WO2022163959A1 - Utilisation du zbtb16 dans une maladie dégénérative du cerveau - Google Patents

Utilisation du zbtb16 dans une maladie dégénérative du cerveau Download PDF

Info

Publication number
WO2022163959A1
WO2022163959A1 PCT/KR2021/010056 KR2021010056W WO2022163959A1 WO 2022163959 A1 WO2022163959 A1 WO 2022163959A1 KR 2021010056 W KR2021010056 W KR 2021010056W WO 2022163959 A1 WO2022163959 A1 WO 2022163959A1
Authority
WO
WIPO (PCT)
Prior art keywords
zbtb16
protein
degenerative brain
brain disease
dementia
Prior art date
Application number
PCT/KR2021/010056
Other languages
English (en)
Korean (ko)
Inventor
임혜인
이상준
최지은
Original Assignee
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210061297A external-priority patent/KR102583540B1/ko
Application filed by 한국과학기술연구원 filed Critical 한국과학기술연구원
Publication of WO2022163959A1 publication Critical patent/WO2022163959A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention is capable of diagnosing degenerative brain disease through Zinc finger and BTB domain-containing protein 16 (ZBTB16). It relates to a kit, a method for providing information necessary for diagnosis of degenerative brain disease, a pharmaceutical composition for treating or preventing degenerative brain disease, and a method for screening a substance capable of preventing or treating degenerative brain disease.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • Degenerative brain disease is a disease that occurs in the brain as we age. Due to unknown causes, a specific group of brain cells in the brain gradually loses its function, death of cranial nerve cells, which is the most important for information transmission in the cranial nervous system, and problems with the shape or function of the synapse that transmits information between cranial nerve cells and cranial nerve cells Or it is known to be caused by an ideal increase or decrease in electrical activity of cranial nerves.
  • Patent Document 1 Korean Patent Publication No. 10-2012-0004965
  • the present invention has been devised to solve the above problems, and an object of the present invention is to provide a biomarker composition for diagnosing degenerative brain disease.
  • Another object of the present invention is to provide a composition for diagnosing degenerative brain disease and a kit for diagnosing degenerative brain disease.
  • Another object of the present invention is to provide a method for providing information necessary for diagnosing degenerative brain disease.
  • Another object of the present invention is to provide a screening method for a therapeutic substance for degenerative brain disease.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative brain disease.
  • the present invention provides a biomarker composition for diagnosing degenerative brain disease, which includes a Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding the same as an active ingredient.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the ZBTB16 protein may be represented by the amino acid sequence of SEQ ID NO: 1.
  • the present invention provides a composition for diagnosing degenerative brain disease comprising, as an active ingredient, an agent capable of measuring the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or a gene encoding the same. do.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the agent for measuring the gene expression level is at least one selected from the group consisting of a probe, primer and antisense oligonucleotide that specifically binds to a gene encoding the ZBTB16 protein, and the agent for measuring the protein expression level is the ZBTB16 It may be any one or more selected from the group consisting of an antibody, peptide, aptamer, and compound that specifically binds to a protein.
  • the ZBTB16 protein may be represented by the amino acid sequence of SEQ ID NO: 1.
  • the present invention provides a kit for diagnosing degenerative brain disease comprising a composition in order to achieve the above another object.
  • the present invention provides a method for providing information necessary for diagnosing degenerative brain disease, comprising the following steps.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the method may further include measuring the expression levels of LC3 and p62 proteins from the biological sample of the subject.
  • the present invention comprises the steps of: a) treating a candidate material in a sample isolated from an animal or patient with degenerative brain disease; b) measuring the expression level of the ZBTB16 protein or a gene encoding the same in the candidate material treatment group; And c) when the expression level of the ZBTB16 protein or the gene encoding it measured in the above step is lower than that of the candidate material non-treated group (control group), selecting a degenerative brain disease treatment material; A screening method is provided.
  • the ZBTB16 protein may be represented by the amino acid sequence of SEQ ID NO: 1.
  • Measurement of the expression level is a polymerase reaction (PCR), quantitative polymerase reaction (qPCR), reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (competitive RT-PCR), quantitative real-time polymerase reaction (qRT) -PCR), real time reverse transcription polymerase reaction (real time RT-PCR), RNase protection assay, Northern blot analysis (northern blot analysis), and measurement using any one method selected from the group consisting of DNA chip analysis. have.
  • the method may further include measuring the expression levels of LC3 and p62 proteins in the serum of the candidate substance-treated group.
  • the step of determining the candidate substance as a degenerative brain disease treatment material is more may include
  • the present invention provides a pharmaceutical composition for preventing or treating degenerative brain disease, comprising as an active ingredient an agent capable of inhibiting the expression or activity of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein do.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the agent capable of inhibiting the expression is siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, which specifically binds to the mRNA of the gene encoding the ZBTB16 protein. It is characterized in that it contains any one or more selected from the group consisting of peptide nucleic acids (PNA) and antisense oligonucleotides, and the agent capable of inhibiting the activity is a compound capable of specifically binding to ZBTB16 protein, a peptide, It may include any one or more selected from the group consisting of aptamers, proteins and antibodies.
  • PNA peptide nucleic acids
  • ribozyme DNAzyme
  • the shRNA is a recombinant adenovirus, adeno-associated viruses (AAV), retrovirus, lentivirus, herpes simplex virus, basinia virus, liposomes and niosomes in any one carrier selected from the group consisting of may be transmitted by
  • the shRNA may be any one or more selected from the group consisting of a nucleotide sequence represented by SEQ ID NO: 7, a nucleotide sequence represented by SEQ ID NO: 8, a nucleotide sequence represented by SEQ ID NO: 9, and a nucleotide sequence represented by SEQ ID NO: 10.
  • the degenerative brain disease includes Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, It may be any one or more selected from the group consisting of Down's syndrome and Huntington's disease.
  • the composition may improve, prevent or treat Behavioral and Psychological Symptoms of Dementia (BPSD) caused by degenerative brain diseases.
  • BPSD Behavioral and Psychological Symptoms of Dementia
  • BPSD Behavioral and Psychological Symptoms of Dementia
  • delusions include delusions, hallucinations, agitation, aggression, activity disturbances, depression, and anxiety.
  • diurnal rhythm disturbances include elation, irritability, lability, affective lability, defective self regulation, abnormal repetitive behavior ( aberrant motor behavior), anxiety and fear (anxiety and phobias), and may be any one or more selected from the group consisting of sleep disorders.
  • a biomarker composition for diagnosing degenerative brain disease comprising Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding the same as an active ingredient, wherein ZBTB16 in the brain striatum of an animal model of degenerative brain disease
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • FIG. 1 is a diagram showing the positions of the dorsal striatum and the nucleus accumbens (NAc) in the brain tissue (Brain) separated from the control group (WT) and the dementia animal model (APPPS1).
  • Figure 2 is a control (WT) and dementia animal model (APPPS1) from the brain tissue (Brain) from the dorsal striatum (dorsal striatum) and the nucleus accumbens (nucleus accumbens, NAc) from the ZBTB16 protein expression was measured by immunohistochemistry. is the result
  • FIG 3 is a graph showing the Y-maze test (YMT) results for the control group (WT+GFP), the dementia animal model (APPPS1+GFP), and the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16).
  • FIG. 4 is a graph showing the results of a novel object recognition test (NOR) for a control group (WT+GFP), an animal model of dementia (APPPS1+GFP), and an animal model of ZBTB16 knockdown dementia (APPPS1+shZbtb16).
  • NOR novel object recognition test
  • FIG. 5 is a view showing the 3-chamber test (3CT) results of the animal model of dementia (APPPS1 + GFP), the animal model of ZBTB16 knockdown dementia (APPPS1 + shZbtb16) and the control (WT + GFP) prepared according to the present invention
  • FIG. 5a is an inanimate object (0) and a living mouse (S1) of the animal model of dementia (APPPS1+GFP), ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) and control (WT+GFP) prepared according to the present invention.
