification at any site. After the DNA fragments are assembled into long-chain DNA, long-chain DNA that can precisely modify bases at any site can be obtained. , the following modification methods are abbreviations of commonly used modification methods. For specific modification methods, please refer to References ^[24-29] .

Specifically, the modification of the base at any position in the DNA fragment can be selected from m ⁶ A, Ψ, m ¹ A, m ⁵ A, ms ² i ⁶ A, i ⁶ A, m ³ C, m ⁵ C, ac ⁴ C, m ⁷ G, m2, 2G, m ² G, m ¹ G, Q, m ⁵ U, mcm ⁵ U, ncm ⁵ U, ncm ⁵ Um, D, mcm ⁵ s ² U, Inosine ( I), hm ⁵ C, s ⁴ U, s ² U, azobenzene, Cm, Um, Gm, t ⁶ A, yW, ms ² t ⁶ A or derivatives thereof.

In some specific embodiments, the set of DNA fragments of the first strand and the set of DNA fragments of the second strand comprise modified deoxyribose sugars at one or more positions of any of the DNA fragments. For example, modified deoxyribose sugars are included at 1, 2, 3, 4, etc. positions of the DNA fragment. The method of deoxyribose modification can adopt the method commonly used in the art, for example, introducing modified deoxyribose in the process of chemically synthesizing short-chain DNA fragments. The introduction of modified deoxyribose in the process of synthesizing DNA fragments can realize the modification of deoxyribose at any site. After the DNA fragments are assembled into long-chain DNA, long-chain DNA that can be precisely modified by deoxyribose at any site can be obtained. .

Specifically, the modification mode of deoxyribose at any position in the DNA fragment can be selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F, 2'-OBn (2'-O- benzyl group) or its derivatives.

In some specific embodiments, the set of DNA fragments of the first strand and the set of DNA fragments of the second strand comprise modified phosphodiester bonds at one or more positions in any of the set of DNA fragments of the first strand, the phosphodiester bonds being formed in the short A strand of DNA between two adjacent deoxyribonucleotides. For example, modified phosphodiester linkages are included at 1, 2, 3, 4, etc. positions of the DNA fragment. The method of phosphodiester bond modification can adopt methods commonly used in the art, for example, introducing modified phosphodiester bonds in the process of chemically synthesizing short-chain DNA fragments. The introduction of modified phosphodiester bonds in the process of synthesizing DNA fragments can realize the modification of phosphodiester bonds at any site. Precisely modified long strands of DNA.

Specifically, the modification mode of the phosphodiester bond at any position in the DNA fragment can be selected from phosphorothioate (PS).

In some preferred embodiments, modifications to base, deoxyribose, and phosphodiester linkages should avoid base, deoxyribose, and phosphodiester linkages immediately adjacent to the junction position to avoid first-strand or second-strand Modifications at the junction may have an effect on the junction ligation in the subsequent assembly precursor of double-stranded DNA.

By modifying at least one of the base, ribose and phosphodiester bonds at any one or more sites in the DNA fragment, and applying the modified DNA fragment to the synthesis of long-chain DNA in the present disclosure, the The precise modification of any site in the long-chain DNA effectively solves the problem that it is difficult to synthesize long-chain DNA with precise modification at a specific site in the current field. The modified long-chain DNA has improved biological properties such as stability and immunogenicity, and has a wide range of uses in the field of biomedicine.

In some specific embodiments, any DNA fragment in the set of DNA fragments of the first strand comprises a phosphate group at the 5' terminal, and a hydroxyl group at the 3' terminal. For example, the 5' end of DNA fragment _ni contains a phosphate group and the 3' end contains a hydroxyl group; the 5' end of DNA fragment _ni+1 contains a phosphate group and the 3' end contains a hydroxyl group, and the 5' end of DNA fragment _ni+2 contains a phosphate group. The ' end contains a phosphate group, and the 3' end contains a hydroxyl group; the 5' end of the DNA fragment n _i+3 contains a phosphate group, and the 3' end contains a hydroxyl group; the 5' end of the DNA fragment n _i+4 contains a phosphate group, 3 The 'terminal contains a hydroxyl group; by connecting the 5' phosphate groups and the 3' hydroxyl groups on both sides of the connection port into a phosphodiester bond, the connection of the connection port in the first strand can be realized, thereby obtaining a continuous single-stranded DNA (No. One strand) is an assembly of double-stranded DNA formed complementary to fragmented single-stranded DNA (second strand).

In some specific embodiments, any DNA fragment in the set of DNA fragments of the second strand comprises a 5' terminal phosphate group, and a 3' hydroxyl group. For example, the 5' end of DNA fragment _mi contains a phosphate group and the 3' end contains a hydroxyl group; the 5' end of DNA fragment _mi+1 contains a phosphate group and the 3' end contains a hydroxyl group, and the 5' end of DNA fragment _mi+2 contains a phosphate group. The 'end contains a phosphate group and the 3'end contains a hydroxyl group; the 5'end of the DNA fragment _mi+3 contains a phosphate group and the 3'end contains a hydroxyl group. After the DNA fragments of the first strand and the second strand are assembled to form the assembly precursor of double-stranded DNA, by connecting the 5' phosphate groups and the 3' hydroxyl groups on both sides of the junction into phosphodiester bonds, the first and second strands can be assembled. The junctions in the two strands are ligated to obtain an assembly comprising double-stranded DNA formed by complementation of the continuous single-stranded DNA (second strand) and the fragmented single-stranded DNA (first strand).

Exemplarily, the method for introducing the phosphate group at the 5' end of the DNA fragment can adopt a modification method commonly used in the art, for example, a phosphate group can be directly introduced at the 5' end of the DNA fragment during the synthesis of the DNA fragment; Alternatively, the phosphate group is modified at the 5' end of the DNA fragment by kinase treatment on the DNA fragment without the introduction of the phosphate group.

With the above-mentioned design method, the 5' phosphate group and the 3' hydroxyl group are added to the DNA fragments of the target single-stranded DNA in the first and second strands, so that only the target single-stranded DNA is connected in the connecting step. , to obtain continuous single-stranded DNA, while the DNA strand complementary to the target single-stranded DNA is still a fragmented DNA chain, which effectively overcomes the difficulty of denaturation of double-stranded long-stranded DNA, and the purity and recovery rate of single-stranded DNA after denaturation. Low problem, and avoid the need to digest, cut and other processing of the complementary strand in the subsequent recovery of the target single-stranded DNA.

<Assembly precursor of double-stranded DNA>

Mixing the DNA fragment group of the first strand and the DNA fragment group of the second strand in the same reaction system and annealing to obtain a double-stranded DNA assembly precursor formed by at least partial complementarity of the first strand and the second strand; Wherein, there is a junction between two adjacent DNA fragments in the first strand, and a junction exists between two adjacent DNA fragments in the second strand; in the DNA fragment group of the first strand The junctions between the adjacent DNA fragments and the junctions between the adjacent DNA fragments in the DNA fragment group of the second strand are staggered from each other.

DNA molecules contain 4 different deoxyribonucleotides, which are adenine deoxyribonucleotide (A), guanine deoxyribonucleotide (G), and cytosine deoxyribonucleoside depending on the type of base. acid (C) and thymidine (T). The bases can be connected to each other through hydrogen bonds, and hydrogen bonds can be formed between A and T, and C and G, respectively. The precise complementary pairing ability between base pairs enables the two reverse DNA single strands whose sequences are complementary to each other to form an accurate double-stranded structure by hydrogen bonding.

Specifically, the first-strand DNA fragment group and the second-strand DNA fragment group are dissolved in the same solvent, and the two are thoroughly mixed to obtain a reaction system for preparing a double-stranded DNA assembly precursor. The present disclosure does not specifically limit the specific solvent, which can be a polar solvent commonly used in the art, such as water and the like. For the molar ratio of mixing DNA fragments in the reaction system, the molar ratio of any two DNA fragments in the DNA fragment group of the first strand and the DNA fragment group of the second strand is 1:(0.1-10), preferably 1:( 0.5-1), most preferably 1:1. Exemplarily, the molar ratio of any two DNA fragments is 1:0.2, 1:0.4, 1:0.6, 1:0.8, 1:2, 1:4, 1:6, 1:8, etc. By setting the molar ratio of DNA fragments, the assembly efficiency of short-chain DNA fragments can be improved.

In order to further improve the assembly efficiency of the assembly precursor of double-stranded DNA, and improve the yield of the assembly of double-stranded DNA, the pH of the reaction system is set to 3-11, preferably pH 4-10, more preferably pH 5-9, and most preferably pH 3-11. Preferably pH 6-8. Exemplarily, the pH of the reaction system is 6, 7, 8, 9, and the like.