  • Figure 2b is a familiar mouse (S1) and a new animal model (APPPS1 + GFP), ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16) and control (WT + GFP) prepared according to the present invention. It is a diagram showing the degree of interest in the mouse (S2).
  • FIG. 6 is a diagram showing the results of the elevated cross maze experiment (EMP) of the dementia animal model (APPPS1 + GFP), the ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16) and the control group (WT + GFP) prepared according to the present invention.
  • EMP elevated cross maze experiment
  • LLB light-dark shift test
  • FIG. 9 is a result of measuring the expression levels of LC3, p62 from the dorsal striatum in brain tissue isolated from the ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16) prepared according to the present invention by immunohistochemistry.
  • GFP green fluorescent protein
  • 11 is a result of measuring the expression levels of ZBTB16 and p62 from dorsal striatum in brain tissue isolated from a 12-month-old normal animal model (WT+GFP (12mo)) by immunohistochemistry.
  • FIG. 13 is a result of measuring the expression levels of ZBTB16 and p62 from dorsal striatum in brain tissue isolated from a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16(12mo)) by immunohistochemistry.
  • Figure 14a is a 12-month-old dementia animal model (APPPS1 + GFP) prepared according to the present invention, a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16), and a 12-month-old control (WT + GFP) inanimate object (0) and living It is a diagram showing the degree of interest (3CT:sociability) for the mouse (S1).
  • 14B shows familiar mice (S1) and new animals of a 12-month-old dementia animal model (APPPS1+GFP), a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) and a 12-month-old control group (WT+GFP) prepared according to the present invention. It is a diagram showing the degree of interest (3CT: novelty) for the mouse (S2).
  • FIG. 15 is a Y-maze of a 12-month-old normal animal model (control group (WT+GFP)) and a 12-month-old dementia animal model (APPPS1+GFP) and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to the present invention.
  • WT+GFP control group
  • APPPS1+GFP 12-month-old dementia animal model
  • APPPS1+shZbtb16 12-month-old ZBTB16 knockdown dementia animal model
  • the present inventors have identified the interaction between degenerative brain disease and ZBTB16, and based on this, the present invention has been completed.
  • One aspect of the present invention relates to a biomarker composition for diagnosing degenerative brain disease, which includes Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding the same as an active ingredient.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the biomarker composition may further include p62 and LC3, which are known autophagosome biomarkers.
  • the LC3 protein is LC3 II (mitrotubule-associated protein light chain 3), and p62 is Sequestosome 1 and SQSTM1.
  • 'Zinc finger and BTB domain-containing protein 16 (ZBTB16)' is a protein encoding the ZBTB16 gene.
  • the gene is one of the Krueppel C2H2 type zinc-finger protein members, and encodes a zinc finger transcription factor including nine Kruppel-type zinc finger domains at the carbosil end.
  • the protein is located in the nucleus, is involved in cell cycle progression, and is known to interact with Histone Deacetylase (HDAC).
  • HDAC Histone Deacetylase
  • amino acid sequence of ZBTB16 may be represented by SEQ ID NO: 1 registered on uniprot.org. In this case, it may include an amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 1. .
  • nucleotide sequence of the gene encoding the ZBTB16 is registered at ncbi.nlm.nih.gov. More specifically, it can be found in In this case, it may include an amino acid sequence having a sequence homology of 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more to the nucleotide sequence represented by SEQ ID NO: 2 .
  • 'degenerative brain disease' is a disease that causes various symptoms as degenerative changes appear in nerve cells of the central nervous system.
  • the disease continues to progress over many years or decades until death, and there is often a family history.
  • Specific examples of the degenerative brain disease of the present invention are not limited thereto, but Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, Down's syndrome, Huntington's disease, amyotrophic lateral sclerosis, Spinocerebellar Atrophy, Tourette's syndrome s Syndrome, Friedrich's Ataxia, Machado-Joseph's disease, Lewy Body Dementia, Dystonia and Progressive Supranuclear Palsy ) may be any one or more selected from the group consisting of.
  • the degenerative brain disease may be more preferably a degenerative brain disease induced by beta-amyloid accumulation, and even more preferably dementia.
  • the dementia is not particularly limited, and for example, Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, Parkinson's disease ), mild cognitive impairment, Down's syndrome and Huntington's disease may be any one or more selected from the group consisting of.
  • the present invention can diagnose early degenerative brain disease or dementia in which the core symptoms of dementia or degenerative brain disease such as cognitive impairment do not appear.
  • the early degenerative brain disease or dementia may include delusions, hallucinations, agitation, aggression, activity disturbances, depression, anxiety, Diurnal rhythm disturbances, elation, irritability, lability, affective lability, defective self regulation, aberrant motor behavior , including those with only one or more mental and behavioral disorders selected from the group consisting of anxiety and phobias and sleep disorders.
  • 'diagnosis' in a broad sense means judging the actual condition of a patient's disease in all aspects.
  • the content of the judgment is the disease name, etiology, disease type, severity, detailed mode of the disease, presence or absence of complications, and prognosis.
  • to determine the susceptibility of an object to a particular disease or condition to determine whether an object currently has a particular disease or disorder, or to determine the prognosis of an object with a particular disease or condition or therametrics (eg, monitoring the condition of an object to provide information about treatment efficacy).
  • 'prognosis' means a prospect for future symptoms or progress determined by diagnosing a disease.
  • the prognosis usually refers to the mode of degenerative brain disease within a certain period of time after the onset or treatment of the degenerative brain disease, the development of mental and behavioral symptoms, or the survival period.
  • the prediction of prognosis is very important as it provides clues about the future direction of treatment for degenerative brain disease, especially for patients with degenerative brain disease.
  • a 'biomarker' refers to an indicator that can detect changes in the body using proteins, DNA, RNA (Reebok nucleic acid), metabolites, and the like.
  • ZBTB16 can be used as a biomarker for diagnosing or early diagnosis of degenerative brain disease. That is, if the expression level of the ZBTB16 protein or a gene encoding it is measured, it is possible to provide information necessary for the diagnosis of degenerative brain disease.
  • "expression” means that a protein or nucleic acid is produced in a cell.
  • 'Protein' is used interchangeably with 'polypeptide' or 'peptide' and refers to, for example, a polymer of amino acid residues as commonly found in proteins in their natural state.
  • 'Polynucleotide' or 'nucleic acid' refers to deoxyribonucleotides (DNA) or ribonucleotides (RNA) in single- or double-stranded form. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner analogous to naturally occurring nucleotides are also included.
  • 'mRNA' refers to RNA that transfers genetic information (gene-specific nucleotide sequence) to ribosomes that specify an amino acid sequence from a specific gene during protein synthesis.
  • Another aspect of the present invention relates to a composition for diagnosing degenerative brain disease, comprising as an active ingredient an agent capable of measuring the expression level of Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding the same.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the agent for measuring the gene expression level may be any one or more selected from the group consisting of a probe, primer, and antisense oligonucleotide that specifically binds to a gene encoding the ZBTB16 protein.
  • the agent for measuring the protein expression level may be any one or more selected from the group consisting of an antibody, peptide, aptamer, and compound that specifically binds to the ZBTB16 protein.
  • 'probe' refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases in length that can specifically bind to mRNA, and is labeled so that the presence or absence of a specific mRNA, the amount of expression can confirm.
  • the probe may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, or the like. Suitable probe selection and hybridization conditions may be appropriately selected according to techniques known in the art.
  • a 'primer' is a nucleic acid sequence having a short free 3' hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for template strand copying. say sequence.
  • the primer is capable of initiating DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.
  • a reagent for polymerization ie, DNA polymerase or reverse transcriptase
  • PCR conditions and lengths of sense and antisense primers may be appropriately selected according to techniques known in the art.
  • the primer or probe may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods.
  • the primer or probe can be variously modified according to methods known in the art within the range that does not interfere with hybridization with ZBTB16 mRNA. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc. ) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.), and fluorescence or enzymatic binding of a labeling material.