Further, in the annealing step of preparing the assembly precursor of the double-stranded DNA, after incubating the DNA fragment group of the first strand and the DNA fragment group of the second strand, the temperature is lowered to form the assembly of the double-stranded DNA. body precursor;

Optionally, the incubation temperature is any temperature of 0-100°C, preferably any temperature of 10-85°C, more preferably any temperature of 20-65°C, and the incubation time is any desired time;

The speed of the cooling can be any speed, and the temperature can be any temperature at which the DNA fragments in the reaction system are hybridized to form an assembly precursor of double-stranded DNA.

<Assembly of double-stranded DNA>

Only the junction present in the first strand is ligated, or only the junction present in the second strand is ligated to form a double-stranded DNA assembly.

Specifically, the 5' phosphate groups and the 3' hydroxyl groups on both sides of the connection port are connected as phosphodiester bonds. Wherein, the ligation method can be enzymatic ligation by T4 DNA ligase, Taq DNA ligase, PfU ligase, etc., or a chemical ligation method. After the ligation port is connected, a complete double-stranded DNA assembly is obtained to realize the preparation of long-chain DNA.

Further, the preparation method of the present disclosure further includes a denaturation step. For the denaturation step, the double-stranded DNA assembly is subjected to denaturation treatment to obtain continuous single-stranded DNA dispersed in the reaction system, that is, the target long-stranded DNA. The method of denaturation treatment can be a method commonly used in the art for melting double-stranded DNA to form single-stranded DNA. For example, the continuous single-stranded DNA and the fragmented single-stranded DNA can be unwound by treating at a temperature of 70 °C, or in a solution containing 7M urea at a constant temperature of 50 °C, and the continuous single-stranded DNA can be dispersed. in the reaction system.

Further, the preparation method of the present disclosure also includes a purification step. The purification step is to purify the continuous single-stranded DNA from the reaction system. The present disclosure does not specifically limit the purification method, and can be various methods for efficiently recovering DNA from the reaction system. The long-chain DNA without other substances obtained after the purification step can be further applied in different fields such as clinical, drug research and development, and biological research.

The preparation method in the present disclosure has all the advantages of conventional DNA chemical synthesis methods (including no need for template strands, precise site modification, etc.) The difficulty of chemical synthesis is reduced, and the high accuracy, high yield and site-specific modification ability of short-chain DNA fragments prepared by chemical synthesis are retained.

The DNA fragments that can be easily prepared by chemical synthesis are reassembled into the double-stranded DNA assembly precursor of the target structure in a specific order through the self-assembly ability of nucleic acid, and any one of the assemblies is assembled by enzymatic or chemical ligation. The ligation ports of the single-stranded DNA are reconnected through phosphodiester bonds to obtain a double-stranded DNA assembly formed by the complementarity of the continuous single-stranded DNA and the fragmented single-stranded DNA. For the assembly of double-stranded DNA, only simple denaturation is required to obtain single-stranded target long-chain DNA. Since the chemical synthesis process can realize the precise modification of any position of the initial short-chain DNA fragment (except the bases immediately adjacent to the two sides of the junction), the obtained target long-chain DNA also has the ability to be accurately modified at almost any position. characteristics.

the second aspect

A second aspect of the present disclosure provides a long-chain DNA, which is prepared by the method of the first aspect and is a single-stranded long-chain DNA.

The long-chain DNA of the present disclosure can achieve accurate modification at any site, and the long single-stranded DNA itself has no sequence dependence on the modification. The application in the field provides the basis.

Example

The embodiments of the present disclosure will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only used to illustrate the present disclosure and should not be regarded as limiting the scope of the present disclosure. If the specific conditions are not indicated in the examples, it is carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used without the manufacturer's indication are conventional products that can be obtained from the market.

The experimental techniques and experimental methods used in the present embodiment, unless otherwise specified, are conventional technical methods, such as experimental methods that do not specify specific conditions in the following examples, usually according to conventional conditions such as people such as Sambrook, molecular cloning: experiment The conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as suggested by the manufacturer. Materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

Materials and methods

The DNA sequences used in the examples were purchased from Qingke Company without additional treatment before use. All experimental water used ultrapure water produced by 18.2MΩcm Millipore Company. T4 DNA ligase and 10X ligase buffer were purchased from Sangon Bioengineering (Shanghai) Co., Ltd. All other chemical reagents were of analytical grade. Fragment analyzer model: Fragment

Capillary electrophoresis system (Siboquan Technology (Hong Kong) Co., Ltd.).

Example 1. Construction of 100/80bp DNA double-stranded assemblies

(1) The long-strand DNA with the first and second strands of 100 nt and 80 nt respectively (referred to as DNA100/80) is used as the target long-strand, and the long-strand is cut into nine short-strand DNAs of 20 nt in length. Among them, D-n1, D-n2, D-n3, D-n4, D-n5 are the DNA fragments for the synthesis of the first strand, and D-m1, D-m2, D-m3 and D-m4 are for the synthesis of the second strand DNA fragments.

(2) Nine short DNA chains were prepared by chemical synthesis.

The specific sequences of the 9 chains used are shown in the table below:

Table 1. Sequence information for the nine short DNA strands used to prepare the assemblies

sequence name	sequence information	nt	SEQ ID NO
D-n1		AAAAGGAAAAGCGATGCTAT	20	SEQ ID NO: 1
D-m1		TACGAATCCAATAGCATCGC	20	SEQ ID NO: 2
D-n2		TGGATTCGTAGGACTGCCTG	20	SEQ ID NO: 3
D-m2		CAAGTAGTTACAGGCAGTCC	20	SEQ ID NO: 4
D-n3		TAACTACTTGTCACTCTCTT	20	SEQ ID NO: 5
D-m3		TGTCGGTAAGAAGAGAGTGA	20	SEQ ID NO: 6
D-n4		CTTACCGACAAAACCTAAAT	20	SEQ ID NO: 7
D-m4		TGAACAGATAATTTAGGTTT	20	SEQ ID NO: 8
D-n5		TATCTGTTCAAAAAGGAAAA	20	SEQ ID NO: 9

(3) Mix the above 9 DNA short chains in an equimolar ratio in 1×TAE-Mg ²⁺ buffer, heat at 70°C for 5 minutes, then gradually cool to room temperature, and place at 4°C for 10 minutes to obtain the target DNA assembly. The obtained assembly was observed by native polyacrylamide gel electrophoresis, and the results are shown in FIG. 3 .

It can be seen from FIG. 3 that the target double-stranded DNA assembly precursor was prepared with high efficiency under the above conditions.

Example 2. Synthesis and gel electrophoresis characterization of 100nt DNA single strands

(1) 9 DNA fragments in Example 1 were synthesized.

(2) Among the DNA100/80 target DNA long chains involved in Example 1, 20 nt short chains (D-n1, D-n2, D-n3, D-n4, D-n5) is modified with a phosphate group at the 5' terminal (the second strand is not modified when calculated in the 5'-3' direction). Modification of the 5' terminal phosphate group can be introduced during the synthesis of DNA fragments.

(3) The DNA100/80 assembly aqueous solution was obtained according to the method in Example 1, and then a certain amount of 10×T4 DNA ligase buffer was added according to the manufacturer’s instructions, and H ₂ O and T4 DNA Ligase were enzymatically linked at 37° C. The 4 junctions in one strand are connected so that the 5 short DNA fragments in the first strand form a complete 100nt strand. The obtained 100 nt chain 1 was observed by polyacrylamide gel electrophoresis, and the results are shown in FIG. 4 .

As can be seen from Figure 4, the target 100nt DNA single strand was obtained with high efficiency under the described conditions.

It should be noted that, as shown in Figure 5, as long as the short-chain DNA fragments form an assembly, regardless of whether they are connected or not, they can be characterized by native polyacrylamide gel electrophoresis to obtain a complete long double-stranded structure (Figure 5a). , but it can be found by denaturing polyacrylamide gel electrophoresis characterization that only the ligated DNA can maintain the complete long chain under denaturing conditions (lanes 2, 3, 5, 6 in Figure 5b), while the unligated DNA The treated DNA long duplexes would re-dissolve into short chains under denaturing conditions (lanes 1, 4 in Figure 5b), demonstrating that successful characterization in native polyacrylamide gel electrophoresis cannot account for the formation of target long-chain structures.