  • 'antibody' is a term known in the art and refers to a specific immunoglobulin directed to an antigenic site.
  • the antibody in the present invention refers to an antibody that specifically binds to ZBTB16 of the present invention, and the antibody can be prepared according to a conventional method in the art.
  • the form of the antibody includes polyclonal antibodies or monoclonal antibodies, and all immunoglobulin antibodies are included.
  • the antibody refers to a complete form having two full-length light chains and two full-length heavy chains.
  • the said antibody also includes special antibodies, such as a humanized antibody.
  • the 'peptide' has an advantage of high binding strength to the target material, and no denaturation occurs even during heat/chemical treatment.
  • the molecular size is small, it can be used as a fusion protein by attaching it to other proteins. Specifically, since it can be used by attaching it to a polymer protein chain, it can be used as a diagnostic kit and drug delivery material.
  • 'aptamer' refers to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) having a stable tertiary structure as a substance capable of specifically binding to an analyte to be detected in a sample, Specifically, the presence of the target protein in the sample may be confirmed.
  • the aptamer is synthesized by determining the sequence of an oligonucleotide having a selective and high binding affinity to the target protein (ZBTB16 protein in the present invention) to be confirmed, and then 5' of the oligonucleotide.
  • -SH, -COOH, -OH or NH 2 It may be made by modifying it, but is not limited thereto.
  • the gene of the present invention has a nucleic acid sequence registered in the gene bank, a person skilled in the art can design an antisense oligonucleotide, primer pair or probe that specifically amplifies a specific region of these genes based on the sequence.
  • the diagnostic composition of the present invention comprising the ZBTB16 protein-specific agent may additionally include an agent necessary for a method for detecting a known protein, and the method for detecting a known protein using the composition can be used without limitation.
  • the expression level of ZBTB16 protein in the sample can be measured.
  • kits for diagnosing degenerative brain disease including Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding the same as an active ingredient.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the kit includes an antibody that specifically binds to a marker component, a secondary antibody conjugate to which a label that develops color by reaction with a substrate is conjugated, a color-developing substrate solution to react with the label, a washing solution and an enzyme reaction stop solution and the like, and may be manufactured as a plurality of separate packaging or compartments containing the reagent components used.
  • the diagnostic kit may be a diagnostic kit comprising essential elements necessary for performing a reverse transcription polymerase reaction.
  • the reverse transcription polymerase reaction kit includes each primer pair specific for a marker gene.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and has a length of about 7 bp to 50 bp, more preferably about 10 bp to 30 bp. It may also include a primer specific for the nucleic acid sequence of the control gene.
  • reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC -Water (DEPC-water), sterile water, etc. may be included.
  • the DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescent probe.
  • the substrate may also contain cDNA or oligonucleotides corresponding to control genes or fragments thereof.
  • Samples used for analysis include blood, blood cells, brain tissue, nerve cells, cerebrospinal fluid, saliva, nasal fluid, sputum, capsular fluid, amniotic fluid, ascites, cervical or vaginal secretions, and urine degenerative brain diseases that can be distinguished from normal conditions. It includes a biological sample capable of identifying a specific protein associated with it. Preferably, it can be measured from a biological sample, for example, any one sample selected from the group consisting of blood, blood cells, brain tissue, nerve cells, and cerebrospinal fluid. The sample may be prepared to increase the detection sensitivity of the protein marker.
  • a serum sample obtained from a patient may be subjected to anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, It may be pre-treated using a method such as sequential extraction or gel electrophoresis.
  • Another aspect of the present invention relates to a method for providing information necessary for diagnosing degenerative brain disease, comprising the following steps.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • a biological sample is separated from a subject, and the expression level of a zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding the same is measured from the biological sample.
  • ZBTB16 zinc finger and BTB domain-containing protein 16
  • the term 'subject' refers to any single entity that is suspected of degenerative brain disease, including humans, cows, dogs, guinea pigs, rabbits, chickens, insects, mice, mice, and the like, and requires a diagnosis of degenerative brain disease. do. Also included in the subject are any subjects participating in a clinical study trial without any clinical findings of degenerative brain disease, or subjects participating in epidemiological studies or subjects used as controls. In an embodiment of the present invention, mice or mice were used.
  • the 'subject suspected of degenerative brain disease' has the core symptoms of degenerative brain disease or Behavioral and Psychological Symptoms of Dementia (BPSD) caused by degenerative brain disease, and is expected to have degenerative brain disease may be a target.
  • BPSD is a mental and behavioral disorder that occurs frequently as degenerative brain disease, especially dementia, progresses from moderate to severe. activity disturbances, depression, anxiety, diurnal rhythm disturbances, elation, irritability, lability, affective lability, deficits in self-regulation (defective self regulation), abnormal motor behavior (aberrant motor behavior), anxiety and fear (anxiety and phobias) and includes any one or more selected from the group consisting of sleep disorders.
  • the 'biological sample' may be used without limitation as long as it is collected from a subject to be diagnosed with degenerative brain disease, for example, blood, blood cells, brain tissue, nerve cells, cerebrospinal fluid, saliva, nasal fluid, sputum, joint capsule fluid, It may be any one selected from the group consisting of amniotic fluid, ascites, cervical or vaginal secretions and urine, but is not particularly limited thereto, and is preferably selected from the group consisting of blood, blood cells, brain tissue, nerve cells, and cerebrospinal fluid. It may be any one sample.
  • 'measurement' may preferably mean 'analysis', which means 'qualitative analysis', which means measuring and confirming the presence of a target substance, or the presence level (expression level) of a target substance. Or it may mean 'quantitative analysis' that measures and confirms the change in quantity.
  • the measurement may be performed including both a qualitative method and a quantitative method, and preferably, a quantitative measurement may be performed.
  • the sample may be pretreated prior to use for detection or diagnosis.
  • it may include homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like.
  • the protein expression level measurement is not particularly limited as long as it is by a protein expression measurement method known in the art, but for example, Western blot, ELISA, radioimmunoassay, radioimmunodiffusion method, Ouchterlony immune diffusion method (Ouchterlony). immunodiffusion), rocket immunoelectrophoresis, immunostaining, immunoprecipitation, complement fixation, FACS, and protein chip.
  • the gene expression level measurement is not particularly limited as long as it is a gene expression measurement method known in the art, but preferably a polymerase reaction (PCR), a quantitative polymerase reaction (qPCR), a reverse transcription polymerase reaction (RT-PCR), competitive Reverse transcription polymerase reaction (competitive RT-PCR), quantitative real-time polymerase reaction (qRT-PCR), real time reverse transcription polymerase reaction (real time RT-PCR), RNase protection assay, northern blot analysis and DNA chip It may be any one method selected from the group consisting of analysis, and more preferably, quantitative polymerase reaction (qPCR) or northern blot analysis.
  • the expression level of the Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein or a gene encoding it in the subject sample measured by the method of step (1) described above was measured in the same manner as ZBTB16 in the normal control sample. It is compared with the expression level of the protein or the gene encoding it (step (2)).
  • the sample is preferably a sample obtained by the same type or the same method between the subject and the normal control.
  • step (3) when the expression level of the ZBTB16 protein or the gene encoding it is higher than that of the normal control sample, it can be determined or diagnosed as degenerative brain disease (step (3)). Specifically, when the ZBTB16 expression level of the subject sample measured by the above method is increased compared to the sample of a healthy normal control group, it may be determined or diagnosed as having a degenerative brain disease.
  • the expression level of the biomarker (ZBTB16) of the present invention is measured in a biological sample obtained from a subject suspected of degenerative brain disease, and the present invention is obtained from a normal control biological sample obtained by the same type or method. After measuring the expression level of the biomarker (ZBTB16), the two are compared, but when the expression level of the subject is lower than the expression level of the normal control, it can be determined that the subject has degenerative brain disease.
  • Another aspect of the present invention relates to a screening method for a therapeutic substance for degenerative brain disease, comprising the following steps.
  • the term 'animal degenerative brain disease induced' refers to an animal in which various symptoms are induced while degenerative changes appear in nerve cells of the central nervous system, more preferably an animal in which dementia is induced by the accumulation of beta-amyloid, and a human It may be a mammal except for, preferably a mouse, a guinea pig, a pig, a bird, and the like.
  • the 'isolated sample' may be a tissue or cell derived from an animal induced with degenerative brain disease.
  • the sample includes a tissue or a cell thereof capable of detecting the expression level of ZBTB16 in an animal induced with a degenerative brain disease, and preferably a tissue or cell isolated from the brain of an animal induced with a degenerative brain disease.
  • the present invention is not limited thereto.
  • the 'candidate substance' means a substance to be tested for therapeutic activity for degenerative brain disease, and may include any molecule such as extracts, proteins, oligopeptides, small organic molecules, polysaccharides, polynucleotides, and a wide range of compounds. have.
  • the 'candidate material' may be a cell transfected with a liposome or a vector. The transfection may be performed using a microinjection method, a calcium phosphate co-precipitation method, an electroporation method, or a liposome method, but is not limited thereto.
  • the 'candidate untreated group' is also referred to as a control group, which is an animal or a sample separated from degenerative brain disease induced without treatment with a candidate material, and is a degenerative disease belonging to the group treated with the candidate material and in a parallel relationship. It refers to an animal or a sample isolated from the induced brain disease.
  • the 'screening method' may be performed by confirming the expression of ZBTB16, a biomarker of degenerative brain disease, and comparing the candidate substance with an untreated group (control group).
  • the degenerative brain disease may specifically be a degenerative brain disease caused by the accumulation of beta-amyloid.
  • the degenerative brain disease may be dementia, and the dementia includes Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, and Parkinson's. It may be any one or more selected from the group consisting of Parkinson's disease, mild cognitive impairment, Down's syndrome, and Huntington's disease.
  • ZBTB16 expression was significantly higher in the brain tissue of the animal model of dementia compared with the normal animal model, and it was confirmed that there were mental and behavioral disorders in the animal model of dementia. However, it was confirmed that the expression of ZBTB16 was significantly reduced in the knockout animal model in which the expression of ZBTB16 was suppressed from the animal model of dementia, and the expression of mental and behavioral disorders was significantly lower than that of the normal animal model.
  • 'prevention' includes all actions that suppress or delay the onset and symptoms of the degenerative brain disease, and includes prevention of disease recurrence after treatment as well as prevention before disease occurrence.
  • 'treatment' includes all of the treatment of symptoms of the degenerative brain disease, improvement of symptoms, and inhibition of progression of symptoms.
  • the present invention b) measures the expression level of the ZBTB16 protein or a gene encoding it in the candidate substance-treated group, and the expression level of the ZBTB16 protein or the gene encoding it measured in step b) is the candidate substance untreated group (control group) ), it can be selected as a therapeutic substance for degenerative brain disease (step c)).
  • the present invention measures the expression level of ZBTB16 protein or a gene encoding the same in an animal or a sample isolated from degenerative brain disease induced in the absence of a candidate substance capable of preventing or treating the degenerative brain disease (candidate Substance-untreated group), after measuring the expression level of ZBTB16 protein or a gene encoding it in the presence of the candidate substance (candidate substance-treated group) and comparing both, ZBTB16 protein or coding for it when the candidate substance is present
  • a substance that suppresses the expression level of a gene rather than the level in the absence of the candidate substance may be predicted or determined as a substance for preventing or treating degenerative brain disease.
  • 'measurement of expression level' is a process of confirming the expression level of the ZBTB16 protein or a gene encoding the same in an animal or a sample isolated from degenerative brain disease induced in the absence and presence of a candidate substance.
  • the expression level was measured by Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip, polymerase reaction (PCR), quantitative polymerase reaction (qPCR), reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (competitive RT-PCR), quantitative real-time polymerase reaction (qRT- PCR), real-time RT-PCR, RNase protection assay, northern blot analysis, and DNA chip analysis may be any one method selected from the group consisting of.
  • the screening method for a therapeutic substance for degenerative brain disease of the present invention may further include measuring the expression levels of LC3 and p62 proteins in the serum of the candidate substance-treated group.
  • the step of determining the candidate substance as a degenerative brain disease treatment material is more may include
  • 'LC3 and p62' are widely known as marker proteins for autophagy.
  • ZBTB16 expression increases when degenerative brain disease occurs, autophagy is reduced, and autophagy is suppressed, so that the disease protein in the striatum cannot be reduced and accumulate, so it can be seen that degenerative brain disease is induced. Therefore, when ZBTB16 is inhibited in brain tissue during degenerative brain disease, autophagy is activated in the brain, so that the expression level of LC3 increases and the expression level of p62 decreases.
  • ZBTB16 gene of the present invention is increased during degenerative brain disease.
  • LC3 protein which is a biomarker related to autophagy
  • p62 protein was significantly reduced. This means that ZBTB16 protein is not only involved in degenerative brain disease, but also the mechanism of action involved in degenerative brain disease, meaning that it can function as a diagnostic, therapeutic, and screening marker.
  • the candidate material selected through the degenerative brain disease prevention or treatment material screening method may suppress or inactivate the expression level of the ZBTB16 gene when compared to the candidate material untreated group (control group) to which the candidate material is not administered.
  • Another aspect of the present invention relates to a composition or kit for screening a substance for treating degenerative brain disease, comprising as an active ingredient an agent capable of inhibiting the expression or activity of Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • ZBTB16 can function as a screening marker for a therapeutic substance for degenerative brain disease. That is, if the expression level of the ZBTB16 protein or a gene encoding it can be measured, a substance for preventing or treating degenerative brain disease can be screened.
  • Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating degenerative brain disease, comprising an agent capable of inhibiting the expression or activity of Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein as an active ingredient.
  • ZBTB16 Zinc finger and BTB domain-containing protein 16
  • the expression of ZBTB16 may include both mRNA expression of a gene, mRNA expression into protein, and mRNA degradation or protein degradation.
  • the activity of ZBTB16 includes the biological function/activity of the ZBTB16 protein in a cell or tissue.
  • 'activity' refers to a biological action that allows the expressed protein to perform its original function in a cell.
  • 'expression' includes all steps of a process in which a gene is made into a protein in vitro or in a cell, and includes, for example, transcription from gene to mRNA and translation from mRNA to protein.
  • the agent capable of inhibiting the expression of the Zinc finger and BTB domain-containing protein 16 (ZBTB16) protein is an siRNA (small interference RNA) or shRNA (short hairpin RNA) that specifically binds to the mRNA of a gene encoding the ZBTB16 protein.
  • siRNA small interference RNA
  • shRNA short hairpin RNA
  • miRNA miRNA
  • ribozyme ribozyme
  • DNAzyme peptide nucleic acids
  • PNA peptide nucleic acids
  • siRNA small interfering RNA
  • shRNA small hairpin RNA
  • miRNA miRNA
  • RISC RNA Induced Silencing Complex
  • An siRNA, shRNA or miRNA has a sequence that is highly complementary to its target sequence.
  • highly complementary sequence is meant at least about 70% complementarity, at least about 80% complementarity, at least about 90% complementarity, or about 100% complementarity with a sequence of at least contiguous 15 bases in length of the target gene.