Example 3. Preparation of longer DNA double-stranded assemblies

In order to synthesize longer DNA sequences, the system was extended in Example 3 to increase the amount of short-chain DNA. Specific steps are as follows:

(1) The first and second strands are respectively 252nt and 240nt long DNA (called DNA 252/240) and 315nt and 300nt long DNA (called DNA315/300) as the target long chain. In 252/240, the DNA fragments divided by the first strand (252nt) include: D1-n1 to D1-n11; the DNA fragments divided by the second strand (240nt) include: D1-m1 to D1-m12. In DNA 315/300, the DNA fragments divided by the first strand (315nt) include: D2-n1 to D2-n11; the DNA fragments divided by the second strand (300nt) include: D2-m1 to D2-m10 . The specific selection of the aforementioned sequences is shown in Table 2.

The specific sequences of the DNA short chains used are shown in the following table:

Table 2. Sequence information for short DNA strands used to prepare assemblies

sequence name	sequence information	nt	SEQ ID NO
D1-n1	ATGAGTAAAGGA	12	SEQ ID NO: 10
D1-n2	GAAGAACTTTTCACTGGAGTTGTC	twenty four	SEQ ID NO: 11
D1-n3	CCAATTCTTGTTGAATTAGATGGT	twenty four	SEQ ID NO: 12
D1-n4	GATGTTAATGGGCACAAATTTTCT	twenty four	SEQ ID NO: 13
D1-n5	GTCAGTGGAGAGGGTGAAGGTGAT	twenty four	SEQ ID NO: 14
D1-n6	GCAACATACGGAAAACTTACCCTT	twenty four	SEQ ID NO: 15
D1-n7	AAATTATTTGCACTACTGGAAAA	twenty four	SEQ ID NO: 16
D1-n8	CTACCTGTTCCATGGCCAACACTT	twenty four	SEQ ID NO: 17
D1-n9	GTCACTACTTTCGGTTATGGTGTT	twenty four	SEQ ID NO: 18
D1-n10	CAATGCTTTGCGAGATACCCAGAT	twenty four	SEQ ID NO: 19
D1-n11	CATATGAAACAGCATGACTTTTTC	twenty four	SEQ ID NO: 20
D1-m10	CTGTTTCATATGATCTGGGTATCT	twenty four	SEQ ID NO: 21
D1-m9	CGCAAAGCATTGAACACCATAACC	twenty four	SEQ ID NO: 22
D1-m8	GAAAGTAGTGACAAGTGTTGGCCA	twenty four	SEQ ID NO: 23
D1-m7	TGGAAACAGGTAGTTTTCCAGTAGT	twenty four	SEQ ID NO: 24
D1-m6	GCAATAAATTTAAGGGTAAGTTT	twenty four	SEQ ID NO: 25
D1-m5	TCCGTATGTTGCATCACCTTCACC	twenty four	SEQ ID NO: 26
D1-m4	CTCTCCACTGACAGAAAATTTGT	twenty three	SEQ ID NO: 27
D1-m3	GCCCATTAACATCACCATCTAATTC	25	SEQ ID NO: 28
D1-m2	AACAAGAATTGGGACAACTCCAGT	twenty four	SEQ ID NO: 29
D1-m1	GAAAAGTTCTTCTCCTTTACTCAT	twenty four	SEQ ID NO: 30
D2-n1	ATGAGTAAAGGAGAA	15	SEQ ID NO: 31
D2-n2	GAACTTTTCACTGGAGTTGTCCCAATTCTT	30	SEQ ID NO: 32
D2-n3	GTTGAATTAGATGGTGATGTTAATGGGCAC	30	SEQ ID NO: 33
D2-n4	AAATTTTCTGTCAGTGGAGAGGGGTGAAGGT	30	SEQ ID NO: 34
D2-n5	GATGCAACATACGGAAAACTTACCCTTAAA	30	SEQ ID NO: 35
D2-n6	TTTATTTGCACTACTGGAAAACTACCTGTT	30	SEQ ID NO: 36
D2-n7	CCATGGCCAACACTTGTCACTACTTTCGGT	30	SEQ ID NO: 37
D2-n8	TATGGTGTTCAATGCTTTGCGAGATACCCA	30	SEQ ID NO: 38