  • Antisense oligonucleotides, siRNAs, shRNAs and/or miRNAs targeting the CTRP3 gene according to the present disclosure of various origins may be used as long as they bind to a target nucleic acid and function as a silencing, and bioequivalents, derivatives and analogs thereof will also include Antisense oligonucleotides are short synthetic nucleic acids that are known in the art and inhibit/reduce expression of the target protein, for example by binding to any coding sequence of the target protein.
  • Antisense RNA may have an appropriate length depending on the target gene and delivery method, for example, about 6, 8 or 10 to 40, 60 or 100 nucleotides.
  • shRNA Since the siRNA has to be prepared in vitro and the knockdown gene is typically delivered transiently for 6-10 days, it is preferable to use shRNA.
  • the shRNA is a molecule of about 20 or more bases having a double-stranded structure in the molecule and having a hairpin-like structure in the molecule by including a partially palindromic nucleotide sequence in the single-stranded RNA.
  • the shRNA for inhibiting ZBTB16 expression has a sequence complementary to a part of the ZBTB16 gene, and can degrade the mRNA of the ZBTB16 gene or inhibit translation.
  • the complementarity is 80-90%, the translation of mRNA can be inhibited, and when the complementarity is 100%, the mRNA can be degraded.
  • the shRNA that inhibits ZBTB16 expression is complementary to SEQ ID NO: 3 (GACTGGAGGATAGAGAAGACGTACCTCTA), SEQ ID NO: 4 (AATGGCTGTGGCAAGAAGTTCAGCCTCAA), SEQ ID NO: 5 (GCAAGCCAAGGCGGAGGACCTGGATGACC) and SEQ ID NO: 6 (ATCTCGAAGCATTCCCA complementary to mouse and human common mRNA) It is preferable to include a nucleotide sequence having 100% homology to the sequence.
  • the shRNA relates to an shRNA that inhibits ZBTB16 expression, and may be any one or more of the nucleotide sequences shown in SEQ ID NOs: 7 to 10 below.
  • the shRNA may be a sequence complementary to any one of SEQ ID NOs: 3 to 6 commonly found in mouse and human ZBTB16 mRNA, preferably SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 It may be any one sequence selected from the displayed nucleotide sequences.
  • Each of the nucleotide sequences may be connected palindrome by a loop region of 4 to 10 bp to form a hairpin structure.
  • SEQ ID NO: 7 TAGAGGTACGTCTTCTCTATCCTCCAGTC
  • SEQ ID NO: 8 TTGAGGCTGAACTTCTTGCCACAGCCATT
  • SEQ ID NO: 9 GGTCATCCAGGTCCTCCGCCTTGGCTTGC
  • SEQ ID NO: 10 CCACTCTCCTCGCTGGAATGCTTCGAGAT
  • shRNA short hairpin RNA
  • Substances that inhibit ZBTB16 expression by RNAi may be artificially synthesized chemically, or hairpin-structured DNA in which the DNA sequences of the sense strand and the antisense strand are linked in the reverse direction using T7 RNA polymerase under laboratory conditions (in vitro). It may also be prepared by synthesizing RNA in When synthesizing under laboratory conditions, antisense and sense RNA can be synthesized from template DNA using T7 RNA polymerase and T7 promoter.
  • introduction into cells induces RNAi and suppresses the expression of ZBTB16.
  • the introduction into cells can be performed, for example, by a calcium phosphate method or a method using various transfection reagents (eg, oligofectamine, lipofectamine, lipofection, etc.).
  • an expression vector containing shRNA or the DNA may be used, or cells containing the expression vector may be used.
  • the type of the expression vector or cell is not particularly limited, but an expression vector or cell already used as a medicine is preferable.
  • the vector refers to a means for expressing a target gene in a host cell.
  • the vector includes elements for expression of a target gene, and may include an origin of replication, a promoter, an operator, a transcription termination sequence, and the like, into the genome of a host cell. Appropriate enzymatic sites (eg, restriction enzyme sites) for introduction of and/or ribosome binding sites (RBS) for translation into proteins and/or selectable markers to confirm successful introduction into host cells, IRES (Internal Ribosome Entry Site) and the like may be additionally included.
  • the vector may further include a transcriptional control sequence (eg, enhancer, etc.) other than the promoter.
  • the vector may be a plasmid DNA, a recombinant vector, or other medium known in the art, and specifically, a linear DNA plasmid DNA, a recombinant non-viral vector, a recombinant viral vector, or an inducible gene expression vector system), and the recombinant viral vector is a retrovirus, adenovirus, adeno associated virus, helper-dependent adenovirus, herpes simplex virus ( herpes simplex virus), lentivirus or vaccinia virus vector, but is not limited thereto.
  • the method for introducing the expression vector into a cell is not particularly limited as long as it is a known method, but is preferably liposome-mediated transfection, calcium phosphate method, DEAE-dextran-mediated transfection, positively charged lipid-mediated transtransfection, electroporation, and phage system. It may include any one or more selected from transduction using a virus or an infection method using a virus.
  • the present invention may include the recombinant expression vector for shRNA expression.
  • shRNA having the nucleotide sequence represented by SEQ ID NO: 2 as the target sequence may be used.
  • the recombinant vector is not particularly limited as long as it is a recombinant DNA method known in the art.
  • the shRNA is delivered to any one carrier selected from the group consisting of recombinant adenovirus, adeno-associated viruses (AAV), retrovirus, lentivirus, herpes simplex virus, basinia virus, liposome and niosome. can be transmitted by any one carrier selected from the group consisting of recombinant adenovirus, adeno-associated viruses (AAV), retrovirus, lentivirus, herpes simplex virus, basinia virus, liposome and niosome. can be transmitted by AAV.
  • AAV adeno-associated viruses
  • the agent capable of inhibiting the activity of the ZBTB16 protein may include any one or more selected from the group consisting of compounds, peptides, aptamers, proteins and antibodies capable of specifically binding to the ZBTB16 protein.
  • the substance capable of inhibiting the expression or activity of the ZBTB16 protein may also include a substance for treating degenerative brain disease screened according to the method for screening a substance for treating degenerative brain disease described above.
  • ZBTB16 By inhibiting the expression or activity of ZBTB16 according to the embodiments described herein, it is possible to prevent or treat degenerative brain disease or mental and behavioral disorders resulting therefrom.
  • the pharmaceutical composition may be for preventing or treating degenerative brain disease.
  • the pharmaceutical composition may be provided in any dosage form suitable for topical application.
  • it may be any one route selected from the group consisting of oral administration, transdermally administration, intravenous administration, intramuscular administration, subcutaneous injection and intra-brain administration.
  • composition according to the present invention may be formulated in a suitable form together with a commonly used pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycol, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
  • composition according to the present invention can be used as a suspending agent, solubilizer, stabilizer, isotonic agent, preservative, anti-adsorption agent, surfactant, diluent, excipient, pH adjuster, analgesic agent, buffer, if necessary depending on the administration method or formulation. , antioxidants and the like may be included as appropriate.
  • pharmaceutically acceptable carriers and agents suitable for the present invention including those exemplified above, are described in detail in Remington's Pharmaceutical Sciences, latest edition.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains, or Alternatively, it may be prepared by being introduced into a multi-dose container.
  • the pharmaceutical composition may be administered by any device capable of moving the active ingredient to the target cell.
  • an administration method using a non-invasive catheter may be used.
  • the pharmaceutical composition of the present invention may be included in a therapeutically effective amount for the treatment of diseases.
  • the term 'treatment' means reversing, alleviating, inhibiting the progression, or preventing one or more symptoms of a disease or disease to which the term is applied, unless otherwise stated.
  • the term 'therapeutically effective amount' refers to an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, which is considered by a researcher, veterinarian, doctor or other clinician, which is a therapeutic an amount that induces alleviation of the symptoms of the disease or disorder being used. It is apparent to those skilled in the art that the active ingredient included in the pharmaceutical composition of the present invention will change depending on the effect.
  • the optimal content of the pharmaceutical composition can be easily determined by those skilled in the art, and the type of disease, the severity of the disease, the content of other components contained in the composition, the type of formulation, and the age, weight, general health status, sex and diet of the patient , administration time, administration route and secretion rate of the composition, treatment period, and drugs used at the same time may be adjusted according to various factors.
  • the method is not particularly limited as long as shRNA or shRNA expression vector that suppresses ZBTB16 expression is expressed in the cell to which it is applied.
  • a viral vector liposome
  • animal viruses such as a retrovirus, a vaccinia virus, an adenovirus, and a synrinsemlici virus, are mentioned, for example.
  • Substances that inhibit ZBTB16 expression by RNAi may be directly injected into cells.
  • the dosage of the composition of the present invention is about 1x10 4 particles to 1x10 12 particles per kg of adult as an active ingredient.
  • the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and response sensitivity, and those skilled in the art In consideration of these factors, the dosage may be appropriately adjusted.
  • the number of administration may be one time or two or more within the range of clinically acceptable side effects, and may be administered to one site or two or more sites for the administration site.
  • the dose is the same as that of a human per kg, or the above dose is adjusted, for example, by the volume ratio (for example, the average value) of the ischemic organ (heart, etc.) between the target animal and the human.
  • the converted amount can be administered.
  • the animal to be treated according to the present invention include humans and other target mammals, specifically humans, monkeys, mice, rats, rabbits, sheep, cattle, dogs, goats, horses, pigs, etc. This is included.
  • the pharmaceutical composition of the present invention may contain various diseases or disorders related to degenerative brain diseases, such as Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia ( frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, Down's syndrome, Huntington's disease, amyotrophic lateral sclerosis, spinal cerebellar Spinocerebellar Atrophy, Tourette's Syndrome, Friedrich's Ataxia, Machado-Joseph's disease, Lewy Body Dementia, muscle tone It can be used for the treatment of Dystonia and Progressive Supranuclear Palsy.
  • Alzheimer-type dementia Lewy body dementia
  • frontotemporal dementia frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment
  • Down's syndrome Huntington's disease
  • amyotrophic lateral sclerosis spinal cerebellar Spinocerebellar Atrophy
  • Tourette's Syndrome Friedrich's Ataxia
  • treatment refers to (i) alleviating or suppressing symptoms of degenerative brain disease; (ii) alleviating or alleviating mental and behavioral disorders caused by degenerative brain disease; and (iii) inhibition of degenerative brain disease by promoting autophagy of disease proteins related to degenerative brain disease.
  • therapeutically effective amount refers to an amount sufficient to achieve the aforementioned pharmacological effect.
  • APP/PS1 mice were prepared for use as experimental animals.
  • the APP/PS1 mouse is a representative Alzheimer's dementia animal model genetically mutated to overproduce beta amyloid (A ⁇ , ⁇ amyloid).
  • a ⁇ beta amyloid
  • This is APPswe/PSEN1dE9(line 85)(The Jackson Lab; available through the JAX MMRRC Stock# 034829(formerly Jackson Lab Stock #004462))(https://www.alzforum.org/research-models/appswepsen1de9-line-85) ) line, and was provided by the KIST Research Animal Resource Center, which maintains and sells it.
  • control group WT+GFP
  • a ⁇ , ⁇ amyloid a control group that was not genetically mutated to overproduce beta amyloid
  • pGFP-C-shLenti-Zbtb16 shRNA vector (ORIGENE) expressing shRNA (SEQ ID NO: 7: 5'-TAGAGGTACGTCTTTCCTATCCTCCAGTC-3') against the gene (SEQ ID NO: 2) of Zbtb16 from ORIGENE (USA) and a specific portion as a negative control
  • a pGFP-C-shLenti-non-targeting shRNA control vector TR30021 expressing shRNA with a random sequence was purchased.
  • a lentivirus expressing Zbtb16 shRNA or control shRNA was prepared using the vector, third-generation packaging system (pMDLg/pRRE, pRSV-Rev, pMD2.G) and HEK293 T cell line according to the manufacturer's manual.
  • HEK293T cell cultures containing lentivirus were concentrated by ultracentrifugation at 50,000 g at 4° C. for 90 minutes. Thereafter, the lentivirus concentrate was titrated using a Lenti-XTM p24 Rapid Titer Kit (clontech, USA).
  • ZBTB16 protein knockdown dementia animal model (APPPS1 + shZtbt16) was prepared by breeding for 1 month (6 months old), control group (WT + GFP) for comparative experiments, and dementia animal model (APPPS1 + GFP) were also bred for 1 month under the same conditions. prepared (6 months old).
  • the animal model was allowed to freely ingest drinking water and feed under conditions of 12 hours of light and 12 hours of shade in a kennel capable of constant temperature and constant humidity.
  • a control group (WT+GFP) and an animal model of dementia (APPPS1+GFP) were prepared, and the experiment was performed at the age of 6 months by breeding for 1 month as in the ZBTB16 protein knockdown dementia animal model. They were randomly assigned to 8 subjects each.
  • immunohistochemistry evaluation was performed.
  • the control group (WT) and the dementia animal model (APPPS1) were anesthetized and perfused, respectively, and brains were removed and brain tissues were fixed with 4% PFA.
  • the tissues of the striatum and the nucleus accumbens were obtained from the brain tissue, and a mouse anti-ZBTB16 antibody (D-9; sc-28319, Santa Cruz Biotechnology, Santa Cruz, CA) was attached to the tissues of the striatum and the nucleus accumbens, respectively ( 4°C, overnight). Then, the tissue was treated with a biotinylated anti-mouse secondary antibody, followed by staining for color development. At this time, the cell nucleus was stained with DAPI.
  • Figure 2 is a control (WT) and dementia animal model (APPPS1) from the brain tissue (Brain) from the dorsal striatum (dorsal striatum) and the nucleus accumbens (nucleus accumbens, NAc) from the ZBTB16 protein expression was measured by immunohistochemistry. is the result
  • the expression of ZBTB16 protein was significantly increased in the dorsal striatum of the dementia animal model.
  • the expression level of ZBTB16 protein in the dementia animal model was significantly increased, so the ZBTB16 protein provides information for the diagnosis of degenerative brain diseases including dementia know you can do it.
  • the novel object recognition test is a modification of the existing method and consists of an adaptor, a searcher, and a new material recognizer. After acclimatization by placing the mice in an open field for 10 minutes for two days, two identical objects were installed at regular intervals. The time spent in each object was measured by Ethovision while the experimental animals were allowed to freely explore for 3 minutes, and then returned to the cage for 30 minutes. Then, one of the installed objects was replaced with a new material and the movement of the experimental animal was measured for 3 minutes. The object's recognition index (%) was converted into a percentage of the time spent in each object among the total search time.
  • FIG 3 is a graph showing the Y-maze test (YMT) results for the control group (WT+GFP), the dementia animal model (APPPS1+GFP), and the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16).
  • the present invention aims to examine whether dementia can be diagnosed early from a dementia risk group without cognitive function symptoms, and the effect of improving, preventing or treating the prognostic symptoms (mental symptoms) that occur in the early stages of dementia, so the animal of the present invention
  • 6-month-old mice which are 6 months younger than 12 months old, were used. Therefore, it can be seen that although dementia was clearly induced, there was no significant difference between the control group, the dementia animal model, and the ZBTB16 knockdown dementia animal model as a result of the YMT experiment. This result is consistent with what the inventors expected.
  • N denotes a novel material
  • F denotes an existing thing (familiar).
  • the present invention aims to examine whether dementia can be diagnosed early from a dementia risk group without cognitive function symptoms, and the effect of improving, preventing or treating the prognostic symptoms (mental symptoms) that occur in the early stages of dementia, so the animal of the present invention
  • 6-month-old mice which are 6 months younger than 12 months old, were used. Therefore, it can be seen that although early dementia was induced by the accumulation of beta-amyloid, there was no significant difference between the control group, the dementia animal model, and the ZBTB16 knockdown dementia animal model as a result of the YMT experiment, which is consistent with what the present inventor expected. is the result
  • a measuring mouse (6 months old, male) was placed in an EthoVision XT 11.5 (manufactured by Noldus, Netherlands) in the middle of three consecutive rooms separated by a transparent wall, and a live mouse (S1) was placed in one of the two rooms. ), an inanimate object (O) was placed in the opposite room, or a familiar mouse (S1) and a new mouse (S2) were placed. Among the two rooms, the longer you stayed, the more red. The test was performed for 10 minutes, and a normal animal model (WT+GFP) was used as a control.
  • WT+GFP normal animal model
  • FIG. 5 is a view showing the 3-chamber test (3CT) results of the animal model of dementia (APPPS1 + GFP), the animal model of ZBTB16 knockdown dementia (APPPS1 + shZbtb16) and the control (WT + GFP) prepared according to the present invention
  • FIG. 5a is an inanimate object (0) and a living mouse (S1) of the animal model of dementia (APPPS1+GFP), ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) and control (WT+GFP) prepared according to the present invention.
  • Figure 2b is a familiar mouse (S1) and a new animal model (APPPS1 + GFP), ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16) and control (WT + GFP) prepared according to the present invention. It is a diagram showing the degree of interest in the mouse (S2).
  • the elevated cross maze experiment is conducted based on the premise that mice are innately dislike of bright and open spaces, and that they voluntarily explore new environments.