D2-n9	GATCATATGAAACAGCATGACTTTTTCAAG	30	SEQ ID NO: 39
D2-n10	AGTGCCATGCCTGAAGGTTATGTACAGGAA	30	SEQ ID NO: 40
D2-n11	AGAACTATATTTTTCAAAGATGACGGGAAC	30	SEQ ID NO: 41
D2-m10	GAAAAATATAGTTCTTTCCTGTACATAACC	30	SEQ ID NO: 42
D2-m9	TTCAGGCATGGCACTCTTGAAAAAGTCATG	30	SEQ ID NO: 43
D2-m8	CTGTTTCATATGATCTGGGTATCTCGCAAA	30	SEQ ID NO: 44
D2-m7	GCATTGAACACCATAACCGAAAGTAGTGAC	30	SEQ ID NO: 45
D2-m6	AAGTGTTGGCCATGGAACAGGTAGTTTTCC	30	SEQ ID NO: 46
D2-m5	AGTAGTGCAATAAATTTAAGGGTAAGTTT	30	SEQ ID NO: 47
D2-m4	TCCGTATGTTGCATCACCTTCACCCTCTCC	30	SEQ ID NO: 58
D2-m3	ACTGACAGAAAATTTGTGCCCATTAACATC	30	SEQ ID NO: 49
D2-m2	ACCATCTAATTCAACAAGAATTGGGACAAC	30	SEQ ID NO: 50
D2-m1	TCCAGTGAAAAGTTCTTCTCCTTTACTCAT	30	SEQ ID NO: 51

(2) The assembly of double-stranded DNA was synthesized by the method shown in Example 1.

The assembly result is shown in Fig. 6, wherein Fig. 6a shows the characterization result of non-denaturing polyacrylamide gel electrophoresis, and Fig. 6b shows the characterization result of the fragment analyzer. It can be seen from Figure 6 that using this method, DNA252/240 and DNA315/300 can be efficiently assembled in one pot, which provides a guarantee for the subsequent synthesis of long sequences.

The above-mentioned embodiments of the present disclosure are only examples for clearly illustrating the present disclosure, and are not intended to limit the embodiments of the present disclosure. For those of ordinary skill in the art, changes or modifications in other different forms can also be made on the basis of the above description. There is no need and cannot be exhaustive of all implementations here. Any modifications, equivalent replacements and improvements made within the spirit and principles of the present disclosure should be included within the protection scope of the claims of the present disclosure.

Claims (16)

1. A method for preparing long-chain DNA, comprising the following steps:

   Synthesis step: synthesizing the first-strand DNA fragment group and the second-strand DNA fragment group, the first-strand DNA fragment group including DNA fragment n _i and DNA fragment n _i+1 , the second-strand DNA fragment group The group includes DNA fragment m _i ; i is selected from a positive integer of 1 or more; wherein, the 5'-end sequence of the DNA fragment _mi and the 5'-end sequence of the DNA fragment n _{i +1} are complementary sequences, and the 3' end sequence of the DNA fragment mi The end sequence and the 3' end sequence of the DNA fragment n _i are complementary sequences;

   Annealing step: mixing the DNA fragment group of the first strand and the DNA fragment group of the second strand in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein, the first strand is adjacent to There is a connection port between two DNA fragments of The junctions with the adjacent DNA fragments in the DNA fragment group of the second strand are staggered from each other;

   Connecting step: connecting the junction of any single-stranded DNA in the first strand and the second strand to obtain a double-stranded DNA assembly formed by the complementation of the continuous single-stranded DNA and the fragmented single-stranded DNA.
2. The method for preparing long-chain DNA according to claim 1, wherein, further comprising the steps of:

   Denaturation step: denaturation of the double-stranded DNA assembly to obtain continuous single-stranded DNA;

   Optionally, the method further includes a purification step: purifying the continuous single-stranded DNA from the reaction system.
3. The method for preparing long-chain DNA according to claim 1 or 2, wherein,

   The 3'-end sequence of the DNA fragment n _i+1 and the 3'-end sequence of the other DNA fragments of the second strand are complementary sequences;

   Optionally, the sequence at the 3' end of the DNA fragment n _i+1 and the sequence at the 3' end of the DNA fragment m _i+1 are complementary sequences, and the sequence at the 5' end of the DNA fragment m _i+1 is the same as the sequence at the 3' end of the DNA fragment m i+1. The other DNA fragments of the set of DNA fragments of one strand are either complementary sequences or unpaired sequences.
4. The method for preparing long-chain DNA according to any one of claims 1-3, wherein the length of the continuous single-stranded DNA is 60 nt or more, preferably 60-1000 nt.
5. The method for preparing long-chain DNA according to any one of claims 1-4, wherein the length of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group is 8- 120nt, preferably 10-80nt, more preferably 15-40nt, most preferably 20-30nt.
6. The method for preparing long-chain DNA according to any one of claims 1 to 5, wherein the 5'-end sequence of any DNA fragment in the first-strand DNA fragment group and the second-strand DNA fragment group The length is 4nt or more, preferably 4-50nt, more preferably 6-30nt, most preferably 10-20nt; or,