  • the elevated cross maze apparatus consists of two open arms (30x5 cm) and two closed arms (5x30 cm, walls 15 cm high) extending from a common central platform (5x5 cm). became The structure was formed in the shape of a plus-sign with corresponding branches arranged to face each other. The device is raised 50 cm above floor level.
  • mice belonging to the three groups were placed in the elevated cross maze device and observed for 7 minutes each. Each experimental animal was individually placed in the center of the open range, and the time spent on each open branch was measured. Behavioral observation images were taken using a video camera connected to the software (Smart Junior, Panlab SL, Barcelona, Spain). Thereafter, the time the mice stayed was measured in units of every second through video file analysis using video tracking software, and the results are shown in FIG. 6 .
  • the contrast shift test is conducted based on the premise that mice naturally dislike bright light and voluntarily explore new environments.
  • the experimental animals belonging to the three groups are placed in a dark room in a mouse cage in which a light box and a dark box are connected by a connecting passage, and while observing for 10 minutes, the delay time until the first exit to the light room , the time spent in a dark room, and the frequency of moving between each dark room and light room were measured. Its frequency is an index measuring the anti-anxiety function.
  • FIG. 6 is a diagram showing the results of the elevated cross maze experiment (EMP) of the dementia animal model (APPPS1 + GFP), the ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16) and the control group (WT + GFP) prepared according to the present invention.
  • EMP elevated cross maze experiment
  • the dementia animal model (APPPS1+GFP) significantly reduced the dwell time in the open branch.
  • the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) increased the dwell time in the open branch to a level similar to that of the control group (WT+GFP). That is, it was confirmed that when early dementia occurred due to the accumulation of beta-amyloid, the time spent in a bright and open space was significantly shortened. In other words, it can be seen that anxiety symptoms increase among mental and behavioral disorders despite the early dementia state in which memory and cognitive function are not significantly reduced by the accumulation of beta-amyloid. At this time, it can be seen that when ZBTB16 protein expression is suppressed, anxiety symptoms, which are mental and behavioral disorders of early dementia, are remarkably improved to a level similar to the normal level.
  • LLB light-dark shift test
  • the dementia animal model significantly decreased the time to stay in the light room compared to the control group (WT+GFP).
  • the ZBTB16 knockdown dementia animal model APPPS1+shZbtb16 stayed in the light room for a long time at a level similar to that of the control group (WT+GFP), and the frequency of movement between the dark room and the light room was significantly increased.
  • anxiety symptoms increase among mental and behavioral disorders despite the early dementia state in which memory and cognitive function are not significantly reduced by the accumulation of beta-amyloid.
  • ZBTB16 protein expression is suppressed, anxiety symptoms, which are mental and behavioral disorders of early dementia, are remarkably improved to a degree similar to the normal level.
  • Immunohistostaining was performed using p62 and LC3 as markers to determine the degree of p62 protein activity and autophagy activity according to the inhibition of the ZBTB16 protein according to the present invention.
  • the section was treated with a primary antibody (anti-LC3; Novus Biologicals; NB100-2220, anti-p62; Abcam; ab91526), and a secondary antibody (Goat anti-Rabbit IgG; Alexa Fluor 488, Goat anti-Mouse IgG; Alexa Fluor 594).
  • a primary antibody anti-LC3; Novus Biologicals; NB100-2220, anti-p62; Abcam; ab91526
  • a secondary antibody Goat anti-Rabbit IgG; Alexa Fluor 488, Goat anti-Mouse IgG; Alexa Fluor 594.
  • FIG. 8 is a result of measuring the expression levels of LC3 and p62 from dorsal striatum in brain tissue isolated from an animal model of dementia (APPPS1 + GFP) prepared according to the present invention by immunohistochemistry
  • FIG. 9 is the present invention.
  • LC3, p62 expression levels from the dorsal striatum in brain tissue isolated from the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to the immunohistochemical staining method were measured.
  • LC3 In order to confirm the autophagy phenomenon involved in the onset of dementia, LC3, an autophagy marker protein, and p62, an autophagy matrix protein, were identified.
  • FIG. 11 is a result of measuring the expression levels of ZBTB16 and p62 from the dorsal striatum in brain tissue isolated from a 12-month-old control group (WT+GFP (12mo)) by immunohistochemistry
  • FIG. 12 is a 12-month-old dementia animal model.
  • ZBTB16, p62 expression levels from the dorsal striatum in brain tissue isolated from (APP/PS1+GFP(12mo)) were measured by immunohistochemistry
  • FIG. 13 is a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1). + shZbtb16), ZBTB16, p62 expression levels from the dorsal striatum in the brain tissue isolated from the immunohistochemical staining method.
  • a measurement animal model (12 months old, male) was placed in the EthoVision XT 11.5 (manufactured by Noldus, Netherlands) in the middle of three consecutive rooms separated by a transparent wall, and live mice ( S1), an inanimate object (O) was placed in the opposite room, or a familiar mouse (S1) and a new mouse (S2) were placed. Among the two rooms, the longer you stayed, the more red.
  • the test was performed for 10 minutes, and the 12-month-old control group (WT+GFP) prepared in Experimental Example 8-1 was used as a control.
  • 14 is a 12-month-old dementia animal model (APPPS1 + GFP) prepared according to the present invention, a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1 + shZbtb16) and a 12-month-old control group (WT + GFP) 3-chamber test (3CT) results 14A is an inanimate object of a 12-month-old dementia animal model (APPPS1+GFP), a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) and a 12-month-old control group (WT+GFP) prepared according to the present invention.
  • APPPS1 + GFP 12-month-old dementia animal model
  • APPPS1 + shZbtb16 12-month-old ZBTB16 knockdown dementia animal model
  • WT + GFP 12-month-old control group
  • Figure 14b is a 12-month-old dementia animal model (APPPS1 + GFP) prepared according to the present invention, a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) and a 12-month-old control group (WT+GFP) show the degree of interest (3CT: novelty) in familiar mice (S1) and new mice (S2).
  • APPPS1 + GFP 12-month-old dementia animal model
  • APPPS1+shZbtb16 a 12-month-old ZBTB16 knockdown dementia animal model
  • WT+GFP 12-month-old control group
  • ZBTB16 exhibits dementia prevention, treatment, and recovery effects not only in the dementia risk group without cognitive symptoms (6-month-old mice) but also in the dementia group with cognitive symptoms (12-month-old mice).
  • the Y-maze experiment was conducted as a method to evaluate the short-term memory type and sequential behavioral ability. Experimental animals were placed at the tip of the branch of the Y-maze (42 ⁇ 3 ⁇ 12 cm) branched into three branches at a 120° angle and allowed to move freely for 8 minutes, and the movement was monitored using a computerized Ethovision system (Noldus IT b.v., Netherlands). was observed with After each branch was designated as A, B, and C, all four feet must completely enter one branch to be counted as the number of entry and exit. The case of entering three different branches one after another was defined as spontaneous alternation behavior. Alternation score (%) was calculated by the following formula.
  • a 12-month-old normal animal model (control group (WT+GFP)) prepared by the method of Experimental Example 8-1, a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) ) was used, and the results were compared.
  • the new substance discovery test is a modification of the existing method and consists of an adaptor, a searcher, and a new substance recognizer. After acclimatization by placing the mice in an open field for 10 minutes for two days, two identical objects were installed at regular intervals. The time spent in each object was measured by Ethovision while the experimental animals were allowed to freely explore for 3 minutes, and then returned to the cage for 30 minutes. Then, one of the installed objects was replaced with a new material and the movement of the experimental animal was measured for 3 minutes. The object preference was converted into a percentage of the time spent in each object among the total search time.
  • a 12-month-old normal animal model (control group (WT+GFP)) prepared by the method of Experimental Example 8-1, a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) ) was used, and the results were compared.
  • FIG. 15 is a Y-maze of a 12-month-old normal animal model (control group (WT+GFP)) and a 12-month-old dementia animal model (APPPS1+GFP) and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to the present invention.
  • WT+GFP control group
  • APPPS1+GFP 12-month-old dementia animal model
  • APPPS1+shZbtb16 12-month-old ZBTB16 knockdown dementia animal model
  • the new substance discovery test can evaluate cognitive ability and memory.
  • WT+GFP normal animal model
  • APPPS1+GFP dementia animal model
  • the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) was similar to the control group (WT+GFP), and it was confirmed that the retention time in the new substance significantly increased compared to the retention time in the familiar substance.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Pathology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)