   The length of the 3'-end sequence of any DNA fragment in the DNA fragment group of the first strand and the DNA fragment group of the second strand is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, most preferably 10- 20nt.
7. The method for preparing long-chain DNA according to any one of claims 1-6, wherein any DNA fragment in the first-strand DNA fragment group comprises a phosphate group at the 5' end, and a phosphate group at the 3' end In the connecting step, the phosphoric acid groups and hydroxyl groups on both sides of the connecting port are connected as phosphodiester bonds;

   Optionally, adjacent phosphate groups and hydroxyl groups in the first strand are linked as phosphodiester bonds by enzymatic or chemical linkage.
8. The method for preparing long-chain DNA according to any one of claims 1 to 6, wherein any DNA fragment in the DNA fragment group of the second strand comprises a phosphate group at the 5' end, and a phosphate group at the 3' end In the connecting step, the phosphoric acid groups and hydroxyl groups on both sides of the connecting port are connected as phosphodiester bonds;

   Optionally, adjacent phosphate groups and hydroxyl groups in the second strand are linked as phosphodiester bonds by enzymatic or chemical linkage.
9. The method for preparing long-chain DNA according to any one of claims 1 to 8, wherein one or more of any DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group comprising a modified base at the position, and the base at the position immediately adjacent to the junction is an unmodified base;

   Optionally, the modification is selected from m ⁶ A, Ψ, m ¹ A, m ⁵ A, ms ² i ⁶ A, i ⁶ A, m ³ C, m ⁵ C, ac ⁴ C, m ⁷ G, m 2 ,2G, ^m2G , ^m1G , Q, ^m5U , ^mcm5U , ^ncm5U , ^ncm5Um , D, ^mcm5s2U , ^Inosine (I), ^hm5C , ^s4U , s ² U, azobenzene, Cm, Um, Gm, t ⁶ A, yW, ms ² t ⁶ A or derivatives thereof.
10. The method for preparing long-chain DNA according to any one of claims 1 to 9, wherein one or more of any DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group comprising modified deoxyribose at the position, and the deoxyribose at the position immediately adjacent to the junction is unmodified deoxyribose;

    Optionally, the modification is selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F or 2'-OBn (2'-O-benzyl group) or derivatives thereof.
11. The method for preparing long-chain DNA according to any one of claims 1 to 10, wherein one or more of any DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group comprising a modified phosphodiester bond at the position, and the phosphodiester bond at the position immediately adjacent to the connecting port is an unmodified phosphodiester bond;

    Optionally, the modification is selected from phosphorothioate (PS).
12. The method for preparing long-chain DNA according to any one of claims 1-11, wherein, in the annealing step, after incubating the DNA fragment group of the first strand and the DNA fragment group of the second strand, Cooling to form an assembly precursor of double-stranded DNA;

    Optionally, the incubation temperature is any temperature of 0-100°C, preferably any temperature of 10-85°C, more preferably any temperature of 20-65°C.
13. The method for preparing long-chain DNA according to any one of claims 1-12, wherein, in the annealing step, the first-strand DNA fragment group and the second-strand DNA fragment group are dissolved in the same solvent to obtain the reaction system.
14. The method for preparing long-chain DNA according to claim 13, wherein the pH of the reaction system is 3-11, preferably pH 4-10, more preferably pH 5-9, most preferably pH 6-8.
15. The method for preparing long-chain DNA according to claim 13 or 14, wherein, in the reaction system, the molar ratio of any two DNA fragments in the first-strand DNA fragment group and the second-strand DNA fragment group It is 1:(0.1-10), preferably 1:(0.5-1), most preferably 1:1.
16. A long-chain DNA, wherein the long-chain DNA is prepared by the method of any one of claims 1-15, and the long-chain DNA is a single-stranded long-chain DNA;

    Preferably, the long strand of DNA comprises modified base, ribose or phosphodiester linkages at one or more positions.

Images