Abstract

Dans la présente invention, il a été découvert que la maladie cérébrale dégénérative peut être diagnostiquée par la protéine 16 contenant le doigt de zinc et le domaine BTB (ZBTB16) et que l'inhibition de l'expression de ZBTB16 conduit à l'amélioration, la prévention ou le traitement des symptômes mentaux et comportementaux de la maladie cérébrale dégénérative. Ainsi, le matériel peut être utilisé en tant que biomarqueur pour une maladie cérébrale dégénérative ainsi que pour la prévention ou le traitement d'une maladie dégénérative du cerveau.
PCT/KR2021/010056 2021-01-26 2021-08-02 Utilisation du zbtb16 dans une maladie dégénérative du cerveau WO2022163959A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210010583 2021-01-26
KR10-2021-0010583 2021-01-26
KR1020210061297A KR102583540B1 (ko) 2021-01-26 2021-05-12 퇴행성 뇌질환에서 zbtb16의 용도
KR10-2021-0061297 2021-05-12

Publications (1)

Publication Number Publication Date
WO2022163959A1 true WO2022163959A1 (fr) 2022-08-04

Family

ID=82653624

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/010056 WO2022163959A1 (fr) 2021-01-26 2021-08-02 Utilisation du zbtb16 dans une maladie dégénérative du cerveau

Country Status (1)

Country Link
WO (1) WO2022163959A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7202025B1 (en) * 1999-06-30 2007-04-10 Gene Expression Technologies Limited Control of gene expression
KR20120082906A (ko) * 2009-09-30 2012-07-24 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 자가포식현상-향상 유전자 생성물의 조절을 통한 자가포식현상의 조절 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7202025B1 (en) * 1999-06-30 2007-04-10 Gene Expression Technologies Limited Control of gene expression
KR20120082906A (ko) * 2009-09-30 2012-07-24 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 자가포식현상-향상 유전자 생성물의 조절을 통한 자가포식현상의 조절 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KUNIKAZU TANJI;YASUO MIKI;TAKU OZAKI;ATSUSHI MARUYAMA;HIDEMI YOSHIDA;JUNSEI MIMURA;TOMOH MATSUMIYA;FUMIAKI MORI;TADAATSU IMAIZUMI;: "Phosphorylation of serine 349 of p62 in Alzheimer?s disease brain", ACTA NEUROPATHOLOGICA COMMUNICATIONS, BIOMED CENTRAL LTD, LONDON, UK, vol. 2, no. 1, 3 May 2014 (2014-05-03), London, UK , pages 50, XP021187127, ISSN: 2051-5960, DOI: 10.1186/2051-5960-2-50 *
LIN DAR-SHONG, HO CHE-SHENG, HUANG YU-WEN, WU TSU-YEN, LEE TSUNG-HAN, HUANG ZO-DARR, WANG TUAN-JEN, YANG SHUN-JIE, CHIANG MING-FU: "Impairment of Proteasome and Autophagy Underlying the Pathogenesis of Leukodystrophy", CELLS, vol. 9, no. 5, pages 1124, XP055953844, DOI: 10.3390/cells9051124 *
ZOU CUIHUA, JIE WANG, XIAOHUA HUANG, CHONGDONG JIAN, DONGHUA ZOU, XUEBIN LI: "Analysis of transcription factor-and ncRNA-mediated potential pathogenic gene modules in alzheimer’s disease", AGING, vol. 11, no. 16, 16 August 2019 (2019-08-16), pages 6109 - 6119, XP055953852, DOI: 10.18632/aging.102169 *

Similar Documents

Publication Publication Date Title
WO2013122408A1 (fr) Utilisation pharmaceutique de fam19a5 impliqués dans la régulation de la gliogenèse
WO2019182371A1 (fr) Composition pour le diagnostic de maladies neurologiques dégénératives
WO2020251263A1 (fr) Biomarqueur pour le diagnostic de maladies du système nerveux cérébral
Trochet et al. Allele‐specific silencing therapy for Dynamin 2‐related dominant centronuclear myopathy
Johnson et al. Silencing of the Fibroblast growth factor 21 gene is an underlying cause of acinar cell injury in mice lacking MIST1
WO2018139759A1 (fr) Procédé de diagnostic de la maladie d'alzheimer à l'aide de micro-arn
WO2021107644A1 (fr) UTILISATION D'UNE COMPOSITION POUR AMÉLIORER L'EFFET ANTICANCÉREUX, COMPRENANT UN INHIBITEUR DE ERRγ COMME PRINCIPE ACTIF
Li et al. Alteration of Scn3a expression is mediated via CpG methylation and MBD2 in mouse hippocampus during postnatal development and seizure condition
AU2020203955B2 (en) Composition and method for inhibiting amyloid beta accumulation and/or aggregation
WO2022163959A1 (fr) Utilisation du zbtb16 dans une maladie dégénérative du cerveau
WO2021177691A1 (fr) Composition pour le diagnostic ou le traitement de la résistance aux médicaments anticancéreux
WO2018004240A1 (fr) Utilisation de nupr1 dans le diagnostic et le traitement de la tumeur au cerveau
WO2017018735A1 (fr) Biomarqueur de détermination du vieillissement, de détermination de l'obésité, et de diagnostic du cancer et trousse de diagnostic l'utilisant
WO2022203314A2 (fr) Composition pour le diagnostic différentiel d'une tumeur maligne des gaines nerveuses périphériques
WO2016209013A1 (fr) Tm4sf19 utilisé comme marqueur de diagnostic de l'obésité et son procédé d'utilisation
WO2018174506A1 (fr) Procédé de prédiction de la susceptibilité au traitement par sorafénib à l'aide d'un gène sulf2, et composition pour le traitement du cancer comprenant un inhibiteur de sulf2
WO2017030395A1 (fr) Composition pharmaceutique pour le traitement ou la prévention de l'obésité
WO2018212503A1 (fr) Protéine cotl1 impliquée dans le maintien de l'homéostasie d'une cellule souche hématopoïétique, et utilisation associée
WO2022019604A1 (fr) Biomarqueur spécifique du cancer du foie et utilisation associée
WO2018074770A1 (fr) Utilisation du rnf20 pour le diagnostic et le traitement du cancer du rein ou du foie et criblage pour identifier des agents thérapeutiques contre le cancer du rein ou du foie
WO2013100273A1 (fr) Marqueur diagnostique d'exposition à un rayonnement igfbp-5, composition permettant de diagnostiquer l'exposition à un rayonnement par mesure du niveau d'expression du marqueur, kit de diagnostic d'exposition à un rayonnement comprenant la composition, et méthode permettant de diagnostiquer l'exposition à un rayonnement faisant appel audit marqueur
WO2023244016A1 (fr) Composition pour la prévention ou le traitement de l'arthrose et son utilisation
WO2019235876A1 (fr) Composition pharmaceutique comprenant un inhibiteur de l'expression ou de l'activité de c-src permettant de prévenir ou de traiter une synucléinopathie
WO2023167544A1 (fr) Biomarqueur comprenant la fam167a pour le diagnostic de la résistance contre l'inhibiteur de la tyrosine kinase indépendante de bcr-abl, et composition ciblant la fam167a pour prévenir ou traiter la leucémie myéloïde chronique
WO2020130467A2 (fr) Composition pharmaceutique pour la prévention ou le traitement d'une maladie médiée par les lymphocytes t de mémoire cd8+

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21923369

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21923369

Country of ref document: EP

Kind code of ref document: A